AU4286100A - Expression of heparin-binding protein in recombinant mammalian cells - Google Patents

Description

WO 00/66627 PCT/DKOO/00216 1 EXPRESSION OF HEPARIN-BINDING PROTEIN IN RECOMBINANT MAMMALIAN CELLS FIELD OF INVENTION 5 The present invention relates to a method for the production of heparin-binding protein (HBP) in a recombinant mammalian cell(s) that can be cultured under anaerobic conditions after transfecting said cells with a nucleic acid encoding said heparin-binding protein. The inven tion also relates to said recombinant mammalian cells. 10 BACKGROUND OF THE INVENTION The covalent structure of two closely related proteins isolated from peripheral neutrophil leukocytes of human and porcine origin have recently been determined (cf. H. Flodgaard et al., 15 1991, Eur. J. Biochem. 197:535-547; J. Pohl et al., 1990, FEBS Lett. 272:200 ff.). Both proteins show a high similarity to neutrophil elastase, but owing to selective mutations of the active serine 195 and histidine 57 (chymotrypsin numbering (B.S. Hartley, 1970, Phil. Trans. Roy. Soc. Series 257:77 ff) the proteins lack protease activity. The proteins have been named human heparin-binding protein (hHBP) and porcine heparin-binding protein (pHBP), respectively, owing 20 to their high affinity for heparin; Schafer et al. (W.M. Schafer et al., 1986, Infect. Immun. 53:651 ff) have named the protein cationic antimicrobial protein (CAP37) due to its antimicrobial activity. The protein has been found to regulate monocyte/macrophage functions such as chemotaxis, increased survival, and differentiation (reviewed in Pereira, 1995, J. Leuk. Biol. 57:805-812, also see U.S. Patent Nos. 5,458,874 and 5,484,885). However, there has been no disclosure as to 25 whether it would inhibit infection of monocytes or macrophages by a microorganism. Furthermore, HBP has been shown to mediate detachment and contraction of endothelial cells and fibroblasts when added to such cells grown in monolayer culture. HBP also stimulates monocyte survival and thrombospondin secretion (E. Ostergaard and H. Flodgaard, 1992, J. 30 Leukocyte Biol. 51:316 ff). A protein with the first 20 N-terminal amino acid residues identical to those of hHBP and CAP37 called azurocidin has also been isolated from the azurophil granules (J.E. Gabay et al., 1989, Proc. NatI. Acad. Sci. USA 86:5610 ff.; C.G. Wilde et al., 1990, J. Biol. Chem. 265:2038 ff.) and WO 00/66627 PCT/DKOO/00216 2 its antimicrobial properties have been reported (D. Campanelli et al., 1990, J. Clin. Invest. 85:904 ff.). The presence of hHBP in the neutrophil leukocytes and the fact that 89% of CAP37 (which is 5 identical to hHBP) is released when the leukocytes are phagocytose Staph. aureus (H.A. Pereira et al., op. cit.) indicate that a function of hHBP could be its involvement in the inflammatory process since the protein is apparently released from activated neutrophils. Pereira et al., op. cit., suggested a function of CAP37 to be at the site of inflammation where it could specifically attract monocytes and thus be one of the factors responsible for the influx of 10 monocytes in the second wave of inflammation. Ostergaard and Flodgaard, op. cit., suggest that, in addition to being important for the recruitment of monocytes, HBP might play a key role in the mechanism of neutrophil as well as monocyte extravasation. The structure of HBP is shown in U.S. Patent No. 5,814,602 and H. Flodgaard et al., op. cit. 15 HBP has otherwise been termed CAP37 (cf. WO 91/00907, U.S. Patent Nos. 5,458,874 and 5,484,885) and azurocidin (cf. C.G. Wilde et al., J. Biol. Chem. 265, 1990, p. 2038). HBP has previously been isolated from neutrophil leukocytes (Flodgaard et al., 1991, Eur. J. Biochem. 197:535-547). However, the yields have been very low. Furthermore, HBP has 20 been produced via recombinant DNA methods in insect cells (Rasmussen et al., 1996, FEBS Lett. 390:109-112). Recombinant HBP (referred in the reference as CAP37) has also been produced in the human kidney 293 cell line (R. Alberdi et al., 1997, FASEB J. 11:1915). An RSV-PL4 25 expression vector is used. This vector contained a transferrin signal peptide for secretion, the HPC4 epitope for immunoaffinity purification, a factor Xa cleavage site and a neomycin resistant gene for G418 selection. Functional heparin-binding protein could only be produced by cleaving the recombinant protein in vitro at the Factor Xa cleavage site using bovine factor Xa to separate the fusion peptide from the recombinant heparin-binding protein. 30 Additionally, recombinant HBP has been produced in reticulocyte blood leukocytes (RBLs) (PCT/DK98/00275). However, a heterogeneous population of HBPs with varying degrees of glycosylation are obtained.

WO 00/66627 PCT/DKOO/00216 3 It would be advantageous to be able to produce heparin-binding protein in high yields in a simple but efficient manner. Therefore, it is an object of the invention to obtain mature hepa rin-binding protein in high yields in a simple but efficient manner. 5 SUMMARY OF THE INVENTION The invention is directed to a method for producing a mammalian heparin-binding protein that can be cultured under anaerobic conditions after introducing into said cell(s) a nucleic acid encoding said heparin-binding protein, comprising (a) introducing a nucleic acid encod 10 ing said heparin-binding protein into a mammalian host cell(s) that can be cultured under an aerobic conditions after introducing into said cell(s) said nucleic acid, (b) culturing the cell(s) of step (a) under conditions conducive to expression of said HBP and (c) recovering said HBP from the culture medium. In a specific embodiment, the cells of step (b) are cultured in the presence of a bradykinin B-2 receptor antagonist. 15 "Heparin-binding protein" ("HBP"), refers to a protein that is (i) proteolytically inactive; (ii) stored in the azurophil granules of polymorphonuclear leukocytes; and (iii) a chemoattractant for monocytes and that optionally has in a glycosylated form a molecular weight of about 27 31 kD. It may be of human or porcine origin. 20 In another embodiment, the invention is directed to a method for producing said mammalian HBP comprising: (a) introducing a nucleic acid encoding said heparin-binding protein into a mammalian host cell(s) that can be cultured under anaerobic conditions after introducing into said cell(s) said nucleic acid, (b) selecting a mammalian host cell of step (a) comprising a 25 nucleic acid encoding said heparin-binding protein; (c) culturing said host cell in serum-free and optionally protein-free culture medium and (d) isolating said heparin-binding protein. The method may further comprise purifying said HBP. The invention further relates to a recombinant mammalian host cell that can be cultured un 30 der anaerobic conditions after introducing into said cell a nucleic acid encoding a mammalian heparin-binding protein, comprising a nucleic acid sequence encoding a heparin-binding pro tein.

