AU2094199A - Thrombogenic polypeptide chimeras and conjugates having activity dependent upon association with tumor vascular endothelium - Google Patents
Thrombogenic polypeptide chimeras and conjugates having activity dependent upon association with tumor vascular endothelium Download PDFInfo
- Publication number
- AU2094199A AU2094199A AU20941/99A AU2094199A AU2094199A AU 2094199 A AU2094199 A AU 2094199A AU 20941/99 A AU20941/99 A AU 20941/99A AU 2094199 A AU2094199 A AU 2094199A AU 2094199 A AU2094199 A AU 2094199A
- Authority
- AU
- Australia
- Prior art keywords
- context
- substructure
- functional entity
- dependent functional
- entity according
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/6435—Plasmin (3.4.21.7), i.e. fibrinolysin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
- A61K47/6425—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a receptor, e.g. CD4, a cell surface antigen, i.e. not a peptide ligand targeting the antigen, or a cell surface determinant, i.e. a part of the surface of a cell
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/745—Blood coagulation or fibrinolysis factors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21007—Plasmin (3.4.21.7), i.e. fibrinolysin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Biotechnology (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Diabetes (AREA)
- Endocrinology (AREA)
- Pathology (AREA)
- Rheumatology (AREA)
- Urology & Nephrology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Description
WO 99/32143 PCT/US98/27498 THROMBOGENIC POLYPEPTIDE CHIMERAS AND CONJUGATES HAVING ACTIVITY DEPENDENT UPON ASSO CIATION WITH TUMOR VASCULAR ENDOTHELIUM FIELD OF THE INVENTION The present invention relates to a novel strategy for the treatment of carcinomas and other solid tumors. In particular, the present invention relates to methods which 5 modulate the function of endothelial cells associated with the tumor vasculature, and compounds useful therefor. BACKGROUND OF THE INVENTION 10 Even a cursory examination of cancer treatments demonstrates the need for better, more efficacious treatment reagents and protocols. Although significant advances in therapy have been achieved during the past 25 years, few drugs have been discovered that have a truly major impact on the course of the disease. Conventional chemotherapy produces severe side effects that range from loss of hair to debilitating 15 neurotoxicity. Furthermore, there has been little inroad into the discovery of new strategies to develop drugs that are mechanistically different and which may present better opportunities to intervene in the disease. Because cancers differ greatly in their causes and origins, drugs are not effective across a wide variety of cancers. No single drug has been shown to be capable of treating a wide spectrum of cancers. Because of 2 0 the complexity of the causes and origins of cancer, it has been difficult to devise a single drug that will act on different cancers in different organ and tissue locations, particularly with solid tumors. Solid tumors make up more than 90% of all human cancers. Yet, the delivery of 25 drugs, antibodies and immunoconjugates to specific tumors has proven to be inefficient because pharmacological barriers exist that prevent the drugs from reaching the tumor in sufficient concentrations that they inhibit or destroy the tumor. To get enough drug into the tumor, high concentrations must be used and these produce unacceptable toxicity to WO 99/32143 PCT/US98/27498 2 the normal cells - side effects. Therapies that target tumor cells using tumor antigens are also often not effective because tumors are heterogeneous, as evidenced by the lack of specific so 5 called "tumor antigens" on all of the cells that constitute a tumor mass. Tumor variants may be produced continuously that may lack the target to which the drug is directed. Moreover, tumor cells can become resistant to many conventional drugs, even to the extent of developing pumps, such as glycoprotein gpl70, to remove drugs from the cell. This and other types of heterogeneity are well-known and are of great concern to 10 oncologists. Solid tumors require a continuous supply of nutrients supplied by the continual formation of new blood vessels that are derived from older blood vessels. When the tumor mass (from metastasis, for example) reaches about 1 to 2 mm in diameter, new 15 blood vessels must be established to support growth. This process is called tumor angiogenesis and represents a potential site for intervention and control of tumor proliferation and growth. The growth of new vessels is likely related to the response of endothelial cells to the presence of various growth factors, proteases, metalloproteinases, chemokines, cytokines, adhesion substructures, etc. that are produced by the nearby 20 tumor cells. Because of the influence of the tumor cells, the endothelial cells within the vessels that feed the tumor mass differ from other normal endothelial cell surfaces in normal tissues and organs. These differences can be detected by the cell surface characteristics found within the blood vessels of the tumor compared to those found in normal tissues and organs. In addition, tumors are known to be procoagulant - patients 25 with cancer typically show evidence of hypercoagulability and may even develop thromboembolic disease. An approach to the therapy of solid tumors is to employ high affinity immunoconjugates that target the endothelium to coagulate the vasculature of solid 30 tumors. See e.g., Huang et al. Science (1997) 275(5299):547-550. However, there are a number of disadvantages associated with such therapies. High affinity targeting WO 99/32143 PCT/US98/27498 3 elements, such as antibodies, include the need for nearly absolute specificity (i.e., the target antigen may not be present on any normal tissue or toxicity will result). Unfortunately, however, few antigens truly are tumor-specific. Moreover, few antigens are found only on one type of tissue (i.e., the endothelial surface of blood vessels). 5 Thus, this approach has limited applicability. For example, immunoconjugate coagulants described previously will unlikely be found adequately selective, effective and safe for use in humans. It is clear that novel approaches are required to improve the ability of 10 oncologists to successfully and safely eradicate or markedly regress tumors in humans. BRIEF DESCRIPTION OF THE INVENTION In accordance with the present invention, a novel strategy has been devised that 15 clearly sets out and creates a new method of treating cancer patients. Invention methods and reagents represent an abrupt departure from conventional approaches of therapeutically attacking tumors, which kill individual tumors on a cell-by-cell basis. Thus, in accordance with the present invention, a method of attacking solid tumors has been developed which employs compounds which modulate the functions of tumor 20 associated vascular endothelial cells. This strategy accomplishes global killing of the tumor by eliminating its nutritional supply. By restricting the flow of nutrients that feeds the individual cells comprising the tumor, the growth of the entire tumor mass can not be sustained, thus resulting in regression and even eradication of the tumor by necrosis. 25 BRIEF DESCRIPTION OF THE FIGURES Figure 1 depicts the process of chemically conjugating a context-enhancing substructure and a cysteine-containing spacer substructure-TF. 30 WO 99/32143 PCT/US98/27498 4 Figure 2 depicts the process of employing a thioether production substructure to produce a context-dependent functional entity. Figure 3a presents a graph illustrating the effect on plasma half-life by antibody 5 against Tissue Factor (TF). Figure 3b presents a graph comparing Tissue Factor half-life with Selective Tumor Vasculature Thrombogen (STVT) half-life. 10 Figure 4 presents a graph illustrating the effect of differing concentrations of NV 124 (protein expressed from the E. coli expression plasmid NuV 124, see Example 7) on tumor growth. Figure 5 depicts a graph illustrating the improved pharmacological effect of 15 multiple infusions of NV124 on tumor growth. Figure 6 graphs the effects of NV129 (protein expressed from the E. coli expression plasmid NuV129, see Example 11) infusions on C1300 tumor growth. 20 Figures 7 and 8 provide graphs illustrating the effects of NV144 (protein expressed from the E. coli expression plasmid NuV144, see Example 12) on C1300 tumor growth in comparison with the effects of saline on tumor growth. DETAILED DESCRIPTION OF THE INVENTION 25 The present invention provides novel single molecules having thrombogenic properties and context-enhancing properties. These molecules are context-dependent functional entities (also referred herein as "Selective Tumor Vasculature Thrombogen" or "STVT") comprising substructures with thrombogenic potential and 30 context-enhancing substructures having the ability to recognize (e.g., possessing functional complementarity) desired biologically susceptible site(s). Context-dependent WO 99/32143 PCT/US98/27498 5 functional entities are characterized as imparting thrombogenic activity when positioned (e.g., functionally complemented) in the function-forming-context at the biologically susceptible site(s), while having substantially no thrombogenic activity absent a function-forming-context at the biologically susceptible site(s). In yet another aspect of 5 the present embodiment, the context-dependent functional entity transiently imparts activity upon formation of a transient function-forming-context at the biologically susceptible site(s). As used herein, "substructure with thrombogenic potential" refers to one or more 10 thrombosis promoting peptidyl, oligopeptidyl, protein or small organic molecule (e.g., medicinal compounds), that has the ability to selectively impart thrombogenic activity when positioned (functionally complemented) in a function-forming-context at a biologically susceptible site(s). The phrase "thrombogenic potential" refers to the ability of such substructures to selectively impart thrombogenic activity when localized and 15 oriented in a complementary function-forming-context at a biologically susceptible site(s) so as to result in thrombogenic activity. In a preferred aspect of the present embodiment, substructures with thrombogenic potential include one or more domains or modules of coagulation factors. Exemplary coagulation factors include fibrinogen, prothrombin, tissue factor (TF), factor V, factor VII through factor XIII (in addition to 20 their activated states), von Willebrand factor, tissue plasminogen activator (tPA), streptokinase, staphylokinase, urokinase, eminase, factor C, Mac-l, EPR-1, venom-derived coagulation enzymes (e.g., Russell's viper venom), cellular enzymes (e.g., granzymes), and the like. Preferred coagulation factors include those involved in the coagulation promoting pathways including TF, factor V, factor VII, factor VIII, 25 factor IX, factor X, factor XI, activated states of such factors, combinations of co-factors (i.e., TF:factor VII/VIIa, factors VIIIa:IXa, factors Va:Xa), and the like. As used herein, the phrase "thrombogenic activity" refers to the selective initiation, promotion, activation and/or propagation of occlusive thrombosis (either 30 partial or complete, transient or prolonged) at biologically susceptible site(s). A preferred thrombogenic activity includes the function of a coagulation factor to activate WO 99/32143 PCT/US98/27498 6 or provide co-factor function for other coagulation factors in a systematic and limited proteolytic sequence (i.e., limited proteolytic cleavage to activate coagulation factors) at a biologically susceptible site(s). Examples of thrombogenic activity include conversion of factor VII to factor VIIa, factor IX to factor IXa, factor X to factor Xa, prothrombin to 5 thrombin, and the like. As used herein, the phrase "occlusive thrombosis" refers to the specific and selective formation of a mass of blood elements (i.e., thrombus) that partially or completely, transiently or for a prolonged period obstructs blood flow at biologically 10 susceptible site(s). Occlusive thrombosis, as contemplated by the present invention, would result in therapeutic activation of coagulation on biologically susceptible site(s) (i.e., selected endothelial cells), by formation of an occlusive thrombus to markedly reduce or even cease blood flow both upstream and downstream of the blockage as far as the points where the thrombosed vascular channel anastomoses with another, 15 unaffected vessel (Danekamp et al. (1984) Prog Appl Microcir 4:28-38). Thus, selective and specific occlusive thrombosis results in hypoxic cell death and ischemic necrosis of cells nourished by the affected blood vessels. A preferred substructure with thrombogenic potential is modified or wild-type 20 tissue factor (TF), preferably of human derivation. As used herein, "modified or wild-type tissue factor (TF)" is a soluble TF, that in combination with factor VII, can selectively activate or initiate occlusive thrombosis only when positioned in the proper function-forming context at biologically susceptible site(s), i.e., by conversion of factor X to Xa and factor IX to IXa. Preferably, the modified or wild-type TF retains the 25 capacity to induce factor VII/VIIa-dependent coagulation. As used herein, "modified TF" refers to truncated or native TF wherein one or more amino acids have been substituted, modified, added and/or deleted and in which carbohydrate moieties are present, absent or modified. 30 Exemplary TFs include soluble forms of TF which consist essentially of the extracellular domain of wild-type TF (as described in Edgington et al., Patent No.
