AU3653599A - Gene encoding syntaxin interacting protein - Google Patents
Gene encoding syntaxin interacting protein Download PDFInfo
- Publication number
- AU3653599A AU3653599A AU36535/99A AU3653599A AU3653599A AU 3653599 A AU3653599 A AU 3653599A AU 36535/99 A AU36535/99 A AU 36535/99A AU 3653599 A AU3653599 A AU 3653599A AU 3653599 A AU3653599 A AU 3653599A
- Authority
- AU
- Australia
- Prior art keywords
- synip
- rna
- cells
- dna sequence
- isolated
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Diabetes (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Emergency Medicine (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Obesity (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Endocrinology (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Plant Pathology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Description
WO 99/54465 PCTIUS99/08568 -1 GENE ENCODING SYNTAXIN INTERACTING PROTEIN BACKGROUND OF THE INVENTION The present invention relates to novel genes and polypeptides derived therefrom encoding a syntaxin interacting protein. The invention also describes 5 vectors and host cells comprising the novel gene. The invention further describes methods for using the novel gene, polypeptides, and antibodies specifically targeting the polypeptides, in the detection of genetic deletions of the gene, subcellular localization of the polypeptide, isolation of discrete classes of RNA, gene therapy applications, diagnostics for syndromes involving abnormal levels of 10 glucose or abnormal GLUT4 translocation, development of proprietary screening strategies for inhibitors of syntaxin interacting protein. SUMMARY OF THE RELATED ART Insulin stimulation of glucose transport in the major insulin responsive cell types, muscle, skeletal and fat, occurs by the recruitment of glucose transporters, 15 in particular GLUT4, from the intracellular low density microsomal compartment to the cell surface. A certain class of proteins have been implicated in the insulin induced translocation of GLUT4 to the plasma membrane. This class of proteins have been referred to as SNARE proteins. SNARE proteins are vesicle membrane and target membrane soluble 20 N-ethylmaleidide-sensitive factor attachments protein receptors. SNARE proteins identified in the vesicle membrane, or v-SNAREs, are synaptobrevin or VAMP. SNARE proteins identified in the target membrane, or t-SNAREs, are syntaxin and SNAP-25. Recent studies have demonstrated that isoforms of syntaxin, namely 25 syntaxin-4, and VAMP, namely VAMP2 and VAMP3/cellubrevin, are required functional t-SNAREs and v-SNAREs for the insulin-stimulated GLUT4 translocation to the plasma membrane. GLUT4 translocation plays an important role in the uptake of glucose by cells, which in turn plays an important role in WO 99/54465 PCT/US99/08568 -2 disease states characterized by abnormal glucose uptake. By gaining an understanding of the biochemical mechanisms behind these required v- and t-SNAREs and their effect on insulin-stimulated GLUT4 translocation, new opportunities for treating and diagnosing diseases related to abnormal (high or 5 low) storage and/or utilization of glucose, may be achieved. Stated another way, a better understanding of the molecular mechanisms of glucose transport will allow improved design of therapeutic drugs that treat diseases related to abnormal storage and/or utilization of glucose. Such disease states include diabetes, glycogen storage diseases, obesity, polycystic ovarian syndrome, hypertension, 10 atherosclerosis and other diseases of insulin-resistance. SUMMARY OF THE INVENTION The invention relates to the discovery and purification of a novel target membrane protein (SNARE) syntaxin-4 interacting protein ("SYNIP") and the isolation of polynucleotide sequences encoding the proteins. SYNIPs are of 15 interest because they may play an important role in the translocation of GLUT4 from the intracellular compartment to the cell surface in response to the presence of insulin. SYNIPs competitively bind to syntaxin-4 and prevent the ligand from interacting with its cognate intracellular receptor. This property of SYNIPs has profound physiological effects. Thus, by regulating the intracellular levels of the 20 subject SYNIPs, desirable physiological effects may be obtained. Such effects may be used to treat a variety of diseases involving abnormal levels of glucose or the abnormal translocation of GLUT4 (ie, disease states include, but are not limited to diabetes, glycogen storage diseases, obesity, polycystic ovarian syndrome, hypertension, atherosclerosis and other diseases of insulin-resistance). 25 The rationale for the therapeutic use of SYNIP to design or discover treatment for these diseases is based upon the general disregulation of glucose transport in such states. Numerous studies have shown that the stimulation of glucose transport by insulin is significantly reduced in Type II diabetes and other states of insulin resistance. Thus, pharmacological or genetic approaches to WO 99/54465 PCT/US99/08568 -3 alleviating this deficiency will have a major impact on the diseases described above. One aspect of the invention is to provide purified SYNIPs. The purified proteins may be obtained from either recombinant cells or naturally occurring 5 cells. The purified SYNIPs of the invention may be mammalian in origin. Primate, including human-derived SYNIPs are examples of the various SYNIPs specifically provided for. The invention also provides allelic variants and biologically active derivatives of naturally occurring SYNIPs. Another aspect of the invention is to provide polynucleotides encoding the 10 SYNIPs of the invention and to provide polynucleotides complementary to polynucleotide coding strand. The polynucleotides of the invention may be used to provide for the recombinant expression of SYNIPs. The polynucleotides of the invention may also be used for genetic therapy purposes so as to treat diseases related to intracellular receptors that bind ligands that bind to SYNIPs, used in the 15 detection of genetic deletions of the polynucleotide, subcellular localization of the polypeptide, and isolation of discrete classes of RNA. The invention also provides polynucleotides for use as hybridization probes and amplification primers for the detection of naturally occurring polynucleotides encoding SYNIPs. Another aspect of the invention is to provide antibodies capable of binding 20 to the SYNIPs of the invention. The antibodies may be polyclonal or monoclonal. The invention also provides methods of using the subject antibodies to detect and measure expression of SYNIPs either in vitro or in vivo, or for detecting proteins that interact with SYNIPs, or molecules that regulate any of the activities of SYNIPs. 25 Another aspect of the invention is to provide assays for the detection or screening of therapeutic compounds that interfere with the interaction between SYNIPs and syntaxin-4 (or other ligands that bind to SYNIPs). The assays of the invention comprise the step of measuring the effect of a compound of interest on binding between SYNIPs and syntaxin-4 (or other ligands that bind to SYNIPs). 30 Binding may be measured in a variety of ways, including the use of labeled SYNIPs or labeled ligands. Another aspect of the invention is to provide assays for the discovery of proteins that interact directly or indirectly with SYNIPs. The assays of the WO 99/54465 PCT/US99/08568 -4 invention comprise a method for detecting such interactions in cells, or in biochemical assays. These interactions may be detected in a variety of ways, including the use of the cDNA encoding SYNIPs, or SYNIPs themselves, or fragments or modifications thereof. 5 The foregoing is not intended and should not be construed as limiting the invention in any way. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this invention belongs. All U.S. patents and all publications mentioned herein are incorporated in their entirety by reference thereto. 10 BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Cloning, characterization of SYNIP expression and specificity of binding. A) Deduced amino acid sequences of the single open reading frame in the isolated SYNIP cDNA. B) Predicted structural organization of SYNIP functional domains. The numbers on the top indicate the amino acid residues that define the 15 boundaries of these domains. C) Northern blot analysis of SYNIP mRNA expression in mouse tissues. The mouse multiple tissue mRNA blot was probed with the coding sequences of SYNIP cDNA. H, heart; Br, brain; Sp, spleen; Lu, lung; Li, liver; Sk, skeletal muscle; K, kidney; Te, testis. D) Specificity of SYNIP/WT and SYNIP/CT binding to Syntaxin 4. Cell lysates from 293T cells 20 overexpressing Flag-tagged wild type SYNIP (SYNIP/WT) or the carboxyl terminal SYNIP (SYNIP/CT) were incubated with equal amounts of GST (lane 1), GST-SynlA (lane 2), GST-SynlB (lane 3), GST-Syn2 (lane 4), GST Syn3 (lane 5) and GST-Syn4 (lane 6) proteins immobilized on Glutathion-agarose beads. The retained proteins were immunoblotted with anti-Flag antibody. The 25 SYNIP and cDNA sequence have been deposited in GeneBank. Accession number XXXXXX. Figure 2. Insulin stimulation induces a dissociation of SYNIP from syntaxin-4 in vivo. CHO/IR cells were transfected with the full-length SYNIP (SYNIP/WT), the amino terminal SYNIP domain (SYNIP/NT) or the carboxyl 30 terminal SYNIP domain (SYNIP/CT) and stimulated with and without insulin.
WO 99/54465 PCT/US99/08568 -5 A) Cell lysates were prepared and immunobloted with the Flag antibody. B) Cell lysates were immunoprecipitated with a syntaxin-4 antibody and immunoblotted with the Flag antibody. C) The immunoprecipitates in (B) were immunoblotted with the syntaxin-4 antibody. 5 Figure 3. Insulin stimulation results in a decreased affinity of SYNIP for syntaxin-4. CHO/IR cells were transfected with the full-length SYNIP (SYNIP/WT), the amino terminal SYNIP domain (SYNIP/NT) or the carboxyl terminal SYNIP domain (SYNIP/CT) and stimulated with and without insulin. A) Cell lysates were prepared and immunobloted with the Flag antibody. B) Cell 10 lysates were incubated with the GST-Syn4 fusion protein and the resultant precipitates were immunoblotted with the Flag antibody. C) Cell lysates were incubated with the GST-SYNIP fusion protein and the resultant precipitates were immunoblotted with the syntaxin-4 antibody. D) Cell lysates were incubated with various amounts of the GST-Syn4 fusion protein and the resultant precipitates 15 were immunoblotted with the Flag antibody. Figure 4. Insulin induces dissociation of the SYNIP:syntaxin-4 complex in differentiated 3T3L1 adipocytes. Differentiated 3T3L1 adipocytes were transfected with the full-length SYNIP (SYNIP/WT) or the carboxyl terminal SYNIP domain (SYNIP/CT) and stimulated with and without insulin. A) Cell 20 lysates were prepared and immunobloted with the Flag antibody. B) The cell lysates were then incubated with the GST-Syn4 fusion protein and the resultant precipitates were immunoblotted with the Flag antibody. Figure 5. Expression of a dominant-interfering mutant of SYNIP inhibits insulin-stimulated glucose transport. A) Differentiated 3T3Ll adipocytes were 25 electroporated with various amounts of pcDNA3.1 -LacZ and transfection/expression efficiency assessed by X-Gal staining for P-galactosidase expression. Under each electroporation condition the total amount of plasmid DNA was 600 gg maintained by the addition of the pcDNA3.1 empty vector. B) Differentiated 3T3Ll adipocytes were electroporated with either empty vector 30 or various SYNIP cDNA constructs and the rate of basal (open bars) and insulin stimulated (solid bars) 2-deoxyglucose transport was determined.
