AU2890700A - Pineal gland specific gene-1 - Google Patents

Description

-1-

S

S

AUSTRALIA

PATENTS ACT 1990 DIVISIONAL APPLICATION NAME OF APPLICANT(S): Human Genome Sciences, Inc ADDRESS FOR SERVICE: DAVIES COLLISON CAVE Patent Attorneys Level 3, 303 Coronation Drive Milton, 4064.

INVENTION TITLE: Pineal gland specific gene-1 The following statement is a full description of this invention, including the best method of performing it known to us: S Q:\OPER\VPA\716415.DIV 19/4/0 PINEAL GLAND SPECIFIC GENE-1 *o This invention relates to newly identified polynucleotides, polypeptides encoded by such •polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention has been putatively identified as a pineal gland specific gene-1, sometimes hereinafter referred to as "PGSG-1".

The pineal gland (pineal gland or epiphysis cerebri) of humans and other mammals is considered to be endocrine in its functional activity. However, in its origin and evolution within vertebrate animals it has had other functional relationships. In lower forms pineal photoreceptive capacity is the major activity suggested on the basis of both microscopic structure and neurophysiology.

The mammalian pineal gland is a distinctive component of the neuroendocrine system. Within the pineal gland, neural and hormonal inputs interact to regulate the synthetic and secretory activities of the pineal unique parenchymal cells, the pinealocytes. These cells are believed to synthesize and secrete hormones of two chemical families: indoleamines such as melatonin, and peptides resembling those of the hypothalamohypophyseal system. The major endocrine function -1of the pineal gland, is mediation or modulation of the timing of some biological rhythms, known as circadian rhythms. This modulation relates to changes in the timing of the phases of the 24 hour (circadian) and seasonal or annual (circannual) rhythms in response to environmental cues, such as the daily start and ending of light. The pineal glands rich sympathetic innervation and physiological interrelationships with stress and arousal have suggested that its endocrine activity probably is tied to these factors as well.

The pineal gland is further thought to act on aspects of brain chemistry and excitability under certain conditions.

The clearest demonstration of pineal function has been made with the seasonal regression of reproductive organs in :.several photoperiodic species. In the golden hamster, the "best studied of these species, the reproductive regression that is prompted by darkness or short day photoperiods depends on the presence of the pineal gland. In humans as in other species, marked 24 hour and seasonal rhythms occur in *"blood levels of the pineal hormone melatonin.

human pineal gland develops early during the second of embryonic life. Although it is a single median structure in the adult, in the embryo it often has two parts, an anterior and solid part originating from the region of the habenular conmissure, and a posterior and hollow part originating from a secular evagination of the diencephalic roof between the habenular and posterior coummissures The *o mammalian pineal gland grows from infancy to adulthood mainly by an increase in the size of the pinealocytes and, secondarily and more variably, by an increase in glial and stromal cells and their products.

Adult human pineal glands are 5 to 8 mn long and 3 to mm wide. Their thin connective tissue capsule is externally continuous with meningeal tissues and is basally interrupted by the pineal stalk.

The dominant view is that pineal innervation is exclusively autonomic and that the endocrine functioning of the pinealocytes depends on their sympathetic innervation.

The anatomical position of the pineal gland is critical to intracranial venous drainage. It lies close to the union of outflow from the deep cerebral veins within the median and deep dural venous sinuses. Pineal tumors often impede or divert this outflow by compressing it against the splenium of the corpus callosum.

The pinealocytes have organelles for active oxidative metabolism and protein synthesis and have at least parts of structures usually associated with synaptic contacts in central nervous or retinal tissues. Pinealocytes contain vesicles or dense bodies that some authors believe to contain presecretory materials. However, the local concentration and number of these vesicles and bodies are generally not great.

Pinealocyte mitochondria are notable for their relatively great number or concentration in the perikaryon, there polymorphism and frequently large size.

Many of the organelles and inclusions of the pinealocytes follow 24 hour cycles of change. Interest in this subject started with the discovery of high-amplitude 24 hour rhythms in pineal serotonin (5-HT, and subsequently in the enzyme activities contributing to the synthesis of melatonin. The chemical and ultrastructural elements contributing to melatonin synthesis and secretion lie within the pinealocytes. In the pinealocytes, cytoplasmic vesicles, microtubules, glycogen granules, synaptic ribbons and synaptic ribbon fields similarly showed marked 24 hour cycles. Many of these elements have their daily peak or acrophase, during the night or dark phase of the daily cycle. It has been suggested that synaptic ribbons in mammalian pinealocytes may be involved more diffusely in the transport and release of chemical mediators.

The pineal products are hormonal in function and are thought to act upon other organs and bodies within the brain.

The pineal products are of two biochemical types, indeolamines and peptides or proteins. The pineal gland is required for normal levels of melatonin in the blood, since these levels are diminished in pinealectomized animals.

Plasma melatonin concentrations in humans and other studied species vary with time of day and with seasons or time of year and apparently in a innate 24 rhythmicity in pineal biosynthetic and metabolic activities in the early postnatal animal comes under sympathetic control and the organ acquires sympathetic innervation. This sympathetic control occurs through the agency of norepinephrine and cyclic amp.

ooo.