WO 99/32143 PCT/US98/27498 7 5,110,730 (1992)), and do not contain portions of the transmembrane anchor region (i.e., TF 220-242, or amino acid residues 252 through 274 of SEQ ID NO:1) which anchors native TF to the cell membrane. Preferably, the TF comprises substantially the amino-terminal amino acids up to approximately residue 252 of SEQ ID NO: 1. More 5 preferably, the modified TF has substantially the same amino acid sequence as TF 3-211 (as set forth in residue nos. 35-243 of SEQ ID NO: 1). In the presently most preferred embodiment of the present invention, the modified TF is modified or further modified to increase thrombogenic activity when placed or oriented in the function-forming-context at a biologically susceptible site(s). Such modifications include substituting the amino 10 acid residue at one or more positions, e.g., TF 167 or position 199 of SEQ ID NO: 1, as well as residues within 15 Angstrom of TF 167 or residue 199 of SEQ ID NO: 1, with a basic amino acid such as lysine, arginine, histidine, and the like. As used herein, the term "purified" means that the molecule is substantially free 15 of contaminants normally associated with a native or natural environment. TF protein, or functional fragments thereof, useful in the practice of the present invention, can be obtained by a number of methods, e.g., precipitation, gel filtration, ion-exchange, reversed-phase, DNA affinity chromatography, and the like. Other well-known methods are described in Deutscher et al., Guide to Protein Purification: Methods in 20 Enzymology Vol. 182, (Academic Press, 1990), which is incorporated herein by reference. TF, and biologically active fragments thereof, useful in the practice of the present invention can also be produced by chemical synthesis. Synthetic polypeptides 25 can be produced, for example, using Applied Biosystems, Inc. Model 430A or 431A automatic polypeptide synthesizer and chemistry provided by the manufacturer. TF, and biologically active fragments thereof, can also be isolated directly from cells which have been transformed with the expression vectors described below in more detail. 30 Alternatively, a purified TF, or functional fragment thereof, useful in the practice of the present invention, can also be obtained by well-known recombinant methods as WO 99/32143 PCT/US98/27498 8 described, for example, in Ausubel et al., Current Protocols in Molecular Biology (Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (1993)), also incorporated herein by reference. An example of recombinant means to prepare modified or wild-type TF is to express nucleic acid encoding TF, or functional fragment 5 thereof, in a suitable host cell, such as a bacterial, yeast (e.g., Saccharomyces or Pichia), insect (e.g., Baculovirus or Drosophila) or mammalian cell, using methods well known in the art, and recovering the expressed protein, again using methods well known in the art. Thus, one embodiment of the present invention includes nucleic acid consisting essentially of the nucleic acid sequence as set forth in SEQ ID NO:1 from about position 10 130 at the 5' terminus to about position 918 at its 3' terminus. Preferably, the last about one hundred fifty bases are not employed. Thus, nucleic acid encoding the soluble form of TF is contemplated, in a preferred aspect, i.e., a nucleic acid segment consisting essentially of the nucleotide sequence from about position 178 to about 804 as set forth in SEQ ID NO:1. 15 As defined herein, the phrase "context-enhancing substructure" refers to one or more peptidyl, oligopeptidyl, protein, or small organic molecule (e.g., medicinal compounds) that enhances thrombogenic activity, and further enhances selectivity by positioning the context-dependent functional entity in a desired context at the 20 biologically susceptible site(s). As used herein, the phrase "having the ability to recognize desired biologically susceptible site(s)" refers to the ability or capacity of the context-enhancing substructure to exhibit elements of specificity and selectivity for the biologically susceptible site(s). Preferably, the context-enhancing substructure will have a low affinity for the desired biologically susceptible site(s) so as to transiently activate 25 the thrombogenic potential of the context-dependent functional entity. The context-enhancing substructure does not contain any substantial portion of any transmembrane region, antibody, or the like, which will anchor or permanently and/or irreversibly associate the context-dependent functional entity to the biologically susceptible site(s). 30 WO 99/32143 PCT/US98/27498 9 The function of the context-enhancing substructure is to provide transient orientation and transient localization of the thrombogenic substructure to preferred biological susceptible sites. Exemplary context-enhancing substructures include cell surface recognition domains (i.e., from annexin), charged phospholipid-associating 5 elements, protease inhibitors, peptidyl sequences that facilitate orientation and/or small molecules that recognize molecules or molecular assemblies enriched in tumor vasculature endothelium (e.g., all, part or modified growth factor, ligand, hormone, or lectin which have transient functional association properties so as to only transiently activate the thrombogenic potential of the context-dependent functional entity), and the 10 like. Specific examples of context-enhancing substructures include uPAR binding antagonists (e.g., peptide/clone 20 (1994) Goodson et al. PNAS 91:7129-7133), anti-angiogenic proteins ((e.g., endostatin from collagen XVIII 20kD C-terminus, (1997) O'Reilly et al. Cell 88(2):277-285; nucleotide sequences 1502 to 2053 from genbank HUMCOL18AX ACCESSION L22548), peptides derived from TSP-1 (e.g., 15 MalIII from (1993) J Cell Biol 22:497-511; peptide 246, (1992) PNAS 89:3040-3044; Laminin binding peptides (e.g., Peptide G, Guo et al. (1992) J Biol Chem 267:17743-17747; Proliferin (PLF, (1988) J Biol Chem 263(7):3521-3527, Proliferin-related-peptide (PRP, (1988) Mol Endocrinol 2(6):579-586 , membrane-binding peptide from factor VIII, (1995) Biochemistry 34(9):3022-3031, 20 single or multiple kringle domains (e.g., kringle 1 from plasminogen (1991) Biochemistry 30(7): 1948-1957; angiostatin, 1994 Cell 79(2):315-328, respectively, or fragments thereof (e.g., Pro Arg Lys Leu Tyr Asp), phosphatidyl-serine binding proteins (eg. annexin V J.Biol. Chem. 1995 270:21594-21599), and the like. Other context-enhancing substructures can be readily identified employing such well known 25 methods such as phage display searches of peptide and constrained peptide combinatorial libraries (See, e.g., Ruoslahti et al., U.S. Patent No. 5,622,699 (1997) and Ruoslahti et al., U.S. Patent No. 5,206,347 (1990), Scott and Smith (1990) Science 249:386-390, Markland et al (1991) Gene 109:13-19), and the like. 30 As defined herein, the phrase "biologically susceptible site(s)" refers to one or more molecules found at the cell surface, unique to, induced or up-regulated in, vascular WO 99/32143 PCT/US98/27498 10 endothelial cells in human tumors. Progressive tumor growth necessitates the development of new blood vessels (angiogenesis) to meet the nutritional needs of the expanding tumor mass. Numerous anatomical, morphological and behavioral differences between tumor-associated blood vessels and normal ones have been 5 documented (See, e.g., Dvorak et al. (1991) Cancer Cells 3:77-85, Jain (1988) Cancer Res 48:2641-2658, and Denekamp (1990) Cancer Metast Rev 9:267-282). Preferably, the invention context-dependent functional entity recognizes these differences as sites in which to selectively initiate, promote, activate and/or propagate occlusive thrombosis. 10 Examples of biologically susceptible sites include vascular structures, specific cells or tissue types associated with cancer and/or angiogenesis, wounds caused by trauma, and other vascular pathologies, such as sites of infection by fungal, bacterial or viral agents. Additionally, examples of biologically susceptible sites include such structures, tissues and/or cells which are recognized by the context-enhancing 15 substructure. In the case of cancer, the biologically susceptible site(s) recognized by the context-dependent functional entity should preferably be molecule(s) on the cell surface of the tumor-associated endothelial cells and one that is not secreted into body fluids. Preferred biologically susceptible site(s) for which the context-enhancing substructure has a functional preference include tumor-associated vascular endothelial cells. Those 20 of skill in the art can readily determine other biologically susceptible site(s) which are contemplated for formation of a function-forming-context by the context-dependent functional entity employed. As used herein, the phrase "function-forming-context" refers to the necessary 25 orientation and position of the context-dependent functional entity to impart thrombogenic activity at the biologically susceptible site(s). The function-forming context will depend on numerous factors including the orientation and position of the context-enhancing substructure relative to the substructure with thrombogenic potential. Thus, the context-enhancing substructure can be positioned at the carboxy terminus of 30 the substructure with thrombogenic potential, the amino terminus of the substructure with thrombogenic potential, or between the amino terminus and the carboxy terminus WO 99/32143 PCT/US98/27498 11 of the substructure with thrombogenic potential (i.e., inserted within a hydrophilic surface loop of the substructure with thrombogenic potential). In a preferred embodiment of the present invention, the context-dependent functional entity comprises two or more context-enhancing substructures to enhance proper or desired alignment of 5 the substructure with thrombogenic potential at the biologically susceptible site(s). Thus, the context-enhancing substructure(s) is(are) located at the carboxy terminus of the substructure with thrombogenic potential, the amino terminus of the substructure with thrombogenic potential, between the amino terminus and the carboxy terminus of the substructure with thrombogenic potential, inserted in a hydrophilic surface loop of 10 the substructure with thrombogenic potential, or any combinations thereof. In yet another embodiment of the present invention, context-dependent functional entities further comprise activity-modulating substructure(s). As used herein, the term "activity-modulating substructure" refers to one or more molecules which 15 enhance the function-forming context by properly orienting and/or positioning the context-enhancing substructure relative to the substructure with thrombogenic potential (e.g., configuration of the active sites of each substructure, the relative distance between the substructures, and the like). Examples of activity modulating substructures include spacer substructures, protease sites, and the like. 20 As used herein, the term "spacer substructure" refers to one or more spacer molecules that serve to link substructures with thrombogenic potential with context-enhancing substructures. The nature of the linkage between the spacer substructure and either the substructure(s) with thrombogenic potential or the 25 context-enhancing substructure(s) depends on the functionality employed in the substructures with thrombogenic potential and the context-enhancing substructures. Preferably, substructures with thrombogenic potential are linked to context-enhancing substructures in a manner that retains the ability of the context-dependent functional entity to activate the substructure with thrombogenic potential. Typically, spacer 30 substructures are non-immunogenic and flexible and fall in the range of about 0 to about 60 residues long, preferably about 10 amino acid residues.