WO 99/54465 PCTIUS99/08568 -6 Figure 6. Expression of a dominant-interfering mutant of SYNIP inhibits insulin-stimulated GLUT4 but not GLUT 1 translocation. A) Differentiated 3T3L1 adipocytes were co-transfected with GLUT4-eGFP and various SYNIP cDNAs. B) Differentiated 3T3L1 adipocytes were co-transfected with eGFP 5 GLUT 1 and various SYNIP cDNAs. The subcellular localization of GLUT4-eGFP and eGFP-GLUT1 was determined in control and insulin stimulated cells by confocal fluorescence microscopy. Figure 7. Hypothetical model for the insulin-dependent regulation of SYNIP function and GLUT4 translocation. 10 DETAILED DESCRIPTION OF THE INVENTION Within this application, unless otherwise stated, the techniques utilized may be found in any of several well-known references such as: Molecular Cloning: A Laboratory Manual (Sambrook et al., 1989, Cold Spring Harbor Laboratory Press), Gene Expression Technology (Methods in Enzymology, 15 Vol. 185, edited by D. Goeddel, 1991. Academic Press, San Diego, CA), "Guide to Protein Purification" in Methods in Enzymology (M.P. Deutshcer, ed., (1990) Academic Press, Inc.); PCR Protocols: A Guide to Methods and Applications (Innis et al., 1990, Academic Press, San Diego, CA), Culture of Animal Cells: A Manual of Basic Technique, 2nd ed. (R.I. Freshney, 1987, Liss, Inc. New York, 20 NY), and Gene Transfer and Expression Protocols, pp. 109-128, ed. E.J. Murray, The Humana Press Inc., Clifton, NJ). In one aspect, the present invention provides novel isolated and purified polynucleotides, hereinafter referred to as syntaxin-4 interacting ("SYNIP") protein genes, encoding SYNIPs. The term "syntaxin-4" is used broadly herein. 25 Unless noted otherwise, the term "syntaxin-4" include, but is not limited to, any natural mammalian-derived form of syntaxin-4 and the like. It is preferred that the term syntaxin-4 include primates and humans. Also, the term "interacting" is used broadly herein. Unless noted otherwise, the term "interacting" includes, but is not limited to, binding, affecting, and regulating.
WO 99/54465 PCT/US99/08568 -7 The polynucleotides provided for may encode complete SYNIPs or portions thereof. The polynucleotides of the invention may be produced by a variety of methods including in vitro-chemical synthesis using well-known solid phase synthesis technique, by cloning or combinations thereof. The 5 polynucleotide of the invention may be derived from cDNA or genomic libraries. Persons of ordinary skill in the art are familiar with the degeneracy of the genetic code and may readily design polynucleotides that encode SYNIPs that have either partial or polynucleotide sequence homology to naturally occurring polynucleotide sequences encoding SYNIPs. The polynucleotides of the invention 10 may be single stranded or double stranded. Polynucleotide complementary to polynucleotides encoding SYNIPs are also provided. Polynulceotide encoding a SYNIP can be obtained from cDNA libraries prepared from tissue believed to possess SYNIP mRNA and to express it at a detectable level. For example, cDNA library can be constructed by obtaining 15 polyadenylated mRNA from a cell line known to express SYNIP, and using the mRNA as a template to synthesize double stranded cDNA. Libraries, either cDNA or genomic, are screened with probes designed to identify the gene of interest or the protein encoded by it. For cDNA expression libraries, suitable probes include monoclonal and polyclonal antibodies that 20 recognize and specifically bind to a SYNIP. For cDNA libraries, suitable probes include carefully selected oligonucleotide probes (usually of about 20-80 bases in length) that encode known or suspected portions of a SYNIP from the same or different species, and/or complementary or homologous cDNAs or fragments thereof that encode the same or a similar gene, and/or homologous genomic 25 DNAs or fragments thereof. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures as described in Chapters 10-12 of Sambrook et al., Molecular Cloning: A Laboratory Manual, New York, Cold Spring Harbor Laboratory Press, 1989). A preferred method of practicing this invention is to use carefully selected 30 oligonucleotide sequences to screen cDNA libraries from various tissues. The oligonucleotide sequences selected as probes should be sufficient in length and sufficiently unambiguous that false positives are minimized. The actual nucleotide sequence(s) is/are usually designed based on regions of a SYNIP that have the WO 99/54465 PCT/US99/08568 -8 least codon redundance. The oligonucleotides may be degenerate at one or more positions. The use of degenerate oligonucleotides is of particular importance where a library is screened from a species in which preferential codon usage is not known. 5 The oligonucleotide must be labeled such that it can be detected upon hybridization to DNA in the library being screened. The preferred method of labeling is to use ATP (eg, T32P) and polynucleotide kinase to radiolabel the 5' end of the oligonucleotide. However, other methods may be used to label the oligonucleotide, including, but not limited to, biotinylation or enzyme labeling. 10 cDNAs encoding SYNIPs can also be identified and isolated by other known techniques of recombinant DNA technology, such as by direct expression cloning or by using the polymerase chain reaction (PCR) as described in US Patent No. 4,683,195, in Section 14 of Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, 15 New York, 1989, or in Chapter 15 of Current Protocols in Molecular Biology, Ausubel et al., eds., Green Publishing Associates and Wiley-Interscience, 1991. This method requires the use of oligonucleotide probes that will hybridize to DNA encoding a SYNIP. In a preferred embodiment, the invention comprises DNA sequences 20 substantially similar to those shown in SEQ ID 1 or 6 (mouse SYNIP polynucleotides) and SEQ ID 3 or 4 (human SYNIP polyneucleotides). As defined herein, "substantially similar" includes identical sequences, as well as deletions, substitutions or additions to a DNA, RNA or protein sequence that maintain the function of the protein product and possess similar zinc-binding motifs. 25 Preferably, the DNA sequences according to the invention consist essentially of the DNA sequence of SEQ ID 1, 3, 4, or 6. These novel purified and isolated DNA sequences can be used to direct expression of SYNIP and for mutational analysis of SYNIP function. Mutated sequences according to the invention can be identified in a routine 30 manner by those skilled in the art using the teachings provided herein, and techniques well-known in the art.
WO 99/54465 PCT/US99/08568 -9 In a preferred embodiment, the present invention comprises a nucleotide sequence that hybridizes to the nucleotide sequence shown in SEQ ID 1, 3, 4, or 6 under high stringency hybridization conditions. As used herein, the term "high stringency hybridization conditions" refers to hybridization at 65'C in a low salt 5 hybridization buffer to the probe of interest at 2 x 108 cpm/g for between about 8 hours to 24 hours, followed by washing in 1% SDS, 20 mM phosphate buffer and 1 mM EDTA at 65'C, for between about 30 minutes to 4 hours. In a preferred embodiment, the low salt hybridization buffer comprises between, 0.5-10% SDS, and 0.05 M and 0.5 M sodium phosphate. In a most preferred embodiment, the 10 low salt hybridization buffer comprises, 7% SDS, and 0.125 M sodium phosphate. The polynucleotides of the invention have a variety of uses, some of which have been indicated or will be addressed in greater detail, infra. The particular uses for a given polynucleotide depend, in part, on the specific polynucleotide embodiment of interest. The polynucleotides of the invention may be used as 15 hybridization probes to recover SYNIP encoding polynucleotides or a portion thereof from genetic libraries. The polynucleotides of the invention may also be used as primers for the amplification of SYNIP encoding polynucleotides or a portion thereof through the polymerase chain reaction (PCR) and other similar amplification procedures. The polynucleotides of the invention may also be used 20 as probes and amplification primers to detect mutations in SYNIP encoding polynucleotides or a portion thereof that have been correlated with diseases, particularly diseases related to overexpression or underexpression of ligands for SYNIP. The invention also provides a variety of polynucleotide expression vectors, 25 comprising SYNIP encoding polynucleotides or a portion thereof or a sequence substantially similar to it subcloned into an extra-chromosomal vector. This aspect of the invention allows for in vitro expression of SYNIP encoding polynucleotides, thus permitting an analysis of SYNIP encoding polynucleotides regulation and SYNIP structure and function. As used herein, the term "extra 30 chromosomal vector" includes, but is not limited to, plasmids, bacteriophages, cosmids, retroviruses and artificial chromosomes. In a preferred embodiment, the extra-chromosomal vector comprises an expression vector that allows for SYNIP WO 99/54465 PCT/US99/08568 -10 production when the recombinant DNA molecule is inserted into a host cell. Such vectors are well-known in the art and include, but are not limited to, those with the T3 or T7 polymerase promoters, the SV40 promoter, the CMV promoter, or any promoter that either can direct gene expression, or that one wishes to test for the 5 ability to direct gene expression. In a preferred embodiment, the subject expression vectors comprise a polynucleotide sequence encoding a SYNIP in functional combination with one or more promoter sequences so as to provide for the expression of the SYNIP (or an anti-sense copy of the sequence suitable for inhibition of expression of an 10 endogenous gene). The vectors may comprise additional polynucleotide sequences for gene expression, regulation, or the convenient manipulation of the vector, such additional sequences include terminators, enhancers, selective markers, packaging sites, and the like. Detailed description of polynucleotide expression vectors and their use can be found in, among other places Gene Expression Technology: 15 Methods in Enzymology, Volume 185, Goeddel, ed., Academic Press Inc., San Diego, CA (1991), Protein Expression in Animal Cells, Roth, ed., Academic Press, San Diego, CA (1994). The polynucleotide expression vectors of the invention have a variety of uses. Such uses include the genetic engineering of host cells to express SYNIPs. 20 In a further aspect, the present invention provides recombinant host cells that are stably transfected with a recombinant DNA molecule comprising SYNIP encoding polynucleotides subcloned into an extra-chromosomal vector. The host cells of the present invention may be of any type, including, but not limited to, bacterial, yeast, and mammalian cells. Transfection of host cells with recombinant 25 DNA molecules is well-known in the art (Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, 1989) and, as used herein, includes, but is not limited to calcium phosphate transfection, dextran sulfate transfection, electroporation, lipofection and viral infection. This aspect of the invention allows for in vitro and in vivo expression of SYNIP and its gene 30 product, or a portion of SYNIP and its gene product, thus enabling high-level expression of SYNIP or a portion thereof. Other uses of the polynucleotide expression vectors, discussed in greater detail, infra, include, their use for genetic therapy for diseases and conditions in WO 99/54465 PCTIUS99/08568 -11 which it may be desirable use to express SYNIPs at levels greater than naturally occurring expression levels. Alternatively, it may be desirable to use the subject vectors for anti-sense expression to reduce the naturally occurring levels of SYNIP. 5 In another aspect, the present invention provides a substantially purified recombinant protein comprising a polypeptide substantially similar to the SYNIP shown in SEQ ID 2 or 5. Furthermore, this aspect of the invention enables the use of SYNIP in several in vitro assays described below. As used herein, the term "substantially similar" includes deletions, substitutions and additions to the 10 sequences of SEQ ID 2 or 5 introduced by any in vitro means. As used herein, the term "substantially purified" means that the protein should be free from detectable contaminating protein, but the SYNIP may be co-purified with an interacting protein, or as an oligomer. In a most preferred embodiment, the protein sequence according to the invention comprises an amino acid sequence of SEQ ID 2 or 5. 