WO 00/66627 PCT/DKOO/00216 4 DETAILED DESCRIPTION OF THE INVENTION The heparin binding protein may be encoded by a nucleic acid sequence having at least about an 80% identity with the nucleic acid sequence set forth in SEQ ID NO:3 (which en 5 codes mature human HBP depicted in SEQ ID NO:1), SEQ ID NO:5 (which encodes a hu man HBP which includes the signal sequence and sequence of the mature protein, depicted in SEQ ID NO:6), SEQ ID NO:7 (which encodes human HBP which includes the signal se quence, the pro sequence and sequence of the mature protein, depicted in SEQ ID NO:8) or SEQ ID NO:4 (which encodes porcine HBP depicted in SEQ ID NO:2), SEQ ID NO:9 (which 10 encodes a porcine HBP which includes the signal sequence and sequence of the mature protein depicted in SEQ ID NO:10), SEQ ID NO:11 (which encodes porcine HBP which in cludes the signal sequence, the pro sequence and sequence of the mature protein depicted in SEQ ID NO:12), more preferably at least about 90%, even more preferably at least about 95%, and most preferably at least about 97%, as determined by agarose gel electrophoresis. 15 The nucleic acid sequence may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof. Ile Val Gly Gly Arg Lys Ala Arg Pro Arg GIn Phe Pro Phe Leu Ala Ser lie GIn Asn Gin Gly Arg His Phe Cys Gly Gly Ala Leu Ile His Ala Arg Phe Val Met Thr Ala Ala Ser Cys Phe Gin Ser 20 Gin Asn Pro Gly Val Ser Thr Val Val Leu Gly Ala Tyr Asp Leu Arg Arg Arg Glu Arg Gin Ser Arg Gin Thr Phe Ser Ile Ser Ser Met Ser Glu Asn GlyTyr Asp Pro Gin Gin Asn Leu Asn Asp Leu Met Leu Leu GIn Leu Asp Arg Glu Ala Asn Leu Thr Ser Ser Val Thr lie Leu Pro Leu Pro Leu Gin Asn Ala Thr Val Glu Ala Gly Thr Arg Cys GIn Val Ala Gly TrpGly Ser Gin Arg Ser Gly Gly Arg Leu Ser Arg Phe Pro Arg Phe Val Asn Val Thr Val Thr Pro Giu Asp GIn Cys Arg Pro 25 Asn Asn Val Cys Thr Gly Val Leu Thr Arg Arg Gly Gly lie Cys Asn Gly Asp Gly Gly Thr Pro Leu Val Cys Glu Gly Leu Ala His Gly Val Ala Ser Phe Ser Leu Gly Pro Cys Gly Arg Gly Pro Asp Phe Phe Thr Arg Val Ala Leu Phe Arg Asp Trp Ile Asp Gly Val Leu Asn Asn Pro Gly Pro Gly Pro Ala (SEQ ID NO:1) 30 Ile Val Gly Gly Arg Arg Ala GIn Pro Gin Glu Phe Pro Phe Leu Ala Ser lie Gin Lys GIn Gly Arg Pro Phe Cys Ala Gly Ala Leu Val His Pro Arg Phe Val Leu Thr Ala Ala Ser Cys Phe Arg Gly Lys Asn Ser Gly Ser Ala Ser Val Val Leu Gly Ala Tyr Asp Leu Arg GIn GIn Glu Gin Ser Arg Gin Thr Phe Ser Ile Arg Ser lie Ser GIn Asn Gly Tyr Asp Pro Arg Gin Asn Leu Asn Asp Val Leu Leu Leu Gin Leu Asp Arg Glu Ala Arg Leu Thr Pro Ser Val Ala Leu Val Pro Leu Pro WO 00/66627 PCT/DKOO/00216 5 Pro Gin Asn Ala Thr Val Glu Ala Gly Thr Asn Cys Gin Val Glu Ala Gly Trp Gly Thr Gin Arg Leu Arg Arg Leu Phe Ser Arg Phe Pro Arg Val Leu Asn Val Thr Val Thr Ser Asn Pro Cys Leu Pro Arg Asp Met Cys lie Gly Val Phe Ser Arg Arg Gly Arg |le Ser Gin Gly Asp Arg Gly Thr Pro Leu Val Cys Asn Gly Leu Ala Gin Gly Val Ala Ser Phe Leu Arg Arg Arg Phe Arg Arg 5 Ser Ser Gly Phe Phe Thr Arg Val Ala Leu Phe Arg Asn Trp Ile Asp Ser Val Leu Asn Asn Pro Pro Ala (SEQ ID NO:2) ATCGTTGGCGGC CGGAAGGCGA GGCCCCGCCA GTTCCCGTTC CTGGCCTCCA TTCAGAATCA AGGCAGGCAC TTCTGCGGGG GTGCCCTGAT 10 CCATGCCCGCTTCGTGATGA CCGCGGCCAG CTGCTTCCAA AGCCAGAACC CCGGGGTTAG CACCGTGGTG CTGGGTGCCT ATGACCTGAG GCGGCGGGAG AGGCAGTCCC GCCAGACGTT TTCCATCAGCAGCATGAGCG AGAATGGCTA CGACCCCCAG CAGAACCTGA ACGACCTGAT GCTGCTTCAG CTGGACCGTG AGGCCAACCT CACCAGCAGC GTGACGATAC TGCCACTGCC 15 TCTGCAGAACGCCACGGTGG AAGCCGGCAC CAGATGCCAG GTGGCCGGCT GGGGGAGCCA GCGCAGTGGG GGGCGTCTCT CCCGTTTTCC CAGGTTCGTC AACGTGACTG TGACCCCCGA GGACCAGTGTCGCCCCAACA ACGTGTGCAC CGGTGTGCTC ACCCGCCGCG GTGGCATCTG CAATGGGGAC GGGGGCACCC CCCTCGTCTG CGAGGGCCTG GCCCACGGCG TGGCCTCCTT 20 TTCCCTGGGGCCCTGTGGCC GAGGCCCTGA CTTCTTCACC CGAGTGGCGC TCTTCCGAGA CTGGATCGAT GGCGTTTTAA ACAATCCGGG ACCGGGGCCA GCCTAG (SEQ ID NO:3) ATTGTGGGCGGC AGGAGGGCCC AGCCGCAGGA GTTCCCGTTT CTGGCCTCCA 25 TTCAGAAACA AGGGAGGCCC TTTtGCGCCG GAGCCCTGGT CCATCCCCGC TTCGTCCTGA CAGCGGCCAG CTGCTTCCGT GGCAAGAACA GCGGAAGTGC CTCTGTGGTG CTGGGGGCCT ATGACCTGAG GCAGCAGGAG CAGTCCCGGC AGACATTCTC CATCAGGAGC ATCAGCCAGA ACGGCTATGA YCCCCGGCAG AATCTGAACG ATGTGCTGCT GCTGCAGCTG GACCGTGAGG CCAGACTCAC 30 CCCCAGTGTG GCCCTGGTAC CGCTGCCCCC GCAGAATGCC ACAGTGGAAG CTGGCACCAA CTGCCAAGTTGCGGGCTGGG GGACCCAGCG GCTTAGGAGG CTTTTCTCCC GCTTCCCAAG GGTGCTCAAT GTCACCGTGA CCTCAAACCC GTGTCTCCCC AGAGACATGT GCATTGGTGT CTTCAGCCGC CGGGGCCGCA TCAGCCAGGG AGACAGAGGC ACCCCCCTCG TCTGCAACGG CCTGGCGCAG WO 00/66627 PCT/DKOO/00216 6 GGCGTGGCCT CCTTCCTCCG GAGGCGTTTC CGCAGGAGCT CCGGCTTCTT CACCCGCGTG GCGCTCTTCA GAAATTGGAT TGATTCAGTT CTCAACAACC CGCCGGCCTGA (SEQ ID NO:4) 5 ATGACCCGGC TGACAGTCCT GGCCCTGCTG GCTGGTCTGC TGGCGTCCTC GAGGGCC ATCGTTGGCGGC CGGAAGGCGA GGCCCCGCCA GTTCCCGTTC CTGGCCTCCA TTCAGAATCA AGGCAGGCAC TTCTGCGGGG GTGCCCTGAT CCATGCCCGCTTCGTGATGA CCGCGGCCAG CTGCTTCCAA AGCCAGAACC CCGGGGTTAG CACCGTGGTG CTGGGTGCCT ATGACCTGAG GCGGCGGGAG 10 AGGCAGTCCC GCCAGACGTT TTCCATCAGCAGCATGAGCG AGAATGGCTA CGACCCCCAG CAGAACCTGA ACGACCTGAT GCTGCTTCAG CTGGACCGTG AGGCCAACCT CACCAGCAGC GTGACGATAC TGCCACTGCC TCTGCAGAACGCCACGGTGG AAGCCGGCAC CAGATGCCAG GTGGCCGGCT GGGGGAGCCA GCGCAGTGGG GGGCGTCTCT CCCGTTTTCC CAGGTTCGTC 15 AACGTGACTG TGACCCCCGA GGACCAGTGTCGCCCCAACA ACGTGTGCAC CGGTGTGCTC ACCCGCCGCG GTGGCATCTG CAATGGGGAC GGGGGCACCC CCCTCGTCTG CGAGGGCCTG GCCCACGGCG TGGCCTCCTT TTCCCTGGGGCCCTGTGGCC GAGGCCCTGA CTTCTTCACC CGAGTGGCGC TCTTCCGAGA CTGGATCGAT GGCGTTTTAA ACAATCCGGG ACCGGGGCCA GCCTAG 20 (SEQ ID NO:5) Met Thr Arg Leu Thr Val Leu Ala Leu Leu Ala Gly Leu Leu Ala Ser Ser Arg Ala lie Val Gly Gly Arg Lys Ala Arg Pro Arg Gin Phe Pro Phe Leu Ala Ser lie GIn Asn GIn Gly Arg His Phe Cys Gly Gly Ala Leu Ile His Ala Arg Phe Val Met Thr Ala Ala Ser Cys Phe Gin Ser Gin Asn 25 Pro Gly Val Ser Thr Val Val Leu Gly Ala Tyr Asp Leu Arg Arg Arg Glu Arg Gin Ser Arg Gin Thr Phe Ser lie Ser Ser Met Ser Glu Asn GlyTyr Asp Pro Gin Gin Asn Leu Asn Asp Leu Met Leu Leu Gin Leu Asp Arg Glu Ala Asn Leu Thr Ser Ser Val Thr Ile Leu Pro Leu Pro Leu Gin Asn Ala Thr Val Glu Ala Gly Thr Arg Cys Gin Val Ala Gly TrpGly Ser Gin Arg Ser Gly Gly Arg Leu Ser Arg Phe Pro Arg Phe Val Asn Val Thr Val Thr Pro Glu Asp Gin Cys Arg Pro Asn Asn 30 Val Cys Thr Gly Val Leu Thr Arg Arg Gly Gly lie Cys Asn Gly Asp Gly Gly Thr Pro Leu Val Cys Glu Gly Leu Ala His Gly Val Ala Ser Phe Ser Leu Gly Pro Cys Gly Arg Gly Pro Asp Phe Phe Thr Arg Val Ala Leu Phe Arg Asp Trp Ile Asp Gly Val Leu Asn Asn Pro Gly Pro Gly Pro Ala (SEQ ID NO:6) WO 00/66627 PCT/DKOO/00216 7 ATGACCCGGC TGACAGTCCT GGCCCTGCTG GCTGGTCTGC TGGCGTCCTC GAGGGCC GGCTCCAGCCCCC TTTTGGAC ATCGTTGGCGGC CGGAAGGCGA GGCCCCGCCA GTTCCCGTTC CTGGCCTCCA TTCAGAATCA AGGCAGGCAC TTCTGCGGGG GTGCCCTGAT CCATGCCCGCTTCGTGATGA CCGCGGCCAG 5 CTGCTTCCAA AGCCAGAACC CCGGGGTTAG CACCGTGGTG CTGGGTGCCT ATGACCTGAG GCGGCGGGAG AGGCAGTCCC GCCAGACGTT TTCCATCAGCAGCATGAGCG AGAATGGCTA CGACCCCCAG CAGAACCTGA ACGACCTGAT GCTGCTTCAG CTGGACCGTG AGGCCAACCT CACCAGCAGC GTGACGATAC TGCCACTGCC TCTGCAGAACGCCACGGTGG AAGCCGGCAC 10 CAGATGCCAG GTGGCCGGCT GGGGGAGCCA GCGCAGTGGG GGGCGTCTCT CCCGTTTTCC CAGGTTCGTC AACGTGACTG TGACCCCCGA GGACCAGTGTCGCCCCAACA ACGTGTGCAC CGGTGTGCTC ACCCGCCGCG GTGGCATCTG CAATGGGGAC GGGGGCACCC CCCTCGTCTG CGAGGGCCTG GCCCACGGCG TGGCCTCCTT TTCCCTGGGGCCCTGTGGCC GAGGCCCTGA 15 CTTCTTCACC CGAGTGGCGC TCTTCCGAGA CTGGATCGAT GGCGTITTAA ACAATCCGGG ACCGGGGCCA GCCTAG (SEQ ID NO:7) Met Thr Arg Leu Thr Val Leu Ala Leu Leu Ala Gly Leu Leu Ala Ser Ser Arg Ala Gly Ser Ser Pro Leu Leu Asp Ile Val Gly Gly Arg Lys Ala Arg Pro Arg Gin Phe Pro Phe Leu Ala Ser lIle 20 Gin Asn Gin Gly Arg His Phe Cys Gly Gly Ala Leu lie His Ala Arg Phe Val Met Thr Ala Ala Ser Cys Phe GIn Ser Gin Asn Pro Gly Val Ser Thr Val Val Leu Gly Ala Tyr Asp Leu Arg Arg Arg Glu Arg Gin Ser Arg Gin Thr Phe Ser lie Ser Ser Met Ser Glu Asn GlyTyr Asp Pro Gin GIn