WO 99/32143 PCT/US98/27498 12 In a preferred embodiment of the present invention, the spacer substructure increases degradation of the context-dependent functional entity by releasing the substructure with thrombogenic potential from the context-enhancing substructure. Preferably, such spacer substructures include those spacer molecules which are subject 5 to scission when the context-dependent functional entity is extracellularly positioned in the function-forming-context with cell surfaces at the biologically susceptible site, subjecting the spacer to degradation upon exposure to a specific enzyme. Examples of bonds within spacer molecules include esters, peptides, amides, phosphodiesters, and even glycosidic bonds, which are hydrolysed by exposure to an esterase, protease or 10 peptidase, amidase, phosphodiesterase and glycosidase, respectively. Preferred context-dependent functional entities will have cysteine residues native to the spacer molecule replaced by glycine, alanine or serine. Preferred context-dependent functional entities can be engineered so that they are hydrolysed only by exposure to an enzyme known to have a precise cellular location, including enzymes associated with the 15 vascular endothelial surface. Cleavage of the spacer substructure provides a safety factor by limiting the lifetime of the intact context-dependent functional entity at the biologically susceptible site(s) and/or irreversibly inactivating the context-dependent functional entity, thus preventing dissemination of native thrombogens or access of additional entities to biologically susceptible site(s). 20 In a preferred embodiment of the present invention, the spacer substructure comprises homo- or hetero-bifunctional crosslinking agents or chitin oligomers. Exemplary spacer substructures include combinations of Gly and Ser modules, such as ((Gly) 4 Ser)n, ((Ser) 4 Gly)n, and the like. Additional spacer substructures contemplated 25 are the hinge region of the heavy chain of immunoglobulin (Ig) proteins, preferably the H chain IgD sequences. Ig hinge regions have flexibility that allows the different domains in immunoglobulins to assume different geometries and orientations. Immunoglobulin hinge regions (see, e.g., Kabat et al. Sequences of Proteins of Immunological Interest, 5 Ed., U.S. Dept. of Human Health Services) may be used as 30 spacers in thrombogens. Examples of hinge regions that may be back converted to their respective DNA sequences obtained from conventional databases and repositories of WO 99/32143 PCT/US98/27498 13 protein and nucleic acid sequences include Human IgD'd, Human IgG 3'C1, Human Iggl eCl, Human IgG eC1, Human IGG2 eC1, Human Igg4 eC1, and the like (See Kabat et al., page 670). The cysteine residues of such hinge regions may be substituted by glycine, alanine, or serine in any combination to eliminate difficulties presented by the 5 presence of particular cysteine thiol groups that may disrupt spacer structure or inhibit proper formation of tertiary structure of the substructure with thrombogenic potential. Alternatively, the present invention provides for the creation of protease sensitive sites to cleave and/or reduce activity (or inactivate) of the context-dependent 10 functional entity after the context-dependent functional entity has performed its desired activity. Context-dependent functional entities comprising protease sensitive sites can be synthesized or manufactured employing methods well known to those of skill in the art (e.g., recombinant or chemical manufacture of integrating protease sensitive sites). 15 In yet another embodiment of the present invention, context-dependent functional entities further comprise production substructure(s). As used herein, the term "production substructure" refers to one or more substructural aspects which facilitate the production and/or assembly of the context-dependent functional entity. Examples of production substructures include restriction sites, vectors, cys residues, His-tags, and the 20 like. Restriction enzyme sites can be optionally introduced to the context-dependent functional entity, as well as the individual substructures that comprise the context-dependent functional entity (i.e., substructure(s) with thrombogenic potential, 25 context enhancing substructure(s), activity-modulating substructure(s) and/or cloning cassette) by additions, deletions, substitutions or modifications made at nucleic acid sequences encoding the amino-terminal, the carboxyl terminal and/or sequences in between to produce the function-forming context. Unique restriction sites may be placed for the convenience of constructing a context-dependent functional entity(ies) 30 with different orientations and configurations, i.e., different combinations of the individual substructures. Unique restriction sites at the junctions of each of these WO 99/32143 PCT/US98/27498 14 individual substructures can be used to clone various subtypes of the individual substructures (for example, spacer substructures of different lengths and compositions). Examples of such modifications include placement of a specific amino acid residue at position 212 of TF or position 245 as set forth in SEQ ID NO:1, preferably a threonine, 5 to yield a restriction site favorable to splicing with a spacer substructure and/or a context-enhancing substructure. The sequences that are presented are the subtypes of the functional substructures without restriction sites. Examples of restriction sites that are preferred include XmaI (CCCGGG), BamHI (GGATCC), KpnI (GGTACC), HindIIl (AAGCTT), Aval (CCCGGG), EcoRI (GAATTC), AvrlI (CCTAGG), or PmlI 10 (CACGTG), and the like. Specific preferred examples of context-dependent functional entity(ies) constructs are provided (e.g., SEQ ID NOs: 6, 12, 15, 24 and 31). Alternatively, the individual substructures can be conjugated chemically via production substructures to produce the context-dependent functional entity with the 15 preferred function-forming-context. Preferred chemical conjugations of the individual substructures use cysteine as a production substructure to link the substructures. The cysteine thiol group provides a convenient site at which chemical links may be established, links that may be reducible (disulfide bonds) or stable (thioether). Context enhancing substructure(s) and/or activity-modulating substructure(s) that contain a 20 cysteine residue production substructure can be coupled to substructure(s) with thrombogenic potential through the cysteine. A peptide that may act as a context enhancing substructure(s) and/or activity-modulating substructure(s) may be modified to contain a cysteine production substructure at its amino terminus, its carboxy terminus, or at a site between the amino and carboxy terminus. Examples of each modification in 25 a disulfide bond constrained peptide (1) are illustrated schematically in Figure 1. The preferred modification does not reduce the ability of the context enhancing substructure(s) and/or activity modulating substructure(s) to facilitate the thrombogenic activity of the final construct. 30 An activity-modulating substructure containing a cysteine production substructure at or near the amino terminus, or at any site within an activity-modulating WO 99/32143 PCT/US98/27498 15 substructure, can be constructed synthetically and fused to the substructure with thrombogenic potential. For example, an activity-modulating substructure of the following sequence may be constructed between a KpnI and XmaI site: 5 GSCGGGGSGGGGSGGGGSP (SEQ ID NO:2) The cysteine in this example is placed at residue number 3 when numbering from the amino terminus. It is possible, however, to place the cysteine at residue number 1 or 2 if desired. However, a thrombin-sensitive sequence such as PRG must be retained in order 10 to efficiently cleave the resulting protein with thrombin. Other peptides inserted between the hexahistidine sequence and the beginning of the substructure with thrombogenic potential may be used in the construct, which would necessitate the use of a different enzyme(s), known to those of skill in the art, to cleave and release the substructure with thrombogenic potential during its purification. The cysteine thiol of 15 the substructure with thrombogenic substructure and the cysteine thiol of cysteine-containing activity-modulating substructure may also be linked by thioether bonds using bismaleimido groups such as that of BMH, bismaleimidohexane. Other methods of cross linking proteins using N-hydroxysuccinimide 20 (NHS)-ester haloacetyl cross linkers, photoreactive cross linkers, and the like that may be useful in establishing the desired bonds between facilitators and the substructure with thrombogenic potential are known to those of skill in the art (see Figure 2). Such chemistry is described in the Pierce Chemical Co. catalogue and in Chemistry of Protein Conjugation and Cross-linking by S.S. Wong, CRC Press, 1991, which are incorporated 25 herein by reference. Context-dependent functional entity, as well as the individual substructures that comprise the context-dependent functional entity (i.e., substructure(s) with thrombogenic potential, context enhancing substructure(s), activity-modulating 30 substructure(s) and/or production substructure) useful in the practice of the present invention, can be obtained by a number of methods, e.g., solid-phase, precipitation, gel WO 99/32143 PCT/US98/27498 16 filtration, ion-exchange, reversed-phase, DNA affinity chromatography, and the like. Other well-known methods are described in Deutscher et al., Guide to Protein Purification: Methods in Enzymology Vol. 182, (Academic Press, 1990), which is incorporated herein by reference. Alternatively, context-dependent functional 5 entity(ies), as well as the individual substructures thereof, can also be obtained by well-known recombinant methods as described, for example, in Ausubel et al., Current Protocols in Molecular Biology (Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. 1993), also incorporated herein by reference. An example of recombinant means to prepare context-dependent functional entity, or the individual substructures, is 10 to express nucleic acid encoding such entity and/or substructure(s) thereof, in a suitable host cell, such as a bacterial, yeast (e.g., Pichia), insect (e.g., Baculovirus) or mammalian cell, using methods well known in the art, and recovering the expressed protein, again using methods well known in the art. 15 Context-dependent functional entity, as well as the individual substructures thereof, useful in the practice of the present invention can also be produced by chemical synthesis (see, e.g., Meyers, Molecular Biology and Biotechnology: A Comprehensive Desk Reference, VCH Publishers (1995)). Synthetic polypeptides can be produced, for example, using Applied Biosystems, Inc. Model 430A or 431A automatic polypeptide 20 synthesizer and chemistry provided by the manufacturer. In addition, synthetic polypeptides can be produced by solid phase peptide synthesis employing a range of solid supports. Examples of solid supports available include those based on polyamides, polyethelene glycol (PEG) resins, and the like. Context-dependent functional entity, as well as the individual substructures thereof, can also be isolated directly from cells 25 which have been transformed with the expression vectors described below in more detail. Alternatively, noncovalent links can be established to link the individual substructures together to form an assembly-dependent functional entity. For example, 30 leucine zippers are preferably used to hold together, by noncovalent interaction, the substructure with thrombogenic potential with the context-enhancing substructure to WO 99/32143 PCT/US98/27498 17 form an entity with thrombogenic potential. In a preferred embodiment of the present invention, the context-dependent functional entity, as well as the individual substructures thereof, is modified to reduce 5 immunogenicity and/or modify biological half-life. Such modifications include employing polyethelene glycol (PEG), and the like. In yet another embodiment of the present invention, the context-dependent functional entity further comprises a cloning cassette. As used herein, the phrase 10 "cloning cassette" refers to one or more additional substructural elements which facilitate orientation of the context-dependent functional entity on the biologically susceptible site(s) or to add synergistic functions. Preferably, cloning cassette(s) contemplated for inclusion into the context-dependent functional entity will be inserted into a permissive hydrophilic loop of the context-dependent functional entity which 15 does not adversely affect thrombogenic activity. The specific region replaced or inserted within will depend on the size and function of the cloning cassette desired, the sequence which imparts thrombogenic potential employed, and the like. Examples of amino acid residues which can be replaced include amino acid residues from about 112 to about 123, preferably from about 115-123, of human TF as set forth in SEQ ID NO:1. 20 Direct loop replacements can be made from about 1-30 amino acids, preferably 12-20 amino acids, so long as the entity retains thrombogenic activity. As used herein, the phrase "synergistic function" refers to functions which enhance the thrombogenic function of the substructure with thrombogenic potential or enhance the function of the context-enhancing substructure to orient the context-dependent functional entity in a 25 function-forming-context at the biologically susceptible site(s). Those of skill in the art can readily determine exemplary cloning cassettes which can be employed in the invention entity, including cloning cassettes identified from combinatorial libraries. In another preferred embodiment of the present invention, there are provided 30 compositions comprising context-dependent functional entities in combination with coagulation factor VIIa. Binding of factor VIIa to TF enhances the enzymatic activation WO 99/32143 PCT/US98/27498 18 of substrate factors IX and X as much as 5,000 fold (Rao et al (1988) PNAS 85:6687). Factor VII can be prepared as described by Fair (1983) Blood 62:784-791. Recombinant Factor VIIa can be purchased from Novo Biolabs (Danbury, Conn.). 5 In yet another aspect of the present invention, nucleic acid constructs encoding the invention context-dependent functional entity are provided. In accordance with the methods of the present invention, an effective amount of the context-dependent functional entity can be administered in vivo as a therapeutic agent to selectively result in partial or complete occlusive thrombosis of the vasculature of solid tumors in a 10 subject in need thereof The context-dependent functional entity can be administered to the subject by any means which readily permits the context-dependent functional entity to function at biologically susceptible site(s) including intraperitoneal, subcutaneous, intravascular, intramuscular, intranasal or intravenous injection or infusion, implant modes of administration, and the like. In another embodiment of the present invention, 15 the context-dependent functional entity is supplied indirectly by administering a nucleic acid segment encoding same to the subject. As used herein, the phrase "the vasculature of solid tumors" refers to endothelial lined vascular channels of the tumor and existing vasculature adopted by invading tumor 20 cells. Examples of tumors, also referred to herein as vascular tumors (tumors of the vasculature as well as vascular malformations), which are contemplated to be treated include solid tumors such as breast, prostrate, lung, liver, colon, rectal, melanoma, kidney, stomach, pancreas, ovarian, bladder, cervical, oral, uteri, brain, and the like. 2 5 In another embodiment of the present invention, there are provided methods for obliterating vasculature malformations by administering to a subject an effective amount of the context-dependent functional entity, alone or in conjunction with aids such as coagulation factors, drugs, local hyperthermia, and the like. As used herein, the phrase "obliterating vasculature malformations" refers to the partial or complete occlusive 30 thrombosis of malformations derived from or influenced by blood vessels and/or structures. Examples of vasculature malformations include hemangiomas, preferably WO 99/32143 PCT/US98/27498 19 inoperable hemangiomas, aneurisms, granulomas, and the like. Those skilled in the art will appreciate that when the compositions of the present invention are administered as therapeutic agents, it may be necessary to combine the 5 context-dependent functional entities with a suitable pharmaceutical carrier. The choice of pharmaceutical carrier and the preparation of the context-dependent functional entity as a therapeutic agent will depend on the intended use and mode of administration. Suitable formulations and methods of administration of therapeutic agents can be readily be determined by those of skill in the art, including rendering the context-dependent 10 functional entity amenable to oral delivery, intravenous delivery, intramuscular delivery, topical delivery, nasal delivery, and the like. Depending on the mode of delivery employed, the context-dependent functional entity can be delivered in a variety of pharmaceutically acceptable forms. For example, 15 the context-dependent functional entity can be delivered in the form of a solid, solution, emulsion, dispersion, micelle, liposome, and the like. Pharmaceutical compositions of the present invention can be used in the form of a solid, a solution, an emulsion, a dispersion, a micelle, a liposome, and the like, 20 wherein the resulting composition contains one or more of the compounds of the present invention, as an active ingredient, in admixture with an organic or inorganic carrier or excipient suitable for enteral or parenteral applications. The active ingredient may be compounded, for example, with the usual non-toxic, pharmaceutically acceptable carriers for tablets, pellets, capsules, suppositories, solutions, emulsions, suspensions, 25 and any other form suitable for use. The carriers which can be used include glucose, lactose, mannose, gum acacia, gelatin, mannitol, starch paste, magnesium trisilicate, talc, corn starch, keratin, colloidal silica, potato starch, urea, medium chain length triglycerides, dextrans, and other carriers suitable for use in manufacturing preparations, in solid, semisolid, or liquid form. In addition auxiliary, stabilizing, thickening and 30 coloring agents and perfumes may be used. Examples of a stabilizing dry agent includes triulose, preferably at concentrations of 0.1% or greater (See, e.g., U.S. Patent No.