15 Mutated sequences according to the invention can be identified in a routine manner by those skilled in the art using the teachings provided herein and techniques well-known in the art. This aspect of the invention provides a novel purified protein that can be used for in vitro assays, and as a component of a pharmaceutical composition for GLUT4 translocation modification, described 20 infra. SYNIPs may be used to discover molecules that interfere with its activities. For example, molecules that prevent the binding of SYNIP to Syntaxin-4 in insulin responsive tissues, thus increasing glucose transport. Additionally, SYNIPs may be used to find other proteins that can directly interact 25 with it, representing additional important regulators of glucose transport. The SYNIPs of the present invention have the biological activity of binding to syntaxin-4. The SYNIP of the invention may be isolated from a variety of mammalian animal species. Preferred mammalian species for isolation are primates and humans. The invention also contemplates allelic variants of SYNIP. 30 SYNIPs may be prepared from a variety of mammalian tissues, however cell lines established from insulin responsive tissues are preferred non-recombinant sources of SYNIPs. Preferably SYNIPs are obtained from recombinant host cells genetically engineered to express significant quantities of SYNIPs. SYNIPs may WO 99/54465 PCT/US99/08568 -12 be isolated from non-recombinant or recombinant cells in a variety of ways well known to a person of ordinary skill in the art. The term "SYNIP" as used herein refers not only to proteins having the amino acid residue sequence of naturally occurring SYNIPs, but also refers to 5 functional derivatives and variants of naturally occurring SYNIP. A "functional derivative" of a native polypeptide is a compound having a qualitative biological activity in common with the native SYNIP. Thus, a functional derivative of a native SYNIP is a compound that has a qualitative biological activity in common with a native SYNIP, eg, binding to syntaxin-4 and other cognate ligands. 10 "Functional derivatives" include, but are not limited to, fragments of native polypeptides from any animal species (including human), and derivatives of native (human and non-human) polypeptides and their fragments, provided that they have a biological activity in common with a respective native polypeptide. "Fragments" comprise regions within the sequence of a mature native 15 polypeptide. The term "derivative" is used to define amino acid sequence and glycosylation variants, and covalent modifications of a native polypeptide, whereas the term "variant" refers to amino acid sequence and glycosylation variants within this definition. Preferably, the functional derivatives are polypeptides which have at least about 65% amino acid sequence identity, more 20 preferably about 75% amino acid sequence identity, even more preferably at least 85% amino acid sequence identity, most preferably at least about 95% amino acid sequence identity with the sequence of a corresponding native polypeptide. Most preferably, the functional derivatives of a native SYNIP retain or mimic the region or regions within the native polypeptide sequence that directly participate in 25 ligand binding. The phrase "functional derivative" specifically includes peptides and small organic molecules having a qualitative biological activity in common with a native SYNIP. "Identity" or "homology" with respect to a native polypeptide and its functional derivative is defined herein as the percentage of amino acid residues in 30 the candidate sequence that are identical with the residues of a corresponding native polypeptide, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology, and not considering any conservative substitutions as part of the sequence identity. Neither N- or WO 99/54465 PCT/US99/08568 -13 C-terminal extensions nor insertions shall be construed as reducing identity or homology. Methods and computer programs for the alignment are well-known in the art. Amino acid sequence variants of native SYNIPs and SYNIP fragments are 5 prepared by methods known in the art by introducing appropriate nucleotide changes into a native or variant SYNIP encoding DNA, or by in vitro synthesis of the desired polypeptide. There are two principal variables in the construction of amino acid sequence variants: the location of the mutation site and the nature of the mutation. With the exception of naturally-occurring alleles, which do not 10 require the manipulation of the DNA sequence encoding the SYNIP, the amino acid sequence variants of SYNIP are preferably constructed by mutating the DNA, either to arrive at an allele or an amino acid sequence variant that does not occur in nature. Alternatively or in addition, amino acid alterations can be made at sites 15 that differ in SYNIPs from various species, or in highly conserved regions, depending on the goal to be achieved. Sites at such locations will typically be modified in series, eg, by (1) substituting first with conservative choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue or 20 residues, or (3) inserting residues of the same or different class adjacent to the located site, or combinations of options 1-3. One helpful technique is called "alanine scanning," Cunningham and Wells, Science, 1989;244:1081-1085. Here, a residue or group of target resides is identified and substituted by alanine or polyalanine. Those domains demonstrating 25 functional sensitivity to the alanine substitutions are then refined by introducing further or other substituents at or for the sites of alanine substitution. After identifying the desired mutation(s), the gene encoding a SYNIP variant can, for example, be obtained by chemical synthesis. More preferably, DNA encoding a SYNIP amino acid sequence variant is 30 prepared by site-directed mutagenesis of DNA that encodes an earlier prepared variant or a nonvariant version of SYNIP. Site-directed (site-specific) mutagenesis allows the production of SYNIP variants through the use of specific oligonucleotide sequences that encode the DNA sequence of the desired mutation, WO 99/54465 PCT/US99/08568 -14 as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed. Typically, a primer of about 20 to 25 nucleotides in length is preferred, with about 5 to 10 residues on both 5 sides of the junction of the sequence being altered. In general, the techniques of site-specific mutagenesis are well-known in the art, as exemplified by publications such as, Edelman et al., DNA, 1983;2:183. As will be appreciated, the site-specific mutagenesis technique typically employs a phage vector that exists in both a single-stranded and double-stranded form. Typical vectors useful in site-directed 10 mutagenesis include vectors such as the M13 phage. This and other phage vectors are commercially available, and their use is well-known to those skilled in the art. A versatile and efficient procedure for the construction of oligodeoxyribonucleotide directed site-specific mutations in DNA fragments using M13-derived vectors was published by Zoller M.J. and Smith M., Nucleic 15 Acids Res., 1982;10:6487-6500). Also, plasmid vectors that contain a single-stranded phage origin of replication, Veira et al., Meth. Enzymol., 1987;153:3, may be employed to obtain single-stranded DNA. Alternatively, nucleotide substitutions are introduced by synthesizing the appropriate DNA fragment in vitro, and amplifying it by PCR procedures known in the art. 20 In general, site-specific mutagenesis may be performed by first obtaining a single-stranded vector that includes within its sequence a DNA sequence that encodes the relevant protein. An oligonucleotide primer bearing the desired mutated sequence is prepared, generally synthetically, for example, by the method of Crea et al., Proc. Natl. Acad. Sci., USA, 1978;75:5765. This primer is then 25 annealed with the single-stranded protein sequence-containing vector, and subjected to DNA-polymerizing enzymes such as, E. coli polymerase I Klenow fragment, to complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is formed wherein one strand encodes the original non-mutated sequence and the second strand bears the desires mutation. This heteroduplex 30 vector is then used to transform appropriate host cells such as HB 101 cells, and clones are selected that include recombinant vectors bearing the mutated sequence arrangement. Thereafter, the mutated region may be removed and placed in an appropriate expression vector for protein production.
WO 99/54465 PCTIUS99/08568 -15 The PCR technique may also be used in creating amino acid sequence variants of a SYNIP. When small amounts of template DNA are used as starting material in a PCR, primers that differ slightly in sequence from the corresponding region in a template DNA can be used to generate relatively large quantities of a 5 specific DNA fragment that differs from the template sequence only at the positions where the primers differ from the template. For introduction of a mutation into a plasmid DNA, one of the primers is designed to overlap the position of the mutation and to contain the mutation; the sequence of the other primer must be identical to a stretch of sequence of the opposite strand of the 10 plasmid, but this sequence can be located anywhere along the plasmid DNA. It is preferred, however, that the sequence of the second primer is located within 200 nucleotides from that of the first, such that in the end the entire amplified region of DNA bounded by the primes can be easily sequenced. PCR amplification using a primer pair like the one just described results in a population 15 of DNA fragments that differ at the position of the mutation specified by the primer, and possibly at other positions, as template copying is somewhat error-prone. Further details of the foregoing and similar mutagenesis techniques are found in general textbooks, such as, for example, Sambrook et al., Molecular 20 Cloning: H Laboratorv Manual, 2nd edition, Cold Spring Harbor Press, Cold Spring Harbor (1989), and Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley and Sons (1995). Naturally-occurring amino acids are divided into groups based on common side chain properties: 25 (1) hydrophobic: norleucine, met, ala, val, leu, ile; (2) neutral hydrophobic: cys, ser. tier; (3) acidic: asp, glu; (4) basic: asn, gin, his, lys, erg; (5) residues that influence chain orientation: gly, pro; and 30 (6) aromatic: trp, tyr, pine. Conservative substitutions involve exchanging a member within one group for another member within the same group, whereas non-conservative substitutions will entail exchanging a member of one of these classes for another.
WO 99/54465 PCTIUS99/08568 -16 Variants obtained by non-conservative substitutions are expected to result in significant changes in the biological properties/function of the obtained variant, and may result in SYNIP variants which block SYNIP biological activities, ie, ligand binding. Amino acid positions that are conserved among various species 5 are generally substituted in a relatively conservative manner if the goal is to retain biological function. Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues, and typically are contiguous. Deletions may be introduced into regions not directly involved in ligand binding. 10 Amino acid insertions include amino- and/or carboxyl terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Intrasequence insertions (ie, insertions within the SYNIP amino acid sequence) may range generally from about 1 to 10 residues, more preferably 1 to 15 5 residues, more preferably 1 to 3 residues. Examples of terminal insertions include the SYNIPs with an N-terminal methionyl residue, an artifact of direct expression in bacterial recombinant cell culture, and fusion of a heterologous N-terminal signal sequence to the N-terminus of the SYNIP to facilitate the secretion of the mature SYNIP from recombinant host cells. Such signal 20 sequences will generally be obtained from, and thus homologous to, the intended host cell species. Suitable sequences include STII or Ipp for E. coli, alpha factor for yeast, and viral signals such as herpes gD for mammalian cells. Other insertional variants of the native SYNIP molecules include the fusion of the N- or C-terminus of an SYNIP to immunogenic polypeptides, eg, bacterial polypeptides 25 such as betalactamase or an enzyme encoded by the E. coli trp locus, or yeast protein, and C-terminal fusions with proteins having a long half-life such as immunoglobulin regions (preferably immunoglobulin constant regions), albumin, or ferritin, as described in PCT published application WO 89/02922. Since it is often difficult to predict in advance the characteristics of a 30 variant SYNIP, it will be appreciated that screening will be needed to select the optimum variant. For this purpose biochemical screening assays, such as those described herein below, will be readily available.