Asn Leu Asn Asp Leu Met Leu Leu Gin Leu Asp Arg Glu Ala Asn Leu Thr Ser Ser Val Thr lie Leu Pro Leu Pro Leu Gin Asn Ala Thr Val Glu Ala Gly Thr Arg Cys Gin Val Ala Gly 25 TrpGly Ser Gin Arg Ser Gly Gly Arg Leu Ser Arg Phe Pro Arg Phe Val Asn Val Thr Val Thr Pro Glu Asp Gin Cys Arg Pro Asn Asn Val Cys Thr Gly Val Leu Thr Arg Arg Gly Gly lie Cys Asn Gly Asp Gly Gly Thr Pro Leu Val Cys Glu Gly Leu Ala His Gly Val Ala Ser Phe Ser Leu Gly Pro Cys Gly Arg Gly Pro Asp Phe Phe Thr Arg Val Ala Leu Phe Arg Asp Trp Ile Asp Gly Val Leu Asn Asn Pro Gly Pro Gly Pro Ala (SEQ ID NO:8) 30 ATGCCAGCAC TCAGATTCCT GGCCCTGCTG GCCAGCCTGC TGGCAACCTC CAGGGTT AT TGTGGGCGGC AGGAGGGCCC AGCCGCAGGA GTTCCCGTTT CTGGCCTCCA TTCAGAAACA AGGGAGGCCC TTTTGCGCCG GAGCCCTGGT CCATCCCCGC TTCGTCCTGA CAGCGGCCAG CTGCTTCCGT GGCAAGAACA WO 00/66627 PCT/DKOO/00216 8 GCGGAAGTGC CTCTGTGGTG CTGGGGGCCT ATGACCTGAG GCAGCAGGAG CAGTCCCGGC AGACATTCTC CATCAGGAGC ATCAGCCAGA ACGGCTATGA CCCCGGCAG AATCTGAACG ATGTGCTGCT GCTGCAGCTG GACCGTGAGG CCAGACTCAC CCCCAGTGTG GCCCTGGTAC CGCTGCCCCC GCAGAATGCC 5 ACAGTGGAAG CTGGCACCAA CTGCCAAGTTGCGGGCTGGG GGACCCAGCG GCTTAGGAGG CTTTTCTCCC GCTTCCCAAG GGTGCTCAAT GTCACCGTGA CCTCAAACCC GTGTCTCCCC AGAGACATGT GCATTGGTGT CTTCAGCCGC CGGGGCCGCA TCAGCCAGGG AGACAGAGGC ACCCCCCTCG TCTGCAACGG CCTGGCGCAG GGCGTGGCCT CCTTCCTCCG GAGGCGTTTC CGCAGGAGCT 10 CCGGCTTCTT CACCCGCGTG GCGCTCTTCA GAAATTGGAT TGATTCAGTT CTCAACAACC CGCCGGCCTGA (SEQ ID NO:9) Met Pro Ala Leu Arg Phe Leu Ala Leu Leu Ala Ser Leu Leu Ala Thr Ser Arg Val Ile Val Gly Gly Arg Arg Ala Gin Pro Gin Glu Phe Pro Phe Leu Ala Ser lie Gin Lys GIn Gly Arg Pro Phe 15 Cys Ala Gly Ala Leu Val His Pro Arg Phe Val Leu Thr Ala Ala Ser Cys Phe Arg Gly Lys Asn Ser Gly Ser Ala Ser Val Val Leu Gly Ala Tyr Asp Leu Arg Gin GIn Glu GIn Ser Arg Gin Thr Phe Ser Ile Arg Ser lie Ser GIn Asn Gly Tyr Asp Pro Arg GIn Asn Leu Asn Asp Val Leu Leu Leu Gin Leu Asp Arg Glu Ala Arg Leu Thr Pro Ser Val Ala Leu Val Pro Leu Pro Pro Gin Asn Ala Thr Val Glu Ala Gly Thr Asn Cys GIn Val Glu Ala Gly Trp Gly Thr Gin Arg Leu Arg Arg 20 Leu Phe Ser Arg Phe Pro Arg Val Leu Asn Val Thr Val Thr Ser Asn Pro Cys Leu Pro Arg Asp Met Cys lie Gly Val Phe Ser Arg Arg Gly Arg Ile Ser Gin Giy Asp Arg Gly Thr Pro Leu Val Cys Asn Gly Leu Ala Gin Gly Val Ala Ser Phe Leu Arg Arg Arg Phe Arg Arg Ser Ser Gly Phe Phe Thr Arg Val Ala Leu Phe Arg Asn Trp Ile Asp Ser Val Leu Asn Asn Pro Pro Ala (SEQ ID NO:10) 25 ATG CCAGCAC TCAGATTCCT GGCCCTGCTG GCCAGCCTGC TGGCAACCTC CAGG GTT GGC TTG GCC ACC CTG GCA GAC ATT GTGGGCGGC AGGAGGGCCC AGCCGCAGGA GTTCCCGTTT CTGGCCTCCA TTCAGAAACA AGGGAGGCCC TTTtGCGCCG GAGCCCTGGT CCATCCCCGC TTCGTCCTGA CAGCGGCCAG 30 CTGCTTCCGT GGCAAGAACA GCGGAAGTGC CTCTGTGGTG CTGGGGGCCT ATGACCTGAG GCAGCAGGAG CAGTCCCGGC AGACATTCTC CATCAGGAGC ATCAGCCAGA ACGGCTATGA CCCCCGGCAG AATCTGAACG ATGTGCTGCT GCTGCAGCTG GACCGTGAGG CCAGACTCAC CCCCAGTGTG GCCCTGGTAC CGCTGCCCCC GCAGAATGCC ACAGTGGAAG CTGGCACCAA WO 00/66627 PCT/DKOO/00216 9 CTGCCAAGTTGCGGGCTGGG GGACCCAGCG GCTTAGGAGG CTT TCTCCC GCTTCCCAAG GGTGCTCAAT GTCACCGTGA CCTCAAACCC GTGTCTCCCC AGAGACATGT GCATTGGTGT CTTCAGCCGC CGGGGCCGCA TCAGCCAGGG AGACAGAGGC ACCCCCCTCG TCTGCAACGG CCTGGCGCAG GGCGTGGCCT 5 CCTTCCTCCG GAGGCGTTTC CGCAGGAGCT CCGGCTTCTT CACCCGCGTG GCGCTCTTCA GAAATTGGAT TGATTCAGTT CTCAACAACC CGCCGGCCTGA (SEQ ID NO:11) Met Pro Ala Leu Arg Phe Leu Ala Leu Leu Ala Ser Leu Leu Ala Thr Ser Arg Val Gly Leu Ala 10 Thr Leu Ala Asp lie Val Gly Gly Arg Arg Ala GIn Pro Gin Glu Phe Pro Phe Leu Ala Ser lie Gin Lys Gin Gly Arg Pro Phe Cys Ala Gly Ala Leu Val His Pro Arg Phe Val Leu Thr Ala Ala Ser Cys Phe Arg Gly Lys Asn Ser Gly Ser Ala Ser Val Val Leu Gly Ala Tyr Asp Leu Arg Gin Gin Glu Gin Ser Arg Gin Thr Phe Ser lie Arg Ser lie Ser Gin Asn Gly Tyr Asp Pro Arg Gin Asn Leu Asn Asp Val Leu Leu Leu GIn Leu Asp Arg Glu Ala Arg Leu Thr Pro Ser Val Ala 15 Leu Val Pro Leu Pro Pro Gin Asn Ala Thr Val Glu Ala Gly Thr Asn Cys Gin Val Glu Ala Gly Trp Gly Thr Gin Arg Leu Arg Arg Leu Phe Ser Arg Phe Pro Arg Val Leu Asn Val Thr Val Thr Ser Asn Pro Cys Leu Pro Arg Asp Met Cys lie Gly Val Phe Ser Arg Arg Gly Arg Ile Ser Gin Gly Asp Arg Gly Thr Pro Leu Val Cys Asn Gly Leu Ala Gin Gly Val Ala Ser Phe Leu Arg Arg Arg Phe Arg Arg Ser Ser Gly Phe Phe Thr Arg Val Ala Leu Phe Arg Asn Trp Ile Asp Ser Val 20 Leu Asn Asn Pro Pro Ala (SEQ ID NO:12) The degree of identity between two nucleic acid sequences may be determined by means of computer programs known in the art such as GAP provided in the GCG program package (Needleman and Wunsch, 1970, Journal of Molecular Biology 48:443-453). For purposes of 25 determining the degree of identity between two nucleic acid sequences for the present inven tion, GAP is used with the following settings: GAP creation penalty of 5.0 and GAP exten sion penalty of 0.3. Modification of the nucleic acid sequence encoding the HBP may be necessary for the syn 30 thesis of polypeptide sequences substantially similar to the HBP. The term "substantially similar" to the HBP refers to non-naturally occurring forms of the HBP. These polypeptide sequences may differ in some engineered way from the HBP isolated from its native source. For example, it may be of interest to synthesize variants of the HBP where the variants differ in specific activity, thermostability, pH optimum, or the like using, e.g., site-directed WO 00/66627 PCT/DKOO/00216 10 mutagenesis. The analogous sequence may be constructed on the basis of the nucleic acid sequence presented as the HBP encoding part of SEQ ID NOS:1 or 2, e.g., a sub-sequence thereof, and/or by introduction of nucleotide substitutions which do not give rise to another amino acid sequence of the HBP encoded by the nucleic acid sequence, but which corre 5 sponds to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions which may give rise to a different amino acid se quence. For a general description of nucleotide substitution, see, e.g., Ford et al., 1991, in Protein Expression and Purification 2:95-107. 10 It will be apparent to those skilled in the art that such substitutions can be made outside the regions critical to the function of the molecule and still result in an active polypeptide se quence. Amino acid residues essential to the activity of the polypeptide encoded by the iso lated nucleic acid sequence of the invention, and therefore preferably not subject to substitu tion, may be identified according to procedures known in the art, such as site-directed 15 mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244:1081 1085). In the latter technique mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for HBP activity to identify amino acid residues that are critical to the activity of the molecule. 20 The heparin-binding protein may also be encoded by a nucleic acid sequence that hybridizes to a nucleic acid sequence set forth in SEQ ID NOS: 3, 4, 5, 7, 9 or 11 at low to high strin gency conditions. Low to high stringency conditions are defined as prehybridization and hy bridization at 42 0 C in 5X SSPE, 0.3% SDS, 200 ug/ml sheared and denatured salmon sperm DNA and either 25, 35 or 50% formamide for low, medium and high stringencies, respec 25 tively. The carrier material is washed three times each for 30 minutes using 2X SSC, 0.2% SDS preferably at least at 50 0 C (very low stringency), more preferably at least at 55 0 C (low stringency), more preferably at least at 60 0 C (medium stringency), more preferably at least at 65 0 C (medium-high stringency), even more preferably at least at 700C (high stringency) and most preferably at least at 75 0 C (very high stringency). 30 PREPARATION OF HBP A nucleic acid sequence encoding HBP may be prepared synthetically by established stan dard methods, e.g., the phosphoamidite method described by S.L. Beaucage and M.H.