WO 99/32143 PCT/US98/27498 20 5,314,695). The active compound (i.e., context-dependent functional entity) is included in the pharmaceutical composition in an amount sufficient to produce the desired effect upon the process or condition of diseases. 5 The pharmaceutical compositions may be in the form of a sterile injectable suspension. This suspension may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. 10 Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides, fatty acids (including oleic acid), naturally occurring vegetable oils like sesame oil, coconut oil, peanut oil, cottonseed oil, etc., or synthetic fatty vehicles like ethyl oleate, or the like. Buffers, preservatives, antioxidants, and the like can be 15 incorporated as required. One particularly preferred method for delivering the context-dependent functional entity is intravascularly to the selected vascular site via a small diameter medical catheter. When delivered by catheter, the injection rate will depend on a 20 number of variables, including the concentration of the active ingredient, the specific substructures employed, the rate of precipitation (formation of the thrombus), total volume of the vasculature to be thrombosed, location of the biologically susceptible site(s), toxicity, side effects, and the like. When introduced into the vascular site, the context-dependent functional entity diffuses rapidly into the blood and initiates 25 occlusive thrombosis specifically at the biologically susceptible site(s). The dosage regimen necessary depends on a variety of factors, including type of disorder, age, weight, sex and medical condition of the patient, as well as the severity of the pathology, the route of administration, and the type of therapeutic agent used. A 30 skilled physician or veterinarian can readily determine and prescribe the effective amount of the context-dependent functional entity or pharmaceutical required to treat WO 99/32143 PCT/US98/27498 21 the patient. Conventionally, those of skill in the art would employ relatively low doses initially and subsequently increase the dose until a maximum response is obtained. Typical daily doses, in general, lie within the range of from about 1 p.g up to 5 about 100 mg per kg body weight, and, preferably within the range of from 50 pg to 10 mg per kg body weight and can be administered up to four times daily. The daily IV dose lies within the range of from about 1 jtg to about 100 mg per kg body weight, and, preferably, within the range of from 10 tg to 10 mg per kg body weight. 10 In yet another embodiment of the present invention, there are provided assembly-dependent functional complexes comprising substructures with thrombogenic potential and one or more association-enhancing substructures having the ability to transiently associate the complexes to increase local concentration at desired 15 biologically susceptible site(s), wherein the complexes impart thrombogenic activity when positioned in the function-forming-context at the biologically susceptible site(s), and wherein such complexes have substantially no thrombogenic activity absent a function-forming-context at the biologically susceptible site(s). In a preferred embodiment of the present invention the complex transiently becomes functional upon 20 association of a functional context with the biologically susceptible site(s). Exemplary substructures with thrombogenic potential comprise a thrombogen, preferably modified or wild-type TF. Exemplary association-enhancing substructures assemble the complex in a function-forming context. 25 The invention will now be described in greater detail by reference to the following non-limiting examples.
WO 99/32143 PCT/US98/27498 22 Example 1 PCR of TF cDNA PCR is performed to amplify a DNA fragment of 639 base pairs from a 5 Marathon-Ready eDNA of human placenta origin (Clontech:(97/98 cat.#7411-1). A 100 tL reaction contains: 2 ptL eDNA mixture, 100 pmoles each of oligos BM21 and BM33 (SEQ ID NO:3 and SEQ ID NO:4 (Oligos Etc.)), buffer, BSA, MgSO 4 according to manufacturer, 1 tL 10mM dNTPs and 2 units of Vent DNA polymerase (New England Biolabs 96/97 cat.#254S) which is added during the first cycle after the 10 temperature reaches 94 0 C. The thermocycling is accomplished with 35 cycles of denaturation for 1 min at 94 0 C, primer annealing for 1 min at 60 0 C, and primer extension for 1 min at 75 0 C. The PCR product is about 640 base pairs in length. This DNA fragment is purified by 15 electrophoretic separation on a 1.0% agarose gel buffered with Tris-Borate-EDTA according to Maniatis, excision of the appropriate band, and extraction of the DNA using the QIAEX II gel extraction kit (QIAGEN cat#20051) according to manufacturer's instructions for DNA Extraction from Agarose Gels (QIAEX II Handbook 08/96). The 640 base pair DNA fragment concentration is estimated by 20 agarose gel electrophoresis according to Maniatis. The 640 base pair fragment is used as template for a second PCR amplification, this time with the oligonucleotides BM51 (SEQ ID NO:5, Oligos Etc.) and BM33. A 100 ItL PCR reaction contains: 10 ng 640 base pair DNA fragment, 100 pmoles each of 25 oligos BM51 and BM33, buffer, BSA, MgSO 4 according to manufacturer, 100 JIM dNTPs and 2 units of Vent DNA polymerase (which is added during the first cycle after the temperature reaches 94oC). The thermocycling is accomplished with 25 cycles of denaturation for 1 min at 94°C, primer annealing for 1 min at 60 0 C, and primer extension for 1 min at 75 0 C. The PCR product is about 670 base pairs in length. This 30 DNA fragment is purified by passage over an Elutip-D column according to the manufacturer's instructions (Schleicher & Schuell cat# 27370). Briefly, the DNA is WO 99/32143 PCT/US98/27498 23 diluted to 1 mL volume with Low-Salt buffer (0.2M NaC1, 20mM Tris-HC1, 1 mM EDTA pH7.4) and passed over the elutip-D column. The column is subsequently washed with 3 mL of Low-Salt buffer and eluted with 0.4 mL High-Salt buffer (lM NaC1, 20mM Tris-HC1, 1 mM EDTA pH7.4). The DNA is desalted and concentrated 5 by ethanol precipitation according to Maniatis. The result is a 640 bp eDNA fragment encoding human TF residues 3 to 211 (i.e., amino acid residues 35-243 of SEQ ID NO:1. Example 2 10 Disulfide Conjugation Different substructures may be joined by employing the thiol group of a cysteine production substructure. In this example, the conjugation is by the cysteine thiol groups of substructure(s) with thrombogenic potential, context enhancing substructure(s) and/or 15 activity-modulating substructure(s), thereby forming a disulfide bond that links the cysteine-containing spacer - TF moiety to the context enhancing substructure(s). In absence of a cysteine, a thiol group may be artificially introduced into an amino group of context enhancing substructure(s), for example, using 2-iminothiolane (Traut's Reagent). To achieve the highest degree of specificity of labeling, peptides with a single 20 free amino group are preferred. The cysteine thiol of the context enhancing substructure(s) (or the cysteine thiol of the cysteine-containing activity-modulating substructure) is formed into a mixed disulfide bond through the use of a 10- to 100-fold molar excess of 5,5'-bis(2-nitrobenzoic acid), DTNB. The amount of reaction is monitored by ultraviolet absorption of DTNB and measured using 14,150 for the molar 25 absorption coefficient at 412 nm. After 1 hour incubation at room temperature in 0.1 M sodium phosphate, pH 7.5, 0.1 M NaC1, 1 mM EDTA, excess DTNB is removed by gel filtration. The mixed disulfide context enhancing substructure is mixed with the 30 cysteine-containing activity-modulating substructure - TF moiety or the cysteine-containing context enhancing substructure(s) (at different molar ratios to improve yield) and left at 4 oC to react at neutral to slightly basic pH for a period of time WO 99/32143 PCT/US98/27498 24 in order to form the desired product (i.e., context-enhancing substructure-SS-spacer substructure - TF). The product is purified by a combination of gel filtration and ion exchange chromatography. The purity of the compound is judged by SDS-PAGE, HPLC using reverse phase chromatography, or by electrospray mass spectometry. 5 Mixed disulfides suitable for reaction with the thiol group of cysteine-containing spacers are artificially introduced into the context enhancing substructure(s) by modification of its amino group(s) with SPDP, N-succinimidyl-3-(2-pyridylthio) propionate, or by any of the other commonly used reagents used for this purpose, 10 including without limitation SMPT, 4-succinimidly-oxycarbonyl-a-(2-pyridyltdithio) toluene; Sulfo-LC-SMPT, sulfosuccinimdyl-6[4-succinimidly-oxycarbonyl-a-methyl a(2-pyridyltdithio)-toluamide] hexanoate; LC-SPDP, succinimidyl 6- [3- (2- pyridyldi thio-)proprionamide) hexanoate; sulfo-LC-SPDP, sulfosuccinimdyl-6- [3(2-pyridyldi thio)-propionamido] hexanoate; PDPH , 3-(2-pyridyldithio)-propionyl hydrazide, and 15 the like. These and other reagents are available from Pierce Chemical Co. The mixed disulfide formed with any of these reagents is isolated by gel filtration chromatography and reacted with the cysteine-containing spacer at different molar concentrations under the conditions described above and analyzed for purity. 20 A water-soluble, monitorable peptide and protein crosslinking agent, N-maleimido-6-aminocaproyl ester of 1-hydroxy-2-nitro-4-benzenesulfonic acid, (mal-sac-HNSA), is reacted with an amino group of a peptide. In order to achieve the best specificity of labeling, the preferred peptide does not contain lysine at any position other than the amino terminus (Aldwin and Nitecki (1987) Anal Biochem 164:494-501). 25 Reaction with amino groups releases the dianion phenolate, HNSA, that can be quantitated using a spectrophotometer. The peptide is linear or its conformation may be restrained (la) by the presence of 1 or more disulfide bonds. The N-maleimido-6-aminocaproyl amide derivative is reacted with the thiol of the cysteine-containing activity-modulating substructure - TF to form a thioether bond that 30 conjugates the context enhancing substructure(s) to TF through a spacer of variable length. Other heterobifunctional cross linkers may be used to introduce a maleimido WO 99/32143 PCT/US98/27498 25 group into the facilitator, these include without limitation such reagents as SMCC, succinimidly 4-(N-maleimido-methyl) cyclohexane-l1-carboxylate; sulfo-SMCC, sulfo-succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxylate; MBS, m-maleimidobenzoyl-N-hydroxysuccinimide ester; sulfo-MBS, m-maleimidobenzoyl 5 N-hydroxysulfosuccinimide ester; SMPB, succinimidyl 4-(p-maleimido-phenyl) -butyrate; sulfo-SMPB, succinimidyl-4- (p-maleimidophenyl)- butyrate; GMBS, N-(-maleimidobutyryloxy) succinimide ester; sulfo-GMBS, N-(-maleimidobutyryloxy) sulfosuccinimide ester; and the like. 1o Example 3 Cloning of TF 3-211 for E.coli expression:NuV120 670 bp TF cDNA fragment from PCR is prepared (described above in Example 1, in PCR of TF cDNA). The purified 670 base pair DNA fragment is digested with 5 15 units restriction endonucleases BamHI and HindIII (New England Biolabs cat#136S and #104S respectively) per tg DNA in 1X BamHI buffer (New England Biolabs) for 4 h at 37 0 C. Subsequently, the 659 base pair fragment is purified from an agarose gel electrophoresis band using the QIAEX II kit as previously described for the 640 base pair fragment. The -659 bp band is cloned into the BamHI and HindIII sites of the 20 vector pTrcHisC (Invitrogen) by standard methods. Briefly, the pTrcHisC DNA is digested with BamHI and HindIII and then the -5 kb band is purified on an agarose gel. Ligation is performed with about 10 ng/piL of the purified vector fragment mixed with a three fold molar excess of the purified 654 bp fragment and T4 DNA ligase reaction conditions according to the manufacturer (New England Biolabs). The resulting clone 25 (NuV120: SEQ ID NO:6) places the TF coding sequence in a translational reading frame with the translational start of the vector. The clone NuV120 is a plasmid for expression of a recombinant protein containing a (His) 6 tag, a thrombin cleavage site, and TF residues 3 to 211 plus threonine at residue 212.