WO 99/54465 PCT/US99/08568 -17 In a further aspect, the present invention provides antibodies and methods for detecting antibodies that selectively bind polypeptides with an amino acid sequence substantially similar to the amino acid sequence of SEQ ID 2 or 5. As discussed in greater detail, infra, the antibody of the present invention can be a 5 polyclonal or a monoclonal antibody, prepared by using all or part of the sequence of SEQ ID 2 or 5, or modified portions thereof, to elicit an immune response in a host animal according to standard techniques (Harlow and Lane (1988), eds., Antibody: A Laboratory Manual, Cold Spring Harbor Press). In a preferred embodiment, the entire polypeptide sequence of SEQ ID 2 is used to elicit the 10 production of polyclonal antibodies in a host animal. The method of detecting SYNIP antibodies comprises contacting cells with an antibody that recognizes SYNIP and incubating the cells in a manner that allows for detection of the SYNIPantibody complex. Standard conditions for antibody detection of antigen can be used to accomplish this aspect of the 15 invention (Harlow and Lane, 1988). This aspect of the invention permits the detection of SYNIP protein both in vitro and in vivo. The subject invention provides methods for the treatment of a variety of diseases characterized by undesirably abnormal levels of glucose or abnormal GLUT4 translocation. Diseases may be treated through either in vivo or in vitro 20 genetic therapy. Protocols for genetic therapy through the use of viral vectors can be found, among other places, in Viral Vector Gene Therapy and Neuroscience Applications, Kaplit and Lowry, Academic Press, San Diego (1995). The genetic therapy methods of the invention comprise the step of introducing a vector for the expression of SYNIP (or inhibitory anti-sense RNA) into a patient cell. The 25 patient cell may be either in the patient, ie, in vivo genetic therapy, or external to the patient and subsequently reintroduced into the patient, ie, in vitro genetic therapy. Diseases that may be treated by the subject genetic therapy methods include, but are not limited to diabetes, glycogen storage diseases, obesity, polycystic ovarian syndrome, hypertension, atherosclerosis and other diseases of 30 insulin-resistance. In a preferred aspect of the invention, a method is provided for protecting mammalian cells from abnormal levels of glucose or abnormal GLUT4 translocation, comprising introducing into mammalian cells an expression vector WO 99/54465 PCTIUS99/08568 -18 comprising a DNA sequence substantially similar to the DNA sequence shown in SEQ ID 1 or 4, that is operatively linked to a DNA sequence that promotes the expression of the DNA sequence and incubating the cells under conditions wherein the DNA sequence of SEQ ID 1 or 4 will be expressed at high levels in 5 the mammalian cells. Suitable expression vectors are as described above. In a preferred embodiment, the coding region of the human SYNIP gene (SEQ ID 4) is subcloned into an expression vector under the transcriptional control of the cytomegalovirus (CMV) promoter to allow for constitutive SYNIP gene expression. 10 In another preferred aspect of the present invention, a method is provided for treating or preventing abnormal levels of glucose or abnormal GLUT4 translocation, comprising introducing into mammalian tumor cells an expression vector comprising a DNA that is antisense to a sequence substantially similar to the DNA sequence shown in SEQ ID 1 or 4 that is operatively linked to a DNA 15 sequence that promotes the expression of the antisense DNA sequence. The cells are then grown under conditions wherein the antisense DNA sequence of SEQ ID 1 or 4 will be expressed at high levels in the mammalian cells. In a most preferred embodiment, the DNA sequence consists essentially of SEQ ID 1 or 4. In a further preferred embodiment, the expression vector 20 comprises an adenoviral vector wherein SYNIP cDNA is operatively linked in an antisense orientation to a cytomegalovirus (CMV) promoter to allow for constitutive expression of the SYNIP antisense cDNA in a host cell. In a preferred embodiment, the SYNIP adenoviral expression vector is introduced into mammalian insulin-sensitive cells by injection into a mammal. 25 Another aspect of the invention is to provide assays useful for determining if a compound of interest can bind to SYNIPs so as to interfere with the binding of syntaxin-4 (or other ligands) to the v- and t-SNAREs. The assay comprises the steps of measuring the binding of a compound of interest to a SYNIP . Either the SYNIP or the compound of interest to be assayed may be labeled with a detectable 30 label, eg, a radioactive or fluorescent label, so as to provide for the detection of complex formation between the compound of interest and the SYNIP. In another embodiment of the subject assays, the assays involve measuring the interference, ie, competitive binding, of a compound of interest with the binding interaction WO 99/54465 PCT/US99/08568 -19 between a SYNIP and syntaxin-4 (or another ligand already known to bind to SYNIP). For example, the effect of increasing quantities of a compound of interest on the formation of complexes between radioactivity labeled syntaxin-4 and an SYNIP may be measured by quantifying the formation of labeled ligand-SYNIP 5 complex formation. Polyclonal antibodies to SYNIPs generally are raised in animals by multiple subcutaneous (se) or intraperitoneal (ip) injections of a SYNIP and an adjuvant. It may be useful to conjugate the SYNIP or a fragment containing the target amino acid sequence to a protein that is immunogenic in the species to be 10 immunized, eg, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor using a bifunctional or derivatizing agent, for example maleimidobenzoyl sulfosuccinimide ester (conjugation through cysteine residues), N-hydroxysuccinimide (through lysine resides), glutaraldehyde, succinic anhydride, SOCl 2 , or R 1 -N=C=NR, where R and RI are 15 different alkyl groups. Animals are immunized against the immunogenic conjugates or derivatives by combing 1 mg or 1 fig of conjugate (for rabbits or mice, respectively) with 3 volumes of Freund's complete adjuvant and injecting the solution intradermally at multiple sites. One month later the animals are boosted 20 with 1/5 to 1/10 the original amount of conjugate in Freund's complete adjuvant by subcutaneous injection at multiple sites. Seven to 14 days later the animals are bled and the serum is assayed for anti-SYNIPs antibody titer. Animals are boosted until the titer plateaus. Preferably, the animal boosted with the conjugate of the same SYNIP, but conjugated to a different protein and/or through a different 25 cross-linking reagent. Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such a alum are used to enhance the immune response. Monoclonal antibodies are obtained from a population of substantially homogeneous antibodies, ie, the individual antibodies comprising the population 30 are identical except for possible naturally-occurring mutations that may be present in minor amounts. Thus, the modifier "monoclonal" indicates the character of the antibody as not being a mixture of discrete antibodies. For example, the WO 99/54465 PCT/US99/08568 -20 anti-SYNIP monoclonal antibodies of the invention may be made using the hybridoma method first described by Kohler & Milstein, Nature, 1975;256:495, or may be made by recombinant DNA methods [Cabilly et al, US Pat. No. 4,816,567]. 5 In the hybridoma method, a mouse or other appropriate host animal, such a hamster is immunized as herein above described to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the protein used for immunization. Alternatively, lymphocytes may be immunized in vitro. Lymphocytes then are fused with myeloma cells using a suitable fusing 10 agent, such as polyethylene glycol, to form a hybridoma cell [Coding, Monoclonal Antibodies: Principles and Practice, pp.59-103 (Academic Press, 1986)]. The anti-SYNIP specific antibodies of the invention have a number of uses. The antibodies may be used to purify SYNIPs from either recombinant or non-recombinant cells. The subject antibodies may be used to detect and/or 15 quantify the presence of SYNIPs in tissue samples, eg, from blood, skin, and the like. Quantitation of SYNIPs may be used diagnostically for those diseases and physiological or genetic conditions that have been correlated with particular levels of SYNIP expression levels. In a further aspect, the present invention provides a diagnostic assay for 20 detecting cells containing SYNIP polynucleotide deletions, comprising isolating total genomic DNA from the cell and subjecting the genomic DNA to PCR amplification using primers derived from the DNA sequence of SEQ ID 1 or 4. This aspect of the invention enables the detection of SYNIP polynucleotide deletions in any type of cell, and can be used in genetic testing or 25 as a laboratory tool. The PCR primers can be chosen in any manner that allows the amplification of a SYNIP polynucleotide fragment large enough to be detected by gel electrophoresis. Detection can be by any method, including, but not limited to ethidium bromide staining of agarose or polyacrylamide gels, autoradiographic detection of radio-labeled SYNIP gene fragments, Southern blot hybridization, 30 and DNA sequence analysis. In a preferred embodiment, detection is accomplished by polyacrylamide gel electrophoresis, followed by DNA sequence analysis to verify the identity of the deletions. PCR conditions are routinely WO 99/54465 PCT/US99/08568 -21 determined based on the length and base-content of the primers selected according to techniques well-known in the art (Sambrook et al., 1989). An additional aspect of the present invention provides a diagnostic assay for detecting cells containing SYNIP polynucleotide deletions, comprising 5 isolating total cell RNA and subjecting the RNA to reverse transcription-PCR amplification using primers derived from the DNA sequence of SEQ ID 1 or 4. This aspect of the invention enables the detection of SYNIP deletions in any type of cell, and can be used in genetic testing or as a laboratory tool. Reverse transcription is routinely accomplished via standards techniques 10 (Ausubel et al., in Current Protocols in Molecular Biology, ed. John Wiley and Sons, Inc., 1994) and PCR is accomplished as described above. In another aspect, the present invention provides methods of isolating RNA containing stretches of polyA (adenine), polyC (cytosine) or polyU (uridine) residues, comprising contacting an RNA sample with SYNIP, incubating the 15 RNA-SYNIP mixture with an antibody that recognizes the SYNIP polypeptide, isolating the antibody-SYNIP-RNA complexes, and purifying the RNA away from the antibody-SYNIP complex. This aspect of the invention provides a novel in vitro method for isolating a discrete class of RNA. In a preferred embodiment, the RNA sample is contacted with SYNIP in the presence (for preferential 20 isolation of polyA and polyC-containing RNAs), or absence (for preferential isolation of polyU-containing RNAs), of a reducing agent. Preferred reducing agents for use in this aspect of the invention include, but are not limited to DTT and f-mercaptoethanol. The reducing agents are preferably used at a concentration of between about 50 nM and 1 M. Isolation of antibody-SYNIP-RNA complexes 25 can be accomplished via standard techniques in the art, including, but not limited to the use of Protein-A conjugated to agarose or cellulose beads. The present invention may be better understood with reference to the accompanying examples that are intended for purposes of illustration only and should not be construed to limit the scope of the invention, as defined by the 30 claims appended hereto.
WO 99/54465 PCT/US99/08568 -22 EXAMPLES Example 1 Summary Insulin-stimulated glucose transport and GLUT4 translocation require 5 specific interactions between the v-SNARE, VAMP2, and the t-SNARE, syntaxin- 4. However, insulin does not directly effect these or any other SNARE like molecules identified to date. As shown in the following example, a novel syntaxin-4 binding protein, SYNIP, was isolated which specifically interacted with syntaxin-4 and was only expressed in cells that displayed insulin-responsive 10 glucose transport and GLUT4 translocation. Insulin induced a dissociation of the SYNIP:syntaxin-4 complex due to a decreased binding affinity of SYNIP for syntaxin-4. In contrast, the binding of the carboxyl terminal SYNIP domain was refractive to insulin stimulation but inhibited glucose transport and GLUT4 translocation. These data identify SYNIP as the first insulin-regulated SNARE 15 like protein directly involved in the regulation of glucose transport and GLUT4 vesicle translocation. Experimental Procedures Materials The Flag M 2 monoclonal antibody was obtained from Kodak and the 20 syntaxin-4 sheep polyclonal antibody was isolated as previously described (Olson A.L., Knight J.B., and Pessin J.E., "Syntaxin 4, VAMP2, and/or VAMP3/cellubrevin are functional target membrane and vesicle SNAP receptors for insulin-stimulated GLUT4 translocation in adipocytes." Mol Cell Biol, 1997;17:2425-2435). The p-galactosidase expression plasmid 25 (pcDNA3. 1/his/LacZ) was purchased from Invitrogen. SuperSigal ULTRA Enhanced Chemiluminescent (ECL) reagents, and the secondary anti-sheep and anti-rabbit IgG-HRP were from Pierce. ECL western blotting reagents and [a- 3 2 P]dCTP were purchased from Amersham Life Science. All restriction enzymes, cell culture media, and reagents were from GIBCO BRL. All other 30 reagents were obtained from Sigma Chemical Co. unless specifically noted.
