AU5718500A - Modified mammary specific promoter - Google Patents

Description

WO 01/00860 PCT/NZ00/00109 MODIFIED MAMMARY SPECIFIC PROMOTER TECHNICAL FIELD This invention relates to mammary specific promoters, particularly, although by no means exclusively to the a-lactalbumin promoter and to a means by which to enhance the frequency of expression of gene constructs in non-human mammals. BACKGROUND ART Over-expression of exogenous or endogenous genes in the lactating mammary gland using transgenes has several applications: use of the mammary gland as a bioreactor to produce pharmaceuticals (Colman, 1996), improvement of nutritional and/or technological properties of milk (Clark, 1996, Mercier and Vilotte, 1997), derivation of animal models for mammary carcinogenesis (Cardiff, 1996). Most constructs contain controlling regions from mammary-specific promoters derived from genes encoding the major milk proteins. Despite some success, a potential drawback of such experiments resides in the rather unpredictable behaviour of transgenes in terms of frequency of expressing lines, level and tissue-specificity of expression. It reflects our relatively poor knowledge of the cis-regulatory elements that control the activity of such promoters (Popov, 1996). Some of these elements are common to milk protein genes which share the same tissue-specificity, others confer differential expression during gestation and after weaning and heterogenous expression during lactation (Nakhasi and Qasba, 1979, Moleenar et al, 1992, Robinson et al, 1995).