Many of the peptides produced by the pineal gland are found in the hypothalamohypophyseal' Other peptides produced by the pineal gland include arginine, vasopressin, arginine vasotocin, LH-RH, TRH, somatostatin, a-MSH, angiotensin 2, and substance P (Quay, Histology Cell and Tissue S Biology (5th pages 1079 to 1089 (1977), (edited by Weiss, Pineal gland tumors, also known as germinomas, are thought to destroy an inhibitory effect on the pituitary gland by the pineal gland which results in precocious puberty in children. Pineal tumors are known most comunon in childhood.

In accordance with one aspect of the present invention, there are provided novel mature polypeptides as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof. The polypeptide of the present invention is of human origin.

In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules, including mRNAs, DNAs, cDNAs, genomic DNAs as well as analogs and biologically active and diagnostically or therapeutically useful fragments thereof.

In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention, under conditions promoting expression' of said protein and subsequent recovery of said protein.

In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptide, or polynucleotide encoding such polypeptide for therapeutic purposes, for example, for regulating secretions of the pituitary gland and for modulating biological rhythms.

so. In accordance with yet a further aspect of the present invention, there is also provided nucleic acid probes copiignucleic acid molecules of sufficient length to spciicll hyrdz to a nucleic acid seuneofth present invention.

In accordance with yet a further aspect of the present invention, there are provided antibodies against such poypeptid~es.

In accordance with another aspect of the present invention, there is provided a process for screening compounds to determine compounds which bind to and activate.

the receptor for the polypeptide of the present invention and for compounds which bind to and inhibit the receptors for the polypeptides, of the present invention.

In accordance with another aspect of the present invention there is provided a process of utilizing compounds which bind to and activate the receptor for the polypeptide of the present invention for therapeutic purposes.

In accordance with yet another aspect of the present invention, there is provided a process f or utilizing the compounds which bind to and inactivate the receptor for the polypeptide of the present invention for therapeutic purposes.

In accordance with another aspect of the present invention there are provided diagnostic assays for detecting diseases related to mutations in the nucleic acid sequences encoding a polypeptide of the present invention and for detecting an altered level of the polypeptide of the present invention.

In accordance with yet a further aspect of the present invention, there are provided processes for utilizing such polypeptide, or polynucleotides encoding such polypeptides, for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors.

These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

Figure 1 illustrates the cDNA and corresponding deduced amino acid sequence of PGSG-1. The underlined region represents a putative signal sequence and the standard one letter abbreviations for amino acids are used.

In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone assigned ATCC Deposit No. 97162, deposited with the American Type Culture Collection 10801 University Boulevard, Manassas VA 20110-2209, United States of America on May 24, 1995.

A polynucleotide encoding a polypeptide of the present invention was discovered in a cDNA library derived from human pineal gland tissue. The polynucleotide of this invention was discovered in a cDNA library derived from a human pineal gland. It contains an open reading frame encoding a protein of 344 amino acid residues of which approximately the first 21 amino acids residues are the putative leader sequence such that the mature protein comprises 323 amino acids. The putative soluble mature portion of the protein comprises amino acid 1 to amino 262 of SEQ ID NO:1. Beyond amino acid 262 of SEQ ID NO:1 the protein is insoluble. The protein includes a transmembrane portion which has been putatively identified as comprising amino acids 262 to 323 of SEQ ID NO:2.

The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be doublestranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID NO:1) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:1) or the deposited cDNA.

The polynucleotide which encodes for the mature polypeptide of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the deposited cDNA may include, but is not limited to: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory "sequence or a proprotein sequence; the coding sequence for t-e mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or noncoding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.

Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.

The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone.

The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a nonnaturally occurring variant of the polynucleotide.

Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO:2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.

As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID NO:1) or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.

The present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptide may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides may also encode for a proprotein which is the mature protein plus additional amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains.

Thus, for example, the polynucleotide of the present invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).

The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexahistidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, et al., Cell, 37:767 (1984)).

The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least and more preferably at least 95% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein used, the term ."stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SEQ ID NO:1) or the deposited cDNA(s), i.e. function as a soluble neuroneptide receptor by retaining the ability to bind the ligands for the receptor even though the polypeptide -9does not function as a membrane bound neuropeptide receptor, for example, by eliciting a second messenger response.

Alternatively, the polynucleotide may be a polynucleotide which has at least 20 bases, preferably bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which does not retain activity. Such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:1, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.

The deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. §112.

The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of "..the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.

The present invention further relates to a polypeptide which has .the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.

The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide. Thus, an analog includes a proprotein "I which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.

The fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA may be one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may a see* not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the too@ teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "isolated" means that the material is removed from its original environment the natural environment if it is naturally occurring). For example, a naturallyoccurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a -11-

"I

composition, and still be isolated in that such vector or composition is not part of its natural environment.

The polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least similarity (preferably at least 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least similarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least similarity (still more preferably at least 95% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.

As known in the art "similarity" between two o polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one Spolypeptide to the sequence of a second polypeptide o.o Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention. The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.

Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the -12form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the PGSG-1 genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used as long as it is replicable and viable in the host.

The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or promoter, the E. coli. lac or tr, the phage lambda P, promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.

The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.

-13- I I The vector may also include appropriate sequences for amplifying expression.

In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transf'-n an appropriate host to permit the host to express the prc _n.

As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomyces, Salmonella tvphimurium; fungal cells, such as yeast; insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS or Bowes melanoma; adenoviruses; plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pDl0, phagescript, psiX174, pbluescript SK, pbsks, pNHBA, pNH16a, pNH1A, pNH46A (Stratagene); ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia); Eukaryotic: pWLNEO, -14pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.

Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda PL and trp.

Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a .C ma. m alian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L., Dibner, Battey, Basic Methods in Molecular Biology, (1986)).

The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.

Fragments of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis, therefore, the fragments may be employed as intermediates for producing the fulllength polypeptides. Fragments of the polynucleotides of the present invention may be used in a similar manner to synthesize the full-length polynucleotides of the present invention.

Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.

Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second :'Edition, Cold Spring Harbor, (1989), the disclosure of Swhich is hereby incorporated by reference.

Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription.

Examples include the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3 -phosphoglycerate kinase (PGK), a-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence -16can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, stabilization or simplified purification of expressed recombinant product.

Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli, .*Bacillus subtilis, Salmo)nella t21himurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.

As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commnercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCc 37017). Such coymmercial vectors include, for example, pKK223-3 (Pharmacia FieChemicals, UpslSee)and GEM. (Promega Biotec, Madison, WI, USA) These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.

Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means temperature shift or chemical induction) and cells are cultured for an additional period.

Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.

-17- Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well known to those skilled in the art.

V.-rious mammalian cell culture systems can also be employed to express recombinant protein. Examples of manmalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CH0, HeLa and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.

The polypeptide can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.

The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant -18production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated Polypeptides of the invention may also include an initial methionine amino acid residue.

Pineal tumors occur at any age, but are most common in childhood. Precocious puberty is a result of pineal tumors, especially in boys. The tumor compresses the aqueduct of Sylvius, causing hydrocephalus, papilledema and other signs of increased intracranial pressure. The region with the superior colliculi is also compressed, resulting in paralysis of upward gaze, ptosis, and loss of pupillary light and accommodation reflexes.

Accordingly, administration of a therapeutically effective amount of PGSG-l polypeptide may be employed to treat the conditions outlined above which result from pineal .:gland tumors.

The PGSG-l gene and gene product, in particular the soluble form of the gene product, may be also be employed to regulate biological rhythms, in particular, circadian rhythms, since it is known that the pineal gland produces melatonin which is known to regulate circadian rhythms.

The PGSG-l gene and gene product may also be employed to regulate pituitary secretion of hormones which regulate the onset of puberty, namely luteinizing hormone follicular stimulating hormone (FSH) and growth hormone (GH) released by the pituitary.

Fragments of the full length PGSG-1 gene may be used as a hybridization probe for a cDNA library to isolate the full length PGSG-l gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity. Probes of this type have at least 20 bases preferably at least 30 bases, and even more preferably at least 50 bases. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic cLone or clones that contain the complete gene -19-

'U

including regulatory and promotor regions, exons, and introns. An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

The polynucleotides and polypeptides of the present invention may be employed as research reagents and materials ""for discovery of treatments and diagnostics to human disease.

This invention provides a method for identification of the receptor for a PGSG-1 polypeptide. The gene encoding the receptor can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting (Coligan, et al., Current Protocols in Immun., 1(2), Chapter 5, (1991)). Preferably, expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the PGSG-1 polypeptide, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the PGSG-1 polypeptide. Transfected cells which are grown on glass slides are exposed to labeled PGSG-1 polypeptide. The PGSG-1 polypeptide can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. Following fixation and incubation, the slides are subjected to auto-radiographic analysis. Positive pools are identified and sub-pools are prepared and re-transfected using an iterative sub-pooling and re-screening process, eventually yielding a single clone that encodes the putative receptor.

As an alternative approach for receptor identification, labeled ligand can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule.

Cross-linked material is resolved by PAGE and exposed to Xray film. The labeled Complex containing the ligand-receptor can be excised, resolved into peptide fragments, and subjected to protein micros equenc ing. The amino acid sequence obtained from microsequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor.

This invention also provides a method of screening compounds to identify those which enhance (agonists) or block (antagonists) the interaction of PGSG-l and its receptor. As an example, when screening for compounds which bind to and activate the PGSG-l receptor, the PGSG-1 receptor in an isolated, immuobilized or cell-bound form is contacted with a plurality of compounds and those compounds are selected which *:bind to and interact with the receptor. The binding or interaction can be measured directly by using radioactively labeled compounds of interest or by the second messenger signals resulting from the interaction or binding of the candidate compound to the receptor.

When screening for compounds which bind to and inhibit interaction of PGSG-l with its receptor, the candidate compounds are subject to competition- screening assays, in which PGSG-l, preferably labeled with an analytically *detectible reagent, most preferably radioactivity, is introduced with the compound to be tested and the compounds capacity to -inhibit or enhance the binding of the labeled PGSG-1 is measured.