WO 99/54465 PCT/US99/08568 -23 Isolation of SYNIP cDNA by yeast two-hybrid screening The coding region of the cytoplasmic domain of syntaxin-4 (residue 2-274) was amplified by PCR from the plasmid carrying syntaxin-4 cDNA using the primers 5'CGGGATCCTGCGCGACAGGACCCATG 3' and 5 5' GGTCGACCTTTTTCTTCCTCGC 3'. The PCR product was then subcloned into BamHI-SalI site of the bait vector pGBT9 (Clontech), in frame with GAL4 DNA-binding domain. To screen for syntaxin-4 binding proteins, yeast strain Y190 was sequentially transformed with the bait DNA and then the yeast two-hybrid cDNA library constructed from 3T3L1 adipocyte mRNA as previously 10 described (Printen J.A., Brady M.J., and Saltiel A.R., "PTG, a protein phosphatase 1-binding protein with a role in glycogen metabolism." Science, 1997;275:1475 1478). The transformation was plated onto synthetic media lacking tryptophan, leucine and histidine and containing 25 mM 3-aminotriazole (Sigma) and incubated at 30'C. Colonies which appeared after 5-7 days of incubation were 15 analyzed for j-galactosidase activity by plating onto the media containing X-Gal. The prey cDNAs were recovered from the strongest hits and were subjected to DNA sequencing. All sequences were analyzed by BLAST search, Protein tool and COILS 2.2 programs. Northern blot analysis 20 The 1.67 kb of the SYNIP cDNA coding sequences were radiolabeled with [a- 3 2 P]dCTP using a random hexamer labelling kit, and the probe was purified with a QIAquick Nucleotide Removal Kit (QIAGEN). The probe was hybridized with a Northern blot containing 2 mg of purified poly A+ RNA isolated from various mouse tissues in ExpressHyb hybridization solution (Clontech) for 25 16 hours at 65'C. The blot was then extensively washed followed manufacturer's recommendation and subjected to autoradiography. Expression Constructs The coding region of SYNIP cDNA was PCR amplified from a plasmid containing 2.6 kb SYNIP cDNA with a pair of oligos: 30 5'GTACTGACCCGGGAATTCGAAAGCATGAGTGATGGTACAGC3' and WO 99/54465 PCT/US99/08568 -24 5'GTCGACGCGGCCGCTCGAGCTACTTGTCATCGTCGTCCTTGTA GTCGCTTTTCGGGTCTGTTAGCTCTCTG3'. The 3' end of the primer incorporated sequences encoding for a eight-amino acid flag epitope. The PCR product was cloned into pCR2.1 vector (Invitrogen). To construct the SYNIP/WT 5 mammalian expression plasmid, the full length carboxyl terminal Flag-tagged SYNIP was subcloned into EcoR1/Xhol sites of the pcDNA3 vector (Invitrogen). To construct SYNIP/NT (residue 1-301) deletion mutant, the insert was first generated by PCR with primers 5'ACTGAATTCATGAGTGATGGTA CTGCTTCTGC3' and 5'ATCCTCGAGCACTTCATCTGCTTCTAGAG 3' and 10 cloned into EcoRI/XhoI sites of a pcDNA3 vector containing a Flag tag immediately downstream of XhoI site. The SYNIP/NT construct was obtained by switching an internal EcoRI/XbaI fragment with the same fragment from the SYNIP/WT plasmid so that it contained the wild type Kozak sequences. To construct the SYNIP/CT mutant, the original two hybrid cDNA was subcloned 15 into EcoRI/SalI sites of pFlag-CMV2 vector (Kodak). The GLUT4-eGFP fusion construct was prepared by subcloning the rat GLUT4 cDNA into the pEGFP vector (Clontech) at the 5' BamHI and 3' HindIll sites. The GLUT4 cDNA was put in frame with the EGFP cDNA by excising the 200 bp BglII-AgeI fragment and replacing it with the BglII/AgeI digested 20 PCR fragment generated by amplification of the rat GLUT4 cDNA using primers 5'CTTCATCTTCACCTTCCTAA3' and 5'GGTGGCGACCGGTA CGTCATTCTCATCTGG3'. The fusion protein is the contiguous sequence of GLUT4 with 5 additional amino acids (Val-Pro-Val-Ala-Thr) connecting it to EGFP. The resultant GLUT4-eGFP was subcloned into pcDNA3 vector using the 25 5' HindlIl and 3' XbaI sites. The eGFP-GLUT1 construct was prepared by subcloning the rat GLUT 1 cDNA into the pEGFP-C3 plasmid (Clontech) using 5' XhoI and 3' EcoRI restriction sites. The resulting construct contains 9 additional amino acids between the EGFP and GLUT 1 (Tyr-Ser-Asp-Leu-Glu Arg-Ser-Ala-Ala).
WO 99/54465 PCT/US99/08568 -25 Cell culture Human embryo kidney 293T cells were obtained from the American Type Culture Collection and maintained in Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum at 37 0 C in a 5% CO 2 atmosphere. 5 Chinese hamster ovary cells expressing the human insulin receptor (CHO/IR) were obtained as previously described (Waters S.B., Yamauchi K., and Pessin J.E., "Insulin-stimulated disassociation of the SOS-Grb2 complex." Mol Cell Biol, 1995;15:2791-2799.) These cells were maintained in minimal Eagle's medium containing nucleotides plus 10% fetal bovine serum at 37 0 C in a 5% 10 CO 2 atmosphere. 3T3L1 preadipocytes were obtained from the American Type Tissue Culture repository and were cultured in DMEM containing 25 mM glucose, 10% calf serum at 37 0 C in a 8% CO 2 atmosphere. Confluent cultures were induced to differentiate by incubation of the cells with DMEM containing 25 mM glucose, 10% fetal bovine serum, 1 mg/mL insulin, 1 mM dexamethasone, 15 and 0.5 mM isobutyl-1-methylxanthine. After 4 days, the medium was changed to DMEM, 25 mM glucose, 10% fetal bovine serum and 1 mg/mL insulin for an additional 4 days. The medium was then changed to DMEM containing 25 mM glucose and 10% fetal bovine serum. Under these conditions greater than 95% of the cell population morphologically differentiated into adipocytes. The adipocytes 20 were maintained for an additional 4 to 8 days prior to use. Purification of GST-fusion proteins Cytoplasmic portions of syntaxin-lA (amino acids 4-264), syntaxin-1B (amino acids 3-263), syntaxin-2 (amino acids 1-265), syntaxin-3 (amino acids 1-262), and syntaxin-4 (amino acids 2-274) were subcloned into pGEX-4T-l 25 expression vector (Pharmacia). The GST-recombinant proteins were overexpressed in BL21 (DE3) (Stratagene) and bacteria cells were lysed using B-PER-Bacterial Protein Extraction Reagent (Pierce). The GST-fusion proteins were then bound to 50% Glutathione-agarose beads, extensively washed and stored for up to 2 weeks at 4'C.
WO 99/54465 PCTIUS99/08568 -26 GST fusion protein precipitation Cell lysates from HEK293T, CHO/IR or 3T3L1 adipocytes were incubated with either GST alone or with GST-fusion proteins immobilized on glutathione agarose beads for 1 hour at 4'C. The beads were washed extensively three times 5 with 1 mL HNTG (50 mM HEPES, pH 7.4, 150 mM sodium chloride, 1% Triton X-100, 10% glycerol, and 1 mM EDTA) buffer and then two times with 1 mL distilled water. The retained proteins were then eluted with 50 gL 2X Laemmli sample buffer, heated at 100'C for 5 minutes and separated by SDS-PAGE, and then immunoblotted with the Flag M 2 monoclonal antibody or a sheep polyclonal 10 SYNIP antibody. Immunoprecipitation and immunoblotting Whole cell detergent extracts were prepared by detergent solubilization in a NP-40 lysis buffer (25 mM Tris pH 7.4, 1% NP-40, 10% glycerol, 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 137 mM NaCl, 1 mM Na 3
VO
4 , 15 1 mM phenylmethylsulfonyl fluoride, 10 tg/mL aprotinin, 1 gg/mL pepstatin, 5 gg/mL leupeptin) for 10 minutes at 4'C. Immunoprecipitations were performed by using 4.0 mg of the cell extracts incubated with 8 gg of a syntaxin-4 polyclonal sheep antibody for 2 hours at 4'C. The syntaxin-4 antibody was prepared in sheep using a GST fusion protein expressing the cytoplasmic domain of syntaxin-4 20 (Olson A.L., Knight J.B., and Pessin J.E., "Syntaxin 4, VAMP2, and/or VAMP3/cellubrevin are functional target membrane and vesicle SNAP receptors for insulin-stimulated GLUT4 translocation in adipocytes." Mol Cell Biol, 1997; 17:2425-2435.) The samples were then incubated with protein A-Sepharose for 2 hours at 4'C. The resulting immunoprecipitates were then subjected to SDS 25 polyacrylamide gel electrophoresis and western blotted using the syntaxin-4 polyclonal antibody and the Flag M 2 monoclonal antibody. Transfection of HEK293T cells, CHO/IR cells and 3T3L1 adipocytes HEK293T cells were transfected with a mammalian CaPO 4 transfection kit (Stratagene). CHO/IR cells were quantitatively transfected by electroporation 30 as previously described (Yamauchi K., Ribon V., Saltiel A.R., and Pessin J.E., WO 99/54465 PCTIUS99/08568 -27 "Identification of the major SHPTP2-binding protein that is tyrosine phosphorylated in response to insulin." J Biol Chem, 1995;270;17716-17722). Briefly, these cells were mixed with a total of 40 gg of plasmid DNA and electroporated at 340 V and 960 ptF. Under these conditions greater than 95% of 5 the surviving cell population express the cDNA of interest. Differentiated 3T3L1 adipocytes were electroporated using a modification of this protocol. The adipocytes were put into suspension by mild trypsinization and electroporated with a total of 600 gg plasmid under low voltage conditions (160 V, 960 RF). The cells were then allowed to adhere to collagen-coated tissue culture dishes for 10 30-48 hours and the adipocytes were then were serum starved for 2 hours prior to incubation in the absence or presence of 100 nM insulin for 15 minutes at 37 0 C. Under these conditions, approximately 15% of the electroporated adipocytes survived but of these cells there was greater than a 70% transfection/expression efficiency. 15 In situ P-galactosidase staining Differentiated 3T3L1 adipocytes were electroporated with various amounts of plasmid DNA containing the LacZ gene (pcDNA3. 1/his/LacZ) as described above, washed with phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 8 mM Na 2
HPO
4 , 2.6 mM KH 2
PO
4 , pH 7.4) and fixed with 2% 20 formaldehyde, 0.2% glutaraldehyde in PBS, pH 7.4 for 10 minutes at room temperature. The cells were then rinsed and incubated with 0.2% 5-bromo 4-chloro-3-indolyl 0,D-galactoside reagent (X-Gal) in 10 mM Na 2
HPO
4 , pH 7.4, 1 mM MgC 2 , 150 mM NaCl, 3.3 mM K 3 Fe(CN) 6 , 3.3 mM K 4 Fe(CN) for 2 hours at 37 0 C. The cells were then stored under 70% glycerol and photographed 25 at 100x magnification. 2-Deoxyglucose transport The electroporated 3T3L1 adipocytes were placed in DMEM containing 25 mM glucose plus 0.5% bovine serum albumin for 2 hours at 37 0 C. The cells were then washed with KRPH buffer (5 mM Na 2
HPO