WO 01/00860 PCT/NZ00/00109 Complex transcriptional regulation of the major milk protein-encoding genes involves multi-hormonal control, cell-cell and cell-extracellular matrix interactions (Popov, 1996 for review). Involvement of the cytokine prolactin in growth and differentiation of the mammary gland has been known for a long time. More recently, it has been demonstrated that one transducer of the prolactin signal involved, at least in vitro, in the transcriptional activation of several milk protein genes is STAT5 (Groner and Gouilleux, 1995, Hennighausen et al, 1997 for review). This latent cytoplasmic transcription factor can be activated by several cytokines and growth factors through its phosphorylation by Janus kinases. It then forms homo or heterodimers that translocate to the nucleus and interact with specific response elements. Identification of its recognition site came from DNA binding studies performed with nuclear extracts from mammary tissue or HC1 mouse mammary cells (Watson et al, 1991, Schmitt-Ney et al, 1991). STAT5 is one of a family of transcription factors which have been shown to be activated by cytokines and comprise a group of DNA binding proteins generically termed "Signal Transducers and Activation of Transcription" (STATs). The general sequence of the STAT binding proteins is disclosed in US 5,814,517 and US 5,712,094 as TTNxAA wherein as the number of spacer nucleotides (Nx) varies, different members of the STAT protein family are bound. Actual sequences for the STAT 1 and STAT 3 binding sites are disclosed in these patents and in US 5,707,803, as well as DNA constructs whereby the STAT binding sites are inserted upstream of and operably linked to a promoter which in turn is operably linked to a heterologous gene under the transcriptional control of the promoter. These patents 2 WO 01/00860 PCT/NZ00/00109 disclose in vitro methods of measuring the ability of compounds to act as agonists of cytokine mediated gene transcription. Hormonal induction of the rat -casein gene in mammary epithelial HC 11 cells (Schmitt-Ney et al, 1991), sheep P-lactoglobulin and rabbit ol-casein genes co transfected in CHO K1 cells with a prolactin receptor cDNA (Lesueur et al, 1990, Jolivet et al, 1996), revealed the occurrence within these promoters of composite prolactin-dependent enhancers that contain a combination of potential regulatory factor binding sites including at least one STAT5-binding site. Such enhancers were found either close to the transcriptional initiation site (around-100bp), in sheep P3-lactoglobulin and rat -casein genes, or several kb away from it in bovine -casein (bcel element) or rabbits 41 genes (Schmidhauser et al, 1992, Jolivet et al, 1996, Rosen et al, 1996 for review). The STAT5-binding site was shown to be essential for prolactin inducibility in cultured cells (Schmitt-Ney et al, 1991, Demmer et al, 1995, Jolivet et al, 1996). Functional significance of this binding site for gene regulation in lactating mammary gland remains unclear as its mutangenesis did not affect the tissue-specificity and only deletions of more distal STAT5-binding sites lower transgene level of expression (Burdon et al, 1994). However, studies on the developmental regulation of sheep P-lactoglobulin gene in transgenic mice revealed appearance of hypersensitive sites within the promoter region that encompass STAT5 sites at midgestation, concomitantly with its transcriptional activation (Whitelaw, 1996). At this stage of mammary development, it was hypothesized that placental lactogens are the major lactogenic influence (Whitelaw, 1996). 3 WO 01/00860 PCT/NZ00/00109 Promoters of known a-lactalbumin (xlac) genes share a potential STAT5 binding site at -270bp and an incomplete one at -70bp (Vilotte and Soulier, 1992) but are not inducible by prolactin in vitro (unpublished observations). It would be desirable to provide a prolactin inducible u-lactalbumin promoter for use in recombinant DNA technology for the production of heterologous proteins in mammalian milk and cells in culture. It is an object of the present invention to go some way towards achieving this desideratum or at least to provide the public with a useful choice. DISCLOSURE OF THE INVENTION According to one aspect of the present invention there is provided an isolated DNA molecule including a mammary specific promoter which has been modified by the insertion of at least one complete STAT5 binding site, the modified promoter providing enhanced frequency of expression of a heterologous gene to which it may be operably linked. Preferably the insertion of a complete STAT5 binding site into the mammary specific promoter confers prolactin inducibility to said promoter. Preferably, said mammary specific promoter is selected from the group including the a-casein promoter, the K-casein promoter, the lactoferrin promoter, and 4 WO 01/00860 PCT/NZ00/00109 the whey acid protein promoter and, the cx-lactalbumin promoter. Most preferably the mammary specific promoter is the oa-lactalbumin promoter. In a second aspect the invention provides a DNA molecule including a prolactin inducible -lactalbumin promoter which has the sequence set out in Figure 1, or a variant thereof having substantially equivalent transcriptional activity thereto. Preferably the DNA molecule includes at least two complete STAT5 binding sites. This may be accomplished by the insertion of a single complete STAT5 site if the native promoter already contains at least one complete STAT5 site, or it may be accomplished by the insertion of two complete STAT5 binding sites where the native promoter does not contain a complete STAT5 site. In a further aspect, the present invention provides an isolated DNA construct including the DNA molecule of the invention operably linked to a heterologous gene. Preferably the DNA molecule is cDNA. In another aspect of the present invention there is provided a pharmaceutically active protein produced by the methods discussed herein. Also provided by the present invention are recombinant expression vectors which contain the DNA molecule of the invention, and/or, the DNA construct of the invention, and 5 WO 01/00860 PCTINZ00/00109 hosts transformed with the vector of the invention capable of prolactin induction of the DNA molecule and/or prolactin inducible expression of the heterologous gene of the DNA construct. In a further aspect, the present invention provides an inducible expression system including: (a) host cells transformed with the DNA construct of the present invention; and (b) prolactin. In a still further aspect, the present invention provides a method of producing a heterologous polypeptide or peptide including the steps of: (a) culturing a host cell which has been transformed or transfected with a vector containing the DNA construct as defined above to express the heterologous polypeptide or peptide encoded by the heterologous gene; and (b) recovering the expressed polypeptide or peptide. In a still further aspect, the present invention provides non-human transgenic mammal that expresses a heterologous polypeptide or peptide in their milk, said non-human mammals having been transfected with the DNA constructs of the present invention. 6 WO 01/00860 PCTINZ00/00109 In a still further aspect, the present invention provides a method of producing non-human animal milk containing a heterologous polypeptide or peptide including the steps: (a) producing milk in the mammary gland of an adult transgenic, non human mammal whose somatic and/or germ cells include a DNA construct of the invention, wherein said construct is expressed in the mammary gland of said mammal and the heterologous polypeptide or peptide is produced in the milk; and (b) collecting the milk produced in step (a); and (c) optionally purifying the heterologous polypeptide or peptide. In further aspects, the present invention provides methods of assaying samples for the presence of a heterologous polypeptide or peptide, test kits suitable for use in such assays; test kits including the inducible expression system of the invention, and compositions and agents useful in such systems. While the invention is broadly as defined above, it will be appreciated by those persons skilled in the art that it is not limited thereto and that it also includes embodiments of which the following description gives examples. BRIEF DESCRIPTION OF THE DRAWINGS In particular, preferred aspects of the invention will be described in relation to the accompanying drawings in which: Figure 1: represents the nucleotide sequences of the 7 WO 01/00860 PCTINZ00/00109 (a) wild type and (b) modulated -lactalbumin promoter and containing a complete STAT5 binding site TTCNNNGAA (9bp). Figure 2: is a schematic diagram depicting the DNA constructs of the invention. White box: murine a-lac 560 bp 5'-flanking and 23 bp exon 1 sequence. Grey box: 800 bp CAT cDNA. Black box: 200 bp IE gene-5 terminator fragment from the HSV-2 genome. The proximal sequence around position -70 bp of the murine ao-lac promoter and the derived forms mimicking the STAT5 site of rat 3-casein and interferon (IFN) regulatory (Reg.) factor 1 genes are indicated. Potential STAT5 binding sites are underlined. Bold-face nt: conserved nt between known w-lac promoters from different species. Xh: XhoI, E: EcoRI, S: SacI, Xb: Xbal. Figure 3: shows the transcriptional activity and prolactin-inducibility of the constructs of Figure 2 in CHO and HC ll cells. CAT activity was measured according to Bignon et al, (1993). Cell extracts were standardized for -galactosidasc activity. 