AU2021412922A1

AU2021412922A1 - Use of hrpn-type multi-mimotope epitope ligand protein in foods, cosmetics, health care products or pharmaceuticals

Info

Publication number: AU2021412922A1
Application number: AU2021412922A
Authority: AU
Inventors: Baozhen WU; Boji WU
Original assignee: Kunming Ruiside Technology Co Ltd
Current assignee: Kunming Ruiside Technology Co Ltd
Priority date: 2020-12-31
Filing date: 2021-12-01
Publication date: 2023-08-24
Also published as: WO2022142976A1

Abstract

Provided is the use of an HrpN-type multi-mimotope ligand protein in foods, cosmetics, health care products or pharmaceuticals. The HrpN-type multi-mimotope ligand protein comprises HrpNEcc, HrpNEca, HrpNEcb, HrpNEch, HrpNDaz, HrpNDada, HrpNDasp, HrpNad, HrpNDaf, HrpNEa, HrpNSam, HrpNBag, HrpNPas and HrpNEnt. The HrpN-type multi-mimotope ligand protein serves as a ligand protein molecule having a special structure and which is rich in multiple epitopes (linear and conformation), and can identify, activate and bind to various types of membrane receptors, membrane proteins, information pathways and metabolic pathways of animals in a transboundary mode.

Description

Use of HrpN-type multi epitopic-like ligand protein in food, cosmetics, health products and

pharmaceutical industry

Technical field

The present invention relates to the field of biopharmaceutical, in particular to the use of HrpN

type multi epitopic-like ligand proteins in the recognition and activation of multiple types of

receptors and/or membrane proteins and their signaling pathways across species boundaries and

causing cascade biological effects in the pharmaceutical industry.

Technical background

Molecular biology studies life phenomena at molecular level. It clarifies the essence of various

life phenomena by studying the structure, function and metabolism of biological

macromolecules. The contents of molecular biology research cover the whole process of life.

DNA, RNA and protein are three important biological macromolecules, which are the molecular

basis of life phenomena. The genome determines what life has, the proteome determines what

life can do, and the metabolome determines what life actually happens. Modem life science,

biotechnology and biopharmaceutical, proteomics and metabonomics, in particular, the

development which progresses by leaps and bounds, update the understanding of disease,

diagnosis, prevention, treatment and rehabilitation of the idea, created a new understanding of

new high efficiency safe drug and the new way, make the development of modem medicine into

a new stage, opened up a broad application prospect.

The receptor theory is one of the basic theories of pharmacodynamics. It is an important basis for

explaining the controllable physiological and pathological processes of life, the pharmacological

mechanism of drugs, and the relationship between the structural effects of drug molecules at the

molecular level. Ligand is a kind of signal. Ligand combines with receptor to recognize and

activate. Its only function is to transmit special signals or information which present in the

internal and external environment to cells. Ligand itself does not have direct function. It can't

take part in the metabolism to produce useful products, or directly induce any cell activity, or

function as enzyme.

Cell signaling (cell communication) is the ability of a cell to receive, process, and transmit

signals with its environment and with itself. Signals that originate from outside a cell (or

extracellular signals) can be physical agents or chemical signals. Cell signaling can occur over

short or long distances. The cell signaling of a multicellular organism send and receive

information through communication mechanism and through the signal amplification to cause

rapid cell physiological and biochemical reaction, or start gene activity, and then in a series of

cell physiological and biochemical activities to coordinate all organizational activities. It

promotes the life organism to make a comprehensive response to the changeable internal and

external environment, which contains the tissues, organs, cells, subcells, molecules,

submolecules of the living organism, to build a coordinated growth, development, defense and

metabolism linkage mechanism.

Receptors are a special class of proteins that mediates cell signal transduction by binding a

specific ligand molecule. When a ligand binds to its receptor, the receptor can change

conformation, and then transmitting a signal into the cell. Receptors can recognize some trace

substances in the surrounding environment (inside and outside the cell environment), combine

with them, and be activated, and trigger subsequent physiological and biochemical reactions

through signal amplification system. Receptors are biological macromolecules composed of

proteins, nucleic acids, lipids and polysaccharides in cell membranes and cells. Receptor is a

very general concept in cell biology. It refers to any biological macromolecule that can combine

with hormones, neurotransmitters, drugs, or signal molecules inside and outside the cell to cause

changes in cell function. The signal molecule is called ligand. There are hundreds of different

signaling molecules in multicellular organisms that carry messages between cells and within

cells, including proteins, amino acid derivatives, nucleotides, cholesterol, fatty acid derivatives,

as well as some soluble gas molecules. The receptors that located on the plasma membrane are

called membrane receptors. The chemical nature of them is mostly sugar mosaic proteins.

Receptors located in the cell fluid and nucleus are called intracellular receptors and they are all

DNA-binding proteins.

A ligand is defined as any molecule that irreversibly binds to a receiving protein molecule

(receptor). Ligand combines with receptor to recognize and activate. Its only function is to

transmit special signals or information which present in the internal and external environment to cells. Ligand itself does not have direct function. It can't take part in the metabolism to produce useful products, or directly induce any cell activity, or function as enzyme.

The combination of ligand and receptor is an intermolecular recognition activation process, which depends on ionic coordination bond, hydrogen bond, - stacking, electrostatic interaction, hydrophobic interaction, van der Waals force, etc. With the increase of complementarity and interaction degree of the two molecular spatial structures, the distance between the interacting groups will be shortened, and the force will be greatly increased. Therefore, the interaction and complementarity of the molecular space structure of ligand and receptor are the main factors for specific binding, namely the concept of "structural group" or "epitope" adopted in this invention. The same ligand may correspond to two or more different receptors, and the combination of the same ligand with different types of receptors will produce different cellular responses. The combination of ligand and receptor will trigger a series of physiological activity, regardless of the ligand is endogenous or exogenous. The ligand-receptor binding compound causes rapid cell physiological and biochemical reaction, or start the gene activity, by conduction and transduction, and through the amplification of signal. A series of cascade reactions then take place to coordinate the activities of various tissues, organs and cells, facilitating the unified whole of life to make a comprehensive response to the changeable internal and external environment.

In 2008, Leader et al. first proposed the idea of classifying proteins according to their pharmacological effects to divide protein drugs into four categories: (1) protein drugs that use the enzyme activity to treat disease through regulatory activity of these proteins; (2) protein drugs with special targeting activity. (3) recombinant protein vaccine; (4) recombinant protein drugs for diagnosis. The first and second categories focus on basic protein therapies, while the third and fourth categories focus on the use of proteins in vaccines and diagnostic drugs. After more than a century of groping and tortuous development, protein drugs have gotten more mature step by step and have occupied a pivotal position in the pharmaceutical industry and clinical applications. They have an important impact on almost all disease fields, such as tumors, infections, autoimmune diseases, metabolic genetic diseases, various geriatric diseases and degenerative diseases. They are becoming important therapeutic, preventive and diagnostic drugs in the 21st century. Looking forward to the next 30 years, the wide application of biotechnology with recombinant DNA technology as the core will give protein drugs a broader development space. Recombinant protein drugs will gradually replace non-recombinant proteins.

Recombination modification (in vivo and in vitro) of protein drugs will become more popular.

Protein drug products expressed in mammalian cell systems will dominate. More and more

attention will be drawn to non-injectable delivery of protein drugs. Biosimilar drugs will have a

bright future (Zhu Xun, Functional Classification and Development trend of Protein drugs, China

Med Biotechnol, February 2010, Vol. 5, No. 1).

It has been demonstrated that the recognition binding of ligands to receptors is determined by the

key amino acid residues that make up the linear or conformational groups or epitopes of ligands.

For example, Phenylalanine (Phe, 82), isoleucine (Ile, 83) and Antagonine (Val, 85) of

polypeptide FIGV located at position 82-85 of boFcy2R are key amino acid residues that bind to

bovine IgG2 receptor. Threonine (Thr, 142), asparagine (Asn, 143), leucine (Leu, 144), glycine

(Gly, 148) and isoleucine (Ile, 149) of polypeptide TNLSHNGI linear ligand binding epitopes at

positions 142-149 of boFcyR I are key amino acid residues that recognizes binding to the bovine

IgGI receptor; Moreover, alanine (Ala 98), glutamate (Gln 99), valinee (Val 101), valine (Val

102) and asparagine (Asn 103) of polypeptide AQRVVN at positions 98-103 of boFcyRIII are

the key amino acid residues to recognize bovine IgG1 receptor.

Harpin is a class of proteins encoded by genes in the hypersensitive response and pathogenicity

(hrp) gene cluster of gram-negative bacteria (mostly plant pathogenic bacteria). All harpin

proteins have similar properties and functions including rich in glycine, cystine free, sensitive to

protein enzymes, heat stable and causing hypersensitive reaction reactions on non-host plants.

Hypersensitive reaction (HR) is characterized by rapid and local atrophy and necrosis of the

infected tissues in non-host plants, which limits the spread of pathogens and induces systemic

resistance. HR is a common and effective way for plants to resist pathogen infection. After

nearly 30 years of research, harpin proteins have been proved to induce systemic resistance in

plants. They have become effective biopesticides for plant protection. Harpin proteins induce

disease resistance, insect repellent, stress resistance in plant. They also promote plant growth and

development and increase yield. For example, the patent number CN1687420: hrpNEccs, a gene

encoding HrpNEccs protein as cell signaling factor with multifunctional activity and broad

spectrum resistance in plants.

HrpNEcb protein (GenBank ID: ABD22989.1) encoded by hrpNEcb gene (GenBank ID:

DQ355519.1) in plant pathogenic bacterium Pectobacteriumbetavasculorum, consisting of 370

amino acid residues. It is a non-enzymatic protein with primary structure, secondary structure,

and tertiary structure but no quaternary structure. It is rich in glycine and serine but no cystine

and cysteine with isoelectric point 5.43. Its molecular weight is 36.64 kDa. The HrpNEcb

protein's conserved domain consists of 201 amino acids and is located at the c-terminal of the

protein, 170-370. a-helix structures located at amino acid residues 44-64, 110-118, 139-155,

174-192,221-243,259-260,262-274,276-279,284-285,298-303,313-330,347-349,353-368;

p-folded structures located at amino acid residues 10-15, 255-256; Intrinsically Disordered Proteins (IDPs) located at residues 1-11, 13-43, 67-95, 99-139, 157-174, 197-216, 340-341, 364

370. The HrpNEch Protein (GenBank ID: AAY17519.1) was isolated from plant pathogenic

bacterium Erwinia chrysanthemi (also called Dickeya Dadantii)strain CSCL006. It is encoded

by hrpNEch, (GenBank ID: AY999000.1). It is composed of 339 amino acid residues. Similar as

HrpNEcb, it is a non-enzymatic protein with primary structure, secondary structure, and tertiary

structure but no quaternary structure. It is rich in glycine and serine but no cystine and cysteine.