4 , 20 mM HEPES, pH 7.4, WO 99/54465 PCTIUS99/08568 -28 1 mM MgSO 4 , 1 mM CaCl 2 , 136 mM NaCl, 4.7 mM KCI, and 1% bovine serum albumin) and either untreated or stimulated with 100 nM insulin for 15 minutes at 37 0 C. Glucose transport was determined by incubation with 50 gM 2-deoxyglucose containing 0.5 mCi of [3H]2-deoxyglucose in the absence or 5 presence of 10 gM cytochalasin B. The reaction was stopped after 10 minutes by washing the cells 3 times with ice cold PBS. The cells were then solubilized in 1% Triton X-100 at 37 0 C for 30 minutes and aliquots were subjected to scintillation counting. Protein concentration was determined by the method of Bradford. Confocal fluorescence microscopy 10 Differentiated 3T3L1 adipocytes were electroporated as described above with 50 pg of pcDNA3-GLUT4-eGFP and 200 jg of either pcDNA3, SYNIP/WT, SYNIP/NT, or SYNIP/CT. Forty-eight hours after electroporation, the cells were serum starved in DMEM media for 3 hours and incubated with or without 100 nM insulin for 30 minutes. Insulin was removed by two washes with ice cold PBS, 15 fixed with 2% paraformaldehyde (in PBS) for 15 minutes at room temperature, and quenched with 100 mM glycine for 15 minutes at room temperature. Fluorescent cells were visualized by scanning confocal microscopy at the University of Iowa Microscope Facility. Results 20 Identification of SYNIP, a multidomain Syntaxin-4 interacting protein To isolate binding protein(s) that might interact with and regulate the function of syntaxin-4 in insulin-responsive tissues, a yeast two hybrid 3T3L1 adipocyte cDNA library fused to the GAL4 transcription activation domain (Printen J.A., Brady M.J., and Saltiel A.R. "PTG, a protein phosphatase 1-binding 25 protein with a role in glycogen metabolism." Science, 1997;275:1475-1478) with the cytoplasmic portion of syntaxin-4 fused to the DNA binding domain of GAL4 as bait (GAL4-Syn4) was screened. Among one million transformants screened, 200 colonies grew on His-Trp-Leu- synthetic medium, of which 102 were positive for P-galactosidase activity when plated on X-Gal containing WO 99/54465 PCT/US99/08568 -29 medium. Library-derived plasmids were recovered for DNA sequencing and focus was given to one class of cDNAs that induced P-galactosidase activity only when coexpressed with GAL4-Syn4, but not with a fusion protein containing the cytoplasmic domain of syntaxin-3. DNA sequences of the GAL4 fusion junctions 5 of the plasmid inserts encoded for different domains of protein fragments overlapping at the carboxyl terminus. To obtain the upstream 5' end of the cDNA, 5'-RACE was carried out and an additional 1.2 kb was cloned. The longest 2.6 kb cDNA was obtained by ligating the original 1.4 kb two-hybrid clone with the 1.2 kb 5'-RACE clone. The nucleotide sequence of the SYNIP gene is set forth in 10 Figure 8. Sequence analysis revealed that this cDNA had a single open reading frame which encoded for a 557 amino acid protein with predicted molecular weight of 61 kDa (Fig. 1A). This protein was designated SYNIP for syntaxin-4 interacting protein. A search of the data bases revealed two mouse EST clones 15 (AA756269 and AA919678) spanning the translation start site of SYNIP. Protein sequence analysis indicated that SYNIP has three specific protein-protein interaction domains: a single PDZ domain at the amino terminus, a pair of tandem coiled-coil domains and a WW domain at the carboxyl terminus (Fig. 1B). In addition, SYNIP contains a potential calcium binding EF-hand motif carboxyl 20 terminal to the predicted PDZ domain and amino terminal to the coiled-coil domains. All these motifs are underlined in the primary amino acid sequences in Figure 1A. The tissue distribution of SYNIP mRNA was determined using a mouse multiple tissue Northern blot hybridized with a radiolabeled probe containing 25 1.67 kb of the SYNIP coding sequence (Fig. 1 C). A 7.5 kb transcript was predominantly found in skeletal muscle and heart, with substantially lower expression in testis. Two additional transcripts with smaller sizes were also detected, but they did not display a similar restricted tissue distribution pattern. There were no specific SYNIP transcripts in brain, liver, spleen, lung, or kidney 30 tissues. Furthermore, SYNIP mRNA was also detected in rat white and brown adipocytes by Northern blotting (data not shown).
WO 99/54465 PCTIUS99/08568 -30 To determine the specificity of SYNIP binding, Flag epitope tag SYNIP constructs were prepared for both full-length SYNIP (SYNIP/WT) and the carboxyl terminal SYNIP domain (SYNIP/CT) encoding for the tandem coiled coil and WW domains. These constructs were then transfected into HEK293T 5 cells and incubated with either GST alone or GST fusion protein containing the cytoplasmic domains of syntaxin-lA, syntaxin-1B, syntaxin-2, syntaxin-3, and syntaxin-4. In vitro binding analysis demonstrated that both SYNIP/WT and SYNIP/CT bound specifically to syntaxin-4 (Fig. 1D, lane 6) but not to the other syntaxin proteins 1A, 1B, 2, and 3 (Fig. 1D, lanes 2-5). Thus, the specific 10 expression of SYNIP in tissues that are enriched in syntaxin-4 and that exclusively display insulin-sensitive glucose transport (muscle and fat), is consistent with a potential role for this protein as a physiologically relevant regulator of GLUT4 translocation. Insulin disrupts the interaction between SYNIP and syntaxin-4 15 Previous studies have demonstrated that VAMP2 functions as a GLUT4 vesicle v-SNARE and that the interaction of VAMP2 with syntaxin-4 is necessary for insulin-stimulated GLUT4 translocation to the plasma membrane (Cain C.C., Trimble W.S., and Lienhard G.E., "Members of the VAMP family of synaptic vesicle proteins are components of glucose transporter-containing 20 vesicles from rat adipocytes." J Biol Chem, 1992;267:11681-11684; Cheatham B., Volchuk A., Kahn C. R., Wang L., Rhodes C.J., and Klip A., "Insulin-stimulated translocation of GLUT4 glucose transporters requires SNARE-complex proteins." Proc Nati Acad Sci USA, 1996;93:15169-15173; Jagadish M.N., Fernandez C.S., Hewish D.R., Macaulay S.L., Gough K.H., Grusovin J., Verkuylen A., 25 Cosgrove L., Alafaci A., Frenkel M.J., and Ward C.W., "Insulin-responsive tissues contain the core complex protein SNAP-25 (synaptosomal-associated protein 25) A and B isoforms in addition to syntaxin-4 and synaptobrevins 1 and 2." Biochem J,1996;317:945-954; Martin L.B., Shewan A., Millar C.A., Gould G.W., and James D.E., "Vesicle-associated membrane protein 2 plays a 30 specific role in the insulin-dependent trafficking of the facilitative glucose transporter GLUT4 in 3T3-L1 adipocytes." JBiol Chem, 1998;273:1444-1452; Olson A.L., Knight J.B., and Pessin J.E., Syntaxin-4, VAMP2, and/or WO 99/54465 PCTIUS99/08568 -31 VAMP3/cellubrevin are functional target membrane and vesicle SNAP receptors for insulin-stimulated GLUT4 translocation in adipocytes." Mol Cell Biol, 1997:17:2425-2435; Tamori Y., Hashiramoto M., Araki S., Kamata Y., Takahashi M., Kozaki S., and Kasuga M., "Cleavage of vesicle-associated 5 membrane protein (VAMP)-2 and cellubrevin on GLUT4-containing vesicles inhibits the translocation of GLUT4 in 3T3-L1 adipocytes." Biochem Biophys Res Commun,1996;220:7 4 0-7 4 5; Volchuk A., Sargeant R., Sumitani S., Liu Z., He L., and Klip A., "Cellubrevin is a resident protein of insulin-sensitive GLUT4 glucose transporter vesicles in 3T3-L1 adipocytes." J Biol Chem, 1995;270:8233-8240). 10 To explore the potential regulation of the SYNIP:syntaxin-4 interaction by insulin, the association of these two proteins was evaluated by co-immunoprecipitation in Chinese hamster ovary cells expressing the human insulin receptor (CHO/IR). Cells were transfected with cDNAs encoding for the Flag epitope-tagged full length SYNIP (SYNIP/WT), the amino terminal SYNIP domain (SYNIP/NT), and 15 the carboxyl terminal SYNIP domain (SYNIP/CT). Immunoblotting of whole cell detergent extracts demonstrated similar expression of SYNIPIWT and SYNIP/NT, with a slightly greater expression of SYNIP/CT in this particular experiment (Fig. 2A, lanes 1, 3, 5). Insulin stimulation had no significant effect on the expression of these proteins (Fig. 2A, lanes 2, 4, 6). As expected, 20 immunoprecipitation of endogenous syntaxin-4 resulted in the co-immunoprecipitation of SYNIP/WT (Fig. 2B, lane 1). However, following insulin treatment there was a marked reduction in the amount of SYNIP/WT that was co-immunoprecipitated with syntaxin-4 (Fig. 2B, lane 2). In contrast, insulin stimulation had no significant effect on the ability of syntaxin-4 to 25 co-immunoprecipitate the SYNIP/NT or SYNIP/CT proteins (Fig. 2B, lanes 3-6). Interestingly, the interaction of SYNIP/NT with syntaxin 4 in vivo was significantly less than that seen with either SYNIP/WT or SYNIP/CT (Fig. 2B), suggesting that the carboxyl terminal region of SYNIP contains the major syntaxin-4 binding domain. In any case, the amount of immunoprecipitated 30 syntaxin-4 can not account for these differences as it was essentially identical under all these conditions (Fig. 2C). There are several possible mechanisms that could account for the insulin stimulated dissociation of SYNIP from syntaxin-4. Since there was no apparent WO 99/54465 PCT/US99/08568 -32 change in SYNIP or syntaxin-4 expression, it seemed most likely that insulin could induce a functional alteration in either SYNIP or syntaxin-4. To explore these possibilities, the ability of GST-syntaxin-4 (GST-Syn4) and GST-SYNIP (GST-SYNIP) fusion proteins to precipitate their corresponding binding partner 5 was examined (Fig. 3). As previously observed, transfection of CHO/IR cells with the SYNIP/WT, SYNIP/NT and SYNIP/CT cDNAs resulted in similar levels of protein expression (Fig. 3A). Incubation of cells with insulin produced a marked reduction in the amount of SYNIP/WT precipitated with GST-Syn4 in cell extracts (Fig. 3B, lanes 1 and 2). However, there was no significant difference in 10 the GST-Syn4 precipitation of either SYNIP/NT or SYNIP/CT in extracts derived from insulin-stimulated cells (Fig. 3B, lanes 3-6). In contrast, incubation of extracts from control and insulin-stimulated cells with GST-SYNIP resulted in the identical amount of syntaxin-4 precipitation (Fig. 3C, lanes 1-4). To confirm that insulin reduced the binding affinity of SYNIP for 15 syntaxin-4, the binding as a function of GST-Syn4 concentration was examined (Fig. 3D). Immunoblots of whole cell detergent extracts demonstrated equal amounts of expressed SYNIP protein in the control and insulin-stimulated cell extracts (Fig. 3D, lanes 1 and 2). Insulin stimulation resulted in a marked reduction in the amount of SYNIP/WT that was precipitated with 10 and 20 jig of 20 GST-Syn4 compared to the control extracts (Fig. 3D, compare lanes 3 with 4 and lanes 5 with 6). However, the difference between the control and insulin stimulated cell extracts was diminished with increasing amounts of GST Syn4 (40 gg), and no significant difference was observed at 80 mg (Fig. 3D, compare lanes 7 with 8 and lanes 9 with 10). The saturation of SYNIP/WT 25 binding was also specific at these concentrations of GST-Syn4 as there was no detectable precipitation of SYNIP/WT by GST alone (data not shown). Thus, these data demonstrate that insulin stimulation results in a specific modification of SYNIP that reduces its ability to associate with syntaxin-4. Furthermore, the decreased binding between SYNIP and syntaxin-4 results from a change in 30 SYNIP binding affinity with no significant alteration in the number of SYNIP or syntaxin-4 binding sites.