8 WO 01/00860 PCT/NZ00/00109 Arbitrary scale values are given. Inducibility: prolactin induction ration (-fold). Nb. Exp.: numbers of experiments performed Mac, alac/MGF and (lac/GAS refer to the wild type lac promoter and the derived constructs described in Fig. 2. Placto: Plactoglobulin. Figure 4: shows transgene tissue specificity of expression in lactating female (lac/MGF/CAT 41. CAT assays were performed with 100 pg of protein sample, according to Gorman et al (1982), with a reaction incubation time of 15 h. Mam: mammary. Sal.: Salivary. DETAILED DESCRIPTION OF THE INVENTION The present invention provides an isolated DNA molecule including a mammary specific promoter which has been modified by the insertion of at least one complete STAT5 binding site, said modified promoter capable of providing enhanced frequency of expression of a heterologous gene to which it may be operably linked. Preferably, said mammary specific promoter is selected from the group comprising the c-casein promoter, the a-casein promoter, the lactoferrin promoter, the whey acid protein promoter and the oa-lactalbumin promoter. Most preferably, the mammary specific promoter is the a-lactalbumin promoter. 9 WO 01/00860 PCT/NZ00/00109 The insertion of a complete STAT5 binding site confers prolactin inducibility to the promoters which were otherwise not prolactin inducible and in additon, confers the ability of these promoters to provide enhanced frequency of expression of a heterologous gene to which they may be operably linked when compared to the umodified native promoters. The present invention further provides an isolated DNA molecule comprising a prolactin inducible -lactalbumin promoter which has the sequence set out in Figure 1, or a variant thereof having substantially equivalent transcriptional activity thereof. The term "variant" as used herein refers to a DNA molecule wherein the nucleotide sequence is substantially identical to the nucleotide sequence set out in Figure 1. The variant may be arrived at by modification of the nucleotide sequence of the DNA molecule by such modifications as insertion, substitution or deletion of one or more nucleic acids of such modifications comprising neutral mutations which do not affect the functioning of the DNA molecule. The term "substantial sequence identity" means that two nucleotide sequences, when optimally aligned, such as by the programs Clustal W using default gap weights, share at least 60 per cent sequence identity, preferably at least 80 per cent sequence identity, more preferably at least 90 per cent sequence identity and most preferably at least 95 percent sequence identity or more. The DNA molecule of the present invention includes a native mammary specific promoter, preferably the u-lactalbumin promoter, which has been modified by site 10 WO 01/00860 PCTINZ00/00109 directed mutagenesis to create a complete proximal STAT5 binding site within the promoter sequence per se, essentially by reproducing the STAT5 binding site sequence present in rat P-casein or interferon regulatory factor (IRFl) promoters. Preferably the modified mammary specific promoter of the present invention comprises at least two complete STAT5 binding sites. Where the mammary specific promoter already comprises a complete STAT5 binding site, the present invention inserts a second complete STAT5 binding site therein, and where the mammary specific promoter does not contain a complete STAT5 binding site, at least two complete STAT5 binding sites are inserted therein. Insertion of a complete STAT5 site into a native mammary specific promoter confers prolactin inducibility of said promoter and confers the ability to provide enhanced frequency of expression of a heterologous gene to which said modified promoter. In a preferred embodiment of the present invention the DNA molecule of the present invention includes or consists of the nucleotide sequence of a non-human mammalian cx-lactalbumin promoter having inserted therein a STAT5 binding site of the rat -casein promoter, ie GAS oligonucleotide: CTCATTTCGGGGAAATCATTGA; or the IRF1 promoter, ie, MGF oligonucleotide: CTTAATTCCAAGAAGTCAATGA. The reader will appreciate that modifications of the DNA molecules of the invention are possible. The production of DNA fragments is also well within the capabilities of a skilled worker. 11 WO 01/00860 PCTINZ00/00109 The DNA molecules of the present invention can be prepared in a variety of ways. For example, they can be produced by isolation from natural source and site directed mutagenesis, by synthesis using only suitable known techniques or through employing recombinant DNA techniques. The variants of the DNA molecule can similarly be made by any of those techniques known in the art. For example, variants can be prepared by site-specific mutagenesis of the DNA sequence as described by Adelman et al. DNA 2: 183 (1983). The DNA molecule may include a native oa-lactalbumin promoter subsequently modified to create a complete STAT5 binding site. The a-lactalbumin promoter can be isolated from any appropriate natural source or can be produced in the form of a synthetic oligonucleotide where the size of the active fragment to be produced permits. By way of example, the Triester method of Matteucci et al, J. Am. Chem. Soc. Vol 103: 3185-3191 (1981) maybe employed. In a further aspect, the present invention consists in a DNA construct including the DNA molecule of the invention, ie the modified mammary specific promoter, preferably the modified a-lactalbumin promoter, operably linked to a heterologous gene such that the heterologous gene is under the transcriptional control of the modified mammary specific, preferably u-lactalbumin, promoter. The modified mammary specific promoters of the invention are prolactin inducible. The constructs may include a modified non-human mammalian a-lactalbumin promoter with a STAT5 site such as a GAS or MGF STAT5 site, therein operably 12 WO 01/00860 PCT/NZ00/00109 linked to a heterologous gene of interest, which may include human insulin, human P-interferon, human growth hormone, human serum albumin, follicle stimulating hormone, humanised monoclonal antibodies. Preferably the non-human mammalian promoter is the bovine promoter. In a further aspect, the present invention consists in replicable transfer vectors suitable for use in the expression of the DNA constructs of the invention to produce a heterologous protein. These vectors may be constructed according to techniques well known in the art, or may be selected from the cloning vectors available in the art. The cloning vector may be selected according to the host or host cell to be used. Useful vectors will generally have the following characteristics: (a) the ability to self-replicate; (b) the possession of a single target or any particular restriction endonuclease; and (c) desirably, carry genes for a readily selectable marker such as antibiotic resistance. Two major types of vectors possessing these characteristics are plasmids and bacterial viruses (bacterophages or phages). Presently preferred vectors include plasmids pUC 19, pBluescript, pSport and pGem. 13 WO 01/00860 PCT/NZ00/00109 Generally, prokaryotic, yeast, insect or mammalian cells are useful hosts. Also included within the term hosts are plasmid vectors. Suitable prokaryotic hosts include E.coli; Bacillus species and various species of Pseuobmonas. Similarly, vectors for use in mammalian cells are also well known. Such vectors include well known derivatives of SV-40, adenovirus, retrovirus-derived DNA sequences, Herpes simplex viruses, and vectors derived from a combination of plasmid and phage DNA. Further eukaryotic expression vectors are known in the art (e.g. P.J. Southern and P.Berg, J. Mol. Apple. Genet. 1 327-341 (1982); S. Subramani et al., Mol.Cell.Biol. 1, 854-864 (1981); R J. Kaufmann and P.A. Sharp, "Amplification and Expression of Sequences Cotransfected with a Modular Dihydrofolate Reducase Complementary DNA Gene, J. Mol. Biol. 159, 601-621 (1982); R J. Kaufmann and P.A. Sharp, Mol.Cell.Biol. 159, 601-664(1982); S.I. Scahill et al., "Expressions And Characterization Of The Product Of A Human Immune Interferon DNA Gene In Chinese Hamster Ovary Cells," Proc. Natl. Acad. Sci. USA. 80, 4654-4659 (1983); G. Urlaub and L.A. Chasin, Proc. Natl. Acad. Sci. USA. 77, 4216-4220, (1980). In the construction of a vector it is an advantage to be able to distinguish the vector incorporating the foreign DNA from unmodified vectors by a convenient and rapid assay. Reporter systems useful in such assays include reporter genes, and other detectable labels which produce measurable colour changes, antibiotic resistance and the like. In one preferred vector, the P-galactosidase reporter gene is used, which gene is detectable by clones exhibiting a blue phenotype on X-gal plates. 14 WO 01/00860 PCT/NZ00/00109 This facilitates selection. In one embodiment, the P3-galactosidase gene may be replaced by a polyhedron-encoding gene; which gene is detectable by clones exhibiting a white phenotype when stained with X-gal. This blue-white colour selection can serve as a useful marker for detecting recombinant vectors. Once selected, the vectors may be isolated from the culture using routine procedures such as freeze-thaw extraction followed by purification. For expression, vectors containing the DNA molecule of the invention containing the heterologous gene to be expressed and control are inserted or transformed into a host or host cell. Some useful expression host cells include well-known prokaryotic and eukaryotic cells. Some suitable prokaryotic hosts include, for example, E.coli, such as E. coli, S G-936, E. coli HB 101, E. coli W3110, E.coli X1776, E. coli, X2282, E. coli, DHT, and E. coli, MR01, Pseudomonas, Bacillus, such as Bacillus subtilis, and Streptomyces. Suitable eukaryotic cells include yeast and other fungi, insect, animal cells, such as COS cells and CHO cells, human cells and plant cells in tissue culture. Most preferred host cells are mammary cells CHO K1 and HC 11 cells. Depending on the host used, transformation is performed according to standard techniques appropriate to such cells. For prokaryotes or other cells that contain substantial cell walls, the calcium treatment process (Cohen, S N Proceedings, National Academy of Science, USA 69 2110 (1972)) may be employed. For mammalian