Theoretical isoelectric point/Molecular weight (Theoretical PIMw): 6.07/34.15 kDa. Its

conserved domain located at amino acid residues 9-334. a-helical structure located at amino

acid residues 39-62, 105-118, 131-134, 147-163, 192-213, 233-245, 268-273; p-folded structures

located at amino acid residues 2-7, 204-205. IDPs structures located at amino acid residues 1-2,

8-11, 13-40,66-100, 131-139, 173-177,339.

Conserved domain is a region with specific structure and independent function in protein, in

particular, an independent stable structural region of a protein composed of different secondary

and supersecondary structures. Conserved domains are also the functional units of the protein.

Different domains are often associated with different functions in multidomain proteins. The

secondary and super secondary structures of proteins are mainly maintained by hydrogen bonds,

including a-helices, p-folds, p-turs, random coils and IDPs structures, etc. a-helix is a repetitive

structure, and the <p and V of each a-carbon in the helix are around -57° and -47°, respectively.

Each helix accounted for 3.6 amino acid residues, rising 0.54 nm along the spiral axis. Each

residue rotated 1000around the axis, rising 0.15nm along the axis. Hydrogen bonds were formed between the adjacent spiral rings, and the orientation of hydrogen bonds was almost parallel to the spiral axis. The p-fold sheet is laterally assembled by two or more stretched polypeptide chains (or several peptides of a polypeptide chain). The serrated lamellar structure is formed by regular hydrogen bonds between N-H and C=O on the backbone of the adjacent peptide chains. IDPs are intrinsically disordered proteins structural regions with a wide range of allosteric effects. As flexible connection regions, IDPs have multiple conformations and motion states. They involved in transcription, translation, cell division, protein aggregation and cell signal transduction, especially in the process of self-assembly regulation due to their high reproducibility, electrification, easy binding, spatial superiority and high coordination.

HrpN-type proteins are proteins encoded by hrpN genes in the "hypersensitive response and pathogenicity (hrp)" gene cluster with similar properties and functions. It includes a class of multidomain proteins with high homology and close evolutionary relatives. They contain multiple linear and conformational structural groups or epitopes-like bound by key amino acid residues. Different domains are often associated with different functions. Thus, we predict the HrpN-type proteins can across species boundaries to recognize and bind multiclass receptors and membrane proteins, activate multiple signaling and metabolic pathways in animal (including human) cells and they can cause multifunctional biological cascade effects. HrpN-type proteins could have a great future in pharmaceutical industry. HrpZ-type proteins could have a great future in pharmaceutical industry. However, there are no reports and applications of above mentioned transboundary recognition and activation of this kind of proteins, especially in animals and humans.

Content of invention

In view of the problems mentioned above, the present invention provides uses of HrpN-type proteins in pharmaceuticals that recognize and activate multiple classes of receptors and/or membrane proteins and their signaling pathways and cause cascading biological effects in animal and human. As a class of ligand protein molecules rich in multiple linear and conformational epitopes-like with special structures, HrpN-type proteins can across species boundaries to recognize and bind to multi-type of animal cell membrane receptors and membrane proteins, activate multiple signaling pathways and metabolic pathways. HrpN-type proteins are a kind of ligand protein with novel function, novel mechanism of action and novel application prospect due to their special multiple epitope-like structure which could induce multi-directional, multi level and multi-aspect biological effects and functions in animal and human. We call these

HrpN-type proteins as multi epitopic-like ligand proteins according to their structural and

functional characteristics as well as their ability to recognize and bind to various types of animal

cell membrane receptors and membrane proteins across species boundaries, and subsequently

activate multiple signaling pathways and metabolic pathways. Biological effects mechanism of

Harpin proteins against disease: Harpin proteins can identify and activate various types of

receptors and/or membrane proteins and their signaling pathways through spraying, oral or other

drug use, and induce response biological effects through information transduction and

transduction, resulting in the regulation of response metabolic function or physiological function

and its products, and participating in the prevention and treatment mechanism of biological

effects of related diseases and conditions to achieve therapeutic effects.

Use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products or

pharmaceuticals that recognize and activate multiclass receptors and/or membrane proteins and

their signaling pathways in human or animal cells and cause cascading biological effects.

HrpN-type multi epitopic-like ligand proteins contain one or multiple structural groups or

epitopes with hydrophobic nonpolar amino acid residues, contain one or multiple structural

groups or epitopes with polar uncharged amino acid residues, contain one or multiple structural

groups or epitopes with amide polarity uncharged amino acid residues, contain one or multiple

structural groups or epitopes with acidic positively charged or basic negatively charged amino

acid residue. The Hydrophobic nonpolar amino acid residues include valine, leucine, isoleucine,

alanine, phenylalanine, and methionine residues. The polar uncharged amino acid residues

include serine residues. The amide group polar uncharged amino acid residues include

asparagine and glutamine residues. The acidic positively charged and basic negatively charged

amino acid residues include aspartate, glutamic acid, lysine, histidine and arginine residues.

Hydrophobic non-polar amino acid residues, polar uncharged amino acid residues, amide polar

uncharged amino acid residues, acidic positively charged amino acid residues and basic negatively charged amino acid residues accounted for 62.3%-73.7% of the whole sequence of HrpN-type multi epitopic-like ligand proteins, 61%-74% in the conserved domain and 66.2% 79% in the a-helical structure. These structural groups or epitopes containing hydrophobic non polar amino acid residues, polar uncharged amino acid residues, amide polar uncharged amino acid residues or acidic positively charged amino acid residues and basic negatively charged amino acid residues accomplish complementarity, interaction and specific recognition, activation and integrating of molecular spatial structure and electrical properties of ligand and acceptor through hydrogen bonds, ionic bonds, hydrophobic, non-polar, polar and van der Waals forces. They can form tight binding surfaces or form complexes with multitype receptors in proteins. They can cause changes in the conformation, energy, electric property and structural information of receptor molecules, and lead to amplified cascade biological effects through signal transduction.

HrpN-type multi epitopic-like ligand proteins include (but not limited to) HrpNEcc, HrpNEca, HrpNEcb, HrpNEch, HrpNDaz, HrpNDada, HrpNDasp, HrpNad, HrpNDaf, HrpNEa, HrpNSam, HrpNBag, HrpNPas, HrpNEnt.

Bioinformatics analysis results revealed that homology of these HrpN proteins is high (60% to 99% identity).

The homology comparison of HrpNs:

CLUSTAL 0(1.2.4) multiple sequence alignment

I I I I I I I I I. I I I I II Il I Ii Ii i II iIIIII IlII 4 N.rtrtN 0rr N Hrr . m. H.r.H. w. H.H.H. P. r. H. H. r. N. [ oD owo o j oor r ro 0 crrrpD. oDo ow D 0 rDPrrpHrorpD. i h i F iF IF~F-H riri rprr r phrPhj1 ~ a ~ ~ 11 0 aP )I I (V aCa QQCOQQHFMI 11111 R o rrr ro rr rr rr rr o a r r rr rr rr rr H< krkHpk H i H~' p H rp Lzr H HH H OH H~ ' H HA H H 11 1 11 L~c~Hrp 1 p H Fl11 (P

oOo om or ru P. a QOMhH-I11I1* n u Ed a EdptoP po H F-' H) rtI-1oHht h1I-m1w phOH p r_ m p O p wpo D p P.p o r iP p pw pwp rapP wpP LotO o V L'r . ti o Pioo oo Lo L0 aLO ~ . jr

w hi AhA 0AHM n1AH

1 Ta2 C3 r -3Pi 0 I I I 0 0 w 14 Ho artIr 00 0 0 00

oo|Aoo M1 00 00 k ao~ 000000o

CO C0 CCO00

v' 0 a 00 F-i ri o(n a QQ WL au I

o oPnor ooMmL aaaaaaa623WU 2 tq33B n i 1it wgn S S

w Zw rlR( pa LO~L LUOf [O LOL oLoa o V HlratrH-cHrH-dH H d1 1 1 11 puPHVH 1

0H|| | | || |1 IHI | | | | | | QihQ Q 0ihiQ 1

w w w p w a tLCL EDt I I1111111I SSI i || Ie || | | | d s d s " I is a

LQ H

t H IoIII

Q tLQ tQLQ I

Lo Lon IH

LQ LQ kIkRLKIU Lo'Lt Ci | | | || 1 m rl-m -l-

Q Lt~Q L L om- C

tQQ LPJwFP tLLQ Lo j .HH H HH HH 4 m i 4Q Q OXQ 0 Q IQ Q Q HHlH9 i m I H H Hl H1 H l 1 HHIl |1 |m . cor0f0t or0[A D or0t . or0t . 1111 I I I LLQ h- F-H- H!Q r LQ [a FQL QL u Iv r r r

LQ LQ a tLQtQ fl HtLQHu Ed m FJJLQ IEd IwH H H r WL t H H H Ih Q-u HH - H~ IQ QLtu 0.~ I IQ IQ IQLLL 11 11 1 IHHHHHIQ Q II F-Q Q'd'd d'dr4 N HH B 1 I111 It QaLLQt tLQ L E I La La aaa LL La I LQtLa Lo ALULawp) iAQ C1L 1~LttWLt L ot wwQLQI Q QQ LntnaaLu nti aL I aRHHHHH q w 1111111. . tLQ L L aLQ LPLQt Q I OL O OL L~~~O L Ct j L - -, ,p Lq CLQ LL tLt Q C [Lu Ediu