WO 99/54465 PCT/US99/08568 -33 Insulin regulates the interaction of SYNIP with syntaxin-4 in 3T3L1 Adipocytes In contrast to CHO/IR cells, 3T3L1 adipocytes respond to insulin with respect to glucose transport and GLUT4 translocation. It was therefore determined 5 whether the interaction between SYNIP and syntaxin-4 was also sensitive to insulin in these cells. Differentiated 3T3L1 adipocytes were transfected by electroporation with the cDNAs encoding for SYNIP/WT and SYNIP/CT (see Figure 5). Immunoblotting of whole cell lysates demonstrated expression of both SYNIP/WT and SYNIP/CT which was not affected by insulin treatment (Fig. 4A, 10 lanes 1-4). Similar to that observed in CHO/IR cells, incubation of insulin stimulated cell extracts with GST-Syn4 resulted in a marked decrease in the precipitation of SYNIP/WT but not SYNIP/CT compared to control cell extracts (Fig. 4B, lanes 1-4). These data recapitulate the findings in CHO/IR cells and demonstrate that insulin regulates the interaction between SYNIP and syntaxin-4 15 in a metabolic insulin-responsive cell type. SYNIP plays a crucial role in insulin-stimulated glucose transport and GLUT4 translocation Several studies have also suggested that syntaxin-4 function is necessary for insulin-stimulated GLUT4 vesicle translocation but not GLUT 1 vesicle 20 trafficking (Cheatham B., Volchuk A., Kahn C. R., Wang L., Rhodes C.J., and Klip A., "Insulin-stimulated translocation of GLUT4 glucose transporters requires SNARE-complex proteins." Proc Natl Acad Sci USA, 1996;93:15169-15173; Olson A.L., Knight J.B., and Pessin J.E., Syntaxin-4, VAMP2, and/or VAMP3/cellubrevin are functional target membrane and vesicle SNAP receptors 25 for insulin-stimulated GLUT4 translocation in adipocytes." Mol Cell Biol, 1997:17:2425-2435; Tamori Y., Hashiramoto M., Araki S., Kamata Y., Takahashi M., Kozaki S., and Kasuga M., "Cleavage of vesicle-associated membrane protein (VAMP)-2 and cellubrevin on GLUT4-containing vesicles inhibits the translocation of GLUT4 in 3T3-L1 adipocytes." Biochem Biophys Res 30 Commun,1996;220:740-745; Volchuk A., Wang Q., Ewart H.S., Liu Z., He L., Bennett M.K., and Klip A., "Syntaxin 4 in 3T3-L1 adipocytes: regulation by insulin and participation in insulin-dependent glucose transport." Mol Biol Cell, WO 99/54465 PCT/US99/08568 -34 1996;7:1075-1082). However, biochemical analyses of these interactions have been inadequate, since efficient transfection/expression of cDNAs in differentiated 3T3L1 adipocytes is notoriously difficult. To circumvent this issue, a low voltage electroporation method was established for fully differentiated 5 adipocytes which provided for efficient expression using high concentrations of plasmid DNA (Fig. 5A). As a marker for transfection/expression efficiency, differentiated 3T3L1 adipocytes were electroporated (160 V, 960 tF) with various amounts of a cDNA encoding for P-galactosidase (LacZ). Electroporation with the empty vector did not result in any detectable X-Gal staining (Fig. 5A, panel 1). In 10 contrast, electroporation with the LacZ plasmid resulted in a concentration dependent increase in adipocytes staining positive for $-galactosidase activity (Fig. 5A, panels 2-5). Electroporation with 600 gg of the LacZ expression plasmid routinely results in greater than 70% transfection efficiency with no detectable expression from contaminating fibroblasts. 15 Having established a reasonable transfection protocol for differentiated 3T3L1 adipocytes, next was examined the effect of SYNIP expression on insulin stimulated glucose transport (Fig. 5B). Cells electroporated with the empty vector (pcDNA3) remained sensitive to insulin with a 4-fold stimulation of 2-deoxyglucose uptake in these cells. Although expression of SYNIP/WT and 20 SYNIP/NT tended to increase the basal uptake of 2-deoxyglucose, exposure of these cells to insulin resulted in an activation of glucose transport similar to that observed in cells transfected with the empty vector. In contrast, expression of SYNIP/CT slightly inhibited the basal rate of glucose transport, but significantly blunted the insulin-stimulated increase. 25 3T3L1 adipocytes express both the GLUT1 and GLUT4 glucose transporter isoforms (Calderhead D.M., Kitagawa K., Lienhard G.E., and Gould G.W., "Translocation of the brain-type glucose transporter largely accounts for insulin stimulation of glucose transport in BC3H- 1 myocytes." Biochem J, 1990;269:597-601; Yang J. and Holman G.D., "Comparison of GLUT4 and 30 GLUT 1 subcellular trafficking in basal and insulin-stimulated 3T3-L1 cells." J Biol Chem, 1993;268:4600-4603). Although GLUT 1 primarily resides on the cell surface in the basal state, it can also undergo insulin-stimulated translocation WO 99/54465 PCTIUS99/08568 -35 to the plasma membrane (Holman G.D., Kozka I.J., Clark A.E., Flower C.J., Saltis J., Habberfield A.D., Simpson I.A., and Cushman S.W., "Cell surface labeling of glucose transporter isoform GLUT4 by bis-mannose photolabel. Correlation with stimulation of glucose transport in rat adipose cells by insulin 5 and phorbol ester." J Biol Chem, 1990;265:18172-18179; Piper R.C., Hess L.J., and James D.E., "Differential sorting of two glucose transporters expressed in insulin-sensitive cells." Am J Physiol, 1991;260:C570-580; Robinson L.J., Pang S., Harris D.S., Heuser J., and James D.E., "Translocation of the glucose transporter (GLUT4) to the cell surface in permeabilized 3T3-L1 adipocytes: 10 effects of ATP insulin, and GTP gamma S and localization of GLUT4 to clathrin lattices." J Cell Biol, 1992; 117:1181-1196). Thus, to distinguish the effect of SYNIP expression on GLUTI and GLUT4 translocation, 3T3L1 adipocytes were transfected with enhanced Green Fluorescent Protein tagged GLUT4 (GLUT4-eGFP) and GLUT 1 (eGFP-GLUT1) cDNAs (Fig. 6). In control 15 cells, GLUT4-eGFP was localized to a perinuclear region and to discrete intracellular vesicles throughout the cell interior, but not at the cell surface (Fig. 6A, panel 1). This pattern of GLUT4-eGFP protein expression is identical to that observed for endogenous GLUT4 and co-localizes with another protein marker for the insulin-responsive GLUT4 vesicles, vp165/IRAP (data not shown). 20 Insulin stimulation resulted in a redistribution of the intracellular localized GLUT4-eGFP to the plasma membrane (Fig. 6A, panel 2). These data demonstrate that the expressed GLUT4-eGFP in 3T3L1 adipocytes undergoes the characteristic insulin-stimulated translocation to the plasma membrane, reminiscent of endogenous GLUT4. Consistent with the glucose transport data, 25 expression of SYNIPIWT and SYNIP/NT had no effect on the insulin-stimulated translocation of GLUT4-eGFP (Fig. 6A, panels 2-6). Although expression of SYNIP/CT did not alter the basal distribution of GLUT4-eGFP, there was a near complete inhibition of plasma membrane rim fluorescence (Fig. 6A, panels 7 and 8). 30 In contrast to GLUT4, a large proportion of GLUT1 is found localized to the plasma membrane in the basal state (Rea S. and James D.E., "Moving GLUT4: the biogenesis and trafficking of GLUT4 storage vesicles." Diabetes, 1997;46:1667-1677; Yang J. and Holman G.D., "Comparison of GLUT4 and WO 99/54465 PCTIUS99/08568 -36 GLUT1 subcellular trafficking in basal and insulin-stimulated 3T3-L1 cells." JBiol Chem, 1993;268:4600-4603). Similarly, expression of eGFP-GLUT1 also resulted in both plasma membrane and intracellular localization in the basal state (Fig. 6B, panel 1). As expected, transfection with the empty vector had no 5 significant effect on the distribution of eGFP-GLUTI (Fig. 6B, panel 2). In addition, expression of SYNIP/WT, SYNIP/NT, or SYNIP/CT did not affect either the basal or insulin-stimulated localization of eGFP-GLUT1 (Fig. 6B, panels 2-8). Thus, the inhibition of insulin-stimulated glucose transport activity by SYNIP/CT was specific for GLUT4 translocation, without any significant effect 10 on GLUTI subcellular distribution. EXAMPLE 2 Cloning of a cDNA Encoding Human SYNIP In order to identify hSYNIP, a human sequence database was queried with the nucleotide sequence encoding for mouse SYNIP. A human expressed 15 sequence tag (EST) clone, AA652491, was identified. This EST exhibited 86% homology to the mouse SYNIP sequence. In order to obtain a full-length human clone, we used the sequence information from the EST to design a polymerase chain reaction (PCR) strategy utilizing Rapid Amplification of cDNA Ends (RACE). Two forward PCR 20 primers, 5'-AGCCCACAAAGGAACAACACCAAGCC-3' and 5'-GCTCAAGTGTGAAGAGATGATGCC-3', were designed for 3' nested PCR RACE and two reverse primers, 5'-GGCATCATCTCTTTCACACTTGAGC-3' and 5'-GCAAGCAAAACAAGTTTCTGGCAACC-3' were designed for 5' nested RACE. Reactions were carried out using a Clontech human fat RACE library. 25 After completing the 5' and 3'RACE reactions, the resulting sequences were combined to obtain the full length sequence. To confirm that the 5'RACE and 3'RACE sequences were from the same gene, a 5' forward primer surrounding the ATG start codon was designed. Using this oligonucleotide, along with a 3' reverse primer surrounding the stop codon, another PCR reaction was 30 preformed, and a single band was amplified, confirming the identity of the cDNA.
WO 99/54465 PCT/US99/08568 -37 The resulting clone was subject to a final sequence analysis, yielding the complete human SYNIP cDNA sequence. It is to be understood that the invention is not to be limited to the exact details of operation, or to the exact compounds, compositions, methods, 5 procedures, or embodiments shown and described, as obvious modifications and equivalents will be apparent to one skilled in the art, and the invention is therefore to be limited only by the full scope of the appended claims.