Another example of screening for compounds which inhibit activation of the PGSG-l receptor comprises contacting the compound to be screened and the PGSG-l polypeptide with the PGSC-l receptor in isolated or membrane-bound form.

Inhibition of the signal generated by PGSG-l upon interaction with its receptor indicates that the compound inhibits activation of the receptor by blocking the receptor or preventing the interaction of PGSG-l with its receptor.

-21- Second messenger signals include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.

Specific examples of compounds which inhibit activation of the PGSG-1 receptor include an antibody, or in some cases, an oligopeptide, which binds to the polypeptide, or a closely related protein which binds to the receptor sites, but which are inactive forms of the polypeptide and thereby block the receptor sites.

Another example is an antisense construct prepared using antisense technology. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and the production of PGSG-1. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the. PGSG-1 polypeptide (Antisense Okano, J.

Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of PGSG-1.

Further examples also include a small molecule which binds to and occupies the catalytic site of the polypeptide thereby making the catalytic site inaccessible to substrate such that normal biological activity is prevented. Examples -22- N of small molecules include but are not limited to small peptides or peptide-like molecules.

These compounds ay be employed to regulate the secretion of hormones from the pituitary gland which regulate growth and differentiation, for example, LH, FSH and Gil.

They may be employed in a composition with a pharmaceutically acceptable carrier, as hereinafter described.

The polypeptides of the present invention and antagonist and agonist compounds thereof may be employed in combination with a suitable pharmaceutical carrier. Such compositions *comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to S. saline, buffered saline, dextrose, water, glycerol, ethanol, combinations thereof. The formulation should suit the mode of administration.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of *manufacture, use or sale for human administration. In the polypeptides of the present invention or compounds may be employed in conjunction with other therapeutic compounds.

The pharmaceutical compositions may be administered in a convenient manner, parenterally. The pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication.

In general, they are administered in an amount of at least about 10 Ag/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about -23- Ag/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.

The PGSG-1 polypeptides and compounds which activate or inhibit its receptor and which are also polypeptides may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy." Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells :hen being provided to a patient to be treated with the polypeptide.

Such methods are well-known in the art and are apparent from the teachings herein. For example, cells may be engineered by the us.e of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention.

Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. For example, a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the *o packaging cell now produces infectious viral particles containing the gene of interest. These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention-by such method should be apparent to those skilled in the art from the teachings of the present invention.

Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.

-24- In one embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.

The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and 3-actin promoters). Other viral S* promoters which may be employed include, but are not limited se. to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable S. promoter will be apparent to those skilled in the art from the teachings contained herein.

The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable ]promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described); the 0-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the gene encoding the polypeptide.

The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, O-AM, PAl2, T19-14X, VT-19-17-H2, OCRE, 4CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO, precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.

The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will S: express the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.

This invention is also related to the use of the gene gene of the present invention as a diagnostic. Detection of a mutation in a polynucleotide sequence of the present invention allows a diagnosis of a disease or a susceptibility to a disease which results from under-expression of PGSG-1 for example,- precocious puberty.

Individuals carrying mutations in the human PGSG-1 gene may be detected at the DNA level by a variety of techniques.

Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis.

RNA or cDNA may also be used for the same purpose. As an example, PCR primers complementary to the nucleic acid -26sequence encoding a polypepticie of the prevention can be used to identify and analyze mutations. Point mutations can be identified by hybridizing amplified DNA to radio-labeled PGSG-1 RNA or alternatively, radio-labeled PGSG-1 antisense DNA sequences. For example, deletions and insertions Can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radiolabeled

PGSG-

1 RNA or alternatively, radiolabeled PGSG-1 antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.

Sequence differences between the reference gene and genes having mutations may be revealed by the direct DNA sequencing method. In addition, cloned DNA segments may be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.

Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of .DNA fragments in gels with or without denaturing .agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis.

DNA

fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, Myers et al., Science, 230:1242 (1985)).

-27- Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and Si protection or the chemical cleavage method Cotton et al., PNAS, USA, 85:4397-4401 (1985)).

Thus, the detection of a specific DNA sequence mnay be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, Restriction Fragment Length Polymorphisms (RFLP)) and Southern blotting of genomic

DNA.

In addition to more conventional gel -electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.

The present invention also relates to a diagnostic assay for detecting altered levels of a polypeptide of the present invention which is below normal when compared to a normal control tissue sample, which may be employed to detect the presence of a penial tumor. Assays to detect levels of a polypeptide of the present invention in a sample derived protein in a sample derived from a host are well-known to those of skill in the art and include radioimmrnoas says, competitive-binding assays, Western Blot analysis and preferably an ELISA assay. An ELISA assay initially comprises preparing an antibody specific to the PGSG-1 antigen, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme. A sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any polypeptides of the present invention attached to the polystyrene-proteins attached to the polystyrene dish. All unbound monoclonal. antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase is no placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to a polypeptide of the present invention. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of the polypeptide of the present invention present in a given protein present in a given volume of patient sample when compared against a standard curve.

competition assay may be employed wherein antibodies .specific to PGSG-l protein are attached to a solid support and labeled PGSG-l protein and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity of PGSG-l protein in the sample.

The sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal -location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.

Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA.

Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR -29screening of somnatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.

Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.

Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA having at least 50 or bases. For a review of this technique, see Verma et al., Human Chrromosomes: a Manual of Basic Techniques, Pergamn Press, New York (1988).

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch medical Library) The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).

Next, it is necessary to determine the dif ferences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per kb).

The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies.

The .esent invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.

Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.

For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBVhybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).

-31- Techniques described for the production of single chain antibodies Patent 4,946,778) can be adapted to produce single chain antibodies to immnunogenic polypeptide products of this invention. Also, transgenic mice may be used~ to express humanized antibodies to ilmmunogenic polypeptide products of this invention.

The present invention will be further *described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.

In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.

"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commnercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids: in accord with published procedures. In addition, .equivalent plasmids to those described are known in the art and will be apparent to the ordi narily skilled artisan.

"Digestion" of DNA refers to catalytic cleavage of the *DNA with a restriction enzyme that -acts only at certain sequences in the DNA. The various restriction enzymes used herein are- commuercially available and their reaction conditions,' cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 pg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 M1 of buffer solution. For the purpose of isolating

DNA

fragments for plasmid construction, typically 5 to 50 pg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the -32manufacturer. Incubation times of about 1 hour at 37 0 C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D.

et al., Nucleic Acids Res., 8:4057 (1980).

"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic o- ligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.

"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 Ag of approximately equimolar amounts of the DNA fragments to be ligated.

Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).

Example 1 Bacterial Expression and Purification of a soluble form of PGSG-1 protein The DNA sequence encodingPGSG-1, ATCCNo. 97162 is initially amplified using as a 5' oligonucleotide primer has sequence GCAGATCTGACAAGTGTTACTGTCAGTCATC (SEQ ID NO:3) which contains a BglII restriction enzyme site followed by 24 nucleotides of PGSG-1 coding sequence starting from the presumed terminal amino acid of the processed protein codon and as a 3' sequence GCAAGATCTTAACGCAGGTTGGGC CTGGCCGCT (SEQ ID NO:4) which contains complementary sequences to a BglII restriction enzyme site and is followed by 28 nucleotides of PGSG-1 coding sequence and further includes a stop codon ending at amino acid 262 of SEQ ID NO:2. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9. pQE-9 encodes antibiotic resistance (Amp') a bacterial origin of replication (ori), an IPTGregulatable promoter operator a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites. pQE-9 was then digested with BamHI. The amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding for the histidine tag and the ribosome binding site (RBS). The vector containing insert with a ppropriate orientation was confirmed by sequencing. The ligation mixture was then used to transform E. coli strain 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lacI repressor and also confers kanamycin resistance (Kant).

Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction- analysis. Clones containing the desired "constructs were grown overnight in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan ug/ml). The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D.

6 w) of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O leading to increased gene expression. Cells were grown an extra 3 to 4 hours.

-34- Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HC1. After clarification, solubilized PGSG-1 was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J.

Chromatography 411:177-184 (1984)). 90" pure protein was eluted from the column in 6 molar guanidine HC1 pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HC1, 100mM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After incubation in this solution for 12 hours the protein was dialyzed to mmolar sodium phosphate.

r. Example 2 Cloning and expression of a soluble form of PGSG-1 using the Sbaculovirus expression system The DNA sequence encoding the full length PGSG-1 protein, ATCC No. 97162, was amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene: The 5' primer has the sequence GCAGATCTATCATGAAAGGTGAACTGCTCCT 3' (SEQ ID NO:5) which contains a BglII restriction enzyme site (in bold).

The 3' primer has the sequence GCAGATCTTTAACGCAGGTTGGCCGGCCTTGGCTT 3' (SEQ ID NO:6) which contains the cleavage site for the restriction endonuclease BglII and 24 nucleotides complementary to the 3' sequence of the PGSG-1 gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, The fragment was then digested with the endonucleases BglII and purified again on a 1% agarose gel.

This fragment is designated F2.

The vector pA2 (modification of pVL941 vector, discussed below) is used for the expression of the PGSG-1 protein using c the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonuclease BamHI. The polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation. For an easy selection of recombinant virus the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of co-transfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pA2, such as pRG1, pAc373, pVL941 and pAcIMI (Luckow, V.A. and Summers, Virology, 170:31-39).

The plasmid was digested with the restriction enzyme BamHI and dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA was then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, This vector DNA is designated V2.

e.

Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli XL-1 Blue cells were then transformed and bacteria identified that contained the plasmid (pBac PGSG-1) with the PGSG-1 gene encoding the soluble form of the protein. Using the XhoII sequence and orientation, the cloned fragment was confirmed by DNA sequencing.

Ag of the plasmid pBacPGSG-i was co-transfected with pg of a commercially available linearized baculovirus ("BaculoGold" baculovirus DNA", Pharmingen, San Diego, CA.) -36using the lipofection method (Felgner et al. Proc. Natl.

