AU656185B2 - Recombinant avipox virus, the culture of cells infected with this virus and vaccines for poultry derived from this virus - Google Patents

Description

COMPLETE SPECIFICATION

(ORIGINAL)

Class Int. Class Application Number: Lodged: Complete Specification Lodged: Accepted: Published: 656185 Priority Related Art: 00 oi 0 0 r q Name of Applicant: Solvay (Societe Anonyme) Actual Inventor(s): Georges Thiry Didier Colau Catherine De Wannemaeker Daniel Malarme Address for Service:

C

1*4..

01)00 c: 0 PHILLIPS ORMONDE FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street Melbourne 3000 AUSTRALIA Invention Title: RECOMBINANT AVIPOX VIRUS, THE CULTURE OF CELLS INFECTED WITH THIS VIRUS AND VACCINES FOR POULTRY DERIVED FROM THIS VIRUS Our Ref 287598 POF Code: 1659/1659 The following statement is a full description of this invention, including the best method of performing it known to applicant(s): 1 6006 L~ i. -il y jyY 1A- Vt V. Se *e Vs. S Va

C

The invention relates to recombinant viruses derived from the Avipox virus and in particular from the virus responsible for fowl variola which is commonly called Fowlpox. The invention also relates to a method of production of these viruses by cell culture, to the use of these viruses for the production of vaccines and to vaccines containing these viruses. The invention also relates to the transfer sequences for the insertion of this recombinant virus into the genome, as well as to the plasmids carrying these sequences.

The virus responsible for fowl variola, or Fowlpox virus (FPV), belong to the Avipox genus of the Poxviridae family.

The Fowlpox virus has the characteristics typical of Pox viruses. These are large-sized viruses whose genome is a linear double-stranded DNA of about 300 kb 20 and whose single-stranded ends are covalently linked.

About 20 kb of the genome have been sequenced, especially the Terminal Inverted Repeat sequence (TIR) (Campbell et al., 1989; Tomley et al., 1988). The terminal inverted repeats are two identical long sequences which are present at each end of the genome, in the inverse orientation.

The vaccinia virus or Vaccinia was the first Pox developed as live recombinant virus capable of expressing foreign proteins. The list of proteins expressed is very long. In particular, the expression of many foreign antigens hes made it possible to obtain immunisations against various diseases.

The use of the Fowlpox virus as a vector for the expression of heterologous proteins for the purpose of preparing a vaccine, that is to say the use of a recombinant virus hjLving integrated a DNA sequence encoding a heterologous protein inside a noncoding intergenic region of its genome, has been proposed in European Patent 44 Amami F 2 Application 0,314,569; this region is a short sequence of 32 nucleotides situated between the Open Reading Frames (ORF) ORF 7 and ORF 9 and has been genetically arranged into a nonessential insertion site. In such short intergenic regions, there is a high risk of the insertion separating a transcription signal from its gene and introducing, as a result, a mutation which inactivates this gene. This can be shown to be the case: indeed this 32-nucleotide sequence appears to be an essential region since it has had to be extended to 55 nucleotides in order to avoid possible overlapping between the promoter of ORF 9 and the 3' coding sequence of ORF 7. In the case of the region which separates ORF 7 from ORF 9, the insertion into the natural sequence is, moreover, unstable (Spehner et al., 1990), and it is essential to arrange it. Furthermore, the proposed manner of arranging a short intergen.- region cannot be generalised.

Moreover, he construction of recombinant Fowlpox S.virus and other recombinant fowl pox viruses charac- S' 20 terised by the insertion of foreign DNA into the S°.o thymidine kinase gene, has also been proposed in Inter- S° national Patent Application W088/02022. This insertion reates a mutation in the gene which could attenuate the infectiousness of the virus. This presents a risk of an S 25 excessive attenuation of the strain and a reduced immunogenicity of the vaccine which is derived from the recombinant virus.

Moreover, the use of a recombinant Fowlpox virus as vector for the expression of heterologous proteins has 30 also been proposed in European Patent Application h" 0,353,851. The insertion of a foreign gene into the viral genome is carried out inside the open reading frames (ORF) situated inside the terminal inverted repeats (TIR). The insertion of one or more foreign genes into open reading frames presents the risk of causing the mutation of a gene whose function is not known.

The present invention provides other regions for the insertion of one or more foreign genes into the viral P 1 1 1

I,

-3genome, which no longer has the disadvantages of the aforementioned insertion regions.

In this regard, the present invention relates to a recombinant Avipox virus derived from an attenuated strain of Avipox virus and containing, in a nonessential part of its genome, at least one DNA sequence encoding all or part of a protein which is heterologous with respect to the Avipox virus as well as the elements capable of ensuring the expression of this protein inside a cell infected by the said recombinant virus, wherein the nonessential part of the genome is composed of a noncoding intergenic region situated between two open reading frames (ORF) including their expression signals, said intergenic region having a sequence of more than 60 nucleotides and being situated inside one of the two TIR regions of the virus.

.o A nonessential part of the Avipox virus genome is understood to mean a region which may be modified without affecting the functions involved in the development of the virus in vitro and in vivo. A noncoding intergenic 20 region of the genome, that is to say situated between two ORFs, including their expression signals, is chosen as the nonessential part.

The intergenic regions according to the invention are large, such that the risk of an insertion separating 25 the signals for the transcription of their respective genes is minimal and also such that it is unnecessary to S"arrange them. Moreover, the sequences of these intergenic regions are noncoding and there is therefore no risk of mutation inside an OR'. A large region is understood to mean a region having a sequence of more than nucleotides. Generally, a region having a sequence of k more than 100 nucleotides is chosen. Preferably, a region having a sequence of more than 200 nucleotides is chosen.

In a particularly preferred manner, a region having a sequence of more than 400 nucleotides is chosen.

Moreover, an intergenic region, in which at least one DNA sequence is cloned, siuated inside one of the ,V two TIR regions of the Avipox virus, is generally chosen.

Normally, at least one DNA sequence is cloned into at 7I 4 least one of the two TIR regions of the Avipox virus.

Preferably, at least one DNA sequence is cloned into the two TIR regions of the virus. Still more preferably, the intergenic region, termed pi region, and/or the intergenic region, termed p2 region, is chosen; the intergenic region, termed pl region, being situated between the nucleotides 1675 and 2165 and the intergenic region, termed p2 region, being situated between the nucleotides 2672 and 3605, taking as starting nucleotide the BamHl restriction site present inside the TIRs. This BamHl restriction site which is chosen here for positioning the intergenic regions, is the first nucleotide of the sequence published by Tomley et al., 1988. These regions according to the invention may also be defined as follows: the intergenic region, termed 1l region, is situated between the open reading frames ORF 1 and ORF 2, the open reading frame O)F 1 being situated between the nucleotides 416 the nucleotide A of ATG and 1674 the 3rd nucleotide of the stop codon and the 20 open reading frame ORF 2 being situated between the nucleotides 2166 the nucleotide A of ATG and 2671 the 3rd nucleotide of the stop codon taking as starting nucleotide the BamHl restriction site inside the TIRs, and the intergenic region, termed p2 region, is 25 situated between the open reading frames ORF 2 and ORF 3, the open reading frame ORF 2 being situated between the nucleotides 2166 the nucleotide A of ATG and 2671 the 3rd nucleotide of the stop codon and the open reading frame ORF 3 being situated between the nucleotides 3606 the 3rd nucleotide of the stop codon and 4055 the nucleotide A of ATG taking as starting o""o nucleotide the BamHl restriction site inside the TIRs. In a particularly preferred manner, there is chosen, inside the pl region, a part situated between the nucleotides 1775 and 2065 and, inside the p2 region, a part situated between the nucleotides 2772 and 3505. Good results have been obtained by cloning at the level of the nucleotide 1842, termed B1 insertion site, situated inside the il i

U

p I t- 4.

.4 4 *5*4 4r .400 .4 5 region, and/or at the level of the nucleotide 3062, termed B2 insertion site, inside the p2 region.

Good results were obtained when at least one DNA sequence is cloned into the /2 region, inside one of the two TIR regions of the Avipox virus. Good results were also obtained when a DNA sequence is cloned into the 3l region, inside each of the two TIRs. This represents another advantage of the invention since it is possible to obtain two copies of the heterologous DNA sequence per genome.

Recombinant Avipox virus derived from an attenuated Avipox virus strain is understood to mean a virus belonging to the Avipox genus, which is attenuated and whose genome contains a heterologous sequence accompanied by expression signals. Generally, a virus of the Avipox genus such as Fowlpox, Pigeonpox or Canarypox, is used as virus. Normally, Fowlpox is used as virus.

Preferably, a vaccinal strain of the chicken variola virus or Fowlpox, such as the vaccine produced and 20 markeed by the company SOLVAY under the trademark POXINE or the vaccine produced and marketed by the company SOLVAY under the trademarks CHICK-N-POX, POULVAC CHICK- N-POX, CHICK-N-POX TC, POULVAC CHICK-N-POX TC, POULVAC POXINE and POULVAC P, is used as Fowlpox virus. In a 25 particularly preferred manner, the vaccine marketed by SOLVAY under the trademarks CHICK-N-POX, POULVAC CHICK- N-POX, CHICK-N-POX TC, POULVAC CHICK-N-POX TC, POULVAC POXINE and POULVAC P, abbreviated CNP, is used as Fowlpox virus.

The attenuation is obtained by successive passages on embryo, or by passages on cell cultures if the virus has been adapted to cultured cells.

Elements capable of ensuring the expression of the gene which encodes the heterologous protein in a cell infected by the said recombinant virus are understood to mean the signals of genetic expression, which are recognised by the virus, especially the promoter and the terminator, elements which are known to a person skilled 131B I

I

Ji 1.1 ir.l i -l I 4 6 Lll~ yl *J I

I'

I

in the art as described especially by Moss, 1990 for example. Generally, a Po. promoter is used. Normally, a Vaccinia or Fowlpox promoter is used. Preferably, the promoter P11 and the promoter P7.5 from Vaccinia, as described by Venkatesan et al., 1981, Cochran et al., 1985 and Bertholet et al., 1985, are used.

At least one DNA sequence encoding all or part of a protein which is heterologous with respect to the Avipox virus is understood to mean any DNA fragment extracted from a genome, or a cDNA copy or alternatively a synthetic DNA, accompanied by the expression signals, and whose sequence encodes all or part of a protein which is foreign with respect to Avipox.

Figures 1 to 11 were prepared in order to allow a better understanding of the invention.

Figure 1 represents the construction of a recombinant Avipox, adapted from Mackett et al., 1984. Cells infected infection) with the Fowlpox virus (FPV) are transfected "transfection") with a transfer plasmid.

This plasmid carries a promoter (Pr) which is orientated so as to permit expression of an adjacent heterologous gene which is flanked on either side by viral DNA sequences. The homologous recombination takes place inside the cytoplasm of the cell between the 25 sequences flanking the gene and the sequences present in the viral genome. This results in the insertion of the heterologous gene into the viral genome. This genomr. may be packaged and may produce recombinant viral particles N represents the nucleus of the cell 30 Figure 2 schematically represents the ends of the Fowlpox genome with the right TIR and the left TIR (TIR-L) symbolised by rectangles and with the unique sequence symbolised by a line. The dashes symbolise the central region of the genome. The EcoRl restriction fragment of the TIR-L is 6.2 kb while that of TIR-R is kb. This schematic representation shows that these two fragments have a common sequence and a unique sequence. A BamHi site situated downstream of EcoRl inside I i It: M4 7 *4 .4

,IC

the TIRs is indicated.

Figure 3 represents a restriction map of the plasmid pTIRB1 (PTIRB1) for some unique sites and the position of the ORFs. The unique BamHl site is used for cloning the heterologous genes.

ori (ORI): origin of replication of the plasmid inside Escherichia coli coli); Ap: gene for resistance to ampicillin; ORF 1 to ORF 6: Fowlpox open reading frames.

Figure 4 represents a figure which is similar to Figure 3, but for the plasmid pTIRB2 (PTIRB2).

Figure 5 represents a restriction map of the plasmid pllLac (P11LAC). This plasmid carries the E. coli LacZ gene under the control of the Vaccinia promoter P11.

P11: Vaccinia promoter P11; LACZ: p-galactosidaseencoding gene; ori: origin of repl-cation in E. coli; strand strand packaged inside the phage M13; Ap: gene for resistance to ampicillin.

Figure 6 represents an example of a vector for transferring the LacZ gene into the TIRs. This vector is pTIRB1P75Lac (PTIRB1P75LAC). The cassette P7.5-LaizZ is cloned into the BamHl site of pTIRB1 in a clockwise direction. P7.5: Vaccinia promoter Figure 7 is a schematic representation of the inserts of the LacZ gene (represented by a shaded rec- 2, tangle) inside the CNP genome. The cassettes and P11-LacZ are inserted into the terminal regions (TIR), in either orientation. The right TIR region is not represented. The arrows indicate the direction of transcription of the genes which are represented by rectangles. The scale is not accurate.

Figure 8 represents the segment A from IBDV, the position of the primers and the various fragments obtained by reverse transcription and by amplification of the RNA of the segment A from the Edgar strain.

A organisation of the ORFs.

p "primers" used for carrying out the amplification of the segment A.

8 orientation of the "primers" relative to the coding sequence of the segment A.

fgt PCR fragments generated by amplification of the RNA of the segment A.

pb base pairs.

Figure 9 (Figure 9a to Figure 9e) represents the nucleotide sequence of the amplified DNA corresponding to the RNA of the segment A from the Edgar strain and the translation of the ORFs 1, 2 and 3 into amino acids.

Primers 0, 1, ib, 2, 3, 4, 5 and 6: primers used for generating, by reverse transcription and by amplification, the DNA fragments corresponding to the segment A from the Edgar strain.

Figure 10 represents the schematic representation for the reconstruction of the DNA segment corresponding to the segment A from the Edgar strain using fragments obtained by reverse transcription and by amplification.

site-directed mutagenesis.

Figure 11 represents a restriction map of the S" 20 plasmid pTIR75E1LAC (PTIR75E1LAC).

The portion of the plasmid represented by a thick line corresponds to the sequences which are homologous with respect to the FPV genome. ori (ORI): origin of replication of the plasmid inside E. coli; Ap: gene for 25 resistance to ampicillin; P7.5: Vaccinia promoter ORF1-IBDV: ORF 1 of the segment A from the Edgar strain; *i P11: Vaccinia promoter P11; LACZ: p-galactosidaseencoding gene; pb: base pairs; ORE I to ORF 6: open reading frames of Fowlpox.

S 30 Figure 12 represents the characterisation, by the ELISA test, of the IBDV proteins expressed in the FPV/IBDV recombinants. The characterisation was carried out as follows: 50 pl of cellular suspensions and twoold serial dilutions of these suspensions were deposited per well. After incubation of the second anti-IBDV antibody (monoclonal anti-VP3 or anti-VP2), the signal was amplified by means of the mouse anti-IgG system labelled with biotin streptavidin conjugated to I f 7 I: -9alkaline phosphatase.