WO 99/32143 PCT/US98/27498 26 NuV120 residues (SEQ ID NO:6) start codon 413-415 (His) 6 tag production substructure 425-442 BamH production substructure 513-518 thrombin cleavage site production substructure 521-532 AvaI/XmaI production substructure 533-538 TF 3-211 substructure with thrombogenic 539-1165 potential PmlI production substructure 1165-1170 stop codon 1169-1171 HindII production substructure 1172-1177 Example 4 5 Cloning of a synthetic spacer sequence in TF: NuV121 Mix oligonucleotides NuV005 through NuV009 (SEQ ID NOs:7-11, respectively (Oligos Etc.)) at 10 pmol/lpL in 20 mM Tris-HC1, 10 mM MgC12, 50 mM NaC1, pH 7.5. Heat mixture to 80 0 C for 2 min then cool to 25 0 C over a period of 30 lo min to allow annealing of oligonucleotides. Clone the resulting synthetic spacer into the Barn HI and Aval sites of NuV120. The vector DNA is prepared by digesting Clone NuV120 with BamH and Aval and isolation of the ~5kb fragment from an agarose gel and purification by QIAEX II (QIAGEN). The 10 [tL ligation reaction contains 100 ng of NuV120-BamHI/AvaI fragment, 0.5 itL of the annealed oligonucleotide mixture, and 15 T4 DNA ligase with buffer according to the manufacturer's recommendations (New England Biolabs). This results in NuV121 (SEQ ID NO:12), a plasmid for expression of a recombinant protein containing a (His) 6 tag, a thrombin cleavage site, a 17 amino acid spacer, and TF residues 3 to 211.
WO 99/32143 PCT/US98/27498 27 NuV121 residues (SEQ ID NO:12) start codon 413-415 (His) 6 tag production substructure 425-442 BamHI production substructure 513-518 thrombin cleavage site production substructure 521-532 spacer activity-modulating substructure 533-574 AvaI/XmaI production substructure 575-580 TF 3-211 substructure with thrombogenic 581-1207 potential PmlI production substructure 1207-1212 stop codon 1211-1213 HindIIl production substructure 1214-1219 Example 5 5 Mutation of TF residue Thrl67 to Lys: NuV122 Oligonucleotide mutagenesis is performed on Clone NuV121 according to the method of Deng and Nickeloff (1992) Analytical Biochem. 200:81-88] (also according to the Transformer Site-Directed Mutagenesis Kit, Clontech #K1600-1). The selection 10 primer (Stul, SEQ ID NO:13, (from Oligos Etc.)) changes the unique Scal site in NuV121 to a StuI site, thus allowing selection against the parental plasmid by restriction with Scal. The mutagenic primer (TF+K, SEQ ID NO:14 (Oligos Etc.)) changes a Thr codon (ACA) to a Lys codon (AAA). Screening for the mutation is performed by DNA sequencing. The modified clone is NuV122 (SEQ ID NO:15), a plasmid for expression 15s of a recombinant protein containing a (His) 6 tag, a thrombin cleavage site, a 17 amino acid spacer, and TF residues 3 to 211, with residue 167 changed to Lys.
WO 99/32143 PCT/US98/27498 28 NuV122 residues (SEQ ID NO:15) start codon 413-415 (His) 6 tag production substructure 425-442 BamHI production substructure 513-518 thrombin cleavage site production substructure 521-532 spacer activity-modulating substructure 533-574 AvaI/XmaI production substructure 575-580 TF 3-211 substructure with thrombogenic 581-1207 potential Thrl67 to Lys codon modification 1073-1075 Lys mutation modification 1074 PmlI production substructure 1207-1212 stop codon 1211-1213 HindIII production substructure 1214-1219 selection mutation 1245-1246 Example 6 Cloning of a synthetic peptide clone20 with a spacer attached to TFK: NuV124 5 Oligonucleotides NuV20-1 through NuV20-8 (SEQ ID Nos:15-23) are mixed at 10 pmol/ptL in 20 mM Tris-HC1, 10 mM MgC12, 50 mM NaC1, pH 7.5. The mixture is heated to 80 0 C for 2 min, then cool to 25 0 C over a period of 30 min to allow annealing of oligonucleotides. The resulting synthetic spacer is cloned into the BamHI and Aval 10 sites of NuV122. The vector DNA is prepared by digesting Clone NuV122 with BamHI and Aval and isolation of the -5kb fragment from an agarose gel and purification by QIAEX II (QIAGEN). The 10 microL ligation reaction contains 100 ng of NuV122-BamHI/AvaI fragment, 0.5 1 iL of the annealed oligonucleotide mixture, and T4 DNA ligase with buffer according to the manufacturer's recommendations (New 15 England Biolabs). The resulting construct, NuV124 (SEQ ID NO:24), is a plasmid for WO 99/32143 PCT/US98/27498 29 expression of a recombinant protein containing a His-tag, a thrombin cleavage site, a peptide sequence referred to as clone20, a spacer segment, and TF3-211 with K167. NuV124 residues (SEQ ID NO:24) start codon 413-415 (His) 6 tag production substructure 425-442 thrombin cleavage site production substructure 521-532 BamHI production substructure 530-535 Clone 20 context-enhancing substructure 536-586 KpnI production substructure 587-592 spacer (G4S)3 activity-modulating substructure 593-637 AvaI/XmaI production substructure 638-643 TF 3-211 substructure with thrombogenic 644-1270 potential Thr167 to Lys codon modification 1136-1138 Lys mutation modification 1137 PmlI production substructure 1270-1275 stop codon 1274-1276 HindlIIl production substructure 1277-1282 selection mutation Scal 2108-2109 to Stul 5 Example 7 Characterization of NV 124 Purification of NV124. 10 The protein, NV124, is expressed from the E. coli expression plasmid NuV124. This protein is insoluble when expressed in E. coli and was recovered from inclusion bodies by solubilizing the proteins with guanidine hydrochloride (GuHC1).
WO 99/32143 PCT/US98/27498 30 NV124 was partially purified by IMAC (immobilized metal anion chromatography) on a Ni-NTA column (Qiagen) in guanidine HC1. After extensive washing, low pH (4.0) was used to release the NV124 from the column. Folding of the protein was performed by dilution of the denatured protein into 20 mM TrisCl containing reduced 5 and oxidized glutathione. The final concentration of the protein after dilution in folding buffer was 50 pg/ml. Thrombin was added under precisely controlled conditions to remove the (His) 6 tag-thrombin cleavage peptide from the NV124. Thrombin was added at 5 microgram per mg of precursor protein. After 4 hours digestion at 37 0 C essentially all of the (His) 6 tag-thrombin cleavage peptide was 10 removed from the NV124. In some studies, the (His) 6 tag was not removed, yet this protein (referred to here as His-NV124) displayed similar biological activity to the mature protein. The final step of purification was MonoQ-HR ion-exchange chromatography using FPLC and a Pharmacia 10/10 column. A gradient elution was used to elute the protein between 20 mM TrisC1, pH 8.5, and 20 mM TrisC1, pH 8.5, 15 containing 1 M NaC1. The estimated purity at this stage is typically greater than 90%. Yields of 20 mg NV124 per liter of E. coli culture are typical. Protein characterization. 20 NV124 and His-NV124 were physically characterized by SDS-PAGE and mass spectrometry (MALDI). The mass of His-NV124 determined by MALDI was 31.6 kDa and was similar to the theoretical mass of 31.7 kDa determined from the sequence. 25 TF function of NV124. NV124 was subjected to rigorous in vitro characterization of the function of its TF moiety. This included analysis of NV124 dependent enhancement of factor VIIa amidolytic activity, measurements of the affinity of NV124 for factor VIIa, and 30 measurements of NV124 dependent enhancement of factor VIIa's proteolytic activity and plasma clotting activity. Table 1 summarizes some of the results obtained from WO 99/32143 PCT/US98/27498 31 the analyses of NV124, in comparison with other STVTs characterized. Amidolytic activity of factor VIIa complexed with NV124 compared favorably with the complex of factor VIIa with TFl1-218. This indicates that the N-terminal addition of about 20 peptide residues by way of a spacer does not interfere with subtle protein-protein 5 interactions at the protease domain of factor VIIa that are responsible for allosteric enhancement of factor VIIa amidolytic function. The affinity of NV124 for factor VIIa as measured by surface plasmon resonance or titration of factor VIIa amidolytic activity was also similar to that of TF1-218. Thus, the NV124 modification does not interfere with extensive interactions between TF and factor VIIa. 10 It is also important that modifications to TF not disrupt proteolytic function of the TF-factor VIIa complex. This was addressed in an assay which measures the ability of the TF-factor VIIa complex to activate factor X in the fluid phase or on phospholipid vesicles. Indeed, TF directly participates in protein-protein interactions 15 with macromolecular substrates factors X and IX. Assay of NV124 dependent enhancement of factor VIIa hydrolysis of substrate factor X either in the presence or absence of phospholipid vesicles gave similar results to that obtained with TF 1-218. Additionally, NV124 initiated plasma clotting times were similar to clotting times obtained with TFl-218. The results indicate that the NV124 modification does not 20 interfere with the proteolytic cofactor function of TF. Moreover, analyses of other STVTs which were tested indicate that modifications at the N-terminus, the C terminus and the permissive loop generally do not interfere with the cofactor functions of TF (Table 1).
WO 99/32143 PCT/US98/27498 32 Table 1: Characterization ofSTVTs produced according to the invention. Yield of Kd Kd Relative Class Protein (2) Amidolytic for VIIa for VIIa Proteolytic 5 of STVT Link ) (mg/liter) activity (3) (n)(4) (nM)(5) activity( 6 ) TF1-218 50 1.000 4.73 3.26 1.000 NuV123 N 47.2 0.998 5.63 4.95 0.995 NuV125 N 0.28 ------- ------- -------- ------- 10 NuV124 N 21.8 0.902 5.63 3.65 1.456 NuV129 N 6.66 0.736 4.42 4.06 0.955 NuV135 N 23.3 ------- ------- 4.23 ------- NuV139 N 7.7 ------- ------- -------- ------- NuV141 N 31.3 1.010 11.55 7.87 0.481 15 NuV142 N 50.6 1.005 15.32 7.42 0.755 NuV144 N 13.3 0.979 4.32 3.22 0.862 NuV128 N 6.90 0.860 3.72 10.8 ------- NuV131 C 3.66 1.031 9.70 -------- 2.082 NuV137 C 3.89 0.941 6.03 -------- 0.858 20 NuV143 I 62.9 1.032 6.18 -------- 0.977 TF-cys N 11.5 ------- -------- -------- ------- 1. Linkage is the position of the facilitator relative to TF. N is amino terminus, C is carboxy terminus, and I is inserted into the permissive loop. Each STVT represents a 25 different subclass of facilitator directed towards a different biological site. 2. Yield of refolding expressed as mg per liter of E. coli culture. 3. Normalized amidolytic activity of STVT:factor VIIa complex. 4. Apparent dissociation constant for factor VIIa determined from amidolytic activity plots at 5 nM factor VIIa concentration and varying the STVT concentration. 5. Dissociation constant determined by surface 30 plasmon resonance in a BIAcore 2000. 6. Normalized factor Xa generation activity of STVT:factor VIIa complexes. As is illustrated in Table 1, each STVT has amidolytic (measured by in vitro activity on a synthetic substrate) and factor VIIa binding activity (measured by 35 BIAcore) that is very close to that of the truncated TF. Therefore, incorporating the facilitators into the structure of TF has not damaged the inherent activity of TF. NuV143 has a facilitator incorporated into the permissive loop, and is a particularly interesting example of invention constructs.
WO 99/32143 PCT/US98/27498 33 Toxicity of NV124. Soluble, truncated TF is a remarkably safe molecule to administer intravenously to mice. A dose of 1.5 mg per mouse (-75 mg/kg) has no visible effect 5 on the mice. When a dose of 2.5 mg per mouse (-125 mg/kg) is administered, about half of the mice die. When native TF is inserted in a phospholipid vesicle and administered, death of all the mice results at a dose of about 10 ng/mouse (-500 ng/kg). Fully constituted native tissue factor is more than 250,000 times more toxic than the soluble, truncated TF used in construction of NV124. 10 When lethal doses of soluble, truncated TF or full length, reconstituted TF are given intravenously to mice, the mice are observed to rapidly become very quiet and hunched over within 30-90 seconds, their respiration rate increases, and death occurs within 1-10 minutes. It was found that most of the radiolabelled soluble, truncated TF 15 is found in the lung a few minutes after IV administration. Doses of typical STVTs that kill 25-50% of 4 mice are generally around 125 to 200 micrograms per mouse (-6.25 to 10 mg/kg). Therefore, NV124 is about 12.5 to 20 times more toxic to mice than soluble, truncated TF and about at least 12,500 to 20,000 times less toxic than fully constituted TF. 20 Half-lives of STVTs. The half-life of a STVT is short, on the order of several minutes as can be seen in the accompanying figures. Figure 3b illustrates the difference between the very 25 short half-life of radioiodinated truncated, soluble TF and the slightly longer half-lives of two different STVTs injected intravenously into mice. As illustrated in Figure 3a, incubating an antibody (10H10) that recognizes, but does not neutralize, TF before injecting the complex into the mouse produces a much longer half-life. When the mice were sacrificed soon after the last time point and their organs collected and 30 counted, most of the radiolabelled proteins were found in the lung. Although injected, soluble TF accumulated in the lung, little thrombosis in the lung was observed. The WO 99/32143 PCT/US98/27498 34 lack of phosphatidylserine expression in lung vesicles (see Ran et al. (1998) Cancer Res. 58(20):4646-53.) may account for the lack of thrombogenic activity in this tissue. Histology 5 The effects of various subclasses of STVT molecules on the tumor vascular system were histologically evaluated. It was desired to be able to quickly determine the effect on the vascular system by removing the tumor within 24 hours (1, 4, or 24 hours) and examining histological slides (H & E or Carstair's staining) to see the 10 effects of the thrombogen on the vascular system. Because the tumor vessels in controls also show significant and variable tendency to thrombose, results that differentiated control and STVT-treated tumors at early stages could not confidently be obtained. Therefore, tumor measurements over a period of 7 to 10 days were relied on. 15 Lack of inhibition of tumor growth by bolus doses of NV124. Mice (strain A/J) were given C1300 neuroblastoma tumor cells subcutaneously on their flank, the tumors were allowed to grow to substantial size (up 20 to 10 mm diameter) before treatment was started. After a bolus dose of selected NV124 (in the range of 25 to 125 pg per mouse), the tumors became blue/black over a period of 1-5 minutes. In spite of the lack of inhibition of tumor growth, it is believed that change in coloration is physiologically significant and related to the NV124, because neither saline controls nor truncated TF alone (which lacks a facilitator) 25 produced this effect. Furthermore, not all STVTs (having different facilitators) produced this effect. Except for an occasional animal, bolus doses were generally not able to adequately infarct and inhibit the growth of tumors.
WO 99/32143 PCT/US98/27498 35 Inhibition of C1300 growth by a single infusion of NV124 Because of these results and the short half-life of the STVTs compared to the antibody based system that was previously demonstrated to work, it was decided to 5 use intravenous infusion to prolong the time that NV124 would have to act on the tumor vascular system. In two independent experiments, tumors were grown for about 10 days before treatment was started. The volume of the tumors was calculated from (a 2 * b)/2 where a is the smallest dimension of the tumor and b is the dimention of right angles to a. For comparison, a 5 x 5 mm and a 15 x 15 mm tumor yields a o10 volume of 62.5 and 1688 mm 3 , respectively. The growth of the tumors was significantly slowed when the NV124 was infused; the results of one experiment are shown in Figure 4. The tumors at the start of this experiment were about 7 x 7 mm. A single dose 25 pg (closed diamond) or 125 jig (closed square) of NV124 was given by infusion through the tail vein over 1 hour. NV124 contained a facilitator, clone 20 15 described by Goodson et al (Proc. Natl. Acad. Sci. USA (1994) 91:7129-7133), which is reputed to interact with human uPAR and much less efficiently with murine uPAR. Multiple infusion of NV124. 20 As shown in Fig. 5, multiple infusions improved the pharmacological effect of NV124 on tumor growth. C1300 tumors were grown in A/J mice to about 5 x 5 mm in about 10 days. The mice had been given two infusions of NV124 that were spaced by 4 days. NV124 was infused through the tail vein over 1 hour at a rate of 0.2 ml per hour. One group received a single infusion of 125 jig (closed squares) and the other 25 group received decreasing doses of 125, 75, and 50 jig per infusion for a total of 3 infusions given on Days 0, 4, and 8. In this evaluation, the controls that were infused with saline grew from about 7 x 7 mm to about 15-17 mm in size in 8 days. The group that received 3 infusions responded better than the group that received only 1 infusion. In some animals, a hard black cap was formed over the tumors. In these 30 particular animals, the tumors were about 1 x 1 cm in size. The cap formation, which strongly resembled a scab, was usually produced when the tumors were developing WO 99/32143 PCT/US98/27498 36 redness just under the skin. Histological evidence of NV124-induced effects on C1300 tumors. 5 Two regions of tumor loss were observed, which may correspond to scarring caused by the first administration and most recent apoptosis caused by the second administration. At least 95% of the cells in the tumor were dead as judged from histological examination. 10 Direct observation of treated vessels. Implanted tumor and angiogenic vessels were observed through a window established in a skin flap. This technique has been used most with hamsters in which the window is placed in the cheek pouch. The skin over the back of the animal (mice 15 or rats) and a metal frame was placed so a fold of skin is held rigidly. A circular piece of skin was removed from one side of the skin fold; this exposed the underside of the skin on the other side of the fold. A cover glass inserted and immobilized in the frame provides a sealed window. Vessels were easily seen by microscopic observation through the window. 20 Before the introduction of NV124, blood was observed flowing through arterioles and venules, individual red blood cells could be seen moving in capillaries, and white blood cells could be seen rolling along the vessel walls. The images were continuously captured on video recording tape. NV124 produced a very rapid 25 response; it caused rapid occlusion of arterioles, which prevented blood flow in the tumor vessels. In some instances, thromboses were visible in the vasculature.
WO 99/32143 PCT/US98/27498 37 Example 8 PCR of human plasminogen cDNA fragments PCR is performed to amplify a DNA fragment of 965 base pairs from the 5 Clontech cDNA mixture (Marathon-Ready cDNA of Human placenta origin from Clontech (97/98cat.#7411-1)) which encodes kringle domains 1 and 2. A 100 pL reaction should contain: 2 iL cDNA mixture, 100 pmoles each of oligos Plg+63 and Plg-1005 (SEQ ID NO:25 and SEQ ID NO:26, respectively), buffer, BSA, MgSO 4 according to manufacturer; 1 pL 10mM dNTPs and 2 units of Vent DNA polymerase 10 which is added during the first cycle after the temperature reaches 94oC. The thermocycling is accomplished with 35 cycles of denaturation for 1 min at 94 0 C, primer annealing for 1 min at 55 0 C, and primer extension for 1 min at 75oC. The PCR product is about 965 base pairs in length. This DNA fragment is purified by electrophoretic separation on a 1.0% agarose gel buffered with Tris-Borate-EDTA according to 15 Maniatis, excision of the appropriate band, and extraction of the DNA using the QIAEX II gel extraction kit (QIAGEN cat#20051) according to manufacturer's instructions for DNA Extraction from Agarose Gels (QIAEX II Handbook 08/96). The 965 base pair DNA fragment concentration is estimated by agarose gel electrophoresis according to Maniatis. 20 The 965 base pair fragment is used as template for a second PCR amplification, this time with the oligonucleotides Plg+289 and Plg-523 (SEQ ID NO:27 and SEQ ID NO:28, respectively) to amplify only the kringle 1 domain and to add restriction sites appropriate for cloning. A 100 pL PCR reaction contains: 10 ng 965 base pairs DNA 25 fragment; 100 pmoles each of oligos Plg+289 and Plg-523, buffer, BSA, MgSO 4 according to manufacturer, 100 pM dNTPs and 2 units of Vent DNA polymerase (which is added during the first cycle after the temperature reaches 94°C). The thermocycling is accomplished with 25 cycles of denaturation for 1 min. at 94°C, primer annealing for 1 min at 55 0 C, and primer extension for 1 min at 75 0 C. The PCR 30 product is about 267 bp in length.
WO 99/32143 PCT/US98/27498 38 This 267 bp DNA fragment is purified by passage over an elutip-D column according to the manufacturer's instructions. Briefly, the DNA is diluted to 1 mL volume with Low-Salt buffer (0.2M NaC1, 20mM Tris-HC1, 1 mM EDTA pH7.4) and passed over the Elutip-D column. The column is subsequently washed with 3 mL of 5 Low-Salt buffer and eluted with 0.4 mL High-Salt buffer (lM NaC1, 20mM Tris-HC1, 1 mM EDTA pH7.4). The DNA is desalted and concentrated by ethanol precipitation according to Maniatis. PCR is performed to amplify a DNA fragment of 1677 bp from the Clontech cDNA mixture which encodes kringle domains 3, 4 and 5. A 100 tL reaction should contain: 2 pL cDNA mixture, 100 pmoles each of oligos Plg+737 and 10 Plg-2393 (SEQ ID NO:29 and SEQ ID NO:30, respectively), buffer, BSA, MgSO 4 according to the manufacturer; 1 tL 10mM dNTPs and 2 units of Vent DNA polymerase which is added during the first cycle after the temperature reaches 94oC. The thermocycling is accomplished with 35 cycles of denaturation for 1 min at 94 0 C, primer annealing for 1 min at 55 0 C, and primer extension for 1 min at 75 0 C. 15 The PCR product is about 1677 bp in length. This DNA fragment is purified by electrophoretic separation on a 1.0% agarose gel buffered with Tris-Borate-EDTA according to Maniatis, excision of the appropriate band, and extraction of the DNA using the QIAEX II gel extraction kit (QIAGEN cat#20051) according to manufacturers 20 instructions for DNA Extraction from Agarose Gels (QIAEX II Handbook 08/96). The 1677 bp DNA fragment concentration is estimated by agarose gel electrophoresis according to Maniatis. The result is a 965 bp cDNA fragment encoding plasminogen kringle domains 1 and 2, a 1677bp eDNA fragment encoding plasminogen kringle domains 3 through 5, and a 267bp eDNA fragment encoding plasminogen kringle 25 domain 1. Example 9 Cloning of plasminogen kringle 1 into TFK: NuV125 30 The plasminogen kringle 1 fragment is cloned into the BamHI and KpnI sites of NuV124, replacing the clone 20 sequence with the plasminogen sequence. The 267 bp WO 99/32143 PCT/US98/27498 39 Plasminogen cDNA fragment from PCR of human plasminogen cDNA fragments is digested with BamHI and KpnI, separated on an agarose gel, purified with QIAEX II resin, and ligated with NuV124 that was prepared as follows: digestion with BamHI and KpnI, separation on an agarose gel, and purification of the -6kb band with QIAEX II 5 resin. The resulting clone is designated NuV125 (SEQ ID NO:31), a plasmid for expression of a recombinant protein containing a His-tag, a thrombin cleavage site, a plasminogen kringle 1, a spacer segment, and TF3-211 with K167. NuV125 residues (SEQ ID NO:31) start codon 413-415 (His) 6 tag production substructure 425-442 thrombin cleavage site production substructure 521-532 BamHI production substructure 530-535 plasminogen kringle 1 context-enhancing substructure 542-778 KpnI production substructure 779-784 spacer (G4S)3 activity-modulating substructure 785-829 Ava/XmaI production substructure 830-835 TF 3-211 substructure with thrombogenic 836-1462 potential Thrl 67 to Lys codon modification 1328-1330 Lys mutation modification 1329 stop codon 1466-1468 PmlI production substructure 1462-1467 HindIII production substructure 1469-1474 selection mutation Scal 2300-2301 to Stul WO 99/32143 PCT/US98/27498 40 Example 10 Expression, refolding, and purification of TF K fusion proteins Expression in E. coli, refolding, thrombin cleavage, and purification of TF K and 5 fusions with TF K are performed essentially as described by Stone et al. (1995) Biochem. J 310:605-614. TF K and variants ofTF K are purified by the same basic protocol with modifications appropriate to the particular characteristics of the TF K fusion protein such as differences in elution from ion exchange chromatography and migration upon SDS-PAGE. TFK fusions are produced in yeast (see Stone et al. (1995) Biochem. J 10 310:605-614) or mammalian cells (see Ruf et al. (1991) Biol. Chem. 266:2158-2166 and Ruf et al.(1992) 1 Crystal Growth 122, 253-264. These systems have the advantage that no refolding step is necessary. Expression in yeast may require additional mutations in TFK which alters recognition sites for the cell glycosylation machinery (Stone et al. (1995) Biochem. J 310:605-614). A biophysical analysis is 15 performed either by SDS PAGE or mass spectrometry (both of which are described by Stone et al. (1995) Biochem. J. 310:605-614). In vitro activity is determined either by titration of factor VIIa monitored by changes in rates of chromogenic substrate hydrolysis or by changes in rates of factor Xa activity generation (as described by Stone et al. (1995) Biochem. J 310:605-614). 