cells without such cell walls the calcium phosphate precipitation method of Graeme and Van Der Eb, Virology 52:546 (1978) or liposome-mediated 15 WO 01/00860 PCTINZ00/00109 methodology is preferred. Transformations into plants may be carried out using Agrobacterium tumefaciens (Shaw et al., Gene 23:315 (1983) or into yeast according to the method of Van Solingen et al. J.Bact. 130: 946 (1977) and Hsiao et al. Proceedings, National Academy of Science, 76: 3829 (1979). Upon transformation of the selected host with an appropriate vector the heterologous polypeptide or peptide encoded can be produced, often in the form of fusion protein, by culturing the host cells. The heterologous polypeptide or peptide produced by the methods of the invention may be detected by rapid assays as indicated above. The heterologous polypeptide or peptide is then recovered and purified as necessary. Recovery and purification can be achieved using any of those procedures known in the art, for example by absorption onto and elution from an anion exchange resin. This method of producing a heterologous polypeptide or peptide of the invention constitutes a further aspect of the present invention. Host cells transformed with the vectors of the invention also form a further aspect of the present invention. Prolactin-responsive expression of heterologous genes is possible using an inducible expression system. In such cases, the prolactin gene may be co transfected with a recombinant construct comprising a desired gene for expression operably linked to the prolactin-responsive mammary specific promoter of the invention, more preferably the modified a-lactalbumin promoter. In this use, a single inducible expression system will typically include a combination of (1) a prolactin inducible c-lactalbumin promoter of the invention; (2) a desired gene for expression, operably linked to the prolactin-inducible a-lactalbumin promoter; and 16 WO 01/00860 PCT/NZ00/00109 (3) prolactin which can bind to the STAT5 site of the prolactin inducible X lactalbumin promoter; and, if required (4) a long-form prolactin receptor gene. Usually, this system will be within a cell, but an in vitro system is also possible. The prolactin may be added exogenously or it may be provided by expression of a nucleic acid encoding it, though it need not be expressed at particularly high levels. Such a prolactin-inducible expression system could be useful in human gene therapy where the expression of a particular gene of interest could be controlled in a temporal fashion by administering prolactin to an affected individual whose cells have previously been transformed to include an expression system as detailed above. The cells of affected individual can be easily transformed with viral vectors or plasmid vectors carrying this inducible expression system. In addition, this prolactin-inducible expression system could be useful for the production of large amounts of protein in the milk of non-human mammals, preferably in the milk of transgenic non-human mammals, whereby the modified mammary specific promoter, preferably the modified oa-lactalbumin promoter of the invention would be induced naturally by endogenous prolactin in mid pregnancy and through lactation. Test kits including the inducible expression system of the invention also form a part of the present invention. The test kits may additionally comprise agents including for example, inducing agents, reagents suitable for use with such an expression system, buffers, diluents, standards and other agents known in the art which are commonly employed in such test kits. 17 WO 01/00860 PCT/NZ00/00109 The present invention further includes the production of a transgenic non-human mammal that expresses a heterologous polypeptide in its milk, said non-human mammal having been transfected with the DNA constructs of the present invention or wherein the DNA construct of the invention has been incorporated into the genome of the non-human mammal. Preferably, the transgenic mammal is a cow, sheep, goat, mouse, or rat, and the DNA construct includes the relevant corresponding modified prolactin inducible mammary gland promoter, preferably the modified prolactin inducible lactalbumin promoter eg bovine, ovine, murine etc. Transgenic non-human animals may be produced by injecting the DNA constructs of the invention into Fl eggs in accordance with known methods (Gordon et al, 1980). Any other methods known to a person skilled in the art may also be employed in the production of transgenic non-human mammals of the present invention. For example, transfection of somatic cells and embryo recostruction by nuclear transfer or sperm mediated transgenesis (Perry et al, 1999). In a further aspect the present invention provides a method of producing non human animal milk containing a heterologous polypeptide or peptide comprising the steps: (a) producing milk in the mammary gland of an adult transgenic, non human mammal whose cells include a DNA construct of the invention, where said construct is expressed in the mammary gland 18 WO 01/00860 PCT/NZ00/00109 of said mammal and the heterologous polypeptide or peptide is produced in the milk; (b) collecting the milk produced in stage (a); (c) optionally purifying the heterologous polypeptide or peptide; and (d) using the resulting product in pharmaceutical and/or nutraceutical products, industrial uses or a range of milk and/or meat products whether it be in their natural or processed state. Non-limiting examples illustrating the invention will now be provided. It will be appreciated that the above description is provided by way of example only and variations in both the materials and techniques used which are known to those persons skilled in the art are contemplated. PROTOCOL Site directed mutagenesis of murine promoter: Four oligos were used: alac 5'-end: GGGGATCCAAGTAGTAGTTG, alac 3' end: CTGCCCCGGGACCTTGTAAT, MGF: CTTAATTCCAAGAAGTCAATGA and GAS: CTCATTTCGGGGAAATCAATGA. Oligo calac 5'end encompassed the BamHI site located at 560 bp upstream from the murine Mlac transcriptional unit (GenBank M87863). Oligo alac 3'end is the reverse of nucleotides (nt) 570-590 of this gene and creates a Sinal site at nt 583 (nt 23 of alodac 5'UTR). Oligos MGF and GAS 19 WO 01/00860 PCT/NZ00/00109 encompass the STAT5 sites located at nt-93 of rat -casein (Schmitt-Ney et al, 1991) and -118 bp of IRF1 (Gilmour et al 1995) genes, respectively and nt from the region -81/-56 of the murine xlac promoter (Fig. 2). DNA from genomic ctlac clone 3 (Vilotte and Soulier, 1992) was used as a template for site directed mutagenesis using the polymerase-chain reaction (PCR) procedure of Landt et al (1990). Three BamHI/SmaI promoters were consequently created that all encompassed 560 bp of 5'-flanking sequence and 23 bp of 5'UTR: the wild-type murine Mlac promoter (using oligos clac 5' and 3'), the oIac/MGF promoter (using oligos clac 5' and MGF for the first PCR and olac 3' for the second) and the olac/GAS promoter (using oligos olac 5' and GAS for the first PCR and cdac 3' for the second). These three promoters were cloned into pUC 19 (using BamHI and SmaI restriction sites) and sequenced using the chain termination method (Sanger et al, 1977). The full sequence of the modified ca-lactalbumin promoter of the present invention is shown in Figure 1 Generation of constructs The three promoter sequences were released from the recombinant pUC plasmids by digestion with HincII and SmaI, gel purified and cloned into the HindII site of the promoterless pB9 CAT recombinant plasmid (Whitelaw et al, 1988). Orientation of the insert with regards to the CAT gene was determined by Xbal digestion, leading to the three constructs lac/CAT, lac/MGF/CAT and lac/GAS/CAT (Fig. 2). Cell cultures and transient expression analyses 20 WO 01/00860 PCT/NZ00/00109 CHO K1 cells were cultured, transfected and collected as previously described (Jolivet et al, 1996). 50 to 75% confluent HC11 cells in 6 cm dishes were transfected with 36 pg/dish of lipofectamine (Gibco-BRL), 3 pg of one of the CAT plasmids and 1 pg of pCH110, a plasmid encoding P-galactosidase (Pharmacia), diluted in 100 pl of optimem (Gibco-BRL). This mixture was added to the cells in 1 ml of optimem, left in contact for 4 hours (h) and replaced by 1xRPMI 1640 media plus 10% FCS for 24 h. Then media with insulin (Spg/ml), dexamethasone (1pM) and, if needed, prolactin (Spg/ml) was added for 48 h. Cells were then collected by scrapping. As a positive control for prolactin transcriptional stimulation, transfections were also performed using vector pBJ23, a plasmid that encompassed the CAT gene flanked by the sheep P-lactoglobulin promoter (Lesueur et al 1990). Cell extracts were prepared by five consecutive freeze-thaw cycles and centrifuged (15,000 x g/10min). Cell extracts were stored at 30 0 C 3-galactosidase and CAT activities were assessed according to Bignon et al (1993). Obtention and analysis of transgenic mice: Gel purified DNA inserts from the three different alac-CAT constructs were micro injected, transgenic mice identified by Southern blot and transgenic lines propagated as previously described (Vilotte et al, 1989). Tail-extracted mouse genomic DNAs were digested by PstI and the CAT cDNA was used as probe for Southern analyses. Expression analyses were performed on Gl or G2 mice heterozygous at the transgene locus. Collected tissues were homogenised in Tris. HC1 0.25M pH 7.4 using an ultra-turrax, heated at 65'C for 10 min and 21 WO 01/00860 PCTINZ00/00109 centrifuged at 15,000 x g for 10 min. Tissue extracts were kept frozen until used. Extract protein content was estimated following the Lowry procedure (Lowry et al, 1951). CAT assays were performed with constant protein content either according to Bignon et al (1993), with a reaction incubation time of 2 h, or according to Gorman et al (1982), with a reaction incubation time of 15 h. Non-transgenic mice tissue samples were used as negative