WO 00/66627 PCT/DKOO/00216 11 Caruthers, Tetrahedron Letters 22, 1981, pp. 1859-1869, or the method described by Mat thes et al., EMBO Journal 3, 1984, pp. 801-805. According to the phosphoamidite method, oligonucleotides are synthesized, e.g., in an automatic DNA synthesizer, purified, annealed, ligated and cloned in suitable vectors. 5 The techniques used to isolate or clone a nucleic acid sequence encoding the heparin bind ing protein used in the method of the present invention are known in the art and include iso lation from genomic DNA, preparation from cDNA, or a combination thereof. The cloning of the nucleic acid sequences of the present invention from such genomic DNA can be effected, 10 e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of ex pression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et al., 1990, A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligated activated transcription (LAT) and nucleic acid sequence-based amplification (NASBA) may be used. 15 The nucleic acid sequence is then inserted into a recombinant expression vector which may be any vector which may conveniently be subjected to recombinant DNA procedures. The choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e., a vector which exists as an ex 20 trachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated. 25 In the vector, the nucleic acid sequence encoding HBP should be operably connected to a suitable promoter sequence. The promoter may be any nucleic acid sequence that shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell. Examples of suitable promoters for directing the transcription of the nucleic acid sequence encoding HBP in mammalian cells 30 are the SV 40 promoter (Subramani et al., Mol. Cell Biol. 1, 1981, pp. 854-864), the MT-1 (metallothionein gene) promoter (Palmiter et al., Science 222, 1983, pp. 809-814) or the adenovirus 2 major late promoter, a Rous sarcoma virus (RSV) promoter, cytomegalovirus (CMV) promoter (Boshart et al., 1981, Cell 41:521-530) and a bovine papilloma virus pro- WO 00/66627 PCT/DKOO/00216 12 moter (BPV). A suitable promoter for use in insect cells is the polyhedrin promoter (Vasuve dan et al., FEBS Lett. 311, 1992, pp. 7-11). The nucleic acid sequence encoding HBP may also be operably connected to a suitable ter 5 minator, such as the human growth hormone terminator (Palmiter et al., op. cit.) The vector may further comprise elements such as polyadenylation signals (e.g. from SV 40 or the adenovirus 5 Elb region), transcriptional enhancer sequences (e.g. the SV 40 enhan cer) and translational enhancer sequences (e.g. the ones encoding adenovirus VA RNAs). 10 The recombinant expression vector may further comprise a DNA sequence enabling the vec tor to replicate in the host cell in question. Examples of such a sequence (when the host cell is a mammalian cell) is the SV 40 or polyoma origin of replication. 15 The vector may also comprise a selectable marker, e.g., a gene the product of which com plements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or one which confers resistance to a drug, e.g., neomycin, geneticin, ampicillin, or hygromycin. 20 In a specific embodiment, the present invention relates to a process for producing HBP, wherein host cells containing a DNA sequence encoding mature HBP preceded by an N terminal extension are cultured in a suitable culture medium under conditions permitting ex pression of HBP, and the resulting HBP is recovered from the culture medium as N terminally extended HBP. 25 The N-terminal extension may be a sequence of from about 5 to about 25 amino acid resi dues, in particular from about 8 to about 15 amino acid residues. The nature of the amino acid residues in the N-terminal sequence is not believed to be critical. The N-terminal exten sion may suitably be the propeptide of HBP with the amino acid sequence Gly-Ser-Ser-Pro 30 Leu-Asp (SEQ ID NO:13) or prepropeptide Met-Thr-Arg-Leu-Thr-Val- Leu-Ala-Leu-Leu-Ala Gly-Leu-Leu-Ala-Ser-Ser-Arg-Ala-Gly-Ser-Ser-Pro-Leu-Leu-Asp (SEQ ID NO:14). In order to facilitate production of mature HBP, it is generally preferred that the DNA se quence encoding N-terminally extended HBP includes a DNA sequence encoding a protease WO 00/66627 PCT/DKOO/00216 13 cleavage site located between the DNA sequence encoding the N-terminal extension and the DNA sequence encoding mature HBP. Examples of suitable protease cleavage sites are an enterokinase cleavage site with the amino acid sequence or a Factor Xa cleavage site. 5 Alternatively, a nucleic acid sequence encoding the signal sequence and mature HBP may be inserted into a vector using the procedures described above. As a result, HBP may be isolated from the culture medium. The procedures used to ligate the nucleic acid sequences coding for HBP or the N-terminally 10 extended HBP, the promoter and the terminator, respectively, and to insert them into suitable vectors containing the information necessary for replication, are well known to persons skilled in the art (cf., for instance, Sambrook et al., op.cit.). The mammalian cell is a cell which can be cultured under anaerobic conditions after trans 15 fection with a nucleic acid encoding mammalian heparin-binding protein. In a more preferred embodiment, the mammalian cell is an adenovirus-transformed cell(s) or derived from an embryonic cell(s). As defined herein, a cell derived from an embryonic cell is a cell(s) ob tained from a primary culture of embryonic cells or a cell(s) from a cell line originally pas saged from a primary culture of embryonic cells. An example of such an adenovirus 20 transformed cell or embryonically-derived cell is a human embryonic kidney (HEK) cell(s), particularly HEK 293 cells. Methods for transfecting mammalian cells and expressing DNA sequences introduced in the cells are described in e.g., Kaufman and Sharp, 1982, J. Mol. Biol. 159:601-621; Southern 25 and Berg, 1982, J. Mol. Apple. Genet. 1:327-341; Loyter et al., 1982, Proc. Nati. Acad. Sci. USA 79:422-426; Wigler et al., 1978, Cell 14:725; Corsaro and Pearson, 1981, Somatic Cell Genetics 7:603, Graham and van der Eb, 1973, Virology 52:456; Fraley et al., 1980, JBC 225:10431; Capecchi, 1980, Cell 22:479; Wiberg et al., 1983,NAR 11:7287; and Neumann et al., 1982, EMBO J. 1:841-845. Insect cells may suitably be transfected with a baculovirus 30 vector as described in U.S. Patent No. 4,745,051. The medium used to culture the cells may be any conventional medium suitable for growing mammalian cells, such as a serum-containing or serum-free medium containing appropriate supplements, or a suitable medium for growing insect cells. Suitable media are available WO 00/66627 PCT/DKOO/00216 14 from commercial suppliers or may be prepared according to published recipes (e.g. in cata logues of the American Type Culture Collection). The cells are then screened for antibiotic resistance. Subsequently, the selected clones are subsequently assayed for HBP activity using assays known in the art such as a chemotaxis assay and assaying for cytokine release 5 from monocytes (see, for example, U.S. Patent No. 5,814,602). The selected clone may be further cultured in serum-free and optionally protein-free medium. Furthermore, it may be cultured in the presence of a bradykinin B-2 receptor antagonist. Ex amples include but are not limited to an anti-bradykinin B-2 receptor antibody (see, for ex 10 ample, Haasemann et al., 1991, J. Immunol. 147:3882-3992) or an antisense polynucleotide sequence against a gene for bradykinin receptor. The HBP produced by the cells may then be recovered from the culture medium by conven tional procedures including separating the host cells from the medium by centrifugation or 15 filtration, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e.g., ammonium sulphate, purification by a variety of chromatographic procedures, e.g., ion exchange chromatography, affinity chromatography, or the like. In a specific em bodiment, the N-terminally extended HBP is purified by chromatography on an agarose linked aprotinin column. 20 If the HBP is N-terminally extended HBP, after recovery from the culture medium, the N terminally extended HBP may advantageously be cleaved with a suitable protease to pro duce mature (and active) HBP. Examples of suitable enzymes include but are not limited to enterokinase and Factor Xa. 25 EXAMPLES Example 1: Expression of pro-HBP in Insect Cells 30 The procedure used to construct pSX556 is described in Rasmussen et al., 1996, FEBS Lett. 390:109-112). The following PCR primers are made: MHJ 2087: 5'-AAA AAG GAT CCA CCA TGA CCC GGC TGA CAG TCC TGG CCC TGC TGG CTG GTC TGC TGG CGT CCT CGA GGG CCG GCT CCA GCC CCC TTT TGG ACA 35 TCG TTG GCG GCC GGA AGG C-3' ((SEQ ID NO:15) WO 00/66627 PCT/DKOO/00216 15 MHJ 2089: 5'-AAA AAA GCT TCC TAG GCT GGC CCC GGT CCC GGA TTG TTT AAA ACG CCA TC -3' (SEQ ID NO:16) 5 MHJ 2087 codes for a BamHl site, the initiation codon and the prepro part of the human cDNA (Morgan, J.G. et al., 1991, J.Immun., 147:3210-3214) followed by the first 20 nucleo tides from the beginning of the mature part of the gene. 10 MHJ 2089 is complementary to the last 8 codons from the coding part of the HBP gene plus two extra codons according to the cDNA sequence cited above. It ends in a HindIll site. PCR is performed using the two primers following the scheme: 15 3 cycles 95 0 C 60 sec, 500C 120 sec, 720C 120 sec 12 cycles 950C 30 sec, 65 0 C 60 sec, 72*C 90 sec The PCR product, a 760 bp fragment, is isolated by electrophoresis on a 1% agarose gel, cut with BamHI and HindIll, and inserted into pSX221 cut with the same two enxymes. (pSX221 20 is a derivative of pUC19 (Yannisch-Perron, C. et al., 1985, Gene 33:103-119). The cloned DNA is verified by sequencing and the BamHI-Hindlll fragment is cut out, isolated, and in serted into pBlueBaclll (Invitrogen Corporation) for expression in insect cells. This fragment constains the entire codig region of HBP including a 19 residue signal peptide a seven amino acid pro-peptide, a mature part of 222 amino acids and a three amino acid C-terminal exten 25 sion. The resulting plasmid is termed pSX556. In order to generate a recombinant baculovirus expressing HBP the MAXBAC kit from Invi trogen Corp. (San Diego, CA) is used and all manipulations are done according to the in cluded Baculovirus Expression System Manual (version 1.5.5). Briefly, 1 pg og linearized 30 AcMNPV DNA and 3 ptg of pSX556 are co-transfected into Spodoptera frugiperda (SF9) in sect cells (2 x 106 cells in 60 mm dishes). The resulting culture supernatant is collected after 7 days. Fresh monolayers of SF9 cells in 100 mm plates are infected with virus supernatant at various dilutions and then overlaid with 1.5% agarose containing complete TNM-FH me dium with 150 pg/ml X-gal. After 8 days, 6 presumed recombinant plaques are identified by 35 their blue collar and used to infect a 6 well plate containing SF9 cells. After 5 days, the corre sponding virus DNA is purified and subjected to a PCR reaction with forward and reverse WO 00/66627 PCT/DKOO/00216 16 primers flanking the site of recombination in the virus DNA. After evaluation of the PCR products on agarose gel the corresponding most pure recombinant virus is subjected to an other round of plaque purification to ensure that the final recombinant virus stock is free of wildtype virus. The production of recombinant HBP is performed in insect cells (SF9 and 5 SF21) adapted to growth in serum-free SF900-Il medium (Gibco BRL/Life-Technologies). Typically, spinner cultures of 5 1 or a fermentor of 10 1, both types with a cell density of 1 x 10 6 /ml, are infected with a MOI of 1 and the medium is harvested 3 days post infection. Puri fication of HBP is carried out as described in U.S. Patent No. 5,814,602. 10 The HBP obtained from insect cells infected with the recombinant baculovirus is tested on SDS-PAGE. This HBP had a molecular weight slightly larger than native HBP purified from human blood. When the N-terminal sequence is determined, it appeared that nearly 100% of the produced material contained the pro-peptide of seven amino acids in front of the mature part indicateing that the insect cells are not able to process the pro-form (pro-HBP) in the 15 same manner as the human myeloid neutrophil precursor cells in the bone marow. Example 2: Expression of Apro-HBP in Insect Cells An oligonucleotide linker (see below) is made covering the first 99 bp of the HBP sequence 20 (from BamHl to Eagl) covering the signal peptide and the first four amino acids of mature HBP but excluding the part covering the proregion (from 73 to 87) and this is substituted for the original BamHl-Eagl in pSX556 giving rise to pSX559. The linker consisted of four oligonucleotides annealed pairwise to give the two following du plexes: 25 MHJ2568/LWN5746: 5'-GATCCACCATGACCCGGCTGACAGTCCTGGCCC-3' (SEQ ID NO:17) 3'-GTGGTACTGGGCCGACTGTCAGGACCGGGACGACC-5' (SEQ ID NO:18) LWN5745/MHJ2566: M0 5'-P-TGCTGGCTGGTCTGCTGGCGTCCTCGAGGGCCATCGTTGGC-3' (SEQ ID NO:19) 3'-GACCAGACGACCGCAGGAGCTCCCGGTAGCAACCGCCGG-5' (SEQ ID NO:20) SF9 cells are transfected with recombinant baculovirus and the HBP expressed is purified as described in Example 1. After N-terminal sequence determination, it is verified that now 90% had been processed correctly starting with Ile'. The remaining 10% had been proc- WO 00/66627 PCT/DKOO/00216 17 essed further downstream starting with Arg 5 . In order to compare the expression of pro-HBP and HBP, a time course experiment is carried out. Each of the first six days (minus day 5) postinfection aliquotes of the culture media are 5 removed and tested in HBP-specific ELISA. The mean value (n=3) of the maximal pro-HBP yield (on day 4) is set to 100%. It is found that HBP is expressed 2-3 times less efficiently than the pro-form. The optimal yield of pro-HBP is obtained four days postinfection whereas the yield of HBP remained nearly unchanged from day three to four. 10 Electrospray mass spectrum (ESMS) analysis of recombinant HBP shows a molecular weight of 27.237 + 3. The calculated value for the 225 amino acid HBP form (the mature part plus three amino acid C-terminal extension) is 24.268.6. Since HBP contains three potential glycosylation sites (Asn', Asn, 14 ,and Asn 145 ). This corresponds to a mass of 2.968for the glycan part(s). This is in turn consistent with the theoretical value for two Man3 15 [Fuc]GIcNAc2 units and one Man3GlcNAc2 unit. Example 3: Expression of pro-HBP in HEK 293 cells The following procedure is used in constructing the expression vector that is transfected into 20 HEK 293 cells. First, plasmid pSX556 is constructed according to the procedures described in Example 1. pSX556 is used as a template in a PCR reaction using the primers PBRa 246 5'-CCGGGGATCCAACTAGGCTGGCCCCGGTCCCGG-3' (SEQ ID NO:21) and 25 PBRa 247 (5'-CCGGGGATCCGATGACCCGGCTGACAGTCCTGG-3' (SEQ ID NO:22) with a Pfu polymerase according to manufacturer's instructions (Stratagene). After BamHl cleavage of the PCR reaction products, the fragments are ligated in correct orientation into the mammalian expression vector pcDNA3 (Invitrogen), linearized with BamHl, resulting in pcDNA3-HBP. 30 The following procedure is used in transfecting HEK 293 cells. The day before transfection, 5 x 10 5 HEK 293 cells are seeded in a 10 cm dish in 10 ml DMEM + 10% FCS + penicil lin/streptomycin. 20 g pcDNA3-HBP is transfected into HEK 293 cells by a modified calcium phosphate method (Chen and Okayama, 1987, Molecular and Cellular Biology 7: 2745- WO 00/66627 PCT/DKOO/00216 18 2752). Transfectants are selected in 600 g/ml Geneticin (Life Technologies). At confluence, the primary transfection-pool is tested positive for HBP expression by usage of a specific HBP sandwich-ELISA. The morphology of the transfected cells are similar to non transfected HEK 293 cells. The transfection-pool is subcloned by the limited dilution proce 5 dure and the best clone (1/E-1 1) is in T-25 flask scale able to produce 11.5 g HBP/ml/day. Specifically, 300 cells are seeded in 5 x 96 well plates and cell clones (subclones) originating from one cell are tested for expression. In order to characterize the produced HBP material, clone 1/E-11 is grown in monolayer cul 10 ture in serum-free medium for six days with renewing of the medium every day. The HBP su pernatant concentration is 8 mg/I as measured by the integration area from the HPLC (using baculovirus HBP as standard). Agarose linked aprotinin is used for purification and eluted with 1 M NaCl. This single step purification yields a 99% pure sample, judged by HPLC analysis. When the N-terminal sequence is determined, it appears that nearly 100% of the 15 produced material contains the pro-peptide of 7 amino acids in front of the mature part indi cating that the HEK 293 cells are not able to process the pro-form (pro-HBP) in the same manner as the human myeloid neutrophil precursor cells in the bone marrow. As described in Example 1, the same observation is made when HBP is expressed in the baculovi rus/insect cell system. The Mr is determined to be 31693 by MALDI, thus, the glycan part 20 having a mass of 6755. Assuming all three N-linked glycosylation site occupied this mass could correspond to three di-sialyated-, galactosylated biantennary structures, numerous other possibilities are naturally possible, however, in all cases, HEK 293 cell HBP seems to possess complex-type native N-linked oligosaccharides. 25 Example 4: Expression of mature HBP in HEK 293 cells The following procedure is used in constructing the expression vector that is transfected into HEK 293 cells. First, plasmid pSX559 is constructed using procedure described in Example 2. 30 pSX559 is used as a template in a PCR reaction using the primers PBRa 246 5'-CCGGGGATCCAACTAGGCTGGCCCCGGTCCCGG-3' (SEQ ID NO:21) and PBRa 247 (5'-CCGGGGATCCGATGACCCGGCTGACAGTCCTGG-3' (SEQ ID NO:22) WO 00/66627 PCT/DKOO/00216 19 with a Pfu polymerase according to manufacturer's instructions (Stratagene). After BamHl cleavage of the PCR reaction products, the fragments are ligated in correct orientation into the mammalian expression vector pcDNA3 (Invitrogen), linearized with BamHl, resulting in pcDNA3-HBPApro. 5 pcDNA3-HBPApro is transfected into HEK 293 cells and the confluent transfection-pool is tested positive for HBP expression by HBP-ELISA. The following procedure is used in trans fecting HEK 293 cells. The day before transfection, 5 x 105 HEK 293 cells are seeded in a 10 cm dish in 10 ml DMEM + 10% FCS + penicillin/streptomycin. 20 g pcDNA3-HBPApro is 10 transfected into HEK 293 cells by a modified calcium phosphate method (Chen and Oka yama, 1987, Molecular and Cellular Biology 7: 2745-2752). Transfectants are selected in 600 g/ml Geneticin (Life Technologies). At confluence, the primary transfection-pool is tested positive for HBP expression by usage of a specific HBP sandwich-ELISA. The morphology of the transfected cells are similar to non-transfected HEK 293 cells. The transfection-pool is 15 subcIoned by the limited dilution procedure. Specifically, 300 cells are seeded into five 96 well plates and cell clones (subclones) originating from one cell are tested for expression. By the limited dilution procedure, a best clone, 3/E-4 (3.25 g HBP/ml/day), is isolated. In order to characterize the produced HBP, clone 3/E-4 is grown in serum-free medium in 20 monolayer culture with renewing of the medium every day. The medium is filtered using Sar torius filters and purified as previously described on a CM-sepharose fast flow column. 0.2 mg pure HBP is isolated. 10 pg is further purified for N-terminal sequencing and mass detec tion by small scale preparative HPLC. 95% of the purified HBP possessed the right N terminal sequence (IVGGRKARPRQFPFL, SEQ ID NO:23), however, the remaining 5% 25 showed a truncation starting at amino acid no. five (RKARPRQFPFLASIQN, SEQ ID NO:24), this N-terminal truncation is consistent with baculovirus/insect cell HBP findings described in Example 1. The MALDI (matrix assisted laser desorption ionization)and ESMS (electrospray mass spectroscopy) mass detection gave both broad peaks with an average mass of (Mw) 30550. This gives the glycan part a mass of approximately 6300. 30 Example 5: Biological activity of HEK 293-produced mature HBP In order to compare the biological activity of HEK 293 produced mature HBP with insect cell derived mature HBP, both recombinant forms are tested in the monocyte/lL6 assay: Human WO 00/66627 PCT/DKOO/00216 20 monocytes are isolated from buffy-coats of normal blood. In 24-well plates, 2 x 105 cells per well are seeded in 1 ml of DMEM medium containing 2 mM Glutamax, 1% non-essential amino acids, and 1 mg/ml BSA. LPS (from E. coli, Sigma) and recombinant HBP are added as indicated in Table 1. After incubation for 24 h at 37 0 C (5% CO 2 ), cell supernatants are col 5 lected , clarified by centrifugation, and stored at -20 0 C until used for assay of their IL-6 con tent. 11-6 determination is carried out by using the Biotrek ELISA system (Amersham Phar macia Biotech). As seen in Table I, the LPS induced IL-6 release is increased with increasing amounts of in 10 sect-HBP. However, in the presence of only 2 g HEK 293-HBP the LPS-induced IL-6 re lease is about the same as seen in the presence of 10 g insect-HBP. This indicates that the specific activity of HEK 293 mature HBP is about 5 times higher than the specific activity of insect derived mature HBP. This increase in specific activity is most likely due to the more complex-type N-linked gycosylation pattern which is performed by the mammalian HEK 293 15 cells.