20 Example 11 Cloning of NuV 129 A human plasminogen fragment encoding the fifth kringle domain was 25 amplified by PCR from a human EST clone (Genome Systems, genbank accession H61584) using Vent DNA polymerase (New England Biolabs) and the following oligonucleotides: Ks+: 5'CACACAGGATCCGAAGAAGACTGTATG 3' (SEQ ID NO:32) 30 Ks-:5' CACACAGGTACCTGAAGGGGCCGCACA 3' (SEQ ID NO:33) WO 99/32143 PCT/US98/27498 41 This amplified a 285 bp fragment, which was digested with BamHI and KpnI and cloned into the corresponding sites of the plasmid NuV127. Plasmid NuV127 is a vector derived from pTrcHisC (Invitrogen) for cloning of amino terminally linked TF fusion proteins. The resulting plasmid NuV129 encodes a protein, NV129, with a 5 His-tag near the N-terminus, a thrombin cleavage site, plasminogen kringle 5 domain, a 15 residue flexible spacer, and human TF residues 3 to 211 at the C terminus. NuV129 residues (SEQ ID NO:34) start codon 413-415 (His) 6 tag production substructure 425-442 thrombin cleavage site production substructure 521-532 BamHI production substructure 530-535 plasminogen kringle 5 context-enhancing substructure 536-796 KpnI production substructure 797-802 spacer activity-modulating substructure 803-847 TF 3-211 substructure with thrombogenic 854-1480 potential stop codon 1484-1486 10 Purification and characterization. Purification of NV129 was performed as described for purification of NV124 (see example 6.) Yields were in the range of 6 mg / L of E. coli culture. Mass spectrometry was performed by MALDI as previously described and resulted in a 15 determination of 39,305 Da in close agreement with the predicted mass of 39,303. TF function of NV129. Characterization of NV129 TF activity was performed as previously described 20 for NV124. As shown in Table 1 although amidolytic activity of NV129:factor VIIa WO 99/32143 PCT/US98/27498 42 was slightly lower than that of TF1-218, affinity for factor VIIa was similar to that of TF1-218. NV129:factor VIIa proteolytic activity for factor X activation was also similar to that of TF 1-218:factor VIIa, as assayed both in the presence and absence of phospholipids. The results demonstrate that the TF entity of NV129 is properly folded 5 and functional. C1300 neuroblastoma cells (500,000) were injected subcutaneously into the flank of A/J mice. After about 7-10 days, the tumors were grown to about 5-7 mm in diameter and were ready for treatment. A restraining device was used in which the 10 mice were immobilized by a vest placed around their trunk and the vest was connected to the interior of a plexiglass tube. The tail of the mice was exposed from one end of the plexiglass tube. The tail was taped to a plexiglass plate and a 30-gauge needle inserted into the tail vein was connected to a Harvard precision pump. The infusion was carried out for 60 minutes without anesthesia. Two hundred microliters 15 was infused. Saline was infused into tumor bearing mice as a control. Tumors were measured with calipers and the volume of the tumor was determined by the formula, (a 2 *b)/2, where a is the smallest dimension of the tumor and b is the dimension at right angles to a. 20 A/J mice bearing C1300 tumors of an initial size of about 6 X 6 mm were infused with 125 micrograms of NV129 for 60 minutes. This treatment produced a statistically significant effect on the growth of C1300 neuroblastoma tumors, as shown in Fig. 6. Saline treated control tumors grew to a volume of near 4 mls in 10 days. 25 Example 12 Cloning of NV144 Oligonucleotides encoding a peptide facillitator were synthesized: 30 KLYD-1: 5' GATCCCCGCGTAAACTGTACGACGGTAC 3' (SEQ IDNO:35) KLYD-2: 5' CGTCGTACAGTTTACGCGGG 3' (SEQ ID NO:36) WO 99/32143 PCT/US98/27498 43 These oligonucleotides were annealed and cloned into the BamHI and KpnI sites of NuV127. The resulting plasmid, NuV144, encodes a protein, NV144, with a His-tag near the N-terminus, a thrombin cleavage site, a six residue peptide , a 15 residue 5 flexible spacer, and human TF residues 3 to 211 at the C terminus. NuV144 residues (SEQ ID NO:37) start codon 413-415 (His) 6 tag production substructure 425-442 thrombin cleavage site production substructure 521-532 BamHI production substructure 530-535 peptide facilitator context-enhancing substructure 536-553 KpnI production substructure 554-559 spacer (G 4
S)
3 activity-modulating substructure 560-604 TF 3-211 substructure with thrombogenic 611-1240 potential stop codon 1241-1243 C1300 neuroblastoma cells (500,000) were injected subcutaneously into the flank of A/J mice. After about 7-10 days, the tumors had grown to about 5-7 mm in 10 diameter and were ready for treatment. A restraining device was used in which the mice were immobilized by a vest placed around their trunk and the vest was connected to the interior of a plexiglass tube. The tail of the mice was exposed from one end of the plexiglass tube. The tail was taped to a plexiglass plate and a 30-gauge needle inserted into the tail vein was connected to a Harvard precision pump. The 15 infusion was carried out for 60 minutes without anesthesia. Two hundred microliters was infused. Saline was infused into tumor bearing mice as a control. Tumors were measured with calipers and the volume of the tumor was determined by the formula, (a 2 *b)/2, where a is the smallest dimension of the tumor and b is the dimension at right angles to a.
WO 99/32143 PCT/US98/27498 44 Figure 7 shows the effect of multiple infusions of NV144 on C1300 tumor growth. A/J mice bearing C1300 tumors were infused over a period of 1 hour with 125 micrograms NV144 (also referred to as K5p-TF) on Day 0 and 50 micrograms 5 NV144 on Day 3. Saline controls grew rapidly with the tumors growing nearly to 3 ml in volume within 8 days. A group of 5 muscle-based tumors (triangles) exhibited reduced tumor growth rate whereas a skin based tumor (diamonds) had remarkably slowed growth rate with a secondary tumor appearing by Day 4. The higher dose of NV144 produced better efficacy than the lower dose. 10 In another experiment shown in Figure 8, A/J mice bearing C1300 tumors of an initial size of 7 X 7 mm were infused over a 1 hour period on day 0 with 125 microgram NV144 and again on Day 2 with 50 microgram NV144. Both animals exhibited dramatic decreased tumor growth compared with saline controls 15 (n=5). By day 7 the primary skin tumors were accompanied with large (> 5X5 mm) muscle tumors. The primary tumors developed superficial black necrotic caps by day 1. This is clear evidence for the pharmacological efficacy of NV144. 20 Example 13 Toxicity tests in animals Dose ranging study to identify the acute effects of test protein (TP) is performed in test animals by intravenous infusion of the drug. The maximum anticipated dosage of 25 a therapeutic candidate molecule(s) in vivo is determined in adult rats, rabbits, dogs, nonhuman primates, etc. by an intravenous infusion schedule that mimics the anticipated potential therapeutic protocol in order to observe the acute effects of the drug. 30 A typical experimental design would include the following. Groups of 3 male rats are used for each dose concentration and for each control. The unanesthetized rats are gently immobilized in an approved manner with tail vein immobilized and prepared WO 99/32143 PCT/US98/27498 45 for sterile insertion of the intravenous catheter. The inserted catheter is flushed with sterile physiologic saline (SPS) or lactated Ringer's solution (LRS) at a rate of 20 L/min/100lgBW. The infusion line intercepts the SPS or LRS line and under pump control permits infusion into the catheter of the test material. The control infusion of 5 SPS or LRS proceeds for 10 min. The test material shall be labeled by confidential test number and have been adjusted to five concentrations. The test samples contain differing concentrations in 3- to 10-fold concentration increments. The test material infusion pump syringe connects to the same infusion catheter by a T connector (or needle insertion) taking care that no bubbles are created that could be infused. This 10 permits washing of the line past the point of test material entry. The test material, under confidential identification number and letter designation, is infused at 5 to 200 L/min/100lgBW. The duration of infusion is 0.5 to 120 min. The rats are observed for changes in behavior, convulsions, increase of 15 respiratory rate, or death and each shall be scored. At the end of the designated test material infusion period, the infusion is switched to SPS or LRS for 1 to 60 min. The catheter is then removed and the behavior, respiratory rate, and hemostasis at the tail vein site observed and monitored at 0.5, 1 and 2 hrs after termination of test infusion. A sample of blood is taken at each interval for enumeration of cell types and counts. Each 20 rat is euthanized twenty-four hours later. The abdomen is opened and the inferior vena cava incised to take a blood sample and exsanguinate the rat followed immediately by perfusion through the heart of cold SPS or LRS containing 50 U/ml of USP heparin. The organs (heart, lungs, liver, kidneys, spleen, pancreas, stomach, large bowel and small bowel, adrenal, and brain are removed, cut to - 3 mm thick blocks and fixed in 25 10% neutral formalin. After processing and embedding in paraffin blocks, cutting at 5 microns, sections are stained with Hematoxylin and easin, as well as by Carstair's method for histological examination.
WO 99/32143 PCT/US98/27498 46 Example 14 Inhibition of human tumors grown in human skin implants in immunodeficient mice 5 The ability of the test compounds to eradicate or reduce the size of tumors in test animals is tested as follows in a model using human skin, such as foreskin or breast reduction mammoplasty, or other transplants in severe combined immunodeficient (SCID) mice, cats or other types of immunodeficient animals. The human foreskins are trimmed to an oval of approximately 8 mm x 13 mm and stored at 4 0 C in DMEM or 10 RPMI tissue culture medium containing 10% FCS until surgery (next day). 100:1 of diluted Ketamine HCI (diluted 1:10 in sterile water) is injected intraperitoneally into mouse abdomen. A light plane of anesthesia is induced with metophane and the back of the mouse is prepared by shaving and swabbing with alcohol. After making an incision in the skin, a sample of foreskin is placed within the wound and secured by sutures. The 15 wound is wrapped and dressed. Observations of the growth of the foreskin implant are made each day for 10 days. After 10 days, the bandages are removed. After 4 weeks, the implant is ready to be inoculated with an injection of tumor cells. Three million tumor cells are injected intradermally into the transplanted human skin. After approximately 2 weeks the tumors are large enough to initiate treatment of the animal 20 with test materials. Example 15 Inhibition of tumors grown immunodeficient, SCID, nude or wildtype rodents 25 The ability of the test materials to eradicate or reduce the size of tumors in test animals is tested as follows in a model using xenografts of human tumor cells implanted into SCID or nude mice or of rodent tumor cells implanted into compatible strains of wildtype rodents. Examples of mouse tumors and their host strains of rodents (i.e., mice 30 or rat) include colon adenocarcinoma CT-26 cells into Balb/c mice, C1300 neuroblastoma cells into A/J mice, Hepatoma 129 cells into C3H mice, Lewis lung cells into B57BL/6 mice, and other combinations of cells and mice listed in the Division of WO 99/32143 PCT/US98/27498 47 Cancer Treatment, Diagnosis and Centers (DCTDC) Tumor Repository Catalogue of Transplantable Animal and Human Tumors that is maintained by The National Cancer Institute, Rederick Cancer Research and Development Center, PO Box B, Frederick, MD 21702. Fifty thousand to three million tumor cells are injected subcutaneously into 5 recipient animals and the tumors allowed to grow for 3 to 30 days. Test materials are injected intravenously after the tumors have reached the desired size. Test materials over various concentrations and doses and over different schedules may be administered. Typical doses range between 0.1 gg to 20 mg of test material per kg. Typical schedules range between a course of 3 to 4 doses per day to 1 dose per week for 10 a course of treatment ranging between 1 to 6 treatment cycles. The tumors are measured with calipers and the rate of growth of the tumors are followed before and after treatment to distinguish effects of the test materials on growth. The tumor sites are removed from the mice for histological examination. 15 Example 16 Pharmacologic Effect in Primates Normal, healthy nonhuman primates are implanted in the superficial subdermal tissue of the volar surface of one forearm with pellets, which are approximately 100 20 microns in diameter and containing one or more angiogenic factors, such as vascular endothelial growth factor (vascular permeability factor), basic fibroblast growth factor, etc., in three sets to produce a variation in the maturity of the vessels that are induced to grow around the pellet. As a control, a similar set of pellets containing human albumin are placed in the same distribution in the other forearm. Pellets are permitted to 25 establish local angiogenic networks for periods of 2 to 14 days. The animals then receive test materials given by intravenous injection. At intervals of 0.5 hours to 3 days following infusion of test materials, a 3 mm diameter punch biopsy is taken to include a pellet and surrounding tissue. The biopsied materials are examined histologically for any effect of the test material on the structure of the vessels and compared with the 30 control biopsy.
WO 99/32143 PCT/US98/27498 48 While the invention has been described in detail with reference to certain preferred embodiments thereof, it will be understood that modifications and variations are within the spirit and scope of that which is described and claimed.
Claims (11)
1. A context-dependent functional entity comprising a substructure with thrombogenic potential and one or more context-enhancing substructure(s) having the ability to recognize desired biologically susceptible site(s), wherein said entity imparts thrombogenic activity when positioned in the function-forming-context at said biologically susceptible site(s), and wherein said entity has substantially no thrombogenic activity absent a function-forming-context at said biologically susceptible site(s).
2. A context-dependent functional entity according to claim 1, wherein said entity transiently imparts activity when positioned in a function-forming-context at the biologically susceptible site.
3. A context-dependent functional entity according to claim 2, wherein said substructure with thrombogenic potential comprises a coagulation factor.
4. A context-dependent functional entity according to claim 3, wherein said clotting factor is modified or wild-type TF.
5. A context-dependent functional entity according to claim 4, wherein said TF is derived from a human.
6. A context-dependent functional entity according to claim 5, wherein said modified TF has substantially the same amino acid(s) as set forth in sequence Nos.
35-243 of SEQ ID NO:1. 7. A context-dependent functional entity according to claim 2, wherein said modified TF is modified to increase thrombogen activity. WO 99/32143 PCT/US98/27498 50 8. A context-dependent functional entity according to claim 6, wherein the amino acid at position 199 of SEQ ID NO:1 is a basic amino acid. 9. A context-dependent functional entity according to claim 2, wherein said context-enhancing substructure has a functional preference for vascular structures, specific cells or tissue types. 10. A context-dependent functional entity according to claim 9, wherein said context-enhancing substructure has a functional preference for tumor-associated vascular endothelial cells. 11. A context-dependent functional entity according to claim 10, wherein said context-enhancing substructure orients said entity on the cell surface of said tumor-associated vascular endothelial cells. 12. A context-dependent functional entity according to claim 11, wherein said context-enhancing substructure comprises a cell surface recognition domain. 13. A context-dependent functional entity according to claim 12, wherein said context-enhancing substructure comprises a cell surface recognition domain derived from an annexin. 14. A context-dependent functional entity according to claim 12, wherein said context-enhancing substructure comprises a protease inhibitor. 15. A context-dependent functional entity according to claim 12, wherein said context-enhancing substructure comprises a charged phospholipid-associating element. 16. A context-dependent functional entity according to claim 12, wherein said context-enhancing substructure comprises a kringle domain. WO 99/32143 PCT/US98/27498 51 17. A context-dependent functional entity according to claim 16, wherein said kringle domain is obtained from protein selected from the group consisting of plasminogen, apolipoprotein(a), hepatocyte growth factor, urokinase, coagulation factor XIII, haptoglobin, tissue plasminogen activator (tPA) and prothrombin. 18. A context-dependent functional entity according to claim 1, wherein said context-enhancing substructure is located at the carboxy terminus of said TF, the amino terminus of said TF, between the amino terminus and the carboxy terminus of said TF or inserted in a hydrophilic surface loop of said TF. 19. A context-dependent functional entity according to claim 1, wherein said context-dependent functional entity comprises two or more context-enhancing substructures and wherein said context-enhancing substructures are located at the carboxy terminus of said TF, the amino terminus of said TF, between the amino terminus and the carboxy terminus of said TF, inserted in a hydrophilic surface loop of said TF, or any combinations thereof. 20. A context-dependent functional entity according to claim 1, wherein said entity further comprises a cloning cassette. 21. A context-dependent functional entity according to claim 20, wherein said cloning cassette further facilitates orientation of said context-dependent functional entity on said biologically susceptible site(s). 22. A context-dependent functional entity according to claim 1, wherein said cloning cassette is selected from all or part of a lectin, hormone or ligand for specific receptors on said tumor cells. 23. A context-dependent functional entity according to claim 1, wherein said entity further comprises an activity-modulating substructure. WO 99/32143 PCT/US98/27498 52 24. A context-dependent functional entity according to claim 23, wherein said activity-modulating substructure is selected from a spacer substructure or a protease site. 25. A context-dependent functional entity according to claim 24, wherein said spacer substructure increases degradation of said entity. 26. A context-dependent functional entity according to claim 25, wherein said spacer substructure comprises homo or hetero bifunctional crosslinking agents or chitin oligomers. 27. A context-dependent functional entity according to claim 24, wherein said spacer substructure comprises a ((Gly)4Ser)n module(s) or ((Ser)4 Gly)n module(s) which spaces the context-enhancing substructure and the modified TF. 28. A context-dependent functional entity according to claim 1, wherein said entity further comprises a production substructure. 29. A context-dependent functional entity according to claim 28, wherein said production substructure is selected from a His-tag, a restriction site, vector, or cys residue. 30. A context-dependent functional entity according to claim 1, wherein said context-dependent functional entity comprises an amino acid sequence substantially as set forth in SEQ ID NOs 6, 12, 15, 24, 31, 34 or 37. 31. A composition comprising a context-dependent functional entity according to claim 1 and coagulation factor VIIa. 32. A nucleic acid construct encoding a context-dependent functional entity according to claim 1. WO 99/32143 PCT/US98/27498 53 33. A nucleic acid construct encoding a context-dependent functional entity according to claim 1, wherein said context-dependent functional entity is substantially encoded by the nucleic acid sequence set forth in SEQ ID NOs 6, 12, 15, 24, 31, 34 or
37. 34. An in vivo method to selectively thrombose the vasculature of solid tumors in a subject in need thereof, said method comprising administering to said subject an effective amount of a context-dependent functional entity according to claim 1. 35. A method according to claim 34 wherein said association-dependent functional entity is supplied indirectly by administering a nucleic acid segment encoding same to said subject. 36. A method to obliterate vasculature malformations, said method comprising administering to said subject an effective amount of a context-dependent functional entity according to claim 1. 37. An assembly-dependent functional complex comprising a substructure with thrombogenic potential and one or more association-enhancing substructure(s) having the ability to assemble said complex at desired biologically susceptible site(s), wherein said complex imparts thrombogenic activity when positioned in the function-forming-context at said biologically susceptible site(s), and wherein said complex has substantially no thrombogenic activity absent a function-forming-context at said biologically susceptible site(s).
38. An assembly-dependent functional complex according to claim 37, wherein said complex is transiently activated upon when positioned in a function-forming-context at the biologically susceptible site.
39. An assembly-dependent functional complex according to claim 38, wherein said substructure with thrombogenic potential comprises a coagulation factor. WO 99/32143 PCT/US98/27498 54
40. An assembly-dependent functional complex according to claim 38, wherein said association-enhancing substructure assembles said complex in a function-forming context.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US99674497A | 1997-12-23 | 1997-12-23 | |
US08996744 | 1997-12-23 | ||
PCT/US1998/027498 WO1999032143A1 (en) | 1997-12-23 | 1998-12-22 | Thrombogenic polypeptide chimeras and conjugates having activity dependent upon association with tumor vascular endothelium |
Publications (1)
Publication Number | Publication Date |
---|---|
AU2094199A true AU2094199A (en) | 1999-07-12 |
Family
ID=25543254
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU20941/99A Abandoned AU2094199A (en) | 1997-12-23 | 1998-12-22 | Thrombogenic polypeptide chimeras and conjugates having activity dependent upon association with tumor vascular endothelium |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP1041999A1 (en) |
AU (1) | AU2094199A (en) |
CA (1) | CA2318434A1 (en) |
WO (1) | WO1999032143A1 (en) |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6576610B1 (en) | 1999-10-04 | 2003-06-10 | Nuvas, Llc | Use of a context-dependent functional entity to enhance the efficacy of an agent |
DK1282438T3 (en) * | 2000-05-10 | 2005-11-14 | Novo Nordisk Healthcare Ag | Pharmaceutical composition comprising a factor VIIa and a factor XIII |
AU2001285919B2 (en) | 2000-09-05 | 2007-08-23 | Jiangsu Simcere Pharmaceutical R&D Co., Ltd | Recombinant endothelial cell growth inhibitors derived from a mammalian plasminogen |
AU2002350623A1 (en) * | 2001-10-26 | 2003-05-06 | The Scripps Research Institute | Targeted thrombosis by tissue factor polypeptides |
US7393833B2 (en) * | 2005-03-09 | 2008-07-01 | The Board Of Regents Of The University Of Oklahoma | Chimeric proteins with phosphatidylserine binding domains |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5433955A (en) * | 1989-01-23 | 1995-07-18 | Akzo N.V. | Site specific in vivo activation of therapeutic drugs |
US5877289A (en) * | 1992-03-05 | 1999-03-02 | The Scripps Research Institute | Tissue factor compositions and ligands for the specific coagulation of vasculature |
-
1998
- 1998-12-22 WO PCT/US1998/027498 patent/WO1999032143A1/en not_active Application Discontinuation
- 1998-12-22 AU AU20941/99A patent/AU2094199A/en not_active Abandoned
- 1998-12-22 CA CA002318434A patent/CA2318434A1/en not_active Abandoned
- 1998-12-22 EP EP98965484A patent/EP1041999A1/en not_active Withdrawn
Also Published As
Publication number | Publication date |
---|---|
CA2318434A1 (en) | 1999-07-01 |
EP1041999A1 (en) | 2000-10-11 |
WO1999032143A1 (en) | 1999-07-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Schulte | Half-life extension through albumin fusion technologies | |
JP5022231B2 (en) | Polymer-von Willebrand factor conjugate | |
JP2024123068A (en) | APJ receptor agonists and uses thereof | |
CN103269723B (en) | For couple water soluble derivative of fatty acid and the material and method of protein | |
US10251941B2 (en) | Factor VIIa-polysialic acid conjugates having prolonged in vivo half-life | |
JP5952847B2 (en) | Fusion proteins that bind growth factors | |
JP2019163258A (en) | Bioactive polypeptide monomer-immunoglobulin fc fragment conjugate having decreased receptor-mediated clearance, and method for preparing the same | |
JP5770161B2 (en) | Targeted delivery of factor VIII protein to platelets | |
CN104479006A (en) | Factor VIII polymer conjugates | |
TW201204382A (en) | An insulin conjugate using an immunoglobulin fragment | |
AU1193999A (en) | J-chain and analogues as epithelial cell targeting conjugates | |
JP6755318B2 (en) | Mutant von Willebrand factor | |
JP2001518304A (en) | Fusion protein containing angiostatin component and its use in antitumor therapy | |
BG107613A (en) | Fusion protein from antibody-cytokine-cytokine interaction as a target-specific prodrug | |
US20080193441A1 (en) | Homogeneous Preparations of Chimeric Protein | |
TW201838647A (en) | A conjugate of insulin analog with reduced affinity to insulin receptor and use thereof | |
JP2000506494A (en) | Complexes useful for treating benign prostatic hyperplasia | |
AU2094199A (en) | Thrombogenic polypeptide chimeras and conjugates having activity dependent upon association with tumor vascular endothelium | |
JP2000504218A (en) | Ligand-directed enzyme prodrug therapy | |
Metzner et al. | Half‐Life Extension by Fusion to Recombinant Albumin | |
US6576610B1 (en) | Use of a context-dependent functional entity to enhance the efficacy of an agent | |
JP7016536B2 (en) | Soluble Glycoprotein V for Treating Thrombotic Diseases | |
JP2007533750A (en) | Polymer conjugates releasable under mild thiol degradation conditions | |
NZ615242B2 (en) | Potent and selective inhibitors of nav1.3 and nav1.7 | |
NZ615242A (en) | Potent and selective inhibitors of nav1.3 and nav1.7 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MK1 | Application lapsed section 142(2)(a) - no request for examination in relevant period |