controls. EXAMPLE 1 Prolactin induction in transfected CHO or HCII cells To assess the prolactin inducibility of the three constructs, ulac/CAT, clac/MGF/CAT and cdac/GAS/CAT, transient transfections studies were undertaken in CHO K1 and HC11 cells. The olac/CAT gene was found to be constitutively highly expressed in both cell types and not responsive to prolactin (Fig. 3), as previously observed using the 750 bp bovine odac promoter. On the contrary, introduction by site-directed mutagenesis of a genuine STAT5-binding site at -70 bp of the murine alac promoter resulted in the loss of constitutive activity and gain of prolactin-dependent transcriptional stimulation (Fig 3). The levels of inducibility of the two mutated promoters were even found to be higher than that of the ovine -lactoglobulin gene promoter used as a positive control (Fig. 3). These results confirmed the important role of a proximal STAT5 site for in vitro prolactin transcriptional inducibility of milk protein gene promoters, as has been previously reported for 3-lac and P-casein promoters (Schmitt-Ney et al, 1991) Demmer et al 1995). However, the loss of constitutive expression of the 22 WO 01/00860 PCTINZ00/00109 odac promoter was surprising. It could result either from the introduction within the mutated sequence of a negative transcription factor binding site or from the deletion of a positive regulatory element. In the former hypothesis, activation of STAT5 by prolactin probably mediates the relief of the negative factor binding, as described for YYl-binding to the rat 3-casein promoter (Meier and Groner, 1994). However, beside the STAT5 binding site, no other obvious potential regulatory elements were introduced in the mutated promoters. Although STAT5 was recently shown to be able to mediate transcriptional inhibition, it was independent from its binding activity and believed to occur via protein/protein interactions (Luo and Yu-Lee, 1997). Thus it is unlikely that STAT5 itself is involved in the observed lac inhibition. A putative GCCC NF1 half-site located in the wild-type promoter is mutated to ACCC in the MGF and GAS promoters. Alteration of such regulatory elements was shown to dramatically reduce the level of WAP gene expression in vivo (Li and Rosen, 1995). However, this sequence is specific to the murine promoter and not conserved in other lac genes, such as the bovine gene. Alternatively, the sequence TCTTCCT conserved among all the lac genes is also mutated in the GAS and MGF promoters. Although this element does not correspond to known consensus regulatory element, it may be recognized by a positive transcription factor. EXAMPLE 2 Generation of transgenic mice and frequency of transgene expression The three genes were injected into C57BL/6 x CBA Fl eggs (Table 1). With the exception of one sterile animal (clac/CAT 20), other founder mice that did not 23 WO 01/00860 PCTINZ00/00109 transmit were probably mosaic for the transgene (Whitelaw et al, 1993). Analysis of transgene expression was performed on the mammary gland of one Gl female from each established line using the method of Gorman et al (1982) at day 7 of lactation. Insertion of a STAT5 binding site around -70 bp within the murine clac 5' flanking region resulted in an apparent higher frequency of expression of the 560 bp promoter linked to the CAT reporter gene in transgenic mice: overall 11 out of 12 lines expressed the trangene compared to 3 out of 6 using the wild-type promoter (Table 1). The olac/MGF promoter was also successfully used to target expression of a different gene in the mammary gland of 3 out of the 4 lines created, suggesting that this high frequency may not be associated with a specific construct (unpublished data). Furthermore, since two different sets of mutations were successfully used that share the STAT5-binding site, it suggests that the difference in the transgene frequency of expression is directly associated with the insertion of this transcription factor regulatory element, although we cannot totally exclude that it results from the mutagenesis of another binding site present in the wild-type sequence. No correlation between the number of copies integrated and the level of expression for the three transgenes could be established. For the calac/CAT construct, it confirms previously reported data on the use in transgenic experiments of relatively short (several kb at most) lac promoters (Vilotte and L'Huillier, 1996 for review). Site-independent expression of an lac transgene has only recently been obtained using a large human YAC clone (Fujiwara et al, 1997). Insertion of a STAT5 binding site at -70 bp of the 560 bp murine promoter increased the frequency of 24 WO 01/00860 PCT/NZ00/00109 expression of the transgene to nearly 100% but did not result in a site independent expression. EXAMPLE 3 Tissue-specificity of transgene expression The two higher expressing line(s) obtained with each construct were chosen for further analysis of the tissue specificity and developmental regulation of transgene expression. For each line, CAT activity was measured in six tissues from two 7 day lactating females (mammary gland, liver, kidney, thymus, salivary gland and brain) and one male (testis, liver, kidney, thymus, salivary gland and brain), heterozygous at the transgene locus (Fig. 5, Tables II). In addition to the transgene expression in the lactating mammary gland, low levels of CAT activity (1-10% of mammary gland level), were detected in various tissues of male or female mice from several lines but lines carrying cdac/GAS/CAT construct (Fig. 5 and Table II). In lactating female tissues, if CAT activity was only observed in one of the two analysed mice, we could not formerly exclude mammary sample contamination and the result was not taken into account for this discussion. The non-mammary activity was found to be independent from copy numbers and from the physiological stage of the animals since it was not only frequently observed in similar tissues of both male and females within a line, but also throughout gestation stages when expression was detected in the liver of the thymus, tissues that were studied alongside the mammary gland during the time 25 WO 01/00860 PCT/NZ00/00109 course analyses (see following section). This is in contrast with the reported hormonally regulated expression of a rat -casein/CAT construct in the thymus of transgenic mice (Lee et al, 1989). The tissue-distribution was not absolutely consistent between lines carrying the same transgene, even in the presence of the insulators, probably reflecting influence of the integration site. Overall, the construct olac/MGF/CAT appears to lead to low expression in all tissues analyzed except the testis, thus having a different tissue-specificity than the lac promoter. Absence of detectable expression in other tissue than the mammary gland in mice from line 7 might result from the presence of only one intact copy of the transgene in this line. Such low ubiquitous expression of the lac/MGF/CAT transgene is a similar observation to the ectopic expression of -lactoglobulin transgenes (Farini and Whitelaw, 1995). Surprisingly, no non-mammary expression of the olac/GAS/CAT construct was detected. This difference between olac/MGF and olac/GAS promoters activity is difficult to explain. Recently, differences between STATS-mediated prolactin inducibility of the rat IRF-1 and 3-casein promoters were reported (Luo and Yu Lee, 1997). However, these differences appear to be only indirectly related to the GAS element itself since STATS inhibition of prolactin induction of the IRF-I promoter does not require its binding activity. EXAMPLE 4 Transgene development expression during gestation 26 WO 01/00860 PCT/NZ00/00109 CAT activity was measured in the liver, thymus and mammary gland of one virgin, and pregnant two days 8, 11, 14 and 17 from seven lines (Fig. 6 and Table Il). These studies revealed that the 560 bp murine cdac promoter is activated in the mammary gland at the end of the gestation, around day 17, as already observed for the endogenous gene (Vilotte and Soulier, 1992) and a bovine Mlac transgene (Soulier et al, 1992). Up to four fold variation between CAT activities of two mammary samples from two mice at the same physiological stage could be observed. This variability could arise from individual variations, heterogeneity of the transgene expression within the mammary tissue as recently reported (Faerman et al, 1995) or variegation (Dobie et al, 1996). The (lac/GAS promoter appears to behave similarly to its wild-type counterpart. However, only one line was analyzed and the observed variability in the regulation of the olac/MGF promoter between lines suggests that this data needs to be confirmed. In line clac/MGF/CAT 10, the developmental regulation of the transgene was similar to that described above. The two other analyzed lines, clac/MGF/CAT 41 and Ins/ulac/MGF/CAT 57, correspond to the highest expressing animals. Significant CAT activity could be detected in virgin mammary gland and remains constant at days 8 and 11 of gestation. Surprisingly, high variability of mammary CAT activity was observed between mice after 11 days of gestation: apparently in some animals the CAT activity remains constant until day 17 of gestation as described for the olac wild-type promoter while in others, CAT activity gradually 27 WO 01/00860 PCT/NZ00/00109 increases from day 11 of gestation to the lactation stage with a 10-fold induction at day 14 of gestation (Table III), resembling the transcriptional regulation of the P3 casein and -lactoglobulin genes (Harris et al, 1991) Southern analysis did not reveal DNA rearrangement between mice from the same line (data not shown). Interestingly, this developmental shift appears to be inherited: in line 41 all mice that have a constant mammary CAT activity from day 11 to 17 of gestation were offspring from one transgenic female while the three mice that show increasing CAT activity during this study were offspring from one transgenic male. Origin of the analyzed mice from line 57 is more confused but when sisters were studied, they always belong to one group in term of developmental regulation. However, in this line, the sex of the transgenic parent cannot be linked to a developmental behaviour of the transgene, suggesting that it is not a simple imprinting phenomenen (Relk and Constancia, 1997 for review). Further studies are needed to clarify this yet unreported genetic incidence on a mammary transgene developmental regulation and to assess if the observed increased CAT activity in some mice at midgestation results from an activation of the transgene transcription per cell and/or the number of mammary epithelial cells that express it. These results provide some demonstration of the hypothesized correlation between in vitro prolactin inducibility and developmental regulation of milk protein promoters. Furthermore, the mutated clac promoter could potentially be an attractive alternative to target expression of foreign genes to the mammary gland in transgenic animals as the frequency of expression was near 100% compared with only 50% for the wildtype construct. 