Acad. Sci. USA, 84:7413-7417 (1987)).

lpg of BaculoGold TM virus DNA and 5 Mg of the plasmid pBac PGSG-1 were mi ed in a sterile well of a microtiter plate containing 50 i of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards I0 Al Lipofectin plus 90 Al Grace's medium were added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture was added drop-wise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 m tissue culture plate with 1 ml Grace's medium without serum. The plate .;as rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 270C. After 5 hours the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum a."was added. The plate was put back into an incubator and cultivation continued at 27 0 C for four days.

After four days the supernatant was collected and a plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques.

(A

detailed description of a "plaque assay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- Four days after the serial dilution, the virus was added to the cells and blue stained plaques were picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses was then resuspended in an Eppendorf tube containing 200 Al of Grace's medium. The agar was removed by a brief centrifugation and the supernatant containing the recombinant baculovirus was used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes were harvested and then stored at 4 0

C.

-37- Sf9 cells were grown in Grace's medium supplemented with heat-inactivated FBS. The cells were infected with the recombinant baculovirus V-PGSG-1 at a multiplicity of infection (MOI) of 2. Six hours later the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 pCi of "S-methionine and 5 gCi 35S cysteine (Amersham) were added. The cells were further incubated for 16 hours before they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.

Example 3 Expression via Gene Therapy a. Fibroblasts are obtained from a subject by skin biopsy.

The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added.

This is then incubated at 37 0 C for approximately one week.

At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks.

pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and HindIII and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on agarose gel and purified, using glass beads.

-38- The cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer containing an EcoRI site and the 3' primer further includes a HindIII site.

Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and HindIII fragment are added together, in the presence T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria HB101, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.

The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's •Modified Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin. The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging *oe• cells are now referred to as producer cells).

Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used-to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.

The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence -39on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product.

Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scor of the appended claims, the invention may be practiced otherwise than as particularly described.

Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or r group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

ooo 0

S

So

("J

SEQUENCE LISTING GENERAL INFORMATION: APPLICANT: HE, ET AL.

(ii) TITLE OF INVENTION: Pineal Gland Specific Gene (iii) NUMBER OF SEQUENCES: 6 (iv) CORRESPONDENCE ADDRESS: ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN, CECCHI, STEWART OLSTEIN STREET: 6 BECKER FARM ROAD CITY: ROSELAND STATE: NEW JERSEY COUNTRY: USA ZIP: 07068 COMPUTER READABLE FORM: MEDIUM TYPE: 3.5 INCH DISKETTE COMPUTER: IBM PS/2 OPERATING SYSTEM: MS-DOS SOFTWARE: WORD PERFECT 5.1 (vi) CURRENT APPLICATION DATA: APPLICATION NUMBER: FILING DATE: Submitted herewith

CLASSIFICATION:

(vii) PRIOR APPLICATION DATA: APPLICATION NUMBER: NONE FILING DATE: NONE riii) ATTORNEY/AGENT

INFORMATION:

NAME: FERRARO, GREGORY D.

REGISTRATION NUMBER: 36,134 REFERENCE/DOCKET NUMBER: 325800iii) TELECOMMUNICATION

INFORMATION:

TELEPHONE: 201-994-1700 TELEFAX: 201-994-1744 INFORMATION FOR SEQ ID N0:1: SEQUENCE CHARACTERISTICS LENGTH: 1198 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) MOLECULE TYPE: cDNA i- 1 -41- (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: TACGzAGGTCA GCAAGGACGC CCAAGAAGAC TCAGTCATGA AAGGTGAACr TCC:AGTGTGA TTGTCCTGCT CCAGGTGGTA TGCAGCTGCC CGGACAAGTG TCATCTACAA ATTrT'GTA3A CrGCAGCCAG CAGGGTCTGG CCGAAAT CCC CCTCCTCAGA CrCGAACGCT GCA'ITTACAA GATAATCAGA TACACCATCr GCA=rAGGT CAGTGCCATG GCTCATGACC TI'AAACTTGT CCAACA.ATrC CTGGCCCCrG GAGCrTCCA TGGG=rCAG CAC7TGCAGG TTTrAAATCr TCACrCCrTr CCCIGGAAAG CAGACr=rC CATrCCCrCC CrCAGCrGAG TTGTCATCAA.ACAACATAAG CCACCTTCCC ACATCCT'rGG GAGAGACrrG ACTATACrM CGGTrCAACA AAACCAGCrr CAGCAGCT'rG ATCGAGCGCr ATGCCCAQTG TGAGGCrr1- AC7TrCAAG GACAACCTC'r GGAAATGCAA CTCGGTCTTA AACTCTGCT GGAGAAAT1'T GTCrTAAmG GGGGACTAAC ATCTGTGAAT CACCAGACAC CrGGAAGG AAGGACCrCC TrAGGATCCC TACCAGCCCT GCCCTC=CC TGjCTCCTGAT CCAGTGTCCT CGCAGGCTCA TCTGCCCACG GTGTGGTCCr GAGGCCTCCr GAGAACCACA ACGCGGGGGzA TTGGAGTGCG AGCTCAAACC CAAGCCAAGG CCGGCCAACC TGCGTCATGC GTCATCATCA CTGGCGTIGT GTGTGGGATT GTGTGTCrCA TGATGTTGGC TATGGCTGCA CCTATGCGGC AATCACAGCC CAGTACCATG GGGGACC=r AATGATCCTG GGAAGGTGGA AGAAAAAGAG CGATrrGACA GCrCACCAGC 7rGTCCAAA TAGGATrGGT CATTGCADGC CAGAAGATAG TGTCTGAGTA G=rCCTGTT AGTCrQATTT TGC7rrGCC AAAAGACAAA AAAAAAAAAA INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS LENGTH: 344 AMINO ACIDS TYPE: AMINO ACID

STRANDEDNESS:

TOPOLOGY: LINEAR (ii) MOLECULE TYPE: PROTEIN (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: GCrCCTGTT TrACTGTCAG TrCCCAI-rA TCCrGCx-yr- CL-r1 ICAAAT AACCCAGAA2' GGAG Cr1GAT GCAGAACCrA CC1'GGAATCC

TTGCCACTI'G

AGACGGCATC

TCATGAGCTG

GTGGCCCGGC

GCGACAACTC

CATrGCCACr

AGCTGCCATC

GGCTCAAACC

L~rGAGA3C7T

GGGCTGATGT

~AAAAAAA

120

ISO

240 300 360 420 480 540 600 660 720 780 940 900 960 1020 1080 1140 1198 Leu Ser Pro Asn Trp Ala Leu Ser Ser Ile Leu Met Gin Thr 10 Ser Gin Leu Pro Thr Leu 100 His 115 Leu 130 Lys Val Asn His Ile Met Gly Gin Pro Leu Al a Gly Val Phe Leu His Thr Ala Asn Gin Pro Val Glu Cys Val Pro His Leu Phe Ser Leu Thr Gin Leu Ser Asp Pro Leu Asn His Leu Arg Ser Gin Cys Cys 15 Gin 30 Pro 45 Leu 60 Gly 75 Leu 90 Glu 105 Leu 120 Asn 135 -15 Pro Ser Thr Ala Ser Leu Ser Leu Gly Gin Asp Gin Arg Phe Asn Gin Leu Asp Giu Leu Leu Leu Phe Ser Lys Gin Thr Ala Asn His Glu Leu Thr Gin Ser Cys Gly Leu Phe Ser Leu Ser Ser Trp Gin Val Tyr Leu His Arg Leu Gin s0 Arg Ser 110 Giu 125 Leu 140 Ile Cys Ala Leu Ser Val Gin Glu Gin Val Ser Asn Val Leu Leu Phe Asn Asn Asrt Leu Asp Arg Leu Ser Ile Asp Pro Leu Asn His Ile Thr Ala -42- Leu Glu Ser Met Pro Ser Val Arg Leu Leu Leu Leu Lys Asp Asn 145 ISO10 Leu 160 Giu 175 Giu 190 His 205 Ser 220 Arg 235 Cys 250 Ile 265 Leu 280 Ile 295 Gly 310 Trp Lys Ser Glu Ser Pro Giu Ala Met Thr Lys Lys Phe Pro Leu Gin Pro Leu Thr Met Ala Val Cys Val Asp Tyr Ala Giu Lys Val Leu Gin Glu Asn Tyr Thr Gin Gin Asn Pro Ile Ala.

Tyr Glu Cys 165 Lys 180 Trp 195 Pro 210 Trp 225 His 240 Lys 255 Ile 270 Ala 285 His 300 Lys 315 His Gly Lys Cys Pro Asn Pro Thr Ala Gly Leu Gly Gly Pro Gly Ala Arg Gly Ile Gly Leu Leu Ley Leu Ser Gly Pro Val Tyr Pro.

Gly Thr Asp Pro Ala Glu Ala Val Gly Leu *Leu 170 Asp 185 Leu 200 Ala 215 His 230 Arg 245 Asn 260 Cys 275 Cys 290 Ala 305 Ser 320 Lys Gly Leu Pro dly Giu Leu Giy Thr Gln Ser Leu Ile Arg Asp Val Leu Arg Ile Tyr Thr.

Pro Trr Ile Ile Pro Vai Leu His Val Ala Leu Cys Pro Vai Leu Giu Ala Cys Al a Glu Arg Phe Asp Asp Pro Ala INFORMATION FOR SEQ ID NO!3: SEQUENCE

CHARACTERISTICS

LENGTH: 31 BASE PAIRS TYPE: NUCLEIC

ACID

STRANDEDNESS:

SINGLE

TOPOLOGY:

LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: GATCTGA CAAGTG'ITAC TGTCAGTCAT

C

GA

(2) INFORMATION FOR SEQ ID NO:4: Ci) SEQUENCE

CHARACTERISTICS

LENGTH: 35 BASE PAIRS TYPE: NUCLEIC

ACID

STRANDEDNESS:

SINGLE

CD) TOPOLOGY:

LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NQ:4: -43- GCA.AGATCrr AACGCAGGTT GCCCGGC=r' GGCTT INFORMATION FOR SEQ ID Wi SEQUENCE CHA.RACrERISTICS LENGTH: 31. BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS:

SINGLE

TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID GCAGATCTAT CATGAAAGGT GAACTGCTCC

T

INFORMATION FOR SEQ ID NO:6: Wi SEQUENCE CHARAC'rRISTICS CA) LENGTH: 34 BASE PAIRS TYPE: NUCLEIC ACID STEANDEDNESS:

SINGLE

CD) TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:.6: GCAGATCTrA ACGCAGGTTG GCCGGC!CTTG

GCT'

-44- Applicant's or agent's file IInternational application No.: US95/07067 reference number: 325800-.466 INDICATIONS RELATING TO A DEPOSITED MICROO RGAMISM (PCT Rule 13bis) A. The indications made below relate to the microorganism referred to in thme description on pages 6. 32. 33. and 45 lines 31 17. 49, (44 and 49). 32. respectively.

H. IDENTIFICATION OF DEPOSIT Futter depstz ace identifie an an addilima sheet Name of depository institution American Type Culture Collection Address of depositary institution (including postal code and country) *12301 Parklawn Drive Rockville, Maryland 20852

.U.S.A.

Date oftleposit: May 24. 1995 JAc~sion Numbecr: 97162 C. ADDITIO0NAL INDICATIONS bID-k ~nor oppftw be) This afamazua is coained on an addliomal sba 13 D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE Ofmw i"d r u1 U ain~tSau E. SEPARATE FURNISHING OF INDICATIONS (t3W b&VAniF n aopinba The indications listed below will be submitted to the International Bureau later (specif the general nature of the indicain "Accession Number of Deposit') 44/1

Claims (18)

1. An isolated polynucleotide comprising a member selected from the group consisting of: a polynucleotide encoding the polypeptide as set forth in SEQ ID NO:1; a polynucleotide encoding the polypeptide comprising amino acid 1 to amino acid 262 as set forth in SEQ ID NO:2; a polynucleotide capable of hybridizing to and which is at least 70% identical *to the polynucleotide of or and a polynucleotide fragment of the polynucleotide of or

2. The polynucleotide of claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of claim 1 wherein the polynucleotide is RNA.

4. The polynucleotide of claim 1 wherein the polynucleotide is genomic DNA.

5. The polynucleotide of claim 2 which encodes the polypeptide as set forth in SEQ ID NO:2.

6. An isolated polynucleotide comprising a member selected from the group consisting of: a polynucleotide which encodes a mature polypeptide encoded by the DNA contained in ATCC Deposit No. 97162; a polynucleotide which encodes a polypeptide expressed by the DNA contained in ATCC Deposit No. 97161; a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of or and a polynucleotide fragment of the polynucleotide of or P:\OPER\VPA\716415.DIV 18/4/00 -46-

7. A vector containing the DNA of claim 2.

8. A host cell genetically engineered with the vector of claim 7.

9. A process for producing a polypeptide comprising: expressing from the host cell of claim 8 the polypeptide encoded by said DNA.

10. A process for producing cells capable of expressing a polypeptide comprising transforming or transfecting the cells with the vector of claim 7.

11. A polypeptide selected from the group consisting of a polypeptide having the deduced amino acid sequence of SEQ ID NO:2 and fragments, analogs and derivatives thereof; (ii) a polypeptide comprising amino acid 1 to amino acid 262 of SEQ ID NO:2; and (iii) a polypeptide encoded by the cDNA of ATCC Deposit No. 97162 and fragments, analogs and derivatives of said polypeptide.

12. A compound effective as an agonist for the polypeptide of claim 11. a

13. A compound effective as an antagonist against the polypeptide of claim 11.

14. A method for the treatment of a patient having need of PGSG-1 comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 11. The method of claim 30 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo.

16. A method for the treatment of a patient having need of PGSG-1 comprising: administering to the patient a therapeutically effective amount of the compound of claim 12. P:\OPER\VPA\716415.DIV 18/4/00 -47-

17. A method for the treatment of a patient having need to inhibit PGSG-1 comprising: administering to the patient a therapeutically effective amount of the antagonist of claim 13.

18. A process for diagnosing a disease or a susceptibility to a disease related to expression of the polypeptide of claim 11 comprising: determining a mutation in the nucleic acid sequence encoding said polypeptide.

19. A diagnostic process comprising: analyzing for the presence of the polypeptide of claim 11 in a sample derived from a host. A method for identifying compounds which bind to and activate or inhibit a receptor for the polypeptide of claim 11 comprising: contacting a cell expressing on the surface thereof a receptor for the polypeptide, said receptor being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said receptor, with a compound to be screened under conditions to permit binding to the receptor; and Sdetermining whether the compound binds to and activates or inhibits the receptor by detecting the presence or absence of a signal generated from the interaction of the compound with the receptor. DATED this 19th day of APRIL Human Genome Sciences, Inc. By DAVIES COLLISON CAVE Patent Attorneys for the applicant