WO 00/66627 PCT/DKOO/00216 21 Table I +/- 10 ng LPS IL-6 (pg/ml) 5 monocytes alone 920 + 3575 + 2 g insect-HBP 890 10 + 4200 + 5 g insect-HBP 1120 + 8050 15 + 10 g insect-HBP 1575 + 11800 + 2 g HEK 293-HBP 1000 + 12550 20 Example 6: Glucose consumption and lactate generation in HBP producing HEK 293 cell lines. In order to examine how the metabolism of stable HEK 293 transfectants producing HBP is 25 affected by the HBP product itself, the glucose consumption and lactate generation in three different HEK 293 cell lines: 1) HEK 293 cell line (control); 2) 1/C-6 (clone, generated in ex actly the same way as 1/E-1 1 in Example 3, producing pro-HBP; 3) 3/E-4 (clone, described in Example 4, producing mature HBP) are measured using KODAK EKTACHEM DT 6011 equipment. Two media are used: Dulbecco's Modified Eagle Medium (DMEM) with 4500 mg/I 30 glucose (Life Technologies) with 10% FCS and a protein-free synthetic medium. The results are shown in Table II: WO 00/66627 PCT/DKOO/00216 22 Table il Glucose (mg/I) Lactate (mg/l) 5 Fresh DMEM medium 3690 153 After 20 hours cultivation: HEK 293 2358 1215 0 1/C-6 1836 1620 3/E-4 1296 1935 Fresh protein-free medium 4158 63 5 After 4 hours cultivation: HEK293 3888 450 1/C-6 3654 540 ?0 3/E-4 3258 855 After 18 hours cultivation: HEK 293 2448 1440 ?5 1/C-6 3/E-4 1926 1305 As shown in Table 11, the glucose consumption and lactate production are increased in the HBP producing HEK 293 cell lines in both media. It is also observed that the 3/E-4 cell line, 30 which produce mature HBP, has the highest glucose consumption and lactate production in the DMEM medium and in the protein-free medium after 4 hours cultivation. After 18 hours the lactate concentration in the 3/E-4 protein-free medium is the smallest one due to lactate degradation.

WO 00/66627 PCT/DKOO/00216 23 The results presented in Table II indicate that HBP, when it localizes around the mitochon dria in the HBP producing HEK 293 cells, in some way shuts down the oxygen dependent mitochondrial ATP generation. As a consequence hereof, the generation of ATP is shifted to take place solely by anaerobic glycolysis that can take place in the HEK 293 cells due to their 5 embryonic origin. Example 7: Construction of pDC312-HBPApro The following procedure is used for the construction of pDC312-HBP pro. First, plasmid 10 pSX559 is constructed using the procedure described in Example 2. pSX559 is used as a template in a PCR reaction using the primers ViLil 18 5'-CCGGGATCCTAGTCCCACCATGACCCGGCTGACA-3' (SEQ ID NO:25) and ViLil 19 5'-GCGCGCGGCCGCCTAGGCTGGCCCCGG-3' (SEQ ID NO:26) 15 with a PfX polymerase according to manufacturer's instructions (Life Technologies). The generated PCR fragments are digested with the restriction enzymes BamHl and Notl. The digested fragments are gel-purified and ligated in correct orientation into the mammalian ex pression vector pDC312 (Immunex), also digested with BamHl and Notl, resulting in pDC312-HBPApro. 20 pDC312-HBPApro is transfected into HEK 293 cells and the confluent transfection-pool is tested positive for HBP expression by HBP-ELISA. The following procedure is used in trans fecting HEK 293 cells. The day before transfection, 5 x 105 HEK 293 cells are seeded in a 10 cm dish in 10 ml DMEM + 10% FCS + penicillin/streptomycin. 20 g pcDNA3-HBPApro is 25 transfected into HEK 293 cells by a modified calcium phosphate method (Chen and Oka yama, 1987, Molecular and Cellular Biology 7: 2745-2752). Transfectants are selected in 0.25 M methotrexate (MTX) (Life Technologies). At confluence, the primary transfection pool is tested positive for HBP expression by usage of a specific HBP sandwich-ELISA. The morphology of the transfected cells are similar to non-transfected HEK 293 cells. The trans 30 fection-pool is subcloned by the limited dilution procedure. Specifically, 300 cells are seeded into five 96 well plates and cell clones (subclones) originating from one cell are tested for ex pression. By the limited dilution procedure, a best clone, 3/E-4 (9.4 g HBP/ml/day), is iso lated.

WO 00/66627 PCT/DKOO/00216 24 In order to characterize the produced HBP, clone 3/E-4 is grown in serum-free medium in monolayer culture with renewing of the medium every day. The medium is filtered using Sar torius filters and purified as previously described on a CM-sepharose fast flow column. 0.2 mg pure HBP is isolated. 10 pg is further purified for N-terminal sequencing and mass detec 5 tion by small scale preparative HPLC. 95% of the purified HBP possessed the right N terminal sequence (IVGGRKARPRQFPFL, SEQ ID NO:27), however, the remaining 5% showed a truncation starting at amino acid no. five (RKARPRQFPFLASIQN, SEQ ID NO:28), this N-terminal truncation is consistent with baculovirus/insect cell HBP findings described in Example 1. The MALDI (matrix assisted laser desorption ionization)and ESMS (electrospray 10 mass spectroscopy) mass detection gave both broad peaks with an average mass of (MW) 30550. This gives the glycan part a mass of approximately 6300. 15 Example 8: Hollow-Fiber Cell Culture System The 293 cells (4.037 x 102), HBP 293 3/B-5 # / 0, are cultivated in Spinner bottles (Techne, Cambridge, UK) before inoculation into the extra capillary (EC) space of the hollow fiber cartridge (two bioreactors, 10 Kd mol wt cut-off, 1,5 M 2 ) in an automated cell culture 20 system (AcuSyst Maximaizer, CELLEX Biosciences, Inc., Minneapolis, USA). This cell line had been tested and found to be free of mycoplasma (GEN-PROBE, Gen-Probe Incorpo rated, San Diego, USA). The starting control parameters are: Temperature = 36,5 0C; pH = 7,10; P 0 2 = 120 Hg/mm. 293 SFM II medium (Life Technologies, Paisley, UK) with the addi tion of 3.5 mM Glutamine (Life Technologies, Paisley, UK), containing dissolved gases are 25 pumped (Circulation pump) through the interior of the fibers 250 ml/min and flowed across the membranes into the EC space. The media flow (media pump) is 50 ml/hr and is in creased to 100 ml/hr after one day of cultivation, to 200 mI/hr after 2-20:08 (2 days, 20 hrs, 8 minutes) days, to 250 ml/hr after 3-19:40 days (3 days, 19 hrs, 40 min.), to 300 ml/hr after 4 20:39 days, to 400 ml/hr after 8-23:15 days, to 450 ml/hr after 19-18:41 days, to 500 ml/hr 30 after 22-01:16 days, to 550 ml/hr after 24-18:46 days, to 600 ml/hr after 24-19:06 days, to 650 ml/hr after 30-20:43 days and to 700 ml/hr after 33-01:03 days. Continuous harvest and feeding of the EC chamber is started after 8-22:59 days with 2 ml/hr. The run is finished after 34-23:01 days and a total of 1529 ml of harvest is collected. 35 The following procedure is used to purify HBP from HEK293 suspensions. The suspension is adjusted to pH 8.5 with 1M NaOH and subsequently filtered on a GF/A filter. The column WO 00/66627 PCT/DKOO/00216 25 (SP 16/10) is equilibrated in 30mM Tris pH 8.5, and the flow rate is 4 ml/min. The application is loaded and ished out with equilibration buffer. HBP is eluted with an NaC gradient. HBP elutes at about 0.9M NaCl. The pool is collected and quantified on a C4 analytical column. The results are shown in Table Ill. 5 Table Ill Batch Volume Conc. Total in Total in pool Yield no. susp. susp. susp. / mg / % / ml / g/I / mg 000301 260 0.3 78 65 83 8/3-2000 155 0.4 62 50 81 8/3-2000 200 0.4 80 60 75 000314 150 0.3 45 80 177 000314 130 0.3 39 55 141 000315 34 - - Ca.5 000317 150 0.3 45 50 111 000320 165 0.3 50 50 100 10 About 400 mg are collected in total. The concentration of HBP has been 0.3-0.4 g/l. All the batches look alike on the preparative purification and on the analytical HPLC. The first batch is analysed additional with MS and sequence. The mass is found to 30,5kD and some dimmer is found too. The sequence correlated to the expected HBP (15 runs). 15 On SDS a strong band at 36 kD appears, and two weak bands at 10-20 kD are also visible. The invention described and claimed herein is not to be limited in scope by the specific em bodiments herein disclosed, since these embodiments are intended as illustrations of several aspects of the invention. Any equivalent embodiments are intended to be within the scope of 20 this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing descrip tion. Such modifications are also intended to fall within the scope of the appended claims. Various references are cited herein, the disclosure of which are incorporated by reference in 25 their entireties.

Claims (22)

1. A method for producing a mammalian heparin-binding protein in a mammalian cell that can be cultured under anaerobic conditions after introducing a nucleic acid encoding 5 said heparin-binding protein into said cell with comprising (a) introducing into said mammalian cell a nucleic acid encoding said heparin-binding protein; (b) culturing the cell of step(a) under conditions conducive to expression of said HBP; and 0 (c) recovering said HBP from the culture medium.

2. The method according to claim 1, in which the mammalian heparin-binding protein is a human or porcine HBP. 15

3. The method according to claim 1, in which the HBP recovered from the culture me dium has an amino acid sequence which has at least about an 80% identity with the amino acid sequence set forth in SEQ ID NO: 1 or 2 or an allelic or natural variant thereof.

4. The method according to claim 1, in which a nucleic acid sequence which hybridizes 20 to the nucleic acid sequence set forth in SEQ ID NO: 3, 4, 5, 7, 9 or 11; (ii) its complementary strand, or (iii) a subsequence of (a) or (b) is introduced into said mammalian cell.

5. The method according to claim 1, in which the HBP recovered from the culture me dium has an amino acid sequence set forth in SEQ ID NO: 1 or 2. 25

6. The method according to claim 1, in which a nucleic acid sequence set forth in SEQ ID NO: 3, 4, 5, 7, 9 or 11 is introduced into said mammalian cell.

7. The method according to claim 1, in which the nucleic acid sequence encodes a ma 30 ture HBP preceded by a signal sequence.

8. The method according to claim 1, in which the cell of step (a) comprises a nucleic acid sequence encoding a heparin-binding protein pro-sequence and a mature heparin binding protein, in which the nucleic acid sequence encoding the N-terminally extended WO 00/66627 PCT/DKOO/00216 27 heparin-binding protein includes a nucleic acid sequence encoding a protease cleavage site located between the nucleic acid sequence encoding the N-terminal extension and the nu cleic acid sequence encoding mature heparin-binding protein. 5

9. The method according to claim 7, which further comprises cleaving the N-terminally extended HBP to obtain mature HBP.

10. The method according to claim 1, in which the cell of step (a) comprises a nucleic acid sequence encoding a heparin-binding protein signal sequence, heparin-binding pro 0 sequence, mature heparin-binding protein and a nucleic acid sequence encoding a protease cleavage site located between the nucleic acid sequence encoding the heparin-binding pro tein pro-sequence and the nucleic acid sequence encoding the mature heparin-binding pro tein. 5

11. The method according to claim 9, which further comprises cleaving the N-terminally extended HBP to obtain mature HBP.

12. The method according to claim 1, wherein the host cell is an adenovirus transformed cell. ?0

13. The method according to claim 1, wherein the host cell is an embryonically-derived cell.

14. The method according to claim 1, wherein the host cell is an human embryonic kid 25 ney cell.

15. The method according to claim 1, wherein the host cell is an human embryonic kid ney 293 cell. 30

16. The method according to claim 1, which further comprises purifiying said heparin binding protein.

17. A method for producing said mammalian HBP comprising : (a) introducing a nucleic acid encoding a heparin-binding protein into a mammalian host cell(s) that can be cultured WO 00/66627 PCT/DKOO/00216 28 under anaerobic conditions after introducing into said cell(s) said nucleic acid, (b) selecting a mammalian host cell of step (a) comprising a nucleic acid encoding said heparin-binding pro tein; (c) culturing said host cell in serum-free and optionally protein-free culture medium and (d) isolating said heparin-binding protein. 5

18. The method according to claim 16 which further comprises purifying said heparin binding protein.

19. A recombinant mammalian host cell which can be cultured under anaerobic condi 0 tions after introducing a nucleic acid encoding a mammalian heparin-binding protein has been introduced into said cell, comprising a nucleic acid sequence encoding said heparin binding protein.

20. The recombinant mammalian host cell according to claim 18, wherein the nucleic 5 acid sequence encodes a human heparin-binding protein.

21. The recombinant mammalian host cell according to claim 18, in which the nucleic acid sequence encodes a mature HBP preceded by a signal sequence. 20

22. The recombinant mammalian host cell according to claim 18, wherein the recombi nant host cell is a human embryonic kidney 293 cell.