28 WO 01/00860 PCT/NZ00/00109 When ectopic expression was detected in either the thymus or the liver (line lac/MGF/CAT 10 or 41 in Table II for example), similar levels were observed throughout gestation and lactation (data not shown). It is to be understood that the scope of the invention is not restricted to the above examples and that numerous variations and modifications may be made to those examples without departing from the scope of the invention or set out in this specification. REFERENCES Bignon C; Daniel N and Djiane J (1993) -galactosidase and chloramphenicol acetyltransferase assays in 96-well plates. BioTech. 15, 243-5. Burdon T G; Maitland K A; Clark A J; Wallace R and Watson C J (1994) Regulation of the sheep -lactoglobulin gene by lactogenis hormones is mediated by a transcription factor that binds an interferon- activation site-related element. Mol. Endo. 8, 1528-36. Cardiff R D (1996) The biology of mammary transgenes: five rules. J. Marn. Gland Biol. and Neo. 1, 61-73. Clark A J (1996) Genetic modification of milk proteins. Am. J. Clin. Nutr. 63, 633S-8S. Colman A (1996) Production of proteins in the milk of transgenic livestock: problems, solutions and successes. Am. J. Clin. Nutr. 63, 639S-45S. 29 WO 01/00860 PCT/NZ00/00109 Demmer J; Burdon T G; Dijiane J; Watson C J and Clark A J (1995) The proximal milk protein binding factor binding site is required for the prolactin responsiveness of the sheep -lactoglobulin promoter in Chinese hamster ovary cells. Mol. Cell. Endo. 107, 113-21. Dobie K W; Lee M; Fantes J A; Graham E; Clark A J; Springbett A; Lathe R and McClenaghan M (1996) Variegated transgene expression in mouse mammary gland is determined by the transgene integration locus. Proc. Natl. Acad. Sci. USA 93, 6659-64. Faerman A; Barash I; Puzis R; Nathan M; Hurwitz D R and Shani M (1995) Dramatic heterogeneity of transgene expression in the mammary gland of lactating mice: a model system to study the synthetic activity of mammary epithelial cells. J. Histochem. Cytochem 43, 461-70. Farini E and Whitelaw C B A (1995) Ectopic expression of -lactoglobulin transgenes. Mol. Gen. Genet. 246, 734-8. Fujiwara Y; Miwa M; Takahashi R; Hirabayashi M; Suzuki T and Ueda M (1997) Position-independent and high-level expression of human -lactalbumin in the milk of transgenic rats carrying a 210 kb YAC DNA. Mol. Reprod. Develop. 47, 157 63. Gilmour K C; Pine R and Reich N C (1995) Interleukin 2 activates STAT5 transcription factor (mammary gland factor) and specific gene expression in T lymphocytes. Proc. Natl. Acad. Sci. USA 92, 10772-6. 30 WO 01/00860 PCT/NZ00/00109 Gordon J W; Scangos G A; Plotkin D J; Barbosa J A; Ruddle F H (1980) Proc. Natl. Acad. Sci. USA 77, 7380. Gorman C M; Moffat L and Howard B H (1982) Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell, Biol. 2, 1044-51. Groner B and Gouilleux F (1995) Prolactin-mediated gene activation in mammary epithelial cells. Current opinion in Genet. & Develop. 5, 587-94. Harris S; McClenagham M; Simons J P; Ali S and Clark A J (1991) Developmental regulation of the sheep -lactoglobulin gene in the mammary gland of transfenic mice. Develop. Genetics 12, 299-307. Hennighausen L; Robinson G W; Wagner K U and Liu X (1997) Prolactin signalling in mammary gland development. J. Biol. Chem. 272, 7567-9. Jolivet G; L'Hotte C; Pierre S; Tourkine N and Houdebine L M (1996) A MGF/STAT5 binding site is necessary in the distal enhancer for high prolactin induction of transfected rabbit sl-casein-CAT gene transcription. FEBS Letters, 389, 257-62. Landt O; Grunert H P and Hahn U A (1990) A general method for rapid site directed mutagenesis using the polymerase chain reaction. Gene 96, 125-128. Lathe R; Vilotte J L and Clark A J (1987) Plasmids and bacteriophage vector for excision of intact inserts. Gene 57, 193-201. 31 WO 01/00860 PCT/NZ00/00109 Lee K F; Atiee S H and Rosen J M (1989) Differential regulation of rat -casein chloranphenicol acetyltransferase fusion gene expression in transgenic mice. Mol. Cell. Biol. 9, 560-5. Lesueur L; Edery M; Paly J; Clark J; Kelly K A and Dijiane J (1990) Prolactin stimulates milk protein promoter in CHO cells cotransfected with prolactin receptor cDNA. Mol. Cell. Endo. 71, R7-12. Li S and Rosen J M (1995) Nuclear factor I and mammary factor (StatS) play a critical role in regulating rat whey acidic protein gene expression in transgenic mice. Mol. Cell. Biol. 15, 2063-70. Lowry O H; Rosebrough N J; Farr A L and Rundall R J (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265-75. Luo G and Yu-Lee L Y (1997) Transcriptional inhibition by Stat5. J. Biol. Chem. 272, 26841-9. Meier V S and Groner B (1994) The nuclear factor YY1 participates in repression of the -casein gene promoter in mammary epithelial cells and is counteracted by mammary gland factor during latogenic hormone induction. Mol. Cell. Biol. 14, 128-37. Mercier J C and Vilotte J L (1997) The modification of milk protein composition through transgenesis: progress and problems. In Houdebine L M ed., Transgenic 32 WO 01/00860 PCT/NZ00/00109 animals-generation and use, pp. 473-82. Switzerland: Harwood academic publishers. Molenaar A J; Davis S R and Wilkins R J (1992) Expression of -lactalbumin -sl-casein, and lactoferrin gene is heterogeneous in sheep and cattle mammary tissue. J. Histochem. Cytochem. 40, 611-8. Nakhasi H L and Qasba P K (1979) Quantification of milk proteins and their mRNAs in rat mammary gland at various stages of gestation and lactation. J. Biol. Chem. 254, 6016-25. Perry A C F; Wakayama T; Kishikawa H; Kasai T; Okabe M; Toyoda Y; YanagimachinR (1999) Science 284, 1180. Popov L S (1996) Some aspects of structure and expression of milk protein genes (a review). Mol. Biol. 30, 742-53. Relk W and Constancia M (1997) Making sense or antisense? Nature 389, 669-71. Robinson G W; McKnight R A; Smith G H and Hennighausen L (1995) Mammary epithelial cells undergo secretory differentiation in cycling virgins but require pregnancy for the establishment of terminal differentiation. Development, 121, 2079-90. Rosen J M; Li S; Raught B and Hadsell D (1996) The mammary gland as a bioreactor: factors regulating the efficient expression of milk protein-based transgenes. Am. J. Clin. Nutr. 63, 627S-32S. 33 WO 01/00860 PCT/NZ00/00109 Sanger F; Nicklen S and Coulson A R (1977) DNA sequencing with chain termination inhibitors. Proc. Natl. Acad. Sci. USA, 74, 5463-7. Schmidhauser C; Casperson G F; Myers C A; Bolten S and Bissell M J (1992) A novel transcriptional enhancer is involved in the prolactin and ECM-dependent regulation of -casein gene expression. Mol. Biol. Cell. 3, 699-709. Schmitt-Ney M; Doppler W; Ball R K and Groner B (1991) -casein gene promoter activity is regulated by the hormone-mediated relief of transcriptional repression and a mammary-gland specific nuclear factor. Mol. Cell. Biol. 11, 3745-55. Soulier S; Vilotte J L; Stinnakre M G and Mercier J C (1992) Expression analysis of ruminant -lactalbumin in transgenic mice: development regulation and general location of important cis-regulatory elements. FEBS Letters. 1,2, 13-8. Vilotte J L and L'Huillier P J (1996) Modification of milk protein composition by gene transfer. In Phillips C J C ed. Progress in Dairy Science, pp 281-310, Oxon: CAB International. Vilotte J L and Soulier S (1992) Isolation and characterization of the mouse -lactalbumin-encoding gene: interspecies comparison, tissue- and stage-specific expression. Gene, 119, 287-92. Vilotte J L; Soulier S; Stinnakre M G; Massoud M and Mercier J C (1989) Efficient and tissue-specific expression of bovine -lactalbumin in transgenic mice. Eur. J. Biochem, 186, 43-8. 34 WO 01/00860 PCT/NZ00/00109 Wang Y; DeMayo F J; Tsai S Y and O'Malley B W (1997) Ligand-inducible and liver-specific target gene expression in transgenic mice. Nature Biotech, 15, 239 43. Watson C J; Gordon K E; Robertson M and Clark A J (1991) Interaction of DNA-binding proteins with a milk protein gene promoter in vitro: identification of a mammary gland-specific factor. Nucl. Acids. Res. 19, 6603-10. Whitelaw C B A (1996) Hormonal influences on -lactoglobulin transgene expression inferred from chromatin structure. Biochem. Biophys. Res. Comn. 224, 121-5. Whitelaw C B A; Springbett A J; Webster J and Clark A J (1993) The majority of GO mice are derived from mosaic embryos. Transg. Res. 2, 29-32. Whitelaw C B A; Wilkie N M; Jones K A; Kadonaga J T; Tijan R and Lang J C (1988) Transcriptionally active domains in the 5'flanking sequence of human c myc. UCLA Symp. on Mol. Biol. 58, 337-51. Aspects of the present invention have been discussed by way of example only and it should be appreciated that modifications and additions may be made thereto without departing from the scope of the appended claims. 35