Figure 12 A corresponds to the detection by means of the anti-VP3 monoclonal antibody. Figure 12 B corresponds to the detection by means of the anti-VP2 monoclonal antibody.

In these figures, the x-axis represents the 2-fold serial dilutions of the cellular extracts in logarithmic units and the y-axis represents the ratio of the absorbances measured at 690 nm and 405 nm.

Figure 13 represents the characterisation by Western blot analysis of the IBDV proteins expressed in the FPV/IBDV recombinants. This characterisation was carried out as follows: the cellular suspensions are centrifuged at 3,000 g and the supernatants obtained are ultracentrifuged at 185,000 g; the pellets resulting from the two centrifugations are pooled and resuspended in PBS buffer (Phosphate Buffered Saline, Gibco).

A deposit of 20 to 40 jg of proteins for the a V "FPV/IBDV recombinants and 5 g for the IBDV-infected 20 cells (positive control) is deposited per well, on *P SDS-acrylamide gel. After transferring onto a membrane, the IBDV proteins are detected by means of a polyclonal Sserum which recognises all the IBDV proteins, for Figure 13 A, or by means of an anti-VP3 monoclonal antibody, for Figure 13 B. Amplification of the signal is carried out tot( by means of the anti-IgG system labelled with biotin and t t the conjugate streptavidin-alkaline phosphatase. PM: molecular weight marker proteins.

ri. The method used for implementing the invention is 30 schematically represented in Figure 1 (modified according S. to Mackett et al., 1984). Cells infected with Avipox or Fowlpox are transfected with a transfer plasmid. This plasmid carries a promoter which is properly orientated so as to permit the expression of an adjacent heterologous gene flanked on either side by viral DNA sequences.

The homologous recombination takes place inside the cytoplasm of the cell between the sequences flanking the gene and the sequences present in the viral genome. The i -c 0 10 insertion of a heterologous gene into the viral genome results therefrom. This genome may be packaged and may produce recombinant viral particles. This technique of insertion through the infection of cells with Pox followed by a transfer through a plasmid was developed for Vaccinia and is commonly used in many laboratories for the construction of recombinant Pox viruses (Mackett et al., 1985).

The method according to the invention normally comprises the following stages: the first stage consists in constructing the transfer plasmids which permit screening, the second stage consists in cloning the genes encoding the heterologous antigens into the transfer plasmids, the third stage consists in constructing the recombinant Avipox viruses, and the fourth stage consists in carrying out vaccina- 0 tion tests using the recombinant viruses.

20 Preferably, the method comprises the following Ss. stages: Construction of the transfer plasmids which permit screening: Cloning of TIR-carrying fragments.

25 Insertion of cloning site into the TIRs.

Cloning of the Vaccinia promoters P11 and S- Construction of a cassette carrying the LacZ gene and its cloning downstream of P11 or Cloning of the elements P11LacZ or P7.5LacZ into TIR-transfer plasmids.

Sb. Construction of recombinant CNP viruses (LacZ gene for carrying out a preliminary test): Transfection of the QT35 cells with the CNP virus and a transfer plasmid.

Screening and then purification of the recombinants by virtue of the expression of the LacZ gene.

Our Ref 287598 5999q 11 Analysis of the genomes of the recombinants and of the expression of LacZ.

c. Vaccination test: Vaccination of chicks with recombinant viruses and protection given by the LacZ recombinant virus against fowl variola.

d. Cloning of genes encoding heterologous artigens (heterologous protein) into the transfer plasmids: Cloning of the genes encoding heterologous antigens downstream of P11 or Cloning of the cassettes P11-antigen and or P7.5-antigen and P11-LacZ into the plasmids TIR.

e. Construction of recombinant CNP viruses: Transfection of QT35 cells with the CNP virus and a transfer plasmid.

Screening and subsequent purification of the '*recombinant viruses by virtue of the expression of the LacZ gene.

Analysis of the expression of the antigen in cell cultures and analysis of the genome of the recombinant viruses.

f. Vaccination: Vaccination with the recombinant CNP viruses.

Evaluation of the level of protection given to CNP by virtue of the expression of the heterologous antigen.

The invention also relates to transfer sequences which enable the heterologous DNA to be inserted into the genome of the Avipox virus as defined above and especially at the sites B1 or B2. The invention also relates to the plasmids which carry these sequences.

Transfer plasmid is understood to mean a plasmid which contains a heterologous gene under the influence of a promoter which is recognised by Avipox, flanked on either side by the sequences situated on either side of the site i B1 or of the site B2. The length of these sequences which are homologous with respect to FPV and which flank the ir A 1 heterologous protein is chosen from the antigens of the infectious bursal disease virus (IBDV), the infectious bronchitis virus (IBV), the virus responsible for chicken anaemia (CAV) and the protozoa Eimeria.

/2 I: 1 t m i- ~ll~~i, *,j f" l l 1 l" 12 0S *6

S

*t S C t heterologous gene, should be sufficiently long so as to permit recombination on the left and on the right of the heterologous gene. Generally, sequences of at least 1 kb are chosen. Good results are obtained for B1 flanked by a sequence of about 1850 nucleotides upstream and 4321 nucleotides downstream, and for B2, alout 3070 nucleotides upstream and 3100 nucleotides downstream. The transfer plasmids play a role in the method for isolating recombinant Avipox viruses, a transfection of the quail cells QT35, previously infected with the Avipox virus, being called into play in the method.

The invention also relates to a culture of eucaryotic cells which are infected with a recombinant Avipox virus derived from an attenuated Avipox virus strain and comprising, in a nonessential part of its genome, at least one DNA sequence encoding all or part of a protein which is heterologous with respect to the Avipox virus, as well as the elements capable of ensuring expression of this protein in a cell infected with the said recombinant virus, the nonessential part being composed of a noncoding intergenic region of the Avipox virus situated between two ORFs, including their expression signals.

Preferably, a culture of fowl cells is used. Good 25 results have been obtained with a culture of quail cells.

Excellent results have been obtained with the culture of the quail cells QT35, as described by Cho (1981).

The recombinant Avipox virus according to the invention is developed as vectors which are capable of expressing all or part of the heterologous protein. The present invention therefore also relates to the use of the virus according to the invention, as a vector which is capable of expressing all or part of a heterologous protein such as an antigen in particular.

The invention also relates to a vaccine containing a recombinant Avipox virus derived from an attenuated Avipox virus strain and containing, in a nonessential part of its genome, at least one DNA sequence encoding

B

d i .i ii: S U Q1 II

H

r- 277 il a, 1! 13 0 0 *c p t o cc 6000 cc t I rtr0

-C,

all or part of a protein which is heterologous with respect to the Avipox virus, as well as the elements capable of ensuring the expression of this protein in a cell infected with the said recombinant virus, the nonessential part of the genome being composed of a noncoding intergenic region of the Avipox virus situated between two ORFs, including their expression signals.

Heterologous protein is understood to mean any protein or part of a protein which is foreign with respect to the Avipox virus, or a natural or modified protein. Generally, this protein may be an antigen enabling a vaccine to be developed against a pathogenic organism. Normally, the antigens are in particular proteins of agents which are infectious to fowls, viruses, bacteria, chlamydia, mycoplasmas, protozoa, fungi and worms.

They are in particular the Adenoviridae, such as the virus responsible for aplastic anaemia (AA) and for the egg drop syndrome (EDS), the Birnaviridae, such as 20 the infectious bursal disease virus (IBDV), the Coronaviridae, such as the infectious bronchitis virus (IBV), the Herpesviridae, such as the Marek's disease virus (MDV) and the virus responsible for infectious laryngotrachitis (ILTV), the Orthomyxoviridae, such as the virus 25 responsible for influenza, the Paramyxoviridae, such as the Newcastle disease (NDV), the Picornaviridae, such as the virus responsible for encephalomyelitis the Reoviridae, responsible for tenosynovitis, the Retrovirus such as 'he virus responsible for lymphoid leukosis (LL), the virus responsible for chicken anaemia (CAV).

They are in particular chlamydia, such as Chlamydia psittaci.

They are in particular mycoplasmas such as Mvcoplasma gallisepticum and M. synoviae.

They are in particular bacteria such as Escherichia coli, Haemophilus including H. paragallinarum which is responsible for coryza, Pasteurella including P. multocida which is responsible for cholera, Salmonella 1 6006

'I;

71 i; i il(i-l- i lil~Y-L--- I LIL- ~L L_-LC .ii_~l~i i n~YI _ili i ii li. i

I

r P

V

a a.

40 4 4~ *440* 0t *0 0 9 *999 tt 'a I 14 including S. gallinarium responsible for typhus and S. pullorum, Clostridium including C. botulinum which produces a toxin responsible for botulism, C. perfrinqens and C. septicum responsible for dermatoses, C. colinum, Campilobacter jejuni, Streptococcus aureus.

They are in particular protozoa such as Eimeria which is responsible for coccidiosis and Cryptosporidiosis baileyi which is responsible for cryptosporodiosis.

They are in particular worms such as cestodes and nematodes including Ascaridia galli.

They are in particular fungi such as Aspergillus fumigatus.

The preferred antigens are those of the infectious bursal disease virus (IBDV), the infectious bronchitis virus (IBV), the virus responsible for chicken anaemia (CAV), the protozoa Eimeria which is responsible for coccidiosis, the Newcastle disease virus (NDV) and the Marek's disease virus (MDV).

20 The antigens which are particularly preferred are those of the infectious bursal disease virus (IBDV), the infectious bronchitis virus (IBV), the virus responsible for chicken anaemia (CAV) and the protozoa Eimeria which is responsible for coccidiosis. Good results have been 25 obtained under the following conditions: for IBDV: all or part of the open reading frames comprising polyprotein and parts of polyprotein.

Such proteins are in particular VP2, VP3 and VP4.

All combinations or modifications thereof are also 30 included. These modifications consist, for example, of the insertion of a cleavage site.

for IBV: the antigen E2.

for Eimeria: the natural surface antigen TA4 and the surface antigen TA4 whose proteolytic cleavage site has been modified.

for CAV: the protein Excellent results have been obtained with IBDV, the heterologous protein being part of the polyprotein c; I i i -L i.ipreparing a vaccine, that is to say the use of a recombi- !j nant virus having integrated a DNA sequence encoding a heterologous protein inside a noncoding intergenic region i|; of its genome, has been proposed in European Patent 15 comprising the amino acids 1 to 493 followed by the amino acids 1010 to 1012, in which the protein VP2 is included; as represented in Figure 9.

The DNA sequences may encode the complete protein or, alternatively, fragments of the protein, and may induce the appropriate immune response in the animal.

Other molecules, besides antigens, may also be taken into consideration including growth factors and immunomodulatory agents such as interleukins. The present invention is also intended to produce in vivo, in poultry, a factor which plays a role in the metabolism of the animal, such as for example a growth hormone or a growth hormoneinducing factor. The present invention also relates to the preparation of proteins or peptides in cell cultures in vitro or in vivo in the animal Depending on the heterologous protein introduced, it may be suitable, in particular, as enzyme, as nutritive constituent or, in the field of human or animal health, as pharmaceutical product for human or veterinary use.

20 Moreover, multiple recombinant viruses, carrying several heterologous genes, may be generated by cloning several genes into the same genome, into the same site, or into different regions or sites. A polyvalent product may also be created by combining different recombinant 25 viruses.

Animal targets for the Avipox virus according to the invention are birds, in particular poultry. The recombinant virus may also be used in species other than fowls.

The vaccine according to the invention may be administered in various forms which are known to a person l "skilled in the art. Normally, the vaccine is administered

I

by the oral route in feed or in drinking water, by the intranasal route, by subcutaneous injection, by aerosol, by intramuscular injection or by transpiercing the wing i; according to the so-called wing web method. Preferably, i the vaccine is administered by piercing the wing membrane i according to the so-called wing web method, by j4 1 open reading frames presents the risk of causing the mutation of a gene whose function is not known.

The present invention provides other regions for the insertion of one or more foreign genes into the viral

,I!

1

I

j i

P

c- -I 16 St..

*t C r C.r

S

*4*C intramuscular injection or by subcutaneous injection.

The vaccine according to the invention is formulated in a manner known to a person skilled in the art.

Normally, the vaccinal composition contains stabilisers which are appropriate for the mode of administration of the vaccine. It may be preserved in freeze-dried form.

The present invention is illustrated by the following examples.

Example 1 Purification of the CNP virus and its DNA As Fowlpox virus, the vaccinal strain marketed by the company Solvay under the trademark POULVAC CHICK-N- POX, CHICK-N-POX, CHICK-N-POX TC, POULVAC CHICK-N-POX TC, (CNP), is used as attenuated live vaccine. The initial stock is obtained from a field strain passed several times on eggs and adapted to the cells in vitro by 2 passages on CEF (chicken embryo fibroblasts) and passages on the quail cell line QT35 described by Cho (1981). The quail cell line QT35 can be obtained from Dr. Moscovici (6816 Northwest 18th Avenue, Gainesville, Florida 32605, United States) who isolated it and who distributes it.

CNP is cultured on the cell line QT35 whose culture media consists of E199 (Gibco, 500 ml), F12 (Gibco, 500 ml), LAH (Gibco, lactalbumin hydrolysate, 25 25 ml), FCS (Gibco, foetal calf serum, 25 ml) and fructose (5 ml of a solution at 200 incubation at 38 0

C,

3% of CO 2 The normal multiplicity of infection (moi) is 0.01 virus per cell, the cells being 80% confluent.

A stock of virus was purified as follows: the cells, infected with the CNP Fowlpox virus and taken up in PBS phosphate buffer (Phosphate Buffered Saline, Gibco), are centrifuged at 6,000 g (15 min). The pellet is resuspended in Tris (pH 9, 1 mM), tx.ypsinised (trypsin at 0.25 mg/ml final concentration; Gibco) and sonicated.

This material is deposited on a 36% (weight/volume) sucrose layer and centrifuged for 45 minutes at 30,000 g.

The pellet is taken up in 1 mM Tris, pH 9.0. Finally, the viruses are centrifuged for 30 minutes at 40,000 g. The i ii i "i Ii i j- 1 _i S. Zi .1-L I 17 *r I t pellet is taken up in lysis buffer: 10 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1% SDS (Sodium Dodecyl Sulphate), 500 pg/ml proteinase K (Boehringer), 0.1 mg/ml RNase (Boehringer) and incubated for 2 hours at 37 0 C. The phenol-extracted DNA is precipitated with ethanol. In the order of 20 pg of DNA were purified from 40 150-cm 2 flasks infected.

Example 2 Construction of an EcoRl genomic library and a BamH1 genomic library of CNP The genetic techniques used are described by Maniatis et al., 1982. The restriction enzymes, the polymerases, ligases and phosphatases were provided by the companies Pharmacia, Boehringer and Biolabs. The synthetic DNAs were provided by the company Eurogentec.