[A-Hr (hi [Ar u I IIH Lq LQLQLQ Lqt LQtQ 11111 H-I 1 11 11 1 t I~H~ H H- HH, Q - - - I I I11I1I1 a11 11 Q ILQ -LqL Q QLQtLQ rv 1 L211 I 11 1 1 1 I 11111111 i I II IFMP FJJFMM[UloI<L I11 I1I1 I ItLqt LPI 111 11 11 11 1 In4InI 11 111 I I ii lii 11111111111 IHHHHHH HU I1111 I~ 11 1 11 1 pliipi ,

Lq~ I I I tHI II 1111i i i ii i i i i i Vuto

LqtT IH I1 1 111I1I I 1 It LQ uI 111 1 1 1I ~r~r~uA I II II I urururaruj 0 j ut Q 111 riI IQLJu E L ap E 0 O IH I1I11 I 11 11 1 w mL m~lhhhf-LFVHHL L aLDLUPi LOUwPiLww

HH HH~ I H 1 I III I I rh q1 LqL fl L~~~~1 Qt!LC I I I Iq I I In A 4iiu f p Q dt auE o[ 1 1 1 ~ FI- hl-i Lo W 10 r 0p pHp pr InUaL HHHHHHw I T-HHHI 1 1 1 I )0pP

f f f 1~ll tn l ~6I pI l t t t t 1 CPLq hM Oh Q q Q Q QL Q G ~ W Q qLQ WW0 Lq qL q Q U LQ LU LQ Edt [aU ~aLLOL E l[ w cr ct rr t crr~r ct r H HnIrtw;r;5'A'D ;IV"PV'LO r Cr rC rrCCr N: H H-;IV PVL PVIV D PV ;-WLa COODOCDC LULIOIFmDIFmDHD. mCmOCDCCCLIwULIDIDmIDImIH 0 M O

H1-dHHHHHHI--H Vi h w l < i H DLiIIP H I--h HH i ldh-H- Hl hF < w "'I H ID H

11 11 1 rLQ ri ri H. oD PU 2c11 1 tLUQIt r rjH P. 0D LU rl It w w w H0 FD w H ID (D tH H H H- IwFPF w V: r

LuI O O Q co ID tI IILaI OOQcD I-I-t H P

H 1 Cr Cr1. H H~II IH- HHI IIHHCO lH qqqq a IaRIC Ln CO 0 0 0 a 0L LI A CO ULULa LUU 'LaI

U)H HH LIO I CHH HHLOLII 0 [A

I-' 11 1 11 lTlaL'Q I-~l'1 11 111 C 12 C " r LpLI L 0DI aC a aL L aLawI LLIIC iULItwI LQ

Ht -J Cr CO H -QCr CO QL Q Ct t m pL C0L PQL

ILNNL 411111111 111 111 LNWWWLN QLLNU 1 1 1 1

111111 1 I~rN 11111 11 tOLQCD DULLLOW IDLNO I II II HIH 1 11 IPC I HH H I HHHHHH - h11 - - 00QQ HitLDUI 1 11 EaLOLOULOLOU nCrLUNDLK ;51W~W U r mO W NL wfJLOL 111111 QQQ :jurr w 1 LUULLUUL LULUL WWW LUj WQ LuN LO LOL L Q L OLQL 11111111 Q Q

QO u u uNQuQUQWH P'L~a KN CLu Q u LOLQLLL Q WL I Q Il 11111111f I FLQ L L L Q CrWQ L I 0--l---NNN OLLOOLLO Q LUIN , - ,HI I 111111111Q Q I Q L LONONLLOU~HL LLNULLLN c OL 1111 INL 1 11 1 01111111111 LII Cr NLWL - qUuLU~ QU LD 111 QO LQtD 1 I1 CDM

HHH H~H' HLH HV LU~ FIHIHh LU LUQ OL LQj QUL IIQ I Io Ia I I I UN N- -N QHH ID N-O mWWCDOC cN toL IN N N III I

I wDDFDIII !LP tUoU LP N-N-I L LLL LL nLq QWL IWFWUII N-DONC--LWD~O0 0 0 0 00CrN .. HHVHHHI-' q I it P itwV uNNL I I I IHI Nuu HuI I QI Luj Lull I HHHHHHQ4 L HP H tFL HHH HHH I-,LLON OW I I I I I 1 L 1W 4 4WLOWLOOL4Oq 'N C WLOOPLOPWWw ILa LuLu LU LU Lu LuL LU (L IL UL CI IN wPQ

Q1111111Q L ILUN - I IHHWH 5 HLUH LOWLUULULuI II IN- IWOL U1

;511 11 1 r;r vHpi, H HHHHHLa a L H LaLLOOO (N ILOILLOOLUOLL 0 QQ qraq I INNt NtC IN IN I LLD~L~rI I I ILaIAti i i N In I a It a IItLLWLW w w m N11111111111' HH HHpl 4LULULUWNWW I I III 1 Ita ( LtoA[A0' 11 1 a10a110a A IN N NN - JO WW LOW Q LULUNCQ I ImI I1I 1111

HH H HpOlCD HN HH HH 111Q1 QIQHQQHmH IHII I HF-I q-FLHI0' q- W N A- HH AH LacaLa[aLa11A-11 I WW 1111111,II

"WIN 0 mO00wLwmmCOk - - C) rOL PI NN N NL 11 11 1 ILURL O OLOL L H I 11 1111

00 00 0 w0 0000D 00 r VF D 00 0 0 0 0H W 0 FDO0Q0OHO00

0p 000P. 0V101 1 11 14 00 00 0 0 11111 P r 14 141 104 H~~~ HHPHH. H1H1H0 0. H H H H L 0~<0H0 I 100 HF~ l~HV H H~' OH HO) H VVVHVVVO H VEH FlO'<HHF1F l lF H LA) HlHNFl pt

111 111 w PO;t P, 0 10 11 1D1 H P,0 w ; P0V010 10 0 VO V 0 tI000 OCP.0 r 0 0 V V t? 0 111-0 I 0 tHHH HHH H p 101 P- 10 V ;HH HH V ; a;H u

u0 0 00 0ItI t' t 0I I It It It000 0 c I P) 0 4H H r) f A10 O H H H j C L

Itc It

0OCD 0 P. CD

CD P.HH CD

00 Cl0 0

I I n InI I I

[fA nln 0

P0 C CD 0

*.HO~ VVVV HHVH VVH HPH 0----- 000 -0000 QOLALA0 Q:Lq

*v LAAAAA L 0 010 1010w0w0w01010w w 1caW 100000111 100110011 H ;Ft t IH VwHaPLL -uu ' 1000000111111 .. HH VV 0-0 Hv Hv L .LLLA) ALO wAAAAA0011111L .. H H ) HH wH HHHHHHHHw ww .. HH HH C) HH HH HH HH 0 0 LA 0Qj j LAW WOLOLwOLAwwLALALAj .LL4LLLL - IA - -j - -j j LALALP.P.LA "'QLQ Q o .0 00 0 LA 0 0 00000000Q Q Q10000000 Q ,Q q4 44 IQ10 q I 10u010101010101: :j 0 01010101 010j .LLLLLLLLL LLAWWLALALALALALAO:j

1 0 HHHHHHH C) HH H HH H H HHH HHH )H HHUHH HHF .0000000 00001111000 100110011 r r r LA k WA 1 000LaL AAA1 A ..u VVu 0 0 uA 0u0 0 00 0 0 wOOLLLL w0 wLLLL wL[O[LLOLau VVOL0.V H r00Ir~ iApiALALA, Hr Hr H- t 0H 0001 ~~ uA 0 . 0 " 0 Il '' ' 'LAO 1111111.1.

*r 1010101001010LA0101010ALALALAAL LAW I 11111 1 1V1 11111111II II 0 0 1 .1 1111111 QIuz 0,0''''0L'11100 ILLL IQ11 11414 1 1 11 H 1 11 1 0 00 0 11 4 11 1 ULLL M11111111QQLQLQ

1 0 H HH HH AH HH HHH HH 1 11 11 IL LAV 1111111

10000111 LA1LAA1 101010o1010101010 I II I LH 111 11 *00---00 0-LA 0.-.0000--01000 P1, 111 11 11 NI NI l l l Iw NI l l l l l l - HHHHHHDrDr D prpr , Dr rv HH HHH HH 0 1111 0111111111q - I L aLaL L a aL H- H H-H- H H-H- F HLHA - 1 H. LA 100 11H1 11 H. HHI , - 1111 11 LP~ HH1 ~ 111P11 I0. Q111PQQ111QQQ11 QL L QQLP

LOWWWLL 0000000LQ LOALLOOLWLWA 44 j LLL L LA 00W 100Lo011 LoL

PV c . p H p P. . Q LAW LA LA LA LAW LAQ LAW LA LA LaWQ LA LAW LOa

HQ LAW LA LA LA LA LA 0.LA 4444 4444 LA LA LA LA LA LA LA *11110 10 10101010R -g ,10010 10 101010 .1110001 lhl hl hLA - 10101010101001001010 -hFh F H HQ HDHQH4 4HH11 0HH HHH 0H . LALALALALALALA LAAAALLL1LAAA0 *F0- t Ili ~ t~HHo~~~ 10000111 Q IQ 4 4 Q IQIQ 101040I1IQ01t *LLLAAALL LaAAAAAALLLLLL L L L L L LA 0 L HQ 10 L L L L L LL1 LALALAALALALLALA)V m 1010010101w10w 0 0.0.0.101010101010100.