Claims (44)

1. An isolated DNA molecule including a mammary specific promoter which has been modified by the insertion of at least one complete STAT5 binding site, said modified promotor providing enhanced frequency of expression of a heterologous gene to which it may be operably linked.

2. A DNA molecule as claimed in claim 1 which is c DNA.

3. A DNA molecule as claimed in either claim 1 or claim 2 wherein the STAT5 binding site confers prolactin inducibility to the promoter.

4. A DNA molecule as claimed in any one of Claims 1 to 3 wherein the mammary specific promoter is selected from the group including, the u-casein promoter, and the ic-casei promoter, and the lactoferrin promoter, and the whey acid protein promoter.

5. A DNA molecule as claimed in any one of Claims 1 to 3 wherein the mammary specific promoter is the c-lactalbumin promoter.

6. A DNA molecule as claimed in any one of Claims 1 to 5 wherein the promoter is either a bovine or ovine promoter. 36 WO 01/00860 PCT/NZ00/00109

7. A DNA molecule including a prolactin inducible O-lactalbumin promoter with the sequence set out in Figure 1 of this patent specification or a variant thereof having substantially equivalent transcriptional activity thereto.

8. A DNA molecule as claimed in any one of claims 1 to 7 which includes a native mammary specific promoter modified by site directed mutagenesis to create a complete proximal STAT5 binding site within the sequence by reproducing the STAT5 binding site sequence present in rat 3-casein or interferon regulatory factor (IRFI) promoters.

9. A DNA molecule as claimed in any one of claims 1 to 8 which includes at least two complete STAT5 binding sites.

10. A DNA molecule as claimed in claim 9 into which has been inserted a single complete STAT5 site as the native promoter already contains at least one STAT5 site.

11. A DNA molecule as claimed in claim 9 which has inserted into it two complete STAT5 binding sites where the native promoter does not contain a complete STAT5 site.