The EcoR1 or BamH1 restriction fragments of the viral DNA were ligated inside the vector pUC18 described by Messing (1983) and introduced into the bacteria E. coli MC1061 (araD139, (ara, leu)7 697 lacX74, qalU, galK, hsdR, strA, sold by the company Pharmacia). The two genomic libraries are stored at -70°C in glycerol in the form of two suspensions of transformed cells. Twenty four of the plasmids contain an insert. Seventeen BamHl fragments and 45 EcoR1 fragments were differentiated on the basis of their size and their mode of restriction by Bgl2 or HinF1. The inserts are 0.5 to 15 kb in size; the sum of the BamH1 inserts thus characterised is 82 kb and 210 kb for the EcoR1 fragments. The size of the Fowlpox genome is close to 300 kb (Coupar et al., 1990). The fragments isolated therefore represent 25% for BamH1 and 70% for EcoR1 relative to the total genome.

Example 3 Cloning of the TIR-carrying fragments The terminal inverted repeats (TIR) are two identical sequences present at the ends of the Pox genome in opposite orientations. A sequence of more than 17 kb ct one end of the genome of the strain HP of Fowlpox has been published (Campbell et al., 1989 and Tomley et al., 1988). It comprises about 10 kb of the repetitive sequence and 7.0 kb of its adjacent sequence.

I

E i"i'a

B

jl' i p

I,

1775 ana zuon ana, insiua Liim pG y between the nucleotides 2772 and 3505. Good results have been obtained by cloning at the level of the nucleotide 1842, termed B1 insertion site, situated inside the p1 Ii: 1;.

P

i: j i, S-U- V i -NFA ON .i j I 18 *r 4 *4 4 04 Se r C r C r

'C

Cloning of the TIR EcoRl fragments is carried out. The repetitive sequence contains an EcoRl site. As shown in Figure 2, two EcoRl fragments are cloned: each carries part of the TIR and a unique adjacent sequence.

The unique sequence is delimited by the EcoRl site which is nearest to the TIRs. These two fragments were isolated by means of an oligonucleotide which is complementary to the sequence situated in the repetitive part. The first fragment is 6.2 kb in size and, by convention, will be denoted TIR-L. The second is 9.0 kb in size and, by convention, will be denoted TIR-R. The sequence of the TIR-L EcoRl fragment of CNP is identical to the one published.

The junction between the TIR and the unique sequence deduced from comparison of the TIR-L and TIR-R sequences, is situated at nucleotide 4007, the BamHl site of the sequence published by Tomley et al. (1988) being taken as nucleotide number 1. The junction is situated in the open reading frame denoted ORF 3 by these authors.

Example 4 Creation by site-directed mutagenesis of BamHl sites inside the TIR Open reading frames (ORF) are deduced from the analysis of the nucleotide sequences of the TIRs. In particular, ORF 1 is situated between the nucleotides 416 and 1674, ORF 2 is situated between the nucleotides 2166 and 2671 and, finally, ORF 3 is situated between the nucleotides 3606 and 4055 and coded on the complementary strand. The first nucleotide G of the BamHl site of the TIRs is taken as nucleotide No. 1. These ORFs delimit two large noncoding intergenic sequences, denoted region pl, between ORF 1 and ORF 2 on the one hand, and region p2 between ORF 2 and ORF 3 on the other hand. These are two intergenic regions which are chosen as insertion regions.

A unique cloning site was introduced by sitedirected mutagenesis (BioRad mutagenesis kit) in pl and in p2. The BamHl site was chosen as cloning site because it is compatible with other restriction sites of which Bell and Bql2. The location of the cloning site was infected by the said recombinant virus are understood to mean the signals of genetic expression, which are recognised by the virus, especially the promoter and the terminator, elements which are known to a person skilled si

B

l t: o:l i;

E

i i ::bi~*lI ';i c i,: ry -i ~it ll~r~-~lriYliii pu1 !e a 04 9 *0 9 09 a( 4 I C 9444

S

1 *r 4440 444 4 4r~ 44 19 chosen approximately in the middle of each intergenic region so as to avoid any risk of separating the transcription signals from their respective genes, that is to say: in the region l: the site B1 is the sequence at the nucleotide 1842, which is converted to BamHl GGATCC by insertion of a G in 5' and a C in 3'; in the region p2: the site B2 is the sequence 5'GGATT at the nucleotide 3062, which is converted to BamHl by mutation of the second T to CC.

There are two BamHl sites inside the plasmid carrying the TIR-L fragment (Example One site is derived from the vector pUC18. The second site is derived from the TIR and is situated at 71 nucleotides downstream of the EcoRl site chosen for the cloning (Campbell et al., 1989; Figure These two BamH1 sites were deleted from the plasmid carrying the TIR-L, by BamHl restriction followed by filling using Klenow polymerase and ligation.

20 The plasmid resulting therefrom is pTIR1.

To generate a BamHl site in Bl, the 0.9 kb HindII fragment of pTIRI was cloned into the vector pBSPlus marketed by the company Stratagene. The mutagenesis primer was: 5'TTTCGAAAGACTTTGGATCCGTAGTATAATATTATA 3'.

The nucleotides in bold, that is to say GGATCC, are the sequence which is recognised by BamHl.

To generate a BamHl site in B2, the 1.7 kb Xbal fragment of pTIR1 was cloned into pBSPlus. The primer was: 30 5'TATATCACGGGATCCAAAAGGTTATTAGTAGTC The nucleotides in bold, that is to say GGATCC, are the sequence which is recognised by BamH1.

The reinsertion of each mutant fragment into pTIR1 is the result of the ligations: for Bl: Hind3-Scal of the pTIRl (1491 bp) Scal- Aat2 of the pBSPlus after mutagenesis (485 bp) Aat2-EcoRl of the pTIR1 (4220 bp) EcoRl-Hind3 of the pTIRl (2635 bp); -4i

'I

j~ fragment of the TIR-L is 6.2 kb while that of TIR-R is kb. This schematic representation shows that these two fragments have a common sequence and a unique sequence. A BamHl site situated downstream of EcoRl inside 20 20 for B2: Xhol-Spll of the pTIR1 (8512 bp) Srll-Xhol of the pBSPlus after mutagenesis (318 bp).

These two ligations generated the vectors pTIRB1 and pTIRB2. Their restriction maps are in Figures 3 and 4.

The plasmid pTIRB1D was generated from the plasmid pTIR1 by deletion of its 2657-bp EcoRi-Hpal fragment.

Example 5 Cloning of the Vaccinia promoters P11 and P11 and P7.5 are known Vaccinia promoters. P11 is the promoter of the gene encoding the protein P11 which is transcribed during the late phase of the viral infection. P7.5 is the promoter of the gene encoding the protein P7.5 which is transcribed both during the immediate and late phases.

Construction of vectors with unique Bgl2 and Bcll sites Two cloning vectors containing the unique Bl2, Bcll and BamH sites were constructed so as to allow the successive clonings of cassettes which are compatible Bwith BamH1. The sequences of the Bl2 and Bcll sites were introduced into the BamH1 site of pBSPlus by cloning of the following synthetic DNA: Bg12 Bcll BamH1 5' GATCGAGATCTTGATCAG 3' 3' CTCTAGAACTAGTCCTAG 44 The vectors are pBSLKI and pBSLK2. The linkers are in the orientation: pBSLK1 Aval/Sma1-BamH1-Bcll-Bqg2-Xbal p pBSLK2 Aval/Smal-Bql2-Bcll-BamHl-Xbal Cloning of the promoter The Bcll-BamHl fragment, 143 bp in length, of the plasmid pGS20 contains the P7.5 promoter oequence (Mackett et al, 1984). The sequence is presented below (Venkatesan et al., 1981; Cochran et al., 1985). The late and immediate promoters are underlined. The last BamH1 base is at 10 bp from the initiator ATG of the gene.

p :organisation ot the ORFs.

1primers" used for carrying out the amplification of the segment A.

I

t -j

I-

If 21

'TGATCACTAATTCOAAACCCACCGGCTTTTTATAGTAAGTTTTTCACCCATAAATMTAAATA

Bc11 Late CAATAATTAATTTCTCGTAAAAGTAGAAAATATATTCTAATTTATTGCACGGTAAGGAKGTAGAa Immediate

TCATAAAGAACAGTGACGGATCC

BamH 1 The Bcl1-BamH1 fragment was cloned into the Bcll and BamHl sites of the plasmids pBSLK1 and pBSLK2, generating the plasmids p1P75 and p2P75 respectively. To allow the Bcll digestion, pBSLK1 and pBSLK2 are extracted from the strain JM110 which can be obtained from ATCC (Amercian Type Culture Collection) under the reference ATnC 47013.

Cloning of the promoter P11 The sequence of the promoter P11 was cloned in the form of a synthetic DNA using the sequence data from Bertholet et al., 1985. Hanggi et al., (1986) have shown that a 30-nucleotide fragment upstream of the first nucleotide of the inRNA contains the promoter.

The synthetic DNA is a 40-mer fragment carrying a Bcil2 site and a BamHl s ite at its ends. This DN4A was 20 cloned into pBSLK1 in order to generate pIPil, and into pBSLK2 in order to generate p2Pll. The Bgl2-BamHl fragment of p2Pll was subsequently cloned into the Xho2- BamHl sites of pACYC184. pACYC184 is a vector described by Chang and Cohen (1978). The ligation between 2Xho2 25 (GGATCT) and B~ql2 (AGATCT) restores M12 The sequence of the P11-carrying synthetic DNA is: 5' GATCAMATTTCATTTTGT'TTTTTTCTArGCTATAAATAAG 3' TTTAAAGTAAAACAAAAAAAGATACGATATTTATTCCTAG 44 9 90 9 04 94 99 9. 0 9 9 0 .9 999~9~

S

9* t St tO ~5tt t .9 C Ott

II

99 9 *9S U 91*1 'Cit It, I Ct I I Pql2 BamH 1 cassette which is comatible with the Bamfi restriction site The expression of the LacZ gene will allow screening of the recombinant viruses.

I

I.

j per well. After incubation of the second anti-IBDV antibody (monoclonal anti-VP3 or anti-VP2), the signal was amplified by means of the mouse anti-IgG system labelled with biotin streptavidin conjugated to 22 A Bql2-BamHl cassette carrying the LacZ gene was constructed by site-directed mutagenesis. This cassette was cloned into the plasmid pBSPlus (stratagene) deleted from the fragment LacZa and this in order to avoid recombination between the two homologous sequences, one with LacZ, the other with LacZa. This plasmid is pBSMutLacZl. The sequence of the ends of the LacZ gene after mutagenesis is given below. The numbers correspond to the numbers of the amino acids of the natural protein.

En Bgl2 Ncol 8 9 AGATCTCACC ATG GCC GTC GTT Met Ala Val Val 3-gal En 3', CAA AAA TAA TAA TAA CCGGGCAGG GGGGATCC Gin Lys 4 10 Example 7 Cloning of the LacZ gene behind the promoters P7.5 or P11 The LacZ, Bgl2-BamHl, cassette of pBSMutLacZl was cloned into the Bl2-BamHl sites of p2P75 and p2Pll in order to generate p75Lac and pllLac respectively. Expres- 15 sion of the LacZ gene is obtained in E. coli when it is placed behind the promoters P7.5 or P11. The transformant colonies have a blue colour on a media containing X-Gal (chromogenic substrate: 5-bromo-4-chloro-3-indolyl-p-Dgalactopyranoside) which produces a blue coloration under the action of p-galactosidase. This test proves that the gene is functional. The PlILac cassette in the form of a Bql2-Hind3 fragment of the plasmid pilLac was also cloned into the Xho2 and Hind3 sites of pACYC184, thus generating pACP11Lac. The map of pllLac is in Figure 5.

I'

ii.

L J3 gous gene ijanXeU on ejL.ueHL a. Lujy v.jLLj. ,,L1 5v" The homologous recombination takes place inside the cytoplasm of the cell between the sequences flanking the gene and the sequences present in the viral genome. The a :t ii :i i

I

I i:: fii 1 I

U

4 1 1 i. .iiti_~i 23 Example 8 Cloning of the cassettes P75Lac and PllLac

L

into the plasmids pTIRB1 and pTIRB2 The Bql2-BamH1 fragment of pllLac (or pACP11Lac) and the Bgl2-BamHl fragment of p75Lac carry the cassette 'Promoter P7.5 or P11 followed by the LacZ gene' (Example These fragments were cloned into the BamHl sites of pTIRB1 and pTIRB2 (Example in the two possible orientations, using the LacZ phenotype for the screening.

Six plasmids were isolated among eight possible recombinants. Their numbering is given below. Let us assume that the orientation is that which places the transcription of the LacZ gene in the ORF1 to ORF2 or ORF2 to ORF3 direction, and the orientation that which corresponds to the reverse orientation. In the plasmid names, 'P75Lac' and 'PllLac' mean that these cassettes are in the orientation while 'LacP75' and 'LacPll' mean that these cassettes are in the orientation. By way of example, the map of the plasmid is in Figure 6.

No. Prom Site Ori Name No. Prom Site Ori Name 3 P7.5 B1 pTIRB1P75Lac 8 P11 B1 pTIRBlP1lLac 4 P7.5 B2 pTIRB2P75Lac 9 P11 Bl pTIRBllacP1 97.5 B2 pTIRB2LacP75 10 P11 B2 pTIRB2LacP1 9* p4 pi 4s

S

p.

e(

I

No.

Prom Site B1 or B2 Ori number given to the plasmid.

promoter.

BamHl cloning site introduced into TIR.

orientation. The orientation is when the direction of transcription of LacZ is in the ORF1 to ORF2 or ORF2 to ORF3 direction. The orientation is the reverse.

name of the tranfer plasmid.

E e i! !I j: Name

J

I *B 1 nants by virtue of the expression of the LacZ gene.

S. II I I

I

24 Example 9 Optimisation of the transfer and screening conditions and isolation of the CNP-LacZ recombinant viruses The principle for the construction of a recombinant CNP virus is presented in Figure 1. The transfer procedure is as follows: On day D=1, 2.5 x 106 QT35 cells are inoculated, per 25-cm 2 flask, into 5 ml of growth media (composition described in Example 1).

On day D=2, the following transfer is carried out: Virus: a 1-ml vial of freeze-dried CNP vaccine is rehydrated with 3 ml of sterile Milli Q water and stored at 0 C. This virus stock is thawed and subjected to gentle sonication for 1 minute. It is then diluted in the culture media labelled E119-F12 and which corresponds to the media E119 described in Example 1, without LAH or serum or fructose, to achieve a multiplicity of infection of 0.05 virus per cell in 2 ml of media. The culture 20 media is then replaced with the viral suspension and the Sculture is incubated for 2 h at 38 0

C.

Plasmids: 20 pg of plasmid are mixed with 400 pl of water C'"i and 100 pl of 1.25 M CaCl 2 500 tl of 2x BBS buffer (BES buffer saline) (50 mM of BES (Sigma), 280 mM NaCl, 1.5 mM Na 2

HPO

4 pH 7.0) are added dropwise and the mixture is incubated for 15 to 30 minutes at 25 0 C. One ml of the plasmid preparation is then added to the cells after removing the media. The mixture is then incubated for minutes at 38 0 C. 4 ml of LAH-free media supplemented with 5% FCS and 15 mM Hepes (Sigma) pH 7.2, are then added.

The mixture is again incubated for 4 hours at 38 0 C. The media is then replaced with 5 ml of the growth media labelled E199 (composition described in Example 1).

On day D=0, the viral cells are harvested as described in Example 1.

The screening is based on the production of p-galactosidase which is detected by a "plaque assay" test on a Petri dish. The procedure on a 6-cm Petri dish

I-

side by the sequences situated on either side of the site B1 or of the site B2. The length of these sequences which are homologous with respect to FPV and which flank the 'i 25 25 is as follows: On day D=l: 2.5 x 106 cells are inoculated into ml of growth media.

On day D=2: this culture is infected with 1 ml of virus diluted 1:10 and 1:100, the mixture is incubated for 4 h at 38 0 C and 4 ml of growth media (composition described in Example 1) are then added.

On day D=3: the media is replaced with 5 ml of an agarose layer consisting of 1 volume of 2% agarose [see plaque agarose (FMC) dissolved in water] and 1 volume of the following mixture: 9 ml of 2 x 199 media (Gibco), ml of LAH (Gibco) and 0.1 ml of Hepes (pH 7.2, 15 mM final) and 1.0 ml of FCS. The melted agarose and the mixture are maintained at 38 0 C before being mixed. The agarose is allowed to gel for 30 minutes at room temperature and the mixture is then incubated at 38 0

C.

On day D=6: the culture is layered with 2 ml of 1% agarose in PBS (Gibco) containing 0.3 mg/ml of X-Gal (5-bromo-4-chloro-3-indolyl-p-D-galactopyranoside, 20 Boehringer). The X-Gal is dissolved at 30 mg/ml in DMSO (dimethyl sulphoxide, Fluka).

00# On day D=7: the number and proportion of blue plaques relative to the number of colourless plaques are counted. Five plaques are then individually removed by means of a Pasteur pipette. The viral cells are stored in 500 pl of growth media at The recombination frequencies for each plasmid are presented in the table below. The notation of the recombinant viruses is followed by the number of the transfer plasmid (as defined in Example The percentage of recombinants ranges from 0.1% to which corresponds to the literature data for Pox viruses. A representation of the recombinant genomes is schematically presented in Figure 7. 1 i j Avipox virus strain and containing, In a nonessenrtia.± part of its genome, at least one DNA sequence encoding I' Now 211 0 26 9* It~ C C

CCC

virus Blue/total Virus Blue/total V3 7/1400 0.5 Vs 1/1000 0.1 V4 10/2000 0.5 V9 60/25000 0.25 15/5000 0.3 1V10 50/30000 0.17 Blue/total number of blue plaques/total number of plaques percentage of blue plaques.

Example 10 Purification of the CNP/LacZ recombinant viruses A clone is obtained by successive purification of a blue plaque on a Petri dish (as described in Example In principle, when all the plaques are blue, a12, the viruses express the LacZ gene and are no longer contaminated with the wild virus. Three to four passages are 15 required in order to achieve this homogeneity. By way of example, the variation of the proportion of blue plaques 6uring the passages was: Number of passages 1st 2nd 3rd 4th Virus Blue/total Blue/total Blue/total Blue/total V3 20/200 10 40/50 80 22/22 100 V4 1/20 20 20/30 70 95/100 95 100/100 100 50/500 10 2/5 40 30/30 100 V8 50/200 25 4/5 80 8/8 100 V9 1/5 20 1/1 100 1/100 1 3/20 15 12/12 100 Blue/total =number of blue plaques/total number of plaques percentage of blue,,plaques.

Escherichia coli, Haemophilus including H. paragallinarum which is responsible for coryza, Pasteurella including P. multocida which is responsible for cholera, Salmonella F.i 27 Structures which are typical of the Pox viruses, in particular the inner structure which has the form of a dog bone, are clearly visible on an electronic microscope photograph of a section of QT35 cells infected with the recombinant virus V8.

Example 11 Production of a large quantity of each recombinant Six recombinants were amplified by three successive passages in flasks. The titre of the second passage ranges from 4 x 105 to 1.1 x 10' TCID50 (tissue culture infectious dose) per ml. Only V10 has a titre of less than 104 The other recombinants, for which the titres are normally between 105 and 107, indeed multiply as well as the wild strain.

Example 12 "Plaque assay" analysis of the stability of the LacZ gene inserted into TIR The LacZ gene inserted into the viral genome may be stable or unstable depending on the type of recombination which occurred (this is stated explicitly by S 20 Shuman et al., 1989). Thus, if there are two recombina- Sitions on either side of the insert, the LacZ gene inserted is stable. On the other hand, a simple recombination results in the insertion of the complete transfer plasmid and therefore of LacZ. This virus gives S blue plaques. However, the viral genome carries homologous sequences in a direct orientation, whose recombination may result in the loss of the insert and the appearance of non-blue plaques.

Moreover, a change in the sequence of a TIR, in Pox viruses, may be transferred to the other TIR during Ui- the viral infection and replication cycles. A double recombination may insert LacZ into TIR-L; the plaque of this virus appears blue. During the following infections, a recombination between this recombinant TIR-L and a wild TIR-R generates a mixed population of TIR-L/LacZ, TIR-L/LacZ-TIR-R/LacZ and WT (wild) virus. Other recombinations may, on the other hand, generate the last possible type which is TIR-R/LacZ. Consequently, a blue 28 plaque may contain three types of virus: viruses wich have lost the LacZ gene, viruses which carry a single copy of the LacZ gene and viruses which carry two copies of the LacZ gene.

The homogeneity of a viral preparation is tested using a "plaque assay" after a few successive infections in liquid media (Example The "plaque assays" of the 3rd passages of the viruses V3, V4, V5, V8, V9 and produce the following proportions of blue: 9o *c C. C e *0 C Virus P3 Blue/total P6 Blue/total V3 60/70 V4 80/90 88 70/80 88 V5 95/100 V8 50/50 100 40/40 100 V9 70/70 100 V10 3/10 20 P3 and P6 3rd and 6th passage of the virus.

Blue/total Number of blue plaques/total number of plaques.

Percentage of blue plaques.

Not carried out.

In conclusion, the preparations of the recombinant viruses V8 and V9 are homogeneous. The recombinant V8 is stable up to the 6th passage. On the other hand, the preparations V3, V4 and V5 are not homogeneous. They contain a proportion of 5 to 20% of wild-type virus. This proportion is even higher for Example 13 Analysis of the CNP/LacZ genomes by Southern blotting The homogeneity of a viral preparation is tested by Southern blotting (Maniatis et al., 1982). The restriction fragments of the genomes of the rocombinant viruses and of the non-recombinant viruses are 11 t by intramuscular injection o by transpiercing the wing according to the so-callbd wing web method. Preferably, the vaccine is administered by piercing the wing membrane according to the so-called wing web method, by 'i -I t c.

29 4 4 r° ee I 4 4 4o 4

I

I

*r i 4 4411 *r *i t *O t differentiated on the basis of their size.

The procedure for the preparation of the viral DNA is as follows: On day D=l: a 25-cm 2 flask containing 5 ml of growth media is inoculated with 2 x 106 QT35 cells.

On day D=2: the cells are infected at a multiplicity of infection of 0.01.

On day D=5: the cells are detached using a scraper (Costar). The mixture is centrifuged for 10 minutes at 6,000 g. 500 pl of lysis buffer consisting of 10 mM Tris-HCl, pH 8.0, 10 mM EDTA, 0.1% SDS, 0.1 mg/ml RNase, 0.1 mg/ml proteinase K are added to the centrifugation pellet. The cells are transferred into an Eppendorf tube. The suspension obtained is then stirred and incubated for 1 hour at 50°C. The aqueous phase is then extracted 3 times with phenol chloroform. The DNA is precipitated with 0.3 M sodium acetate and 2 volumes of ethanol at -20 0 C for 15 minutes. The mixture is centrifuged for 10 minutes at 18,300 g. The centrifugation 20 pellet is suspended in 500 pl of water. In the order of yl of this total DNA suspension are sufficient for a Southern blotting.

For the B1 site The genomes are digested with EcoRl. The probe is 25 the plasmid pTIRB1LacP75 digested with EcoRl. This probe differentiates the recombinant and parental TIR-L and TIR-R fragments. The sizes of the fragments are 9.3 and 6.2 kb for the wild virus, 7.4, 5.1 (doublet) and 4.4 for V3, 7.4, 4.9 and 4.4 kb for V8 and finally for Vp, 10.4, 30 7.3 and 2.0 kb (doublet). The viruses V8 and V9 acquired two copies of the LacZ gene, one in each TIR, and do not contain any parental-type TIR fragment. This is, on the other hand, the case for the virus V3.

Since a copy of LacZ can be cloned into each TIR, it can be concluded that the insertion site Bl is nonessential for the development of the virus and for its growth on cultured cells. Moreover, given that the LacZ gene is about 3 kb in size, the isolation of these double ;a i 1~ i

SI

sucrose layer and centrifuged for 45 minutes at 30,000 g. K The pellet is taken up in 1 mM Tris, pH 9.0. Finally, the viruses are centrifuged for 30 minutes at 40,000 g. The recombinants proves that 6 kb can be inserted per genome of the CNP virus.

For the B2 site The Southern blots show the presence of recombinant TIR-L and TIR-R fragments, but also of the parental fragments in the preparation of V4, V5 and VI0. These three preparations are therefore not homogeneous.

Example 14 Alternative for isolating a double recombinant in the BI insertion site The development of recombinations in the TIRs foretells the appearance of stable double recombinants in the progeny of a virus carrying a wild TIR and a recombinant TIR. Viral plaques are reisolated from a blue plaque using a Petri dish "plaque assay", either by a new "plaque assay" or on 96-well microtitre plates. The genome of each new plaque may be analysed either by Southern blotting or by PCR. These different possibilities were exploited.

The Southern blotting carried out on the virus genomes of 10 different blue plaques obtained from a "plaque assay" for the 3rd passage of V3, showed that, of the 10 plaques, one preparation is homogeneous and contains a LacZ insert in each of the TIRs.

For the microtitre plate, the dilution is such that there is zero or one viral plaque per well. This 4 optimal dilution is assessed by prior titration. Good results are obtained by infecting a microtitre plate (200 Al per well, 20 ml per plate) with 50 ul of the viral suspension obtained from a Petri dish "plaque 30 assay" taken up in 1 ml. When the plaques are clearly visible, the wells containing a plaque are noted. After freezing and thawing, 100 Al of media are taken per well.

For the PCR, the total DNA is rapidly extracted under the following conditions: the mixture is centrifuged for 10 minutes at 10,000 g, the pellet is taken up in 200 l of lysis buffer (10 mM Tris-HCl, pH 8.0, 10 mM EDTA, 0.1% SDS), ,jupplemented with RNase (0.1 mg/ml) and proteinase K 1 rg/ml) and the mixture thus obtained is ct one end of the genome of the strain HP of Fowlpox has been published (Campbell et al., 1989 and Tomley et al., 1988). It comprises about 10 kb of the repetitive sequence and 7.0 kb of its adjacent sequence. Ii Rai% 31 incubated for 1 hour at 50 0 C. The aqueous phase is then extracted three times with phenol/chloroform. The DNA is precipitated from this aqueous phase with ethanol. The pellet obtained is taken up in 50 pl of water. 10 pl of this suspension are used per PCR. The PCR conditions used are those recommended by Perkin Elmer (GeneAmp DNA Amplification Reagent Kit). The amplified fragments are analysed on agarose gel.

The primers 5168 and 5169 hybridise on either side of the Bl insertion site, downstream and upstream of the site respectively. Their sequence is as follows.

Number 5' to 3' sequence Complementary to 5169 5' CCTTTACTGTTAGTTCTACAATCGAAATTATGC 3' FPV 5168 5' CATGTAGATTTTAATCCGTTAACACGCGCAG 3' FPV 3254 5' GCCGGAAAACCTACCGGATTGATGG 3' LacZ A 220-bp fragment is amplified on the wild TIRs and a fragment of more than 3 kb for the recombinant TIR Scontaining the LacZ gene. For the detection of the LacZ gene, a second amplification uses the primer 5168 situated downstream of the B1 site and the primer 3254 situated inside the LacZ gene. A 674-bp fragment is amplified. This judicious choice of primers therefore 1 enables the recombinant TIRs and the non-recombinant TIRs to be differentiated. A viral suspension is considered to be homogeneous, double recombinant, if the WT (wild) fragment is not amplified. The controls are the genome of the WT virus, the plasmids pTIRB1 and pTIRBlLac.

SPrimers Wild fragment Recombinant fragment 5169 5168 220 bp 3 kb 3254 5168 674 bp no amplified fragment.

otiigteLc ee o h eeto fteLc it is compatible with other restriction sites of which Bell and Blg12. The location of the cloning site was 0 M M i-v 32 Example 15 Expression of the LacZ gene in tissue culture by the CNP/LacZ recombinant viruses The p-galactosidase (p-gal) activity is measured using o-nitrophenyl-p-D-galatopyranoside (ONPG) as substrate. The enzyme converts ONPG to galactose and o-nitrophenol which is yellow in colour and the quantity of which is measured by absorption at 420 nm. This absorption is converted to p-gal units using a calibration curve according to the rule "1 pgal unit 1 /mol of ONP produced/3 x 106 cells/60 minutes of incubation of the extracts at 28°C".

This "p-gal" test is carried out as follows, for a flask with a surface area of 25 cm 2 Immediate and late phases of infection can be differentiated in Pox viruses.

The shortest is the immediate phase; it lasts for about 6 hours. It ends at the time of the replication of the genome. The late phase starts at the replication and ends at the end of the infectious cycle with the release of S'viral particles, that is to say three days later. For i: 20 sufficient expression of LacZ during the immediate phase, the immediate phase is artificially prolonged using cytosine p-D-arabinofuranoside (CraC) which is an inhibitor of replication.

a. Cells S 25 On day D=1, 3 x 106 QT35 cells are inoculated, per flask, into 5 ml of growth media.

On day D=2: the cells are infected at a multiplicity of infection of 3 viruses per cell. The mixture &ti is incubated for 1 hour at 38 0 C. The viral inoculum is then removed by means of a pipette. 5 ml of maintenance media, supplemented or not with AraC (Sigma) at 40 Ag/ml, j are added per flask. The cultures are incubated for 16 hours at 38C.

b. Harvest on day D=3 The cells are scraped from the flask.

The culture is centrifuged for 10 minutes at 6,000 g. The centrifugation pellet is resuspended in 500 il of PBS, this suspension is mixed and it is Ie' z Aat2 of the pBSPlus after mutagenesis (485 bp) Aat2-EcoRl of the pTIR1 (4220 bp) EcoRl-Hind3 of the pTIR1 (2635 bp); *1i 1~ 33 transferred into a 1.4-ml Eppendorf tube.

The cells are then lysed by the addition of 50 pl of CHC13 and 5 pl of 10% SDS. The cell suspension is briefly mixed. This suspension is then centrifuged for 5 minutes at 9,000 g.

c. Enzymatic reaction The ONPG substrate for 25 samples is prepared as follows: 27.7 mg of ONPG (Sigma) and 50 ml of diluent consisting of 1 ml of 0.1 M MgSO 4 and 1 ml of 2-mercaptoethanol (Merck) in a final volume of 100 ml of buffer ml of 0.1 M NaHPO 4 pH 7.0, 0.1 M MgSO 4 1 ml of mercaptoethanol).

1.95 ml of the ONPG solution and 50 Al of the cellular suspension are mixed and the mixture is incubated for 1 hour at 28 0 C. 2 ml of 1 M Na 2

CO

3 are added to this suspension and the absorbance of this suspension is measured at 420 nm.

Comparison of the p-gal activity for the recombinant viruses is given below in p-gal units.

Virus Immediate (AraC) Immediate late (-AraC) Abs u 3-gal Abs u p-gal 25 wt 0 0 0 0 V3 0.28 57 0.58 120 V4 0.34 71 0.58 120 0.26 52 0.49 101 V8 0.05 10 0.65(1:5) 670 30 V9 0.05 10 0.31(1:10) 640 4 44 r 0 4 I4 4 44 4 r 4 44 *4 4 *Z 46441 444c 4 wt Immediate (AraC) non-recombinant wild type.

immediate growth phase artificially prolonged for 16 hours by AraC.

(~flvenxa-cesu tL z and immediate promoters are underlined. The last BamHl base is at 10 bp from the initiator ATG of the gene.

-ir- 1: 4( 4: 34 p p •p p 6 l* e p.

S I t i a I Immediate late (-AraC) natural immediate and late phases without AraC.

Abs absorbance.

u p-gal p-galactosidase unit measured.

and 1:10 prior 5-fold and dilutions of the extracts.

The Vaccinia promoter P7.5 functions during the immediate and late phases of the infection (V3, V4 and V5); the promoter P11 has only a late activity (V8 and V9); the promoter Pll is stronger than the promoter as in Vaccinia. The temporal regulation as well as the relative strength of the two promoters are therefore preserved in the CNP virus, whether the insertion is into Bl or B2 or whether it is of the LacZ orientation.

Example 16 Vaccination of chicks with the CNP/LacZ recombinant virus. Protection against the fowl variola. Immune response against f-qal The vaccinating power of the CNP/acZ recombi- 20 nants is tested. The two criteria selected are the protection against fowl variola and the immune response against p-galatosidase.

a. Administration by transpiercing the wing A suspension of the recombinant viruses V4 and V8 or a suspension of the vaccinal CNP strain were injected into one-day-old chicks, certified specific-pathogen-free (SPF), by transpiercing the wing membrane (so-called "wing web" method) (WW).

The tests are carried out on three groups of 28 30 to 30 chicks which are vaccinated with V4 or with V8 or with CNP, and on a group of 15 non-vaccinated chicks, as negative control.

Each vaccinated chick received 10 Al of a suspension at 5 x 10 5 TCID50 (Tissue Culture Infectious Dose)/ml of virus, which is eq;ivalent to 5 x 103 TCID50 per bird.

At 29 days, the chickii were brought into contact with the virulent virus (Fowl. Pox Challenge Virus strain obtained from Aphis, USA).

IC

I II I I ICI I CttI I I C, Ct

I

7' ur 35 a. A* *o A a a, .a A a.

a.

a a.

The absence of lesions, evaluated ten days later, shows a protection of all the chicks vaccinated against fowl variola. On the other hand, half of the nonvaccinated chicks had lesions. Analysis of the antibody titres against p-galactosidase by direct ELISA showed that 21 of the 29 chicks vaccinated with the V4 viruses and 20 of the 28 chicks vaccinated with the V8 virus exhibit a seroconversion, that is to say are seropositive.

The ELISA titre being the last dilution which gives an optical density greater than 100, the mean anti-p-galactosidase ELISA titre in the sera of these chicks is 1:800.

b. Administration by the intramuscular and subcutaneous routes One-day-old chicks are vaccinated on the first day with 104' TCID50 of virus V8 by the intramuscular route (1M, 27 chicks) or subcutaneous route (SC, 34 chicks). They are subjected to a challenge 27 days later. They are protected against the fowl variola Seroconversion against p-galactosidase is observed in 24 of the 27 chicks vaccinated by the IM route and in 27 of the 34 chicks vaccinated by the SC route.

25 In conclusion, the immunisation results show: that the recombinant viruses containing the LacZ gene in the TIR regions of their genome, at the B1 or B2 site, preserved their immunogenicity; that the P7.5 and P11 promoters function in the 30 animal; that an antibody nesponse is induced against p-galactosidase, which is considered here as a heterologous protein which is expressed by the CNP recombinant; that the intramuscular subcutaneous (SC) and wing membrane transpiercing (WW) routes are equivalent both in terms of protection against the fowl variola and of the percentage of seroconversion b I 36 against p-galactosidase.

Example 17 Insertion of the genes, encoding the glycoprotein E2 of the fowl bronchitis virus, into the transfer vectors The virus responsible for the infectious fowl bronchitis (IBV) is a coronavirus. The most important surface antigen of this virus is the protein E2 which consists of two sub-units Sl and S2 (Cavanagh, 1983, Cavanagh et al., 1988). Many serotypes exist including Massachusetts, denoted M41, and Dutch serotypes, especially D1466 and D274 (Kusters et al., 1987).

A recombinant CNP vaccine expressing the E2 protein of an IBV is developed so as to obtain an effective vaccine against the virus responsible for the infectious fowl bronchitis (IBV).

The gene for the protein E2, of the serotype M41, Swas obtained from Dr. Kusters of the University of Utrecht as well as large fragments of the E2 genes, of the serotypes D1466, D207 and D274.

20 A BamHl cassette of the E2 gene of the serotype M41 was constructed by site-directed mutagenesis. The complete gene of the strain D1466 and a complete hybrid gene D207/D274 were constructed from fragments, also on cassettes which were compatible with BamHl. These three cassettes were cloned downstream of the promoter thus generating the three plasmids p75M41, p75D1466 and i I. p75D207.

The cassettes P7.5-E2 were cloned into the BamHl site of the transfer vector pTIRB1, and the cassette PllLac is then cloned, downstream of E2, into the BamHl Ssite. These transfer plasmids are pTIRBlP75M41Lac, pTIRB1P75D1466Lac and pTIRB1P75D207Lac. The recombinant viruses are constructed by transfer and purified as described in Examples 9, 10 and 11. The genomes are analysed by Southern blotting as described in Example 13.

The expression of the E2 antigen is detected by the following immunological techniques: ELISA, Western blotting or immunofluorescencei, using specific reverse.

Name name of the tranfer plasmid.

37 antibodies. A stock of recombinant viruses is produced.

Poultry is vaccinated with a dose of these recombinants.

The efficacy of the vaccine is evaluated after infection with pathogenic viruses using the conventional methods for infectious bronchitis, and by evaluation of the level of antibodies against the virus.

Example 18 Insertion of an Eimeria gene into the transfer plasmids construction of CNP/TA4 recombinants The Eimeria genus comprises parasites of poultry, which are responsible for coccidiosis. Surface antigens have been described for the E. tenella, E. necatrix, E. maxima species in particular (European Patent Applications 0,164,176 and 0,231,537).

An effective recombinant vaccine against coccidiosis is developed.

The E. tenella antigen, denoted TA4 or A4, is a protein consisting of two sub-units of 17 kd and 8 kd linked by a disulphide bridge. The gene was isolated .f 20 from a genomic library and also from mRNA. The complete description of the gene has been published in the above- 0 mentioned patent applications.

SA BamH1 cassette of the TA4 gene was constructed by subcloning. The plasmid pTA406 contains the coding sequence of TA4. The plasmid pTA410 carries the TA4 gene with a modification in the proteolytic sequence which Sseparates the two sub-units. The native sequence Arg-Arg-Leu was replaced by the sequence Arg-Glu-Lys-Arg (described by Kieny et al., 1988), by site-directed mutagenesis. These two BamHl cassettes were cloned downstream of the promoter P7.5 of the plasmid plP7.5, in the orientation which places the TA4 gene under the control of The cassettes P7.5-TA406 and P7.5-TA410 are cloned into the BamH1 site of the transfer vector pTIRB1D. The cassette P11-Lac is then cloned into the BamHl site downstream of the TA4 gene. The transfer plasmids are pTIRTA406Lac and pTIRTA41OLac.

1 (dscried y Keny t 188) bysitedirct- 4,aeei.TeetoBm~ aste eecoe p-galactosidase which is detected by a "plaque assay" test on a Petri dish. The procedure on a 6-cm Petri dish i 38 The recombinant viruses were obtained by transfer as described in Examples 9, 10 and 11. Blue plaques are obtained. The recombinant which carries the TA406 gene is the recombinant which carries the TA410 gene is V21.

A double recombinant V21 vi I, that is to say which carries a copy of TA410 and LacZ in each TIR, is purified on each microtitre plate and its genome analysed by PCR as described in Example 14. The primers used and che size of the amplified fragments are presented in the table below. The primer 1871 is complementary to the LacZ gene.

Primers Wild fragments Recombinant fragments 15 0 0 0r 0 5169 5168 220 bp 4 kb 5169 1871 1.2 kp S" The expression of the TA4 antigen is detected by the following immunological techniques: ELISA, Western blotting or immunofluorescence, using specific antibodies.

A stock of recombinant viruses is produced.

Poultry is vaccinated with a dose of these recombinants.

The efficacy of the vaccine is evaluated after a challenge with virulent Eimeria using conventional methods for coccidiosis including analysis of sera, rate of weight gain and clinical signs.

Example 19 Insertion of the polyprotein gene of the infectious bursal disease virus into the transfer vectors The causal agent of the infectious bursal disease virus is a virus of the Birnaviridae family. The virus, called IBDV (Infectious Bursal Disease Virus), causes a highly contagious disease (infectious bursal disease) which affects young chickens and is characterised by the destruction of the lymphoid cells of the bursa of Fabricius. The virus possesses a genome consisting of 2 i I II i; -39 segments of double-stranded RNA, called segment A (about 3,400 base pairs; bp) and segment B (about 2,900 bp). The viral particles are without envelopes and are of icosahedral form of about 60 nanometres in diameter. Four viral proteins were clearly identified: VP1 with a molecular weight (MW) of 90 K kilodalton); VP2, MW of 37 K to 40 K; VP3, MW of 32 K to 35 K and VP4, MW of 24 K to 29 K (Dobos 1979, Fahey et al., 1985). VP2 is derived from a precursor VPX with an MW of 41 K to 54 K.

The segment B encodes VP1 which is probably the viral polymerase. The segment A encodes 3 other proteins.

These proteins are generated, by proteolytic cleavage, from a precursor with an MW of about 110 K corresponding to a large open reading frame of the segment A. The S: 15 protein VP4 is involved in this proteolytic cleavage (Jagadish et al., 1988). The proteins VP2 and VP3 con- Sstitute the viral capsid. VP2 contains the antigenic determinants which are capable of inducing the synthesis of antibodies which neutralise the virus (Becht et al., 1988; Fahey et al., 1989).

A recombinant Fowlpox vaccine against the infectious bursal disease is developed.

The stages of this development are as follows: 1. Isolation of the genetic material of the selected It,' 25 IBDV strain, namely the EDGAR strain. The EDGAR virus strain can be obtained from the United States Department of Agriculture (USDA, APHIS 6505 Belcrest Road, Hyattsville, MD 20782, United States).

2. Synthesis, cloning and determination of the nucleotide sequence of the cDNA corresponding to the segment A.

3. Insertion of the cDNA as well as the sequences required for the expression of this genetic material in animal cells infected with Fowlpox, and the sequences permitting screening of the recombinant Fowlpox viruses, into the transfer plasmid pTIRB1 described in Example 4.

Blue/total number of blue plaques/total number of plaques percentage of blue plaques.

40 4. Isolation and purification of the recombinant viruses.

Genetic analysis of the recombinant viruses.

6. Analysis of the expression in vitro, in cell culture, of the IBDV genes carried by these recombinant viruses.

7. Vaccination of chicks with the recombinant viruses and analysis of the protection against infectious bursal disease.

Stage 1 The viral RNA of the EDGAR strain was isolated from the bursas of chickens infected with the virus.

About 40 g of bursas, harvested 7 days after infection with the virus, are ground in 40 ml of TNE buffer (TNE: 10 mM Tris-HCl, 100 mM NaCI, 1 mM EDTA, pH The ground product is centrifuged at 17,000 g and the aqueous phase obtained is deposited on a preformed sucrose gradient consisting of 2 layers, containing and 60% sucrose by weight/volume, in the TNE buffer).

The gradient is centrifuged at 134,000 g for 2 hours 30 minutes. The 40%-60% interphase of the sucrose gradient is harvested and it contains the partially purified virus. 5 ml of this phase are added to 5 ml of buffer containing 10 mM Tris-HCl, 100 mM NaCl, 0.5% SDS, 25 10 mM EDTA, 2 mg/ml proteinase K, pH 7.5. The mixture is incubated for 1 hour at 37°C. The aqueous phase is then f. extracted with phenol/chloroform. The nucleic acids of the aqueous phase are precipitated with ethanol in the Spresence of 0.8 M LiCI and taken up in 500 pl of water.

Stage 2 The synthesis and the amplification of the cDNA corresponding to the segment A were carried out according to the method described in "GENEAMP RNA PCR KIT, PERKIN ELMER CETUS" and using synthetic oligonucleotides or primers, which are complementary to the sequence of the segment A, as primer for the synthesis of the first DNA strand by reverse transcriptase. The choice of these synthetic oligonuclootides was determined by analysis of b 1 recombinations may, on the other hand, generate the last possible type which is TIR-R/LacZ. Consequently, a blue

A

12J~ 41

F

t l the published sequences of the segments A of other IBDV strai lI the Australian strain 002-73 (Hudson et al., 1986), the German strain CU-i (Spies et al., 1989) and the British strain 52/70 (Bayliss et al., 1990). The sequence of the primers and their position relative to the segment A of the EDGAR strain are presented in Figures 8 and 9.

Analysis of the published sequences for the IBDV strains indicates that two other open reading frames exist on the same coding strand of the segment A, in addition to the large open reading frame ORFI which encodes the proteins VP2, VP4 and VP3. One of them, ORF2, which is initiated 34 bp upstream of the ATG of ORFi, overlaps the latter and is 435 bp in length. The other, ORF3, is initiated 32 bp upstream of ORF2 and is 31 bp in length. The possible role of these ORFs in the biology of the virus is currently undefined.

Four double-stranded cDNA fragments, delimited by the pairs of primers, 0-1b (585 bp), 1-2 (1129 bp), 3-4 (670 bp), 5-6 (1301 bp) respectively and spanning ORFI and ORF2 of the segment A (see Figure were generated.

These fragments were cloned into the plasmids pBSPlus or pBSLK1; six plasmids were thus constructed (see Figures 8 and

L

±ne nomogene.Lty u.L a L.

by Southern blotting (Maniatis et al., 1982). The restriction fragments of the gena'mes of the recombinant viruses and of the non-recombinant viruses are 7, 42 0o a a S a a.

94 504 9 a..

9~ *0'*004 Name of Size Construction scheme plasmid (bp) pBSIBDVO 3478 pB3SPlus (Ps1 Hinc2) 277-bp Pstl fragment of the 0-lb fragment pBS1A2 3932 pBSLK1 (Pstl T4 DNA polymerase, Sacl) 760-bp Sadl fragment of the 1-2 fragment pBSlB 3538 pBSLK1 (Pstl T4 DNA polymerase, 15 Sacl) 36 9bp Sa dl fragment of the 1-2 pEDGAR34i 3887 pBSLK1 (Pstl T4 DNA polymerase, Hinc2) 670-bp 3-4 fragment pBS3A 4175 pBSLKl (Pstl T4 DNA polymerase, Spjhl) 25 956-bp S.phi fragment of the 5-6 fragment pBS3B 3509 pBSLK1 (Pstl T4 DNA polymerase, Sphl) 345-bp Sphl fragment of the 5-6 fragment The nucleotide sequences of the IBDV fragments of these plasmids were determined and aligned so as to reconstitute the sequence of the segment A of the EDGAR strain, which is amplified by PCR (see Figure The original sequences of the EDGAR strain, which were

I

growth on cultured cells. Moreover, !given that the LacZ gene is about 3 kb 'in size, the isolation of these double 2 43 replaced by the use "of primers which were defined on the basis of published sequences of other IBDV strains, were also determined from the amplification products of these regions using primers situated outside them.

The reconstruction of the segment A f rom the clones obtained is schematically represented in Figure The stages are aE; follows: 1. Construction of VEDGAR12: pBSlA2 (EcoR1 T4 DNA polymerase, Sal) pBS1B (Sphl T4 DNA polymerase, Sacl) 2. Construction of PEDGARM12 by site-directed mutag~enesis on PEDGAR12: a. deletion of the Sphl site of pEDGAR12 situated upstream of the IBDV sequence: original sequence Sph"1 7 5' GTCTGATCTCTACGCATGCAAGCTTTTGTTCCCTTTAGTGAGGG 3' to.9 Mutagenesis primer 5' GTCTGATCTCTACGGTTCCCTTTAGTGAGGG 3' b. deletion of the EcoRi site of pEDGAR12 and introduction of an Sphl site downstream of the I13DV sequence; original sequence: EcoRi 5' CGACTCACTATAGGGCGAATTCCCCCCAGCGACCGTAACGACTG 3' IBDV :Mutagenesis primer 1 5' CGACTCACTATAGGGCGGATCCCGCATGCCCCAGCGACCGTAACGACTG 3'

IBDV

3. Construction of pACEDGARM12: Insertion of the Bcll-Sphl fragment of pEDGARM12 into the Bcll-Sphl sites of pACYC184 4. Construction of -pEDGARM34i by site-directed mutag~enesis on pEDGAR34i: Replacement of the Sphl site by an Nsil site; EDTA, SDS), rupplemented with RNase (0.1 mg/mi) and proteinase K ()1agm)adteixuehus obtained is 444 Sphl Original sequence: 5' GCTCGAAGTTGCTCAGGCATGCAAGCTTTTG 3' IBDV mutagene sis Nsil primer 5' GCTCGAAGTTGCTCATGCATGCAAGCTTTTG 3' IBDV Construction of pBS3A (Hijnc2 Pstl) Hinc2-Pstl fragment of pEDGAR34i 6. Construction of pACEDGAR14: pACEDGARM12 (Sphl T4 DNA polymerase, RjmHl) pEDGARM34i (Nsil T4 DNA polymerase, BamH1) 7. Construction of pACEDGAR14 (Baml T4 DNA polymerase, g~ll) (Pvu2-SaJ..) 15 8. Construction of~ PACEDGARI: pACEDGARiS (Spja1 EcoRV) pBS3B (Sphl Py3A2).

44~This plasmid contains the complete sequence of ORFI of the segment A on the Bcll-BamHl fragment.

9. Construction of PBSIBDVOb by site-directed mutagenesis of PBSIBDVO: :Introduction of ORF3 into pBSIBDVO which carries OV, the beginning of ORFi and ORF2; Original sequence: pBSPlus 4 25 51CCGGTCCAATCTCTTCAGGTATAG 31 Bc 11 Mutagenesis primer: -ORF2- pBSPlus ORF3 51 CCCGGGGATCCTCTAGAGTCTGATCAOGATGGAACTGCTCGTTCTACAAGCTATCATTGATGG 31 Boll Construction of PACEDGAR2 and PACEDGAR3: The plasmids pACEDGAR2 and pACEDGAR3 were obtained by replacing the Bcll--Rsr2 regrion of the plasmid pACEDGARi with the Bcll-Rsr2 fragment of the plasmids pBSIBDVO and pBSIBDVOb respectively.

The 3 plasmids pACEDGARi, pACEDGAR2 and pACEDGAB3,,l therefore enable ORF1, ORF1-ORF2 and ORF1-ORF2-ORF3, no ampl~ified fragment.

W~ 45 99 9 99 9 99 9* 9. 9 9 9 9 99*9 9 .9 .4 99* 9 99 9. 9 999 9 99* 1 994 respectively, of the segment A of the EDGAR strain, to be isolated on a Bcll-BamHl fragment.

The seq~uences of these 3 plasmids, on the ATG side of the ORFs, are represented below: Bc11 pACEDGARI: 5' TGATCACAGCGATGACA 3' -ORFi- Bc 11 pACEDGAR2: 5' TGATCATTGATGGTTAGTAGAGATCACACAAACCATCGCAGGGATGACA 3' -ORFi- Bc 11 ,pACEDGAR3: 5' TGATCAGGATGGAACTCCTCCTTCTACAACGCTATGATTGATGGTTAGT 3' ORF3 15-- -O F Stage 3 These Bcll-BamHl fragments were then cloned into the BamHl site of the plasrnid p2P75, thus generating the plasmids p75EDGAR1, p75EDGAR2 and p75EDGAR3 and placing the coding sequence(s) of the .egme~nt A under the control of the promoter These coding sequences were also placed under the control of the promoter P11. The Bcll-BamHl fragment of the plasmid pACP11, carrying the promoter P11, was inserted 25 into the BamH1 site of the plasmids pACEDGARI, pACEDGAR2 and pACFDGAR3 so as to generate the plasmids pilEDGARi, p11EDGAR2 and p11EDGAR3 respectively.

Bcll-BamHl cassettes, P75-EDGAR or P11-EDGAR., were isolated from these different plasmids and inserted into the BamHl site of the plasmid pTIRB1, thus producing the plasmids pTIR75EDGAR1, pTIR75EDGAR2, pTIR75EDGAR3, pTIR11EDGAR1, pTIR11EDGAR2 and pTIR11EDGAR3. The orientation of these Bcll-BamHl cassettes inside the plasmid pTIR8i, which was conserved, is such that the direction of transcription, initiated from the promoters P7.5 and P11, coincides with that of ORFi and ORF2 which are prei :nt inside the plasmid pTIRB1.

~1 j

I

I

I

9; The culture is centrifuged for 10 minutes at 6,000 g. The centrifugation pellet is resuspended in 500 pl of PBS, this suspension is mixed and it is 11,

:I

94 4r 41 4.

4444 4.

4* 44* 4 4 C*4 4 44 46 The Bg_12-BamH1 fragment of the plasmid pACP11LAC, carrying the P11-LACZ cassette, was inserted into the BamHl site of the plasmids pTIR75EDGAR1 and pTIR75EDGAR2 so as to generate the plasmids pTIR75E1LAC and pTIR75E2LAC respectively. The orientation of P11-LACZ inside these plasmids is such that the direction of transcription of the LACZ gene coincides with that of ORF1 and ORF2.

In a similar manner, the plasmids pTIR11E1LAC, pTIR11E2LAC and pTIR11E3LAC were generated by insertion of the p75-LACZ cassette, isolated in the form of a Bgl2-BamHl fragment of the plasmid p75LAC, into the BamHl site of the plasmids pTIR11EDGAR1, pTIR11EDGAR2 and pTIR11EDGAR3 respectively.

15 Finally, the plasmid pTIR11VP2LAC was generated by inserting the Xhol (treated with T4 DNA polymerase)-Bgl2 fragment of the plasmid pl1EDGAR1, into the PDuM1 (treated with T4 DNA polymerase) and B1l2 sites of the plasmid pTIR11E1LAC. The transfer plasmid pTIR11VP2LAC contains, under the control of the promoter P11, the complete sequence of the protein VP2 as well as the amino-terminal part of the protein VP4; by virtue of the construction, the last three amino acids (Asp, Leu and Glu; carboxy- terminal part of VP3) and the stop codon for translation (TGA) of the polyprotein are fused in phase. It can be seen in Figure 9 that this heterologous protein therefore corresponds to a part of the polyprotein containing the amino acids 1 to 493, followed by the amino acids 1010 to 1012, in which the protein VP2 is included.

By way of example, the plasmid pTIR75E1LAC is represented in Figure 11.

Stage 4 and stage The recombinant Fowlpox viruses, in which the ORFs of the EDGAR strain have been integrated, were isolated, purified and characterised according to the methods described in Examples 9, 10, 11, 12, 13 and 14.

The notation of the recombinant viruses is: 1 16 hours by AraC.

-47- V11 P7.5E1 V12 P7.5E2 V14 P11E1 V15 P11E2 V17 P11VP2 V16 P11E3 The primers used for selecting the double recombinant TIRs by PCR, differentiate the WT TIRs and the TIRs containing LacZ, El, E2, E3 or VP2. The combinations of primers and the size of the amplified fragments are given in the table below.

The primers IBDV16, 3, Ib and 22 hybridise to IBDV. The primers IBDV16, lb and 3 hybridise to the coding part of VP2. The primer IBDV22 hybridises to the coding part of VP3 and therefore not to the V17 genome.

The primers 5168 and 5169 hybridise to FPV. The primer 1871 hybridises to the p-galactosidase gene. The sequence 15 of these primers is defined in the table "List and sequences of the primers".

Primers Virus Fragments (nt) 5169 5168 WT 220 recombinants 6.0 kb •J 5169 1871 V8 310 Srecombinants 3.6 kb .1 5169 IBDV16 Vll 341 V14, V17 339 S 25 V12 373 371 V16 402 S" 5169 IBDVlb V17 766 IBDV22 1871 Vli, V12 379 V14, V15, V16 479 V17 IBDV3 1871 V14, V15, V16 2280 V17 732 Stace 6 The expression of the IBDV antigens of the recombinant viruses inside the QT35 cells was compared.

I.

i virulent virus (Fowl Pox Challenge Virus strain obtained from Aphis, USA).

3 i O J ii~-ili i 9* *1 99 9 9 r4 '.9 .9 9 ~l 99: .9994 48 The antibodies used, which were raised against the IBDV strain Cu-1, were kindly provided by Professor H. Miller, InstitUt fUr virologie, Justus-Liebig- Universitat, Giessen, Germany.

They are: 1, a polyclonal serum (No. B22) of a rabbit which was hyperimmunised against the Cu-1 strain 2, an anti-VP3 mouse monoclonal antibody (No. I/A10) which recognises the protein VP3 in native and denatured form 3, an anti-VP2 mouse monoclonal antibody (No. B1) which recognises a conformational epitope of the protein VP2; the B1 antibody is an antibody which is capable of neutralising the viral strain Cu-1.

a. Experimental conditions for the infection On day D=l, 2.5 x 10 6 QT35 cells are inoculated, per 2 flask, into 5 ml of growth media (composition described in Example Eight flasks are prepared.

20 On day D=2, the cells are infected at a multiplicity of infection of 0.01 virus per cell with each recombinant virus, V11, V12, V14, V15, V16, V17, V8 (negative control) and IBDV (bursine strain 2, positive control).

On day D=5, the infected cells are harvested and 25 [lacuna] the media after freezing followed by thawing.

b. Analysis of the expression products by sandwich type

ELISA

The ELISA test is carried out using, as first antibody, the polyclonal antibody B22 and, as second antibody, either the anti-VP3 monoclonal antibody (No. I/A10) or the anti-VP2 neutralising monoclonal antibody (No. Bl). The ELISA curves are presented in Figure 12A for anti-VP3, and in Figure 12B for anti-VP2.

The results of these analyses show that: 1 Figure 12A: the protein VP3 is expressed in all the recombinants (Vll, V12, V14, V15 and V16), which contain at least the sequence encoling the polyprotein (ORF, VP2-VP4-VP3 proteins), but not in the recombinant

I

i I iV

-I

wing membrane transpiercing (WW) routes are equiva- lent both in terms of protection against the fowl variola and of the percentage of seroconversion i 49- 1.

V17 since it contains only the region encoding VP2 and the amino-terminal part of VP4, nor in the recombinant V8 since it contains no IBDV sequence.

11 1 49 The level of expression of the protein VP3 is lower in the recombinants V11 and V12 than in the recombinants V14, V15 and V16, which is probably correlated with the strength of the promoters which are present in the various recombinants: the activity of the promoter (recombinants Vll and V12) being less strong than that of the promoter pll (recombinants V14, V15 and V16) (see Example No difference is observed in the level of expression of VP3 as a function of the reading frames of the segment A, which are introduced into the various recombi- 1.5 nants: ORF1 for the recombinants Vll and V14, ORF1 ORF2 for the recombinants V12 and V15 and ORFI ORF2 ORF3 for the recombinant V16.

t 2 Figure 12B: the protein VP2 is expressed in all the recombinants except for V8 which does not contain IBDV sequences.

The level of expression is highest for the recombinant V17; in this case, it is close to that of the "1 protein VP2 which is expressed in the cells infected by the IBDV virus.

A correlation is again oberved between the strength of the promoters present in the various recombi- Snants and the level of expression of the protein VP2.

These results show, on the one hand, that the epitope of the protein VP2 which is recognised by the neutralising antibody B1 raised against the strain Cu-1, is also present ii the protein VP2 of the American strain Edgar, and on the other hand, that the original conformation of the protein VP2 is preserved, at least in this region, in all the recombinants.

c. Analysis of the expressidon products by Western blotting Western blot analysis of the proteins produced by the various recombinants was carried out, on the one

I

The expression of the E2 antigen is detected by the following immunological techniques: ELISA, Western blotting or immunofluorescence, using specific

,J.

o::c~ i~ 50 ft 4f f ft ft.

0* ft 94* 444944 t 'f 4c 0 ft ft I ft 11 4i 44e

I

4,'4 hand, using the polyclonal serum (B22) which recognises all of the IBDV proteins and, on the other hand, using the anti-VP3 monoclonal antibody The results, which are illustrated in Figure 13A, show that the polyclonal serum recognises, in the extracts of the cells infected by IBDV, essentially 3 proteins corresponding to VP2 40 kd), VP3 32 kd) and VP4 28 kd). A protein of about 46 kd can also be observed and it may constitute the VP2 precursor (VPX, 48-49 kd).

For all the recombinants (Vil, V12, V14, V15 and V16), which contain at least the sequence encoding the polyprotein (ORF1, VP2-VP3-VP4), proteins with a molecular weight (MW) corresponding to VP3, VP4 and probably 15 VPX respectively are detected with the anti-IBDV polyclonal serum (Figure 13A). For the recombinant V17, only one protein, whose molecular weight is close to that of the fusion protein VP2 amino-terminal region of VP4 52 kd), is detected.

The anti-VP3 monoclonal antibody (Figure 13B), recognises essentially two proteins,. VP3 and probably a degradation product of VP3, in the cells infected by IBDV and all the recombinants expressing the polyprotein. No IBDV protein is recognised in the recombinant V17 expres- 25 sing the fusion protein VP2-VP4.

All these results indicate that the reading frame encoding the polyprotein (ORFl) is translated in all the recombinants irrespective of the presence of the additional reading frames ORF2 (recombinants V12 and V15) or ORF2 and ORF3 (recombinant V16). The cleavage of the precursor polyprotein is carried out accurately but appears to be incomplete in the case of VP2; it has been suggested that the complete maturation of the precursor VPX would take place during or after transportation of the IBDV viral particles to the surface of the cells (MUller et al., 1982).

V

I

il.J BamHl site downstream of the TA4 gene. The transfer plasmids are pTIRTA406Lac and pTIRTA410Lac.

I1 'ro 0 1 51 Stage 7 The vaccinating power of the recombinants *C 4 .4 9 49

S~

44 4 4 C rI FPV/IBDV is tested.

a. Seroconversion with V11 A first vaccination campaign with a recombinant FPV/IBDV compared the seroconversion against p-galactosidase and against the IBDV virus for three different administration routes: by the intramuscular route (IM), by the subcutaneous route (SC) and by piercing the wing (WW or wing web).

One-day-old chicks are vaccinated with 10'. V11 recombinant viruses using the three administration routes, IM, SC or WW. They are killed by euthanasia 11 days later.

15 Analysis of the sera by direct ELISA showed that 2/14 of the chicks vaccinated by the intramuscular route, 3/6 of the chicks vaccinated by the subcutaneous route and 8/15 of the chicks vaccinated by transpiercing the wing, had antibodies against p-galactosi ase, while 5/14 of the chicks vaccinated by the intramuscular route, 1/6 of the chicks vaccinated by the subcutaneous route and 1/15 of the chicks vaccinated by transpiercing the wing, had antibodies against the IBDV virus.

25 In conclusion, the IBDV proteins are expressed by the recombinant FPV/IBDV11 in the vaccinated and they induce an antibody response in a few chicks. Of the three administration routes, the intramuscular route induces a higher response than the other two.

b. Early protection with V11, V15 and V16 One-day-old chicks received a dose of 104' V8 (negative control), V11, V15 or V16 virus by the intramuscular route and were challenged 10 days later with 100 LD50 (100 times the lethal dose) of the virus 849VB administered by the ocular route. The 849VB strain is described by Van Den Berg et al., 1991.

The chicks are killed by euthanasia 20 days later.

'4o~ S.3 _L I ana is cnadrac erLsea Dy Lne destruction of the lymphoid, cells of the bursa of Fabricius. The virus possesses a genome consisting of 2 S52 The ratio, multiplied by 100, between the weight of the bursa and the total weight is a protection index.

In the control group, which is vaccinated with V8 and not subjected to the IBDV challenge, this ratio is 0.57 (mean for 10 chicks).

In the V8 group subjected to the challenge, this ratio becomes 0.11 (9 chicks).

In the chicks vaccinated with V11, V15 and V16, these ratios are 0.11 (20 chicks), 0.12 (18 chicks) and 0.12 (18 chicks) respectively.

On the basis of this criterion, there is no early protection against the IBDV virus by the recombinants VII, V15 and V16.

c. Late protection with V11, V15 and V16 15 Chicks vaccinated with V8, V11, V15 and V16, as described in the preceding section, were subjected to the S. IBDV challenge 42 days after the injection.

The sera collected before the challenge are analysed by the ELISA method in order to evaluate the antibody response against p-galactosidase and the IBDV virus.

The anti-p-galactosidase response shows that 100% 4 00 t seroconversion is obtained in all the vaccinated chicks, that is to say 70 chicks in total. The titres range from 1:200 to 1:51,200. There is no significant difference .sit between the titres obtained with Vil, whose LacZ gene is 4I under the control of P7.5, and V8, V15 and V16, whose LacZ genes are under the control of the promoter Pl.

SThe anti-IBDV response in the 10 chicks vaccinated with V8 is zero; it is positive in all the chicks vaccinated with V11, V15 and V16. In detail, the titres of the responses in the 20 chicks vaccinated with V11 range from 1:800 to 1:51,200, with a mean of 1:6,400.

They are from 1:6,400 to 1:102,400, with a mean of 1:25,600 for the 20 chicks vaccinated with V15. They are between 1 6,400 and 1:204,800, with a mean of 1:25,600 in the 20 chicks vaccinated with V.16. The antibody levels are substantially higher for the groups vaccinated with 'owlpox viruses, into the transter plasmid pTIRBl described in Example 4.

53 or V16 than for those vaccinated with V11.

The seroneutralisation titres for the vaccinal strain PBG68, adapted to cultured cells, are 1:10 for

V

11, as negative control; 4 sera out of 20 for V15 and 1 serum out of 20 for V16 have seroneutralisation titres of 1:20. This titre is therefore low and is observed in only a few of the animals.

The ratio (weight of bursas/total weight) x 100 has a mean of 0.66 in the unchallenged V8 control group (10 chicks).

It becomes 0.1 in the challenged group V8 (1 survival).It is 0.1, 0.11, 0.11 for the three groups V11 (3 chicks), V15 (11 chicks) and V16 (8 chicks) respectively. There is no protection against atrophy of 0.o, 15 the bursas.

The mortality during the four days which followed Sas athe challenge was almost total for the control group (9 chicks out of 10). In the group V11, 3 chicks out of survived while 11 chicks out of 20 which were vaccinated with V15 and 8 chicks out of 20 which were vaccinated with V16 survived. A protection of the order of 50% of the animals vaccinated with V15 or V16 is therefore observed.

i S d. Protection with V14, V15 and V17 25 Four groups of three-week old poultry received 0.2 ml of the recombinant viruses V8 (negative control), I V14, V15 or V17. The amount of virus per chicken was 106,4 TCID50. The administration route is intramuscular.

Twenty-one days later, serum is collected from each animal in order to evaluate the anti-IBDV antibody titre. One hundred times the lethal dose of IBDV is injected into the animals of groups V14, V15 and V17 and into some of the animals of the group V8 (that is to say the group of poultry which received the recombinant virus V8).

11 days later, that is to say 32 days after the vaccination, the control animals of the group V8 and those which survived the challenge, are killed by 0;r segment A, as primer for the synthesis or ue of- t strand by reverse transcriptase. The choice of these synthetic oligonucleotides was determined by analysis of -54euthanasia and the ratio (weight of the bursas/weight of the poultry) x 100 is determined.

The results are: -Mortality: the number of poultry animals which succumbed to the challenge can be divided as follows: for V8: 12 poultry animals/14 for V14: 21/24 for V15: 17/25 and for V17: 0/25 In other words, all the poultry vaccinated with the recombinant V17 resisted the challenge. The protection is total in this group. Furthermore, none of the poultry showed the slightest clinical sign of disease. The 32% protection obtained with the recombinant is close to the 50% protection obtained in the preceding experiment.

ELISA: the mean titres estimated against the virus S are: for V8, titres less than 1:100 and considered as negative; for V14, titres of 1:12800 (from 1:6400 to 1:51200), for V15, titres of 1:6400 (from 1:800 to 1:25600), for V17, titres less than 1:100 except for 3 poultry animals (1:800, 1:6400 and 1:51200).

Consequently, the antibody response against IBDV, which is induced by the expression of the polyprotein of the recombinant FPV/IBDV, is very high. In contrast, the response against the complete virus, which is induced by V17, is low.

Seroneutralisation: the seroneutralisation titres against the PBG68 strain have a mean value of: for V8, V14 and V15, titres less than 1:10 and considered as negative; for V17, 5 poultry animals out of 20 have a titre above 1:20, that is to say, in detail, a titre of 1:20 (twice), 1:40, 1:80 and 1:320.

Consequently, a seroneutralisation is observed only in the sera of poultry which were vaccinated with V17.

Bursas: the mean of the ratio (weight of the bursas/total weight) x 100 is as follows: for unchallenged V8, a ratio of 0.68 0.13), for challenged V8, a ratio of 0.09 0.01), for V14, a ratio of 0.10 iA 0.02), for V15, a ratio of 0.13 0.04) and for V17, a ratio of 0.34 0.23).

Consequently, a partial protection of the bursas of Fabricius is observed only in the group V17. Indeed, 8 poultry animals out of 24 have a ratio which is similar to that of the unchallenged controls. The other sixteen have a higher ratio than the challenged controls.

Conclusions The main conclusions of these vaccination campaigns are: The recombinants which express the IBDV polyprotein induce a strong ELISA response in poultry, with high titres against the virus.

The recombinant which expresses the VP2 portion of *4 os the polyprotein completely protects the poultry against mortality and partially protects them S against atrophy of the bursa.

ooee or, o S si i i -I strain, which is amplif ied by PCR (see Figure 9) The original sequences of the EDGAR strain, which were Name Vectors for cloni pUC 18 pBSPlus pBSLK1 pBSLK2 pACYC184 56 List of the Plasmids Charact eristics ng into E. coli Cloning vector (Messing 1983) Cloning vector (Stratagene) pBSPlus witnh a Bcll and 3g12 site inside the polylinker Identical to pBSLK1 but the Bcll and Bgl2 sites are in the inverse order Cloning vector (Chang, 1978) Vaccinia nromotexs 0R Re U 4 C

C

0R C o C C

CC

CR CS U C

C

o qC Ce C

U

C

*0 C -t C 44

"SC

4 CC 9e 4

'SC

CC

I.

4 44CC

C

*045

C

*5 C~ C 'a"

C

CC CCRC

C

pGS2O p1P75 15 p2P75 pp~l 20 p2Pll pACP11 LacZ gene pBSMutLacZ 1 Transfer vector for Vaccinia (Mackett 1984) pBSLK1 Bcl1-EBamH1 fragment of pGS2O with the Vaccinia promoter P7.5 inside Bcll-BamHl Identical to PIP75 but inside pBSLK2 pBSLK1 40-mer synthetic DNA with the Vaccinia promoter P11 inside Bgl2-BamHI Identical to piPil but inside pBSLK2 Identical to piPli but inside Xho2-BamHI of pACYC184 pBSPlus with LacZ in a Bql2-BamH1 cassette p2P75J Bq12-BamHl cassette with LacZ in Bcij2-BamH1, Identical to p75Lac but in p2!Pll pACYC184 Pli-Lac cassette in a Bql2- Hind3 fragment of pilLac in Xho2-Hind3 for CNP pUCiB with the Y4"coRI TIR-L fragment of CNP. The fragment which separates the BamHl sites of the pUC18 linker of the CN~P BamHl wits deleted.

Insertion of a BamHl into pTIR1, between ORFi and ORF2.

p751ac pilLac pACP1 iT ac Transfer vectors pTIR1 pTIRB1 Replacement of the Sphl site by an Nsil site;

-L

57 plTIRB2 pTIRBlD Transfer vectors Identical to pTIRB1 but between ORF2 and ORF3.

Identical to pTIRB1, but deletion of the EcoRl-Hpal fragment.

with LacZ pTIRB1 P75-Lac cassette of p75Lac in a pli2-BamHl fragment cloned into BamHl.

As above but inside pTIRB2 As above but in the opposite orienitation pTIRB1 Pli-Lac cassette of plILac in a Bql2-BamHl fragment cloned into BamHl As above but in the opposite orientat ion As above but inside pTIFB2 pTIRB2P75Lac pTIRB2LacP75 e. *0 0 9 9* 9 9* .9 9.

0 p *9 9 C 0 pTIRBlP11Lac pTIRB1LacP1 1 pTIRB2LacP1 1 *9 0 .a *0 *9* 9 *9*9

C

p..

9* 0 Plasmids which carry the E2 of IBV p75M41 E2 gene of the serotype M41, cloned downstream of 20 p75D1466 As above but of the serotype D1466 p75D207 As above but of the serotype D207/D274 Transfer vectors with the E2 of IBV pTIRB1P75M41Lac P7.5-E2 cassettes of M41 and Pil-Lac cloned into the BamHl site of TIRBi.

25 pTIRB1P75D1466Lac As above but E2 of D1466.

pTIRB1P75D2O7Lac As above but E2 of D207/D274.

Plasmids which carry the TA4 of Eimeria pTA4 06 pTA4 10 p7 5TA4 06 p7 5TA4 10 pTIRTA406 cDNA of the TA4 antigen of Eimeria tenella cloned into a BamHl cassette As above but the proteolytic site is different TA406 gene cloned downstream of As above but TA410 gene P7.5-TA406 cassette cloned into BamHl of pTIRB1D As above but P7.5-TA41O cassette with the TA4 of Eimeria pTIRTA4 10 Transfer vectors pTIRTA406Lac pTIRA4 06LacPlLac cassette cloned into pTIRTA4O6 e -L -JA -V r- -iL-i- The 3 plasmids pACEDGARi, pACEDGAR2 and pACEDGAR3 therefore enable ORFI, ORF1-ORF2 and ORF1-ORF2-ORF3,

I

58 pTIRTA4 lOLac Plasmids for the pBS IBDVO pBSIBDVOb pBSlA2 9* 99 .9 9 9 9 *9 9* 0 9 *9 9 0 *099 a 9 pBS1B pEDGAR3 4i 0 *0 pEDGARM34 1 pBS3A 20 pBS3B pEDGAR12 As above but inside pTIRTA41O cloning of IBDV pBSPlus (Pstl-Hinc2), this work 277-bp Pstl fragment of the fragment EDGAR 0-lb obtained by PCR.

Derived from pBSIBDV0 by site-directed mutagenesis pBSLKl (Pst1 T4 DNA polymerase, Sadl) 760-bp Sadl fragment of the fragment EDGAR 1-2 obtained by PCR.

pBSLKl (Pstl T4 DNA polymerase, Sac]) 369-bp Sadl fragment of the fragment EDGAR 1-2 obtained by PCR.

pBSLKl (Pstl T4 DNA polymerase, Hinc2) 670-bp EDGAR 3-4 fragment obtained by PCR.

Derived from pEDGAR34i by site-directed mutagenesis pBSLK1 (Pstl T4 DNA polymerase, Sphl) 956-bp Sphl fragment of the fragment EDGAR 5-6 obtained~ by PCR.

pBSLK1 (Pstl T4 DNA polymerase, Sphl) 345-bp Sphl fragment of the fragment EDGAR 5-6 obtained by PCR.

pBS1A2 (EcoRi T4 DNA polymerase, Sadl) pBS1B fragment (Sphl T4 DNA polymerase, Sadl) Derived from pEDGAR12 by site-directed n'utagenesis Insert, 'on of the Bcll-Sphl fragment of pEDGARM12 into the Bcll-Sphl sitet of pACYC 1841 pBS3A (Hinc2-Pstl) Hinc2-Pstl fragment of pEDGAR341 pACEDGARM12 (Sphl\) T4 DNA polymerase, BamHl) pEDGARM34i fragment (Nsil T4 DNA polymerase, BamF!1) pE DGARM 12 pACEDGAR1412 pEDGAR4 5 pACEDGAR14 Ijj cdnu u.r wnicn are prer', nt inside the plasmid pTIRBl.

if ltA Ii

II

iv rJ~ 59 pACEDGARl4 (Bamill T4 DNA polymerase, Sall) pEDGAR45 fragment (Pvu2-Sall) pACEDGAR pACEDGARiS (Sphl-EcoRV) pBS3B fragment (Sphl-Pvu2) pACEDGAR2 Replacement of the Bcll-Rsr2 fragment of pACEDGARi by the Bcli,-Rsr2 fragment of pBSIBDVO pACEDGAR3 Identical to the Bcll-Rsr2 fragment of pBS IBDVOb Plasmids with IBDV and a Vaccinia promoter p.

p p p. p

Q.

p. *e p.

p *6WP p p p o p p..

p p.

p7 SEDGAR1 p7 5EDGAR2 15 p75EDGAR3 p1lEDGARi 20 p11EDGAR2 p1 1EDGAR3 Transfer vectors 25 pTIR75EDGAR1 pTIR7 5EDGAR2 pTIR7 5EDGAR3 pTIR1 lEDGARI pTIRl1EDGAR2 pTIRl 1EDGAR3 Transfer vectors Bcll-BamHl fragment of pACEDGARi inserted into the BamHl site of p2P75 Identical, to the Bcll-BamHl fragment of pACEDGAR2 Identical to the Bcll-BamHl fragment of pACEDGAR3 Bcll-BamHl fragment carrying P11 of pACPll inserted into the BamHl site of pACEDGARi As above but inside the plasmid pACEDGAR2 As above but inside the plasmid pACEDGAR3 with IBDV alone Bcll-BamHl fragment of p75EDGAR1 inserted into the BamHl site of pTIRB1 Identical to the plasmid p75EDGAR2 Identical to the plasmid p75EDGAR3 Identical to the plasmid plEDGARi Identical to the plasmid pl1EDGAR2 Identical to the plasmid plIEDGAR3 with IBDV and Lac Bgl2-BamHl fragment of pACP11LAC inserted into the BamHl site of pTIR7 SEDGARI Identical to the piasmid pTIR75EDGAR2 Bgl2-BamHl fragment of p.75LAC inserted into the BamHl site of pTIR11EDGAR1 pTIR7SE ILAC pTIR7 5E2LAC pTlRl1ElLAC

II

The notation of the recombinant viruses is:

IM

L I VI if: ii

E

60 pTIR11E2LAC pTIR11E3LAC pTIR11VP2LAC Identical to the plasmid pTIR11EDGAR2 Identical to the plasmid pTIRi1EDGAR3 Xhol (T4 DNA polymerase)-Bgl2 fragment of pliEDGARi nloned into the PpuMl (T4 DNA polymerase)-Bgl2 sites of pTIRllElLAC a.

ei *a a

II

GSL

I

II

.w I recomibinant viruses inside the QT35 cells was compared.

-6

REFERENCES

-Bayliss Spies Shaw Peters Papageorgiou A., Mflller H. and Boursnell J. gen. Virology 71, 1303-1312 (1990).

-Becht MUller H. and MUller J. gen. Virology 69, 631-640 (1988).

-Bertholet R. Drillien, R. Wittek. 1985. Proc. Natl. Acad.

Sci. USA, 82:2096-2100.

-Campbell M.M. Binns, F.M. Tomley, N.E.G. Boursnell. 1989.

10 J. Gen. Virol., 70:145-154.

Cavanagh, D. 1983. J. Gen. Virol., 64:2577-2583.

Cavanagh, D. et al. 1988. Virus research, 11:141-150.

Chang, A.C.Y. et Cohen, S.N. 1978. J. Bacteriol. 134:1141-1156.

0 Cho Avian Diseases vol. 25, no 4, 839-84.6 (1981).

Cochran et al, 1985. J. of Virol., 54 30-37.

-Dobos Journal of Virology 32, 1046-1050 (1979).

Fahey.~ O'onl1.J. and Azad J e.Vrlg 6 1479-1488 (1985).

-Fahey Erny K. and Crooks J. gen. Virology 1473-1481 (1989).

Hanggl et al, 1986. EMBO Journal, 5 1071-1076.

Hudson McKern Power B.E. and Azad Nucleic acids research 14, 5001-5012 (1986).

-Jagadish Staton Hudson P.J. and Azad A.A., J. Virology 62, 1084-1087 (1988).

-Kieny et alt 1988. Protein engineering, 2 (3)%219-225.

-Kusters, J.G. et al. 1987. J. Gen. Virol. 68:343-352.

-Mackett et alt 1984. J. of virol., 49 857-864.

-Mackett et al, 1985. DNA cloning. A practical approach, Vol. 2, 191-211.

-Maniatis, T.p E.F. Fritisch, and J. Samnbrook. 1982. Molecular cloning a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

Messing, 3. 1983. Methods Enzymol. 101:20-78.

i- rigure 12A: the protein VP3 is expressed in all the recombinants (Vii, V12, V14, V15 and V16), which contain at least the sequence enc,-Aing the polyprotein (ORFI, VP2-VP4-VP3 proteins), but not in the recombinant -62- Moss, B. 1990. Annu. Rev. Biochem. 59:661-88.

MUller H. and Becht HI., 1982. journal of Virology 44 384-392 Spehner et all,go)9. j. of Virol., 64:527-533.

Spies Hillier H. and Becht Nucleic acids research 17, 7982 (1989).

Shuman et al, 1989. Virology, 170:302-306.

Tomley et al, 1988. J. Gen. Viral., 69, 1025-1040.

Venkatesan et al, 1981. Cell, 125, 805-813.

_Van Den Berg, Gonze et Meulemans, 1991. Avian PathologyP 133-143 *04 63 List of organisms Namie Characteristics 1. E. COLI BACTERIA MC1061 araD139, (ara, leu)7697, lacX74, galU, galK, hsdR, strA (Pharmacia) JM1110 Used for its dam- phenotype (N3837dam4) e* f• 0 o°•eo o«e o II 2. CNP VIRUS

LVCO

CNP

V3 V4 15 V5 V8 V9 V10 Standard Fowlpox challenge strain of the

USDA.

Fowlpox vaccinal strain (SOLVAY) Recombinant CNP virus with the cassette in TIRB1 Identical to V3, but the cassette is in TIRB2 Identical to V4, but the cassette is in the opposite orientation Identical to V3, but the cassette is Pll-Lac Identical to VS, but the cassette is in the opposite orientation Identical to V9, but the cassette is in TIRB2 EDGAR strain, American isolate from S.A.

EDGAR, Auburn University, propagated 3 times on chicken and once on embryonic eggs. USDA standard challenge.

Pathogenic strain described by Van Den Berg et al., 1991.

Strain adapted to CEF cells.

Vaccinal strain adapted to QT35 cells.

Quail cell line.

Chicken embryo fibroblasta 3. IBDV VIRUS

EDGAR

849VB PBG98 Bursine2 4. CELLS

CEF

(MUller et al., 1982).

7- 64 CNP/IBD VIRUS Vii Carries V12 Carries V14 Carries V15 Carries V16 Carries V17 Carries the cassettes the cassettes the cassettes the cassettes the cassettes the cassettes P1lLac and P7.5E1 PilLac and P7.5E2 P7.5E1 and PlILac P7.5E2 and PllLac P7.5E3 anbd PlILac P7.5VP2 and P11Lac 6. CNP/TA4 VIRUS V21 Carries the cassettes PilLac and P7.STA41O i 4 *0 0 0* 4 9C r 4 0 000*r 09 04 004 0w 9 *4~ 0*) 04 *r 9 'Ai L l ~I The chicks are killed by euthanasia 20 days, later.

I

'7 65 LIST AND SEQUENCES OF THE PR~IMERS Number Sequence from 5' to 3' Complementary 5169 5168 3254 1871 IBDV16 IBDV1b IBDV3 IBDV22 CCTTTACTGTTAGTTCTACAATCGAAATTATGC 3' CATGTAGATTTTAATCCGTTAACACGCGCAG 3' GCCGGAAAACCTACCGGATTGATGG 3' GAAACCAGGCAAAGCGCC 3' CCAGGGTGTCGTCCGGAATGG 3' CCCAAGATCATATGATGTGGGTAAGCTGAGG 3' TGAGCAACTTCGAGCTGATCCCAAATCCTG 3' CTGCTCTTGACTGCGATGGAG 3'

FPV

FPV

L~ac Lac

IBDV

IBDV

IBDV

I BDV *9 49 9 9 9 .9 9* 99 09 99 9 9 4 99 9 9 *,99 4 99.999 9 4. 9 9 99 4**4 9* *9 9 9*9 9 9 99 94 9 999 9 9944 9.99 *99 4 9 9, 99 9 999 9 9 .9.94.

9 9

Claims (16)

1. Recombinant Avipox virus delrived from an attenuated strain of Avipox virus and containing, in a nonessential part of its genome, at least one DNA sequence encoding all or part of a protein which ij heterologous with respect to the Avipox virus as well as the elements capable of ensuring the expression of this protein inside a cell infected by the said recombinant virus, wherein the nonessential part of the genome is composed of a noncoding intergenic region situated between two open reading frames (ORF) including their expression signals, said intergenic region having a sequence of more than 60 nucleotides and being situated inside one of the two TIR regions of the virus.

2. Virus according to claim 1, derived from an attenuated strain of Fowlpox virus. S3. Virus according to claim 1 or claim 2, wherein at ,least one DNA sequence is cloned into the two TIR regions l ih rof the virus.

4. Virus according to any one of claims 1 to 3, wherein the intergenic region is the region, termed region 31, situated between the nucleotides 1675 and 2165, taking as starting nucleotide the BamHl restriction site present Sinside the TIRs. S 25 5. Virus according to any one of claims 1 to 3, Swherein the intergenic region is the region, termed region ~382, situated between the nucleotides 2672 and 3605, taking as starting nucleotide the BamHl restriction site present «i inside the TIRs.

6. Virus according to claim 4 and 5, characterised in that a DNA sequence is cloned into the 1l region, inside each of the two TIRs,

7. Virus according to any one of claims 1 to 6, wherein the heterologous protein is chosen from the antigens of thL& infectious bursaI disease virus (IBDV), the infectious bronchitis virus (IBV), the virus responsible for chicken anaemia (CAV), the protozoa Eimeria which is responsible for coccidiosis, the PLi Newcastle disease virus (NDV) and the Maek's disease twrl1t L.L^ ecsl ieaevrs(D)adth ae' ies ii uays .aTer, mnat ,Ls to say 32 days atter the vaccination, the control animals of the group V8 and those which survived the challenge, are killed by 'I U 1 -67- virus (MDV).

8. Virus according to claim 7, wherein the heterologous protein is chosen from the antigens of the infectious bursal disease virus (IBDV), the infectious bronchitis virus (IBV), the virus responsible for chicken anaemia (CAV) and the protozoa Eimeria.

9. Virus according to claim 8, wherein the heterologous protein is chosen from all or part of the open reading frames comprising polyprotein and parts of polyprotein for IBDV, the antigen E2 for IBV, the surface antigen TA4 for Eimeria and the protein P50 for CAV. Virus according to claim 9, wherein the heterologous protein is part of the polyprotein containing the amino acids 1 to 493 followed by the amino acids 1010 to 1012.

11. Culture of eukaryotic cells which are infected with a recombinant Avipox virus according to any one of claims 1 to

12. Culture of cells according to claim 11, which 20 relates to fowl cells.

13. Vaccine containing an Avipox virus according to any one of claims 1 to

14. Use of an Avipox virus according to any one of claims 1 to 10 as a vector which is capable of expressing 25 all or part of a protein which is heterologous with •respect to the virus.

15. Virus according to any one of claims 1 to wherein said at least one DNA sequence is insertc& into the non-essential part of the genome by means of a 30 transfer sequence.

16. Virus according to claim 15, wherein said transfer sequence is contained in a p:tA'mid.

17. A virus according to claim 1 substantially as hereinbefore described with reference to the examples.

18. A culture of eukaryotic cells according to claim 11 substantially as hereinbefore described with reference to example *L'l1 ratio (weight of the bursas/total weight) X 100 is as -follows: for unchallenged V8, a ratio of 0.68 0.13), for challenged V8, a ratio of 0.09 0.01), for V14, a ratio of 0.10 A 1~ ViV *1 -68-

19. A vaccine according to claim 13 substantially as hereinbefore described with reference to example 16. DATED: 16 November 1994 PHILLIPS ORMONDE FITZPATRICK Attorneys for: SOLVAY (SOCIETE ANONYME) 5619m o e1 0 *9 9* *9 9 9 9 9 9* 9 9 99*< 9 9 9* o *e ABSTRACT Recombinant Avipox virus, the culture of cells infect'ed with this virus and vaccines for poultry derived from this virus The invention relates to a recombinant Avipox virus derived from an attenuated strain of Avipox virus and containing, in a nonessential part of its genome, at least one DNA sequence encoding all or part of a protein which is heterologous with respect to the Avipox virus, the nonessential part of the genome being composed of an intergenic region of the TIRs (terminal inverted repeat region). The invention also relates to the culture of I cells which are infected with this virus, to the vaccines containing this recombinant Avipox virus and to the use of this virus as a vector capable of expressing all or part of a protein which is heterologous with respect to the virus. Figure 7. ioii i< i:i