Claims (20)
1. An isolated and purified DNA sequence substantially similar to the DNA sequence shown in SEQ ID 1 or 4. 5
2. An isolated and purified DNA sequence that hybridizes to the DNA sequence shown in SEQ ID 1 or 4 under high stringency hybridization conditions.
3. An isolated and purified DNA sequence that consists essentially of the DNA sequence shown in SEQ ID 1 or 4. 10
4. A recombinant DNA molecule comprising the isolated and purified DNA sequence of Claim 1, 2, or 3 subeloned into an extra-chromosomal vector.
5. A recombinant host cell comprising a host cell transfected with the recombinant DNA molecule of Claim 4.
6. A substantially purified recombinant polypeptide, wherein the amino acid 15 sequence of the substantially purified recombinant polypeptide is substantially similar to the amino acid sequence shown in SEQ ID 2 or 5.
7. A substantially purified recombinant polypeptide, wherein the amino acid sequence of the substantially purified recombinant polypeptide consists essentially of the amino acid sequence shown in SEQ ID 2 or 5. 20
8. An antibody that selectively binds polypeptides with an amino acid sequence substantially similar to the amino acid sequence of Claim 6.
9. A method of detecting a SYNIP in cells, comprising contacting cells with the antibody of Claim 8 and incubating the cells in a manner that allows for detection of the SYNIP-antibody complex. WO 99/54465 PCT/US99/08568 -39
10. A diagnostic assay for detecting cells containing SYNIP mutations, comprising isolating total genomic DNA from the cell and subjecting the genomic DNA to PCR amplification using primers derived from the isolated and purified DNA sequence of Claim 1, 2, or 3 and determining 5 whether the resulting PCR product contains a mutation.
11. A diagnostic assay for detecting cells containing SYNIP mutations, comprising isolating total cell RNA, subjecting the RNA to reverse transcription-PCR amplification using primers derived from the isolated and purified DNA sequence of Claim 1, 2, or 3 and determining whether 10 the resulting PCR product contains a mutation.
12. A diagnostic assay for detecting or screening of therapeutic compounds that interfere with the interaction between SYNIP and syntaxin-4 or other ligands that bind to SYNIP, comprising the step of measuring the interaction between SYNIP and syntax-4 or other ligands that bind to 15 SYNIP, while in the presence of at least one other therapeutic compound.
13. A diagnostic assay for the discovery of proteins that interact directly or indirectly with SYNIP, comprising the step of detecting the interaction of SYNIP or cDNA encoding SYNIP with proteins in mammalian cells.
14. A method of isolating RNA containing stretches of polyA or polyC 20 residues, comprising: (a) contacting an RNA sample with SYNIP in RNA binding buffer in the presence of a reducing agent; (b) incubating the RNA-SYNIP mixture with the antibody of Claim 8; (c) isolating the antibody-SYNIP-RNA complexes; and 25 (d) purifying the RNA away from the antibody-SYNIP complex.
15. A method of isolating RNA containing stretches of polyU residues, comprising: WO 99/54465 PCTIUS99/08568 -40 (a) contacting an RNA sample with SYNIP in RNA binding buffer in the absence of reducing agents; (b) incubating the RNA-SYNIP mixture with the antibody of Claim 8; (c) isolating the antibody-SYNIP-RNA complexes; and 5 (d) purifying the RNA away from the antibody-SYNIP complex.
16. A method for purifying SYNIP from bacterial cells comprising: (a) transfecting a bacterial host cell with a vector comprising the isolated and purified DNA sequence of Claim 1, 2, or 3 operatively linked to a promoter capable of directing gene expression in a 10 bacterial host cell; (b) inducing expression of the isolated and purified DNA sequence in the bacterial cells; (c) lysing the bacterial cells; (d) isolating bacterial inclusion bodies; 15 (e) purifying SYNIP protein from the isolated inclusion bodies.
17. A method of isolating RNA containing stretches of polyU residues, comprising: (a) contacting an RNA sample with SYNIP in RNA binding buffer in the absence of reducing agents; 20 (b) incubating the RNA-SYNIP mixture with the antibody of Claim 8; (c) isolating the antibody-SYNIP-RNA complexes; and (d) purifying the RNA away from the antibody-SYNIP complex.
18. A method for protecting mammalian cells from glucose utilization or storage disorders, comprising introducing into mammalian cells an 25 expression vector comprising the isolated and purified DNA sequence of Claim 1, 2, or 3, which is operatively linked to a DNA sequence that promotes the high level expression of the isolated and purified DNA sequence in mammalian cells. WO 99/54465 PCT/US99/08568 -41
19. A method for treating or preventing insulin resistance, comprising introducing into a mammal an expression vector comprising the isolated and purified DNA sequence of Claim 1, 2, or 3, which is operatively linked to a DNA sequence that promotes the high level expression of the 5 antisense strand of the isolated and purified DNA sequence in mammalian cells.
20. A method for purifying SYNIP from bacterial cells comprising: (a) transfecting a bacterial host cell with a vector comprising the isolated and purified DNA sequence of Claim 1, 2, or 3 operatively 10 linked to a promoter capable of directing gene expression in a bacterial host cell; (b) inducing expression of the isolated and purified DNA sequence in the bacterial cells; (c) lysing the bacterial cells; 15 (d) isolating bacterial inclusion bodies; (e) purifying SYNIP protein from the isolated inclusion bodies.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2003266470A AU2003266470A1 (en) | 1998-04-20 | 2003-12-04 | Gene encoding syntaxin interacting protein |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US8245498P | 1998-04-20 | 1998-04-20 | |
US60/082454 | 1998-04-20 | ||
PCT/US1999/008568 WO1999054465A2 (en) | 1998-04-20 | 1999-04-19 | Gene encoding syntaxin interacting protein |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2003266470A Division AU2003266470A1 (en) | 1998-04-20 | 2003-12-04 | Gene encoding syntaxin interacting protein |
Publications (2)
Publication Number | Publication Date |
---|---|
AU3653599A true AU3653599A (en) | 1999-11-08 |
AU769825B2 AU769825B2 (en) | 2004-02-05 |
Family
ID=22171326
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU36535/99A Ceased AU769825B2 (en) | 1998-04-20 | 1999-04-19 | Gene encoding syntaxin interacting protein |
Country Status (9)
Country | Link |
---|---|
EP (1) | EP1071771A2 (en) |
JP (1) | JP2002512031A (en) |
KR (1) | KR20010042834A (en) |
AU (1) | AU769825B2 (en) |
BR (1) | BR9909732A (en) |
CA (1) | CA2326623A1 (en) |
NZ (2) | NZ526016A (en) |
WO (1) | WO1999054465A2 (en) |
ZA (1) | ZA200005845B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6503756B1 (en) | 2000-09-22 | 2003-01-07 | Isis Pharmaceuticals, Inc. | Antisense modulation of syntaxin 4 interacting protein expression |
WO2004053103A2 (en) * | 2002-12-11 | 2004-06-24 | University Of Massachusetts | METHOD OF INTRODUCING siRNA INTO ADIPOCYTES |
FR2890859B1 (en) * | 2005-09-21 | 2012-12-21 | Oreal | DOUBLE-STRANDED RNA OLIGONUCLEOTIDE INHIBITING TYROSINASE EXPRESSION |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2001519667A (en) * | 1997-04-10 | 2001-10-23 | ジェネティックス・インスチチュート・インコーポレーテッド | Secretory expression sequence tags (sESTs) |
-
1999
- 1999-04-19 NZ NZ526016A patent/NZ526016A/en unknown
- 1999-04-19 CA CA002326623A patent/CA2326623A1/en not_active Abandoned
- 1999-04-19 EP EP99918680A patent/EP1071771A2/en not_active Withdrawn
- 1999-04-19 BR BR9909732-0A patent/BR9909732A/en not_active IP Right Cessation
- 1999-04-19 WO PCT/US1999/008568 patent/WO1999054465A2/en not_active Application Discontinuation
- 1999-04-19 JP JP2000544797A patent/JP2002512031A/en active Pending
- 1999-04-19 KR KR1020007011597A patent/KR20010042834A/en not_active Application Discontinuation
- 1999-04-19 NZ NZ507640A patent/NZ507640A/en unknown
- 1999-04-19 AU AU36535/99A patent/AU769825B2/en not_active Ceased
-
2000
- 2000-10-19 ZA ZA200005845A patent/ZA200005845B/en unknown
Also Published As
Publication number | Publication date |
---|---|
WO1999054465A2 (en) | 1999-10-28 |
AU769825B2 (en) | 2004-02-05 |
WO1999054465A9 (en) | 2000-01-27 |
KR20010042834A (en) | 2001-05-25 |
EP1071771A2 (en) | 2001-01-31 |
BR9909732A (en) | 2000-12-19 |
JP2002512031A (en) | 2002-04-23 |
NZ507640A (en) | 2003-12-19 |
ZA200005845B (en) | 2002-04-19 |
NZ526016A (en) | 2004-10-29 |
WO1999054465A3 (en) | 2000-03-02 |
CA2326623A1 (en) | 1999-10-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU700915B2 (en) | Lung cancer marker | |
JP3294575B2 (en) | Proteins that interact with the IGF-1 receptor, genes encoding them and uses thereof | |
WO1995033819A2 (en) | Cdk4 (cyclin dependent kinase 4) binding proteins | |
EP1005549A2 (en) | Prostate tumor polynucleotide and antigen compositions | |
WO1995014777A1 (en) | p53-BINDING POLYPEPTIDES AND POLYNUCLEOTIDES ENCODING SAME | |
WO2000052173A2 (en) | Cloned human sphingosine kinase homologues | |
JP5180582B2 (en) | Purkinje cell identification method targeting Corl2 gene | |
AU769825B2 (en) | Gene encoding syntaxin interacting protein | |
US6596855B2 (en) | Probes for chondrogenesis | |
CA2236154A1 (en) | Novel creba isoform | |
EP0863204B1 (en) | Human cyclin i and gene encoding the same | |
US6680196B1 (en) | Gene that is amplified and overexpressed in cancer and methods of use thereof | |
AU2003266470A1 (en) | Gene encoding syntaxin interacting protein | |
US6294384B1 (en) | Compositions and methods based upon an isoform of p53 | |
MXPA00009332A (en) | Gene encoding syntaxin interacting protein | |
CA2359145A1 (en) | Exocytosis pathway proteins and methods of use | |
US6300473B1 (en) | SLM-1: a novel Sam68-like mammalian protein | |
US20040171810A1 (en) | Presynaptic protein cast | |
EP1135496B1 (en) | Ucp5 | |
CA2376404A1 (en) | Meg-1 protein | |
WO1996022367A1 (en) | Nucleic acid encoding a stress-responsive subunit of human rna polymerase ii | |
US20030105001A1 (en) | Pro-apoptotic proteins and DNA molecules encoding them | |
JP2001224378A (en) | HUMAN PROTEIN AND cDNA [7] | |
WO2002074919A2 (en) | Protein-protein interactions | |
JP2002101891A (en) | Cell cycle-regulating protein |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FGA | Letters patent sealed or granted (standard patent) |