12. A DNA molecule as claimed in any one of claims 1 to 1 1 which includes or consists of the nucleotide sequence of a non-human mammalian cu lactalbumin promoter having inserted therein a STAT5 binding site of the rat P-casein promoter, ie GAS oligonucleotide: CTCATTTCGGGGAAATCATTGA; or the IRF1 promoter, ie, MGF oligonucleotide: CTTAATTCCAAGAAGTCAATGA. 37 WO 01/00860 PCTNZ00/00109

13. An isolated DNA construct including the DNA molecule as claimed in any one of the previous claims operably linked to a heterologous gene.

14. A DNA construct as claimed in Claim 13 wherein the heterologous gene is under the transcriptional control of the modified mammary specific promoter.

15. A construct as claimed in either Claim 13 or Claim 14 which includes a modified non-human mammalian cx-lactalbumin promoter with a STAT5 site such as a GAS or MGF STAT5 site, therein operably linked to a heterologous gene of interest, which may include human insulin, human interferon, human growth hormone, human serum albumin, follicle stimulating hormone, humanised monoclonal antibodies.

16. Recombinant expression vectors which contain a DNA molecule as claimed in any one of claims 1 to 12.

17. Recombinant expression vectors which contains a DNA construct as claimed in any one of claims 13 to 15.

18. A recombinant expression vector as claimed in either claim 16 or 17 which contains hosts tranformed with the vector of the invention capable of prolactin induction of the DNA molecule and/or prolactin inducible expression of the heterologous gene of the DNA construct.

19. An inducible expression system including 38 WO 01/00860 PCTINZ00/00109 (a) host cells transformed with the DNA construct of the present invention, and (b) prolactin.

20. An inducible expression system including a combination of (1) a prolactin inducible a-lactalbumin promoter of the invention; (2) a desired gene for expression, operably linked to the prolactin inducible a-lactalbumin promoter; and (3) prolactin which can bind to the STAT5 site of the prolactin inducible u-lactalbumin promoter; and, if required (4) a long-form prolactin receptor gene.

21. A method of producing a heterologous polypeptide or peptide including the steps of: (a) culturing a host cell which has been transformed or transfected with a vector containing the DNA construct previously claimed to express the heterologous polypeptide or peptide encoded by the heterologous gene; and (b) recovering the expressed polypeptide or peptide.

22. Replicable transfer vectors for use in the expression and the DNA constructs of the invention to produce a heterologous protein. 39 WO 01/00860 PCTINZ00/00109

23. A vector as claimed in claim 22 which uses -galactosidase reporter gene which is detectable by clones exhibiting a blue phenotype of X-gal plates.

24. A vector as claimed in claim 22 which uses a polyhedron-encoding gene detectable by clones exhibiting a white phenotype when stained with X-gal.

25. A non-human transgenic mammal that expresses a heterologous polypeptide or peptide in their milk, said non-human mammals having been transfected with the DNA constructs of the present invention.

26. A non-human transgenic mammal that exhibits a heterologous polypeptide or peptide in their milk wherein the DNA construct as previously claimed has been incorporated into the genome of the non-human animal.

27. A non-human transgenic mammal as claimed in either Claim 25 or Claim 26 which includes a relevant corresponding modified prolactin inducible mammary gland promoter.

28. A method of producing non-human animal milk containing a heterologous polypeptide or peptide including the steps: (a) producing milk in the mammary gland of an adult transgenic, non-human mammal whose cells include a DNA construct as previously claimed wherein said construct is expressed in the mammary gland of said mammal and the heterologous polypeptide or peptide is produced in the milk; and 40 WO 01/00860 PCT/NZ00/00109 (b) collecting the milk produced in step (a); and (c) optionally purifying the heterologous polypeptide or peptide.

29. A method as claimed in claim 28 characterised by the further step of inducing a mammary specific promoter by endogenous prolactin in mid pregnancy and through lactation.

30. A test kit for use in assaying samples for the presence of a heterologous polypeptide or peptide including the inducible expression system as previously claimed and compositions and agents useful in such systems.

31. A method of medical treatment of a human characterised by the steps of: (a) transforming the cells of the individual to include an expression system as claimed in either claim 19 or claim 20, and (b) controlling the expression of particular gene of interest in a temporal fashion by administering prolactin to the individual.

32. A pharmaceutically active protein produced by the methods as previously claimed.

33. A DNA molecule substantially as herein described with reference to and as illustrated by the accompanying drawings.

34. A DNA construct substantially as herein described with reference to and as illustrated by the accompanying drawings. 41 WO 01/00860 PCT/NZ00/00109

35. Recombinent expression vectors substantially as herein described with reference to and as illustrated by the accompanying drawings.

36. An inducible expression system substantially as herein described with reference to and as illustrated by the accompanying drawings.

37. A method of producing a heterologous polypeptide or peptide substantially as herein described with reference to and as illustrated by the accompanying drawings.

38. A non-human transgenic mammal substantially as herein described with reference to and as illustrated by the accompanying drawings.

39. A method of producing non-human animal milk substantially as herein described with reference to and as illustrated by the accompanying drawings.

40. A test kit substantially as herein described with reference to and as illustrated by the accompanying drawings.

41. A method of medical treatment substantially as herein described with reference to and as illustrated by the accompanying drawings.

42. Replicable transfer vectors substantially as herein described with reference to and as illustrated by the accompanying drawings.

43. Use of the products as claimed previously in pharmaceutical and/or nutraceutical products, industrial uses or a range of milk and/or meat products whether it be in their natural or processed state. 42 TABLE I LINES TRANSGENE Generated/ Analysed Expressing (%) pups borned alac/CAT 8/68 6 3/6 (50) clac/ MGF/CAT 5152 5 5/5 (100) alac/GAS/CAT 9/66 7 6/7 (85.7) 43 WO 01/00860 PCT/NZOOOO1O9 TABLE 2 Transgene Line S e Main. Testis Liver Saiv. Brain KidneY Thynnis ctlac/CAT 28 F ++ - M k: C Si F + - F + alacfTMGFr/CAT 10 F Hi£- F -I++ £ M - + £ - E 41 F --- It E + E E F *+++ 9 + M E~ E E E alac/GAS/CAT 20 F ++- - F - - -' 33 F -ii - - Table 11: TI-5sue~specifCILiY of traflsgefle expression. F: ~dy=acttilgfemale, IM: Male. Marn,: Mammjary gland. Saliv.: Salivary glund. Tissuu-sarnPle CAT activities were estimated according to Grinan et al. (1982) using, 100 ±g of proteinsamflie and a reaction incubation time of 15 h

44 WO 01/00860 PCT/NZOO/00109 I I 091 to r Cl4 t 4 oC Q I r I I I r J' 4r- 10''a I n W%C~f co11f ( I r 4% U %A toI I r, I w I tA 1D In I I . ta I I m I cl I -I '3 1 I aI Ik 6 q4 aV a I Il < Ii u I a, ~ a~ i ? 45