.. 0001111 "10 00 00 LA mL m4 .4 0-j WW 10 L01 0000 ,HHHHHH-j - 0doNHH w I~0 ghL4LALALALA0LOLOWWW 0 jA-j LALALAmLAL

Ia to IaIa to Io IaIa Iz I m Ia Ijt jt I o I to I oI aI oI I m Im II Ij Id II II Ij lo p ( oFl p PFPP ro lP [A w P.P.HPHL.IF-. . L r rprrpPrp P[PHr [w P. PHHHH.LIHH.P. cr rrr r r rr L [Ar HP.r-~l~r P ,A v 5 5 La'Vt u rr rct rtrrrtL [ HP.c A PV A, A, rp W V tou COCC LIwCI uL o rulp rPu[HA(F rp L 0 0COOLICLILILIjuwIL0lm 0 m mH 0 PQa Lupu [AH curuP.u l< k<l<L<~~Luu <w uli ut~ 1rurly Or Or ty[mI-r P. 0 < < < < o 4 <

lH- HH-HHHH - [ H ~<[ LI' wA F1i [A H H H 1H-H HQ W [A HF1 F1~ W A F1 D wA

1 11 1 LCt Ph,HID 111 111 t1wILILHLi Lu 1 " l r O

Ht-[ Fl-HFlAFF-L I rH P r! H t [A[H[H[Al [AH F AH1 IrHr 0-'a L OOIOF'L 0 Lu OO LCILHL Lu 0 wLu

[a urur t rtut ~ tou H F-' Lu 0

[LaF1F1lLu1l - I Hr Ht Ht L

Pi Lw w r-CLLLL L i

nA ~ IH III I L[A 0A[A[[A LiI f[[[[[[A L Li l , - j 14LIIL H- NF -'L jL LLLIF C 0 M on 'm' C

OQ L SLQQ S~ LQ Qw 0QQQ I F-' IjII pIp- to I P I

H1H' -H MOOF H J CO )wX , ,KKA P. P. P. P. Pi PHP'P . .P

Pr N- H, H5 IQ Lu Lu Lu cu Lu Lu Luz Lu Lu ,

La r,~ ~ ~L to Ea1 [AwwwL jw[A) j0 ju LI- mlf-f-l wD mD [A p P fl p0 p pP) p-fl-fllr-mfml Lu w I 010101010QLQLQ Q L CL- LQ rQ Q c I10 L

Lu i 5 5 ;- - s LI L LIOOQL OLQ QI 0Q LLL Ea

HHHHHH i HH HH HH HH

' LO ww wi w11 w-L wA1w w w w w LuQ

Lu~ ~ ~ ~ ~ ~ ~~~~~~~~~~~~L Lu LuQ LuL uiuLL uLQuIL ILL u*1111111 1111111111111 hF~~~~ 111 11,uI ILp:IL II I 1i~~~ Z'11~ii i ~~~~

101010Q1Q101010() Lu Lu Lu Lu Lu Lu Lu Lu L L LuQ u u utHOiL.uQ~.L~ M RLQLQ-L-L- L I- QLQ QID QD flL-flLI-LI-RLL-L LLQ wOw w w w w La a La Laww Pi w)ww E

9, n ww ww ww LomuL u u-u u u u u-u0u m0a.[aa a aa a . [Ar, L i-- - HHH[ N A 0

HrpN Phylogenetie Tree:

Iz Iz I Iz I Iz I Iz I Iz I Iz I Iz I Iz I Iz Iz I

T-0-0 -0 -0 T -' oW 00m0r

o5 o9 F,~~ = -, 0D0 C C

.: 0

* LAi i 0

11111 Qn §Qmno "- . - -L cc

~~c6o coN

HrpN-type multi epitopic-like ligand proteins are rich in multiple linear and conformational

structural groups or epitopes which are functional groups composed of key amino acid residues.

Those function groups can recognize and bind with cell membrane receptors and membrane

proteins. The functional groups are composed of the amino acid residues including rich proton

donating or proton-receiving amino acid residues which can recognize and bind the receptors on

membrane. Furthermore, they contain one or multiple structural groups or epitopes with

hydrophobic nonpolar amino acid residues, contain one or multiple structural groups or epitopes

with polar uncharged amino acid residues, contain one or multiple structural groups or epitopes

with amide polarity uncharged amino acid residues, contain one or multiple structural groups or

epitopes with acidic positively charged or basic negatively charged amino acid residue.

Furthermore, they are rich in protone-donating (except methionine residues) or protone-receiving

(including methionine residues) amino acid residues: glutamic acid, aspartate, lysine, histidine,

methionine, serine, threonine, tyrosine, arginine. They can recognize and form tight binding

surface or complex with the corresponding amino acid residues of multitype receptor proteins in

the way of hydrogen bond. Furthermore, hydrophobic non-polar amino acid residues: valine,

leucine, isoleucine, alanine, and phenylalanine can form tight binding surfaces or complexes

with multitype receptors by non-polar hydrophobic and van der Waals forces. Acidic positively

charged and basic negatively charged amino acid residues: aspartate, glutamic acid, lysine, and

arginine can form tight binding surfaces or complexes with multiple types of receptors through

ionic bonds. Amide polar uncharged amino acid residues: asparagine and glutamine can form

binding surface or complex with the cysteine recognition region of the receptor Pam3 CSK4 by

strong hydrogen bond. Polar uncharged amino acid residues: serine forms tight binding surfaces

or complexes with multitype acceptors by strong hydrogen bonds through polarity.

Furthermore, the complete sequence of HrpNEcb multi epitopic-like ligand protein contains 370

amino acid residues, including 226 key amino acid residues: 94 hydrophobic non-polar amino

acid residues, 41 polar uncharged amino acid residues, 44 amide amino acid residues, 47 acidic

positively charged and basic negatively charged amino acid residues. The key amino acids

accounted for 61% of the whole sequence. The conserved domain of HrpNEcb contains 200 amino acid residues. 138 of them are key amino acid residues including 51 of hydrophobic nonpolar amino acid residues, 19 polarity is not charged amino acid residues, 28 amide group amino acid residues, 40 of acidic positively charged or alkaline negatively charged amino acid residues. The key amino acids accounted for 69% of the conservative domain. Alpha helix of

HrpNEcb protein contains 71 amino acid residues and 52 of them are key amino acid residues,

including 27 hydrophobic nonpolar amino acid residues, 7 polar uncharged amino acid residues,

8 amide amino acid residues, 10 acidic positively charged or basic negatively charged amino

acid residues. The Key amino acids account for 73% of the a-helical structure. Furthermore, we

have cloned and overexpressed HrpNEcc, HrpNEca, HrpNEcb, HrpNEch, HrpNDaz,

HrpNDada, HrpNDasp, HrpNad, HrpNDaf, HrpNEa, HrpNSam, HrpNBag, HrpNPas,

HrpNEnt proteins from a number of bacteria belonging to the genus Pectobacterium (also called

Erwinia) and other genera.

According to the bioinformatics analysis of these HrpN proteins, they have similar structural

features, structural evolution trend, high homology and multiple conformational epitopes and

linear epitope structure similar to the multi epitopic-like ligand protein HrpNEcb. They all

contain one or multiple structural group(s) or epitope(s) with one or more hydrophobic nonpolar

amino acid residues, one or multiple structural group(s) or epitope(s) with polar uncharged

amino acid residues, contain one or multiple structural group(s) or epitope(s) with amide group

polar uncharged amino acid residues, and one or multiple structural group(s) or epitope(s) with

acidic positively charged and basic negatively charged amino acid residues. Hydrophobic

nonpolar amino acid residues include valine, leucine, isoleucine, phenylalanine, alanine,

methionine. Polar uncharged amino acid residue is serine. The amide group of polar uncharged

amino acid residues include asparagine and glutamine. Acidic positively charged and basic

negatively charged amino acid residues include aspartate, glutamic acid, lysine, histidine,

arginine. Furthermore, the key amino acid residues described above accounted for 62.3%-73.7%

of the whole sequences of these protein molecules, 61%-74% of the conserved domains, and

66.2%-79% of the a-helical structures. Furthermore, HrpNEcb can realize the complementarity,

interaction, specific recognition, activation and binding of ligand and receptor molecular space

structure and electrical properties through hydrogen bond, ionic bond, hydrophobic, non-polar,

polar and van der Waals forces. The formation of tight binding surfaces or complexes with multiple types of receptors could cause changes in the conformation, energy, electricity and information of receptor molecules, and lead to amplified cascade biological effects through signal transduction.

Furthermore, the complete sequence of HrpNEch multi epitopic-like ligand protein contains 339 amino acid residues, including 236 key amino acid residues: 106 hydrophobic non-polar amino acid residues, 40 polar uncharged amino acid residues, 42 amide amino acid residues, 48 acidic positively charged and basic negatively charged amino acid residues. The key amino acids accounted for 69% of the total sequence. HrpNEch conservative region contains 326 amino acid residues, including 226 key amino acid residues: 99 hydrophobic non-polar amino acid residues, 40 polar uncharged amino acid residues, 40 amide amino acid residues, and 47 acidic positively charged and basic negatively charged amino acid residues. The key amino acids accounted for 69% in the conserved region. The HrpNEch a-helical region, contains seven a-helices, twop folds and seven IDPS-structural regions. In the a-helical region, there are 100 amino acid residues and 71 key amino acid residues, including 35 hydrophobic non-polar amino acid residues, 12 polar uncharged amino acid residues, 13 amide amino acid residues, 11 acidic positively charged and basic negatively charged amino acid residues. The key amino acids account for 71% of the a-helical structure. Furthermore, we have cloned and overexpressed HrpNEcc, HrpNEca, HrpNEcb, HrpNEch, HrpNDaz, HrpNDada, HrpNDasp, HrpNad, HrpNDaf, HrpNEa, HrpNSam, HrpNBag, HrpNPas, HrpNEnt proteins from a number of bacteria belonging to the genus Pectobacterium (also called Erwinia) and other genera. According to the bioinformatics analysis of these HrpN proteins, they have similar structural features, structural evolution trend, high homology and multiple conformational epitopes and linear epitope structure similar to the multi epitopic-like ligand protein HrpNEch. They all contain one or multiple structural group(s) or epitope(s) with one or more hydrophobic nonpolar amino acid residues, one or multiple structural group(s) or epitope(s) with polar uncharged amino acid residues, contain one or multiple structural group(s) or epitope(s) with amide group polar uncharged amino acid residues, and one or multiple structural group(s) or epitope(s) with acidic positively charged and basic negatively charged amino acid residues. Hydrophobic nonpolar amino acid residues include valine, leucine, isoleucine, phenylalanine, alanine, methionine. Polar uncharged amino acid residue is serine. The amide group of polar uncharged amino acid residues include asparagine and glutamine. Acidic positively charged and basic negatively charged amino acid residues include aspartate, glutamic acid, lysine, histidine, arginine. Furthermore, the key amino acid residues described above accounted for 62.3%-73.7% of the whole sequences of these protein molecules, 61%-74% of the conserved domains, and

66.2%-79% of the a-helical structures. Furthermore, HrpNEch can realize the complementarity,

polar and van der Waals forces. The formation of tight binding surfaces or complexes with

multiple types of receptors could cause changes in the conformation, energy, electricity and

information of receptor molecules, and lead to amplified cascade biological effects through

signal transduction and transduction.

Multifunctional cascade biological effect refers to the significant differences in the expression of

functional gene groups related to cellular components, molecular functions and biological

processes in different organs and tissues. Expression of those related functional gene groups

showed significant changes including cell components (cell, cell junction, cell part, extracellular

matrix, extracellular matrix component, extracellular region, extracellular region part,

macromolecular complex, membrane, membrane part, membrane-enclosed lumen, organelle,

organelle part, supramolecular fiber, synapse, synaptic part, etc.), molecular functions (binding,

catalytic activity, chemoattractant activity, chemorepellent activity, electron carrier activity,

metallochaperone activity, molecular function regulator, molecular transducer activity, nucleic

acid binding transcription factor activity, signal transducer activity, structural molecule activity,

transcription factor activity, protein binding, transporter activity, etc.) and biological process

(behavior, biological adhesion, biological regulation, cell aggregation, cell death, cellular

component organization or biogenesis, detoxification, developmental process, growth, immune

system process, localization, locomotion, metabolic process, multi-organism process, negative

regulation of biological process, positive regulation of biological process, regulation of

biological process, presynaptic process involved in synaptic transmission, reproduction, reproductive process, response to stimulus, rhythmic process, signaling, single-organism process, etc.).

The amino acid sequence of HrpNEcb multi epitopic-like ligand protein is shown as SEQ ID NO:1. The amino acid sequence of the HrpNEch multi epitopic-like ligand protein is shown in SEQ ID NO:2.

Preferably, the HrpN-type multi epitopic-like ligand protein is HrpNEcb multi epitopic-like ligand protein. It recognizes and binds multiple classes of receptors in cultured mouse liver cells including LRRC15- Leucine-rich repeat-containing protein 15 receptor, HLA-A major histocompatibility complex, class I, A, LGALS3BP galactose-3-binding protein receptor, LAMP2 lysosomal associated membrane protein 2 receptor, GNB2 G guanine nucleotide binding protein subunit Beta 2 receptor.

Preferably, the HrpN-type multi epitopic-like ligand protein is HrpNEch multi epitopic-like ligand protein. It recognizes and binds multiple classes of receptors in cultured mouse liver cells including GNG12 guanine nucleotide binding protein y- 12 receptor, ANXA5 annexin A5 receptor, ANXA2 annexin A2 receptor, ANXA1 annexin Al receptor, IGHG2 Immunoglobulin double constant y2 receptor, IGHM immunoglobulin double constant Mu receptor, CACNAlS calcium voltage-gated channel subunit alS receptor, ZNF185 zinc finger protein 185 receptor, and HLA-A major histocompatibility complex, class I, A receptor, LAMP2 lysosomal associated membrane protein 2 receptor, GNB2 G guanine nucleotide binding protein subunit P2 receptor, KTN1 kinectin 1 receptor.

Preferably, the HrpN-type multi epitopic-like ligand protein is HrpNEcb multi epitopic-like ligand protein. It recognizes and binds multiple cell membrane proteins in cultured mouse liver cells including DSG4 desmosomal core protein, ANXA4 annexin A4, CAPRINI cyclin, 1UTRN dystrophin, Pinin desmosomal protein, VAMP associated protein A, VCL vinculin, Ezrin Ezeze- epithelial cadherin, and PKP3 plakophilin, TM9SF2 transmembrane 9 superfamily member 2, NAALAD2 N-acetylated a-linked acid dipeptidase 2.

Preferably, the HrpN-type multi epitopic-like ligand protein is HrpNEch multi epitopic-like ligand protein. It recognizes and binds multiple cell membrane proteins in cultured mouse liver cells including DSC3 desmocollin 3, ANXA8/ANXA8Ll annexin A8/ annexin A8 Like 1, EVPL envoplakin, POFIB actin-binding protein, CTNNA1 catenin alpha 1, TGMI Transglutaminase 1, BAIAP2 BAR/IMD domain containing adaptor protein 2, RAB29 RAS oncogene family member, CLDN19 claudin 19, STXBP2 syntaxin Binding Protein 2, VAMP vesicle-associated membrane protein-associated protein A, VCL vinculin, Ezrin Eze-epithelial cadherin, PKP3 plakophilin, NAALAD2 N acetylated a-linked acid dipeptidase 2, PKP1 platelet-affinity protein 1, SPRR IA small proline rich protein 1A.

Preferably, the HrpN-type multi epitopic-like ligand protein is HrpNEcb multi epitopic-like ligand protein. The cell membrane proteins recognized and bonded by HrpNEcb participated signaling pathways in cultured mouse liver cell membrane including hsa04152 AMPK signaling pathway, hsa03460 Fanconi anemia pathway, hsa0332: AMPK signaling pathway. PPAR signaling pathway, hsa04071 sphingolipid signaling pathway, hsa04014 Ras signaling pathway, hsa04151 PI3K-Akt signaling pathway, hsa04310 Wnt signaling pathway, hsa04062 chemokine signaling pathway, hsa04015 Rap1 signaling pathway, hsa04024 cAMP signaling pathway, hsa04915 estrogen signaling pathway, hsa04910 insulin signaling pathway, hsa04390 hippo signaling pathway.

Preferably, the HrpN-type multi epitopic-like ligand protein is HrpNEch multi epitopic-like ligand protein. The cell membrane proteins recognized and bonded by HrpNEch participated in 22 signaling pathways in cultured mouse liver cell membrane including hsa03320 PPAR signaling pathway, hsa05120 epithelial cell signaling in Helicobacterpyloriinfection, hsa04071 sphingolipid signaling pathway, hsa04014 Ras signaling pathway, hsa04151 PI3K-Akt signaling pathway, hsa04070 phosphatidylinositol signaling pathway, hsa04010 MAPK signaling pathway, hsa04310 Wnt signaling pathway, hsa04062 chemokine signaling pathway, hsa04015 Rap1 signaling pathway, hsa04024 cAMP signaling pathway, hsa04915 estrogen signaling pathway, hsa04910 insulin signaling pathway, hsa04390 hippo signaling pathway, hsa04922 glucagon signaling pathway, hsa04912 gonadotropin signaling pathway, hsa04022 CGMP-PKG signaling pathway, hsa04921 oxytocin signaling pathway, hsa04722 neurotrophin signaling pathway, hsa04723 retrograde neural signaling pathway, hsa04066 HIF-1 signaling pathway, hsa04020 calcium signaling pathways.

Preferably, the signaling pathway includes metabolic signaling pathway, which includes

antiviral, anti-bacterial, anti-foreign body and anti-inflammatory metabolic pathways; includes

metabolic pathways of important neurological diseases; includes nucleic acid, protein, amino

acid, sugar, fat metabolism pathway; includes cell connection, nerve connection, vascular,

endocrine, reproductive system metabolic pathways.

Preferably, the HrpN-type multi epitopic-like ligand protein is HrpNEcb multi epitopic-like

ligand protein. The cell membrane proteins recognized and bound by HrpNEcb in cultured

mouse liver cell participated in antiviral, anti-bacterial, anti-foreign body and anti-inflammatory

related KEGG pathways including hsa04144 endocytosis, hsa04145 phagosome, hsa04142

lysosome, hsaO1130: biosynthesis of antibiotics, hsa05131: shigellosis, hsa04612 antigen

processing and presentation, hsa05130 pathogenic Escherichia coli infection, hsa05100 bacterial

invasion of epithelial cells, hsa05132: Salmonella infection, hsa05169 barr virus infection,

hsa05168 herpes simplex virus 1 infection, hsa05203 viral carcinogenesis, hsa05166 HTLV-I

infection, hsa05164 influenza A, hsa05134 legionnaires' disease, hsa05160 hepatitis C, hsa05162

measles, hsa05133 whooping cough, hsa05322 systemic lupus erythematosus, hsa04670

transepithelial migration of leukocytes, hsa05146 amoebiasis, hsa05142 chagas disease,

hsa05200 pathways in cancer. The cell membrane proteins recognized and bound by HrpNEcb in

cultured mouse liver cell participated in neurological diseases related KEGG pathways of

hsa05012 Parkinson's disease, hsa05016 Huntington's disease, hsa05010 Alzheimer's disease.

The cell membrane proteins recognized and bound by HrpNEcb in cultured mouse liver cell

participated in nucleic acid, protein, amino acid, sugar, fat metabolism related KEGG pathways

of hsa03420 nucleotide excised repair, hsa00970 aminoacyl biosynthesis, hsa03430 mismatch repair, hsa01210 2-oxocarboxylic acid metabolism, hsa03440 homologous recombination, hsa04360 axonal guidance, hsaOO051 fructose and mannose metabolism, hsa00565 ether lipid metabolism, hsa00510 N-polysaccharide biosynthesis, hsa04110 cell cycle, hsa03030 DNA replication, hsa03013 RNA transport, hsa03018 RNA degradation, hsa03040 spliceosome, hsa03010 ribosome, hsa04141 ER protein processing, hsa04810 regulation of the actin skeleton, hsa03O5Oproteasome, hsa01230 amino acid biosynthesis, hsa00190 oxidative phosphorylation, hsa049 32 non-alcoholic fatty liver disease (NAFLD), hsaOO020 citric acid cycle, hsa00564 glycerol phospholipid metabolism, hsa03008 biogenesis of eukaryotic ribosomes, hsa03015 mRNA monitoring pathway, hsa01200 carbon metabolism, hsa00520 amino sugar and nucleotide sugar metabolism, hsa05034 alcoholism, hsa04120 ubiquitin mediated proteolysis, hsa05205 proteoglycans in cancer, hsa05206 microRNAs in cancer. The cell membrane proteins recognized and bound by HrpNEcb in cultured mouse liver cell participated in cell connections, nerve connections, vascular, endocrine, reproductive system metabolic KEGG pathways including Hsa04723 retrograde neural signaling, hsa04726 serotonin-activated synapses, hsa00900 backbone of terpenoid biosynthesis, hsa04520 adhesion knot, hsa05032: morphine addiction, hsa04510 focal adhesion, hsa04724 glutamatergic synapses, hsa04530 tightjunctions, hsaOO830 retinol metabolism, hsa04114 oocyte meiosis, hsa04728 dopaminergic synapses, hsa00100 steroid biosynthesis, hsa04261 adrenergic signaling in cardiomyocytes, hsa04727

Neuronal synapse, hsa04725 cholinergic synapse, hsa04540 gap junction, hsa04971 gastric acid

secretion, hsa04713 circadian entrainment, hsa04931 insulin resistance.

Preferably, the HrpN-type multi epitopic-like ligand protein is HrpNEch multi epitopic-like

ligand protein. The cell membrane proteins recognized and bound by HrpNEch in cultured

lysosome, hsa04666 Fe gamma R-mediated phagocytosis, hsa01130 antibiotic biosynthesis,

hsa05131 Shigellosis, hsa04612 antigen handling and presentation, hsa05130 pathogenic

Escherichia coli infection, hsa05100 bacterial invasion of epithelial cells, hsa05132 Salmonella

infection, hsa05169 barr virus infection, hsa05203 viral carcinogenesis, hsa05134 Legionnaires'

disease, hsa05160 hepatitis C, hsa05162 measles, hsa05133 whooping cough, hsa05322 systemic lupus erythematosus, hsa04670 leukocyte migration across the endothelium, hsa05152 tuberculosis, hsa05150 Staphylococcus aureus infection, hsa05146 amoebiasis, hsa05142 Chagas disease, hsa05200 pathways in cancer, hsa05143 African trypanosomiasis, hsa04750 regulation of inflammatory mediators of TRP channels, hsa04916 bactericidal effect, hsa05230 central carbon metabolism in cancer, hsa05214 glioma, hsa05212 pancreatic cancer. The cell membrane proteins recognized and bound by HrpNEch in cultured mouse liver cell involved three important

KEGG pathways related to neurological diseases including hsa05010 Alzheimer's disease,

hsa05012 Parkinson's disease, hsa05016 Huntington's disease. The cell membrane proteins

recognized and bound by HrpNEch in cultured mouse liver cell participated in 39 nucleic acid,

protein, amino acid, sugar, fat metabolism related KEGG pathways including hsa03013 RNA

transport, hsa03018 RNA degradation, hsa03040 spliceosome, hsa03010 ribosome, hsa0414 ER

protein processing, hsa04810 actin skeleton modulation, hsa03050 proteasome, hsa01230 amino

acid biosynthesis, hsa00190 oxidative phosphorylation, hsa00230 purine metabolism, hsa04932

non-alcoholic fatty liver disease, hsa00020 citric acid cycle, hsa03008 biogenesis of eukaryotic

ribosomes, hsa00240 pyrimidine metabolism, hsa00650 butanoate metabolism, hsa01200 carbon

metabolism, hsa00520 amino sugar and nucleotide sugar metabolism, hsa05034 alcoholism,

hsaOO071 fatty acid degradation, hsa04120 ubiquitin mediated proteolysis, hsa05205

proteoglycans in cancer, hsa05206 microRNAs in cancer, hsa00410 alanine metabolism,

hsa00340 histidine metabolism, hsa00910 nitrogen metabolism, hsa00250 alanine, aspartic acid,

glutamate metabolism, hsa00350 tyrosine metabolism, hsa04726 serotonin-activated synapses,

hsa00900 backbone of terpenoid biosynthesis, hsa04610 complement and coagulation cascade,

hsa00330 arginine and proline metabolism, hsa04520 adhesion junction, hsa00860 porphyrin and

chlorophyll metabolism, hsa00010glycolysis and glycogenesis, hsa00982 Drug metabolism

cytochrome P450, hsa00980 metabolism of exogenous drugs, hsa04962 vasopressin regulates

water reabsorption, hsa00983 drug metabolism - other enzymes. The cell membrane proteins

recognized and bound by HrpNEch in cultured mouse liver cell also involved in 34 cellular

junctions, neural connections, vascular, endocrine, and reproductive system related KEGG

pathways including hsa04510 focal adhesion, hsa04724 glutamatergic synapses, hsa04530 tight

junctions, hsa00830 retinol metabolism, hsa04114 oocyte meiosis, hsa04728: dopamine

synapses, hsaOO140 steroid hormone biosynthesis, hsa04261 adrenergic signaling in cardiomyocytes, hsa04727 y-aminobutyric acid synapses, hsa04725:cholinergic synapses, hsa04540 gap junctions, hsa04971 gastric acid secretion, hsa04713 circadian entrainment, hsa04931 insulin resistance, hsa05031 amphetamine addiction, hsa04924 renin secretion, hsa04925 aldosterone synthesis and secretion, hsa00590 arachidonic acid metabolism, hsa04270 vascular smooth muscle contraction, hsa00760 niacin and nicotinamide metabolism, hsa04740: olfactory conduction, hsa04260: myocardial contraction, hsa04720 long-term potential difference phenomenon, hsa04744 light conduction, hsa04966 collection of duct acid secretions, hsa05412 arrhythmogenic right ventricular cardiomyopathy, hsa05410 hypertrophic cardiomyopathy, hsa04146 peroxisome, hsa05414 dilated cardiomyopathy, hsa04970 salivation, hsa04611 platelet stimulation Live, hsa05204 chemical carcinogenesis, hsa04721 synaptic vesicle cycling.

Multifunctional cascade biological effects include inducing significant differences in the

expression of functional gene groups related to cell components, molecular functions and

biological processes in different organs and tissues. Cell components include cell, cell junction,

cell part, extracellular matrix, extracellular matrix component, extracellular region, extracellular

region part, macromolecular complex, membrane, membrane part, membrane sealing cavity,

organelle, part of organelle, supramolecular fiber, synapse, synaptic part, antioxidant activity,

etc. Molecular functions include binding, catalytic activity, chemical activity in the enticement,

chemical repellent activity carrier, electronic, metal, molecular chaperone activity function of

regulator, molecular transducer activity, nucleic acid combined with the activity of transcription

factors, signal sensor activity, molecular structure, transcription factor active protein,

transportation activities, etc. Biological processes include behavior, biological adhesion,

biological regulation, cells, cell death, cell composition organization or biology, cell processes,

detoxification, the process of development and growth, the process of the immune system,

localization, motion, metabolic process, biological process, negative regulation of biological

process, biological process, biological process regulation, presynaptic process involving

synapses, transmission, biological process regulation, reproduction, reproductive process,

stimulus response, rhythmic process, signal, single biological process, etc.

HrpN-type multi epitopic-like ligand protein is HrpNEcb multi epitopic-like ligand protein. The

cascade of biological effects of HrpNEcb protein includes inducing multiple differentially

expressed genes (DEGs) involved in cellular processes, environmental information processing

and genetic information processing, metabolism, organismal systems and other functional

pathways. Furthermore, 1) multiple differentially expressed genes (DEGs) induced by HrpNEcb

multi epitope-like ligand protein were involved in cellular processes including transport and

catabolism, cell population, cell activity, cell growth and death. 2) multiple DEGs induced by

HrpNEcb were involved in environmental information processing including signal molecules

and interactions, signal transduction, membrane transport. 3) multiple DEGs induced by

HrpNEcb were involved in the biological process including translation, replication and repair,

folding, classification and degradation. 4) multiple DEGs induced by HrpNEcb were involved in

metabolic processes such as biodegradation and metabolism, nucleotide metabolism, metabolism

of other amino acids, metabolic cofactors and vitamins, lipid metabolism, sugar biosynthesis and

metabolism, global and overview map, energy metabolism, carbohydrate metabolism and amino

acid metabolism. 5) multiple DEGs induced by HrpNEcb were involved in organismal systems

including sensory system, nervous system, immune system, excretory system, environmental

adaptation, endocrine system, digestive system, developmental circulation system and other

biological processes.

HrpN-type multi epitopic-like ligand protein is HrpNEch multi epitopic-like ligand protein.

The cascade of biological effects of HrpNEch protein includes inducing multiple differentially

pathways. Furthermore, 1) multiple differentially expressed genes (DEGs) induced by HrpNEch

HrpNEch were involved in environmental information processing including signal molecules

HrpNEch were involved in the biological processe including translation, replication and repair,

folding, classification and degradation. 4) multiple DEGs induced by HrpNEch were involved in metabolic processes including biodegradation and metabolism, nucleotide metabolism, metabolism of other amino acids, metabolic cofactors and vitamins, lipid metabolism, biosynthesis and metabolism of sugar, global and overview maps, energy metabolism, carbohydrate metabolism and amino acid metabolism. 5) multiple DEGs induced by HrpNEch were involved in organismal systems including sensory system, nervous system, immune system, excretory system, environmental adaptation, endocrine system, digestive system, developmental circulation system.

Preferably, HrpN-type multi epitopic-like ligand protein is HrpNEcb multi epitopic-like ligand

protein. HrpNEcb induced DEGs related to biological processes including breeding, cell death,

the immune system, the process of behavior, metabolism, cell processes, reproductive process,

biological adhesion, signals, cell biological processes, development, growth, movement, a single

organization, the process of biofacies, rhythmic process, biological process is regulation and

negative regulation of biological process, biological process adjustment, stimulus-response,

positioning, biological control, cellular component organization or biogenesis, cell aggregation,

detoxification, and presynaptic processes involved in synaptic transmission. HrpNEcb induced

DEGs related to cell components including covers cells and extracellular region, type of nuclear

membrane, virus particles, cells and extracellular matrix, cell membrane closed cavity, complex

macromolecules and organelles, extracellular matrix components, extracellular region, organelles

parts, components, virus particles membrane components, synapses, cell components, synapses,

and cells supramolecular fiber etc. HrpNEcb also induced DEGs related to molecular function

including covers the activity of transcription factors, proteins, nucleic acids in combination with

the activity of transcription factors, catalytic activity, signal sensor, molecular structure,

transport, binding, electron carriers, forming activity, antioxidant activity, metal chaperone

activity, protein markers, chemical enticement, translational control, chemical repellent activity,

activity molecular sensors, molecular function regulation, etc.

Preferably, HrpN-type multi epitopic-like ligand protein is HrpNEch multi epitopic-like ligand

protein. HrpNEch induced DEGs related to biological processes including breeding, cell death,

biological adhesion, signals, cell biological processes, development, growth, movement, a single organization, the process of biofacies, rhythmic process, biological process is regulation and negative regulation of biological process, biological process adjustment, stimulus-response, positioning, biological control, cellular component organization or biogenesis, cell aggregation, detoxification, and presynaptic processes involved in synaptic transmission. HrpNEch induced

and cells supramolecular fiber etc. HrpNEch also induced DEGs related to molecular function

activity molecular sensors, molecular function regulation, etc.

Preferably, the dosage form of the product or drug used in the pharmaceutical industry is liquid,

powder, tablets or capsules.

Preferably, the pharmaceutical use also includes the preparation and administration of active

compounds for HrpNEcb multi epitopic-like ligand protein (HrpNEcb multi epitopic-like ligand

protein preparations and/or drugs) and their derivatives, usually in unit dose or multiple dosage

forms. Each unit dose contains a predetermined amount of the therapeutic active compound. Its

combination with the desired drug carrier, or excipient is sufficient to produce the desired

therapeutic effect. Examples of unit dosage forms include ampoules and syringes and

individually packaged tablets or capsules. Unit dosage form may be applied in fractions or

multiples thereof. Multiple dosage forms are multiple identical unit dosage forms packaged in a

single container, which are to be applied as separate unit dosage forms. Examples of multiple

dosage forms include vials, tablets or capsule bottles, or bottles. Therefore, multiple dosage

forms are multiple unit doses that are not separated in the package. Dosage forms or

compositions can be prepared that contain between 0.001% and 100% of the active ingredients,

with the remainder consisting of non-toxic carriers. For oral administration, pharmaceutical

compositions can take the form such as tablets or capsules in which pharmacologically acceptable excipients such as adhesives (including, but not limited to, pregelated cornstarch, polyvinylpyrrolidone or propyl methyl cellulose),fillers (including, but not limited to, lactose, microcrystalline cellulose), lubricants (including, but not limited to, magnesium stearate, talcum powder or silica), disintegrants (including, but not limited to, potato starch or starch sodium hydroxyacetate) or wetting agent (including, but not limited to, sodium dodecyl sulfate) are used.

Tablets can be coated by a commonly used method in the field. The drug composition may also

be in liquid form, including, but not limited to, a solution, syrup or suspension, or may be given

as a drug product, which can be reconstructed with water or other suitable carrier prior to use.

Such liquid preparations may be prepared by conventional ways with medically acceptable

additives such as suspensions (including, but not limited to, sorbitol syrups, cellulose derivatives,

or edible fats), emulsifiers (including, but not limited to, lecithin or Arabic gum), non

waterborne transport carriers (including, but not limited to, almond oil, oily ester, or fractionated

vegetable oil) and preservatives (including, but not limited to, methyl paraben or propyl ester or

sorbic acid). Preparations suitable for rectal administration may be supplied as unit dose

suppositories. These can be prepared by mixing HrpNEcb multi epitopic-like ligand protein as

active compound with one or more solid supports, such as cocoa butter. The resulting mixture is

then shaped for preparation. Preparations suitable for topical application to the skin or eye

include, but are not limited to, cartilage agents, creams, lotions, pastes, gels, sprays, aerosols, and

oils. Exemplary carriers for topical application preparations include, but are not limited to,

petroleum jelly, lanolin, polyethylene glycol, alcohols, and two or more combinations thereof.

Topical preparations may also contain thickeners of 0.001% to 15%, 20%, or 25% by weight

including, but not limited to, hydroxypropyl methylcellulose, methylcellulose,

polyvinylpyrrolidone, polyvinyl alcohol, polyethylene glycol, poly/hydroxyalkyl (methyl)

acrylamide, or poly (methyl) acrylamide. Local preparations are commonly applied in

conjunctival cyst by instillation or by infusion or as a cartilage agent. It can be used to flush or

lubricate the eyes, facial sinuses, and external auditory canal. It can also be injected into the

anterior chamber of eye and other places. A topical preparation in the liquid state may also exist

in the form of a contact lens in a hydrophilic 3D polymer matrix from which the active

ingredient is released. For preparations suitable for ingestion (sublingual) administration include,

but are not limited to, pastilles containing active compounds with flavoring substrates (usually sucrose and acacia gum or acacia yarrow gum); And soft pastilles containing active compounds in inert substrates including, but not limited to, gelatin and glycerol or sucrose and Arabic gum.

Drug compositions of the same type of multi epitopic-like ligands can be prepared for use by

injection, including, but not limited to, parenteral administration by rapid concentration or

continuous perfusion. The preparation used for injection may be in a unit dosage form, for

example, in an ampoule or multidose container, with added additives. The composition may be a

suspension, solution or emulsion in an oil-based or water-based carrier and may include, but is

not limited to, formulated reagents such as suspensions, stabilizers and, alternatively. The active

ingredient may be in powder form and reconstituted with a suitable carrier such as sterile

pyrogen-free water or other solvent prior to use. Preparations suitable for percutaneous

application may be given in discrete patches suitable for close contact with the recipient's

epidermis for extended periods of time. Such patches appropriately contain an aqueous solution

of the active compound. Preparations suitable for percutaneous application may be delivered by

ion electroosmosis and take the form of an optional buffered aqueous solution of the active

compound.

compounds for HrpNEch multi epitopic-like ligand protein (HrpNEch multi epitopic-like ligand

individually packaged tablets or capsules. Unit dosage forms may be applied in fractions or

compositions can take the form such as tablets or capsules in which pharmacologically

acceptable excipients such as adhesives (including, but not limited to, pregelated cornstarch, polyvinylpyrrolidone or propyl methyl cellulose),fillers (including, but not limited to, lactose, microcrystalline cellulose), lubricants (including, but not limited to, magnesium stearate, talcum powder or silica), disintegrants (including, but not limited to, potato starch or starch sodium hydroxyacetate) or wetting agent (including, but not limited to, sodium dodecyl sulfate) are used.

Such liquid preparations may be prepared by conventional means with medically acceptable

or edible fats); Emulsifiers (including, but not limited to, lecithin or Arabic gum); Non

suppositories. These can be prepared by mixing HrpNEch multi epitopic-like ligand protein as

including, but not limited to, hydroxypropyl methylcellulose, methylcellulose,

but are not limited to, pastilles containing active compounds with flavoring substrates (usually

sucrose and acacia gum or acacia yarrow gum); And soft pastilles containing active compounds in inert substrates including, but not limited to, gelatin and glycerol or sucrose and Arabic gum. Drug compositions of the same type of multi epitopic-like ligands can be prepared for use by injection, including, but not limited to, parenteral administration by rapid concentration or continuous perfusion. The preparation used for injection may be in a unit dosage form, for example, in an ampoule or multidose container, with added additives. The composition may be a suspension, solution or emulsion in an oil-based or water-based carrier and may include, but is not limited to, formulated reagents such as suspensions, stabilizers and, alternatively. The active ingredient may be in powder form and reconstituted with a suitable carrier such as sterile pyrogen-free water or other solvent prior to use. Preparations suitable for percutaneous application may be given in discrete patches suitable for close contact with the recipient's epidermis for extended periods of time. Such patches appropriately contain an aqueous solution of the active compound. Preparations suitable for percutaneous application may be delivered by ion electroosmosis and take the form of an optional buffered aqueous solution of the active compound.

The HrpN-type multi epitopic-like ligand protein is HrpNEcb multi epitopic-like ligand protein, and the products or drugs are mainly prepared from purified HrpNEcb protein with a mass content of 0.001%-100%.

The HrpN-type multi epitopic-like ligand protein is HrpNEch multi epitopic-like ligand. The products or drugs are mainly prepared from purified HrpNEch protein, with a mass content of 0.001%-100%.

The HrpN-type multi epitopic-like ligand proteins were purified HrpN-type proteins.

The purification method of HrpN-type proteins includes the following steps: Step 1: The high pressure cell crusher breaks the engineered bacteria, and the broken bacteria in liquid is passed into the continuous flow centrifuge to remove the cell debris. The pressure range is 800-1000Mpa. Step 2: The HrpN-His recombinant proteins were purified by Ni-NTA agarose gel column to obtain the purified HrpN-type multi epitopic-like ligand proteins as active drug compounds.

The preparation method for efficient expression of HrpNEcb protein, purification and production of HrpNEcb protein adopted in the invention methods includes the following steps: 1. Preparation of HrpNEcb protein by bacteria fermentation using E.coli strain BL21(DE3) harboring the plasmid encoding genes of HrpNEcb proteins (including, but not limited to, genes from biological samples, synthesis genes, genetically modified recombinant genes, similar genes and their gene modifications). E.coli strain BL21(DE3) harboring plasmid was grown in LB medium with 50 micrograms per liter of kanamycin. When the bacterial cultures reached OD600=0. 7 at certain temperature, IPTG (isopropyl p-D-1-thiogalactopyranoside) was added to a final concentration of 1 mMol. The bacteria were collected by centrifugation after 7-9 hours growth. The expressed HrpNEcb protein product was analyzed by 10% SDS-PAGE polyacrylamide gel electrophoresis. A 36.64 kDa band appeared in the lane of the electrophoresis gel, which was the expressed product of HrpNEcb protein. 2. High pressure cell crusher to crush engineered bacteria, continuous use 800-1000Mpa pressure, broken the bacteria. 3. HrpNEcb multi epitopic-like ligand protein was collected by centrifugation with centrifugal force range of 1,000-8,000g, preferably 1,000-2,000g preferably 2,000-3,500g, preferably 6,000 8,000g, preferably 4,500-6,000g. The optimal centrifugal force is 3,500-4,500g. HrpNEcb multi epitopic-like ligand protein was present in the supernatant. 4. The HrpNEcb-His recombinant protein was purified by Ni-NTA agarose gel column. The protein purification was carried out according to the method suggested by manufacturer, and the purified HrpNEcb multi epitopic-like ligand protein active drug compound was obtained.

The invention revealed that HrpNEcb protein preparation recognized and activated multi-class receptors, membrane proteins in humans or animals and subsequently induced multifunctional cascade biological effects through these receptors, membrane proteins involved signaling pathways. HrpNEcb protein preparation can be applied through any ways known to professionals in this field. The application ways include internal, topical, oral, injection, intramuscular, intravenous, intradermal, peritoneal, subcutaneous, nasal, mouth, rectal, topical, sublingual administration and percutaneous application or any means. HrpNEcb multi epitopic-like ligand protein can be administered by any convenient methods, such as by perfusion or rapid perfusion, absorption through the epithelium or the lining of the skin mucosa (e.g., the mucosa of the mouth, nasal cavity, stomach, rectum, and intestine, etc.). It may be applied sequentially, intermittently, or in the same composition with other bioactive agents. Depending on the site of treatment, the application may be topical, superficial, or systemic. Topical application to the area to be treated may, but is not limited to, local perfusion, surface application, by immersion, by injection, through catheters, through suppositories. Application may also include a controlled release system, including controlled release preparations and devices, such as by a pump. The appropriate approach in any given case will depend on the nature and severity of the disease or condition being treated and the nature of the specific composition used. Multiple known delivery systems can be used to deliver multi epitopic-like ligand proteins that can be encapsulated in liposomes, microparticles and microcapsules. In general, pharmaceutical compositions with multi epitopic-like ligand proteins may be prepared according to pharmaceutically acceptable compositions for use in patients in accordance with regulatory authority approval or in accordance with accepted pharmacopoeia.

The invention revealed that HrpNEcb multi epitopic-like ligand protein recognized and activated

multi-class receptors, membrane proteins in humans or animals and subsequently induced

multifunctional cascade biological effects. The diversity biological effects and functions are

broadly concerned with the diagnosis, or prevention, or treatment, or rehabilitation of diseases

and conditions associated with multiple systems, tissues, organs, and cells, as well as with the

pharmaceutical use of products or medicines. HrpNEcb multi epitopic-like ligand protein can

also be used in food, antiseptic, cosmetic and health related uses.

The invention relates to pharmaceutical uses of HrpNEcb multi-epitope-ligand protein products

or drugs in diagnosis, or prevention, or treatment, or rehabilitation of diseases and conditions of

the nervous system, digestive system, motor system, circulatory system, respiratory system,

endocrine system, immune system, urinary system, reproductive system.

or drugs in diagnosis, prevention, treatment, and rehabilitation of neural connections disease,

dementia, Parkinson's disease, central nervous system disease, neuromuscular disease, epilepsy, headache and neuralgia, peripheral neuropathy, attention deficit hyperactivity disorder, and tic disorders, insomnia, depression, anxiety disorder, bipolar disorder, mental disorder, neurodermatitis and nervous system related disease.

The invention relates to pharmaceutical uses of HrpNEcb multi epitopic-like ligand protein products or drugs in diagnosis, prevention, treatment, rehabilitation of digestive related diseases and conditions such as gastric acid secretion disorders, gastrointestinal neurosis, gastrointestinal motility, gastrointestinal mucositis, liver diseases, microecological disorders.

The invention relates to pharmaceutical uses of HrpNEcb multi epitopic-like ligand and protein products or drugs in diagnosis, prevention, treatment, rehabilitation of sporting system diseases and conditions such as arthritis, muscle cramps, pain, muscular dystrophy, muscle and nerve damage, dehydration.

The invention relates to pharmaceutical uses of HrpNEcb multi epitopic-like ligand protein products or drugs in diagnosis, prevention, treatment, rehabilitation of circulatory associated diseases and conditions such as heart failure, arrhythmias, hypertension, myocardial injury, ischemia, angina pectoris, hyperlipidemia, calcium channel block, vasospasm, hemagglutination, hematologic abnormalities, and myocardial infarction.

The invention relates to pharmaceutical uses of HrpNEcb multi epitopic-like ligand protein products or drugs in diagnosis, prevention, treatment, rehabilitation of respiratory related diseases and conditions such as asthma, chronic obstructive pulmonary disease, bronchiectasis, allergen immunity, allergy, pneumonia, acute or chronic bronchitis, bronchial asthma, gastroesophageal reflux, rhinitis.

The invention relates to pharmaceutical uses of HrpNEcb multi epitopic-like ligand protein products or drugs in diagnosis, prevention, treatment, rehabilitation of endocrine system related diseases and conditions such as diabetes mellitus, thyroid diseases and pituitary diseases, hyperprolactinemia, diabetes insipidus, adrenal diseases, parathyroid diseases and osteoporosis.

The invention relates to pharmaceutical uses of HrpNEcb multi epitopic-like ligand protein

products or drugs in diagnosis, prevention, treatment, rehabilitation of immune system related

diseases and conditions such as Immune deficiency, rheumatoid arthritis, lupus erythematosus.

products or drugs in diagnosis, prevention, treatment, rehabilitation of genitourinary system

related diseases and conditions such as nephrotic syndrome, interstitial nephritis, renal failure,

urinary and reproductive system infection, pyelonephritis, cystitis, prostatitis, urethritis,

epididymitis and orchitis, hyperplasia of prostate and bladder excessive activity, male sexual

dysfunction, and various related, infective inflammation of gynaecology and functional disease.

products or drugs in diagnosis, prevention, treatment, rehabilitation of skin system related

diseases and conditions such as systemic skin nutrition, activate cells, regenerate, repair, clear

smooth, delicate, ultraviolet melanin deposition, eczema, rough, crack, dark grain, dry and hard

skin, dermatitis, allergies, neurodermatitis, injury, acne, acne, scar, dark heavy, mites, oily skin,

inflammatory skin disease, autoimmune skin disease, pigment skin disease, skin atrophy, thin,

dry Dryness, pigmentation, wrinkle hyperplasia, dermal dyskeratosis, xeroderma, contact

dermatitis, anti-aging skin, improve skin function, whitening and freckle.

The purification method of HrpNEcb multi epitopic-like ligand protein that recognize and

activate multiclass receptors, membrane proteins and their signaling pathways in humans or

animals and induce multifunctional cascade biological effects includes the following steps: 1, the

preparation of the HrpNEcb protein, using E. coli strain BL21(DE3) containing

EcbCSL101HrpNEcb gene (cloned in expression vector PET28a(+), through fermentation and

purification.

1) Fermentation. Preparation of HrpNEcb protein by bacteria fermentation using E.coli strain

BL21(DE3) harboring the plasmids encoding genes of HrpNEcb proteins (including, but not

limited to, genes from biological samples, synthesis genes, genetically modified recombinant

genes, similar genes and their gene modifications). E.coli strain BL21(DE3) harboring plasmid

was grown in LB medium with 50 micrograms per liter of kanamycin. When the bacterial cultures reached OD600=0. 7 at certain temperature, IPTG (isopropyl p-D-1 thiogalactopyranoside) was added to a final concentration of 1 mMol. The bacteria were collected by centrifugation after 7-9 hours growth. The expressed HrpNEcb protein product was analyzed by 10% SDS-PAGE polyacrylamide gel electrophoresis. A 36.64 kDa band appeared in the lane of the electrophoresis gel, which was the expressed product of hrpNEcb protein.

Fermentation medium Na2HPO4 -KH2PO4 buffer system pH range is 1-14. Preferably, pH 1-3,

preferably pH 14-10, preferably pH 4-5, preferably pH 9-7. The optimal pH is 6.5-5.5.

Fermentation temperature range 0-60°C. The optimal temperature is 0-20°C, the preferably

temperature is 20-35°C, the preferably temperature is 60-50°C, The preferably temperature is 50

45°C. The optimal temperature is 37-38°C.

The concentration of glucose in the liquid medium for fermentation and proliferation ranged

from 3.00%-0.00%, preferably 3.00%-1.00%, preferably 0.00%-0.01%, preferably 1.00%-0.3%,

preferably 0.01%-0.05%. The best choice is 0.1% to 0.05%.

The concentration of glucose in liquid medium for target protein induction ranged from 3.00%

0.00%. Preferably 3.00%-1.00%, preferably 1.00%-0.3%, preferably 0.3-0.1%, preferably 0.1%

0.05%. The best choice is 0.05%-0.00%.

The lactose concentration range of protein induced liquid medium is 10.00%-0.00%. Preferably

10.00%-1.00%, preferably 0.00%-0.1%, preferably 1.00%-0.6%, preferably 0.1% to 0.3%. The

best choice is 0.5% to 0. 4 %.

Fermentation culture time range 0-24 hours. Preferably time is 0-2 hours, preferably time is 24

15 hours, preferably time is 2-6 hours, preferably time is 15-10 hours. The optimal time is 7-9

hours.

2) Post-treatment after fermentation. (1) sterilization, the bacterial culture was sterilized at 80°C

for 30 minutes, and then rapidly cooled to below 30°C; (2) washing, wash with glucose

Na2HPO4-KH2PO4 buffer (pH 5-5.5) with glucose (200-300 mmol). The bacteria were washed five to eight times in a continuous flow centrifuge. (3) break bacterial cells, the bacteria were diluted with Na2HPO4-KH2PO4 buffer (pH 5-5.5) with glucose (200-300 mmol), and the fresh weight of the bacteria was adjusted to 20%-30% of the diluent. The bacteria were introduced into the high pressure cell crusher, and the pressure of 800-1000Mpa was continuously used to break the engineered bacteria. The broken bacteria solution was passed into a continuous flow centrifuge to remove the cell debris. The HrpNEcb multi epitopic-like ligand protein was present in the supernatant.

3) Purification of HrpNEcb multi epitopic-like ligand protein. HrpNEcb-His recombinant protein was purified using Ni-NTA agarose gel column. The protein purification was carried out according to the recommended method of Ni-NTA agarose gel column manufacturer.

Preparation of the HrpNEcb multi epitopic-like ligand protein. Further, HrpNEcb multi epitopic like ligand protein can also be prepared by over-expression the "synthetic gene", through fermentation and purification. First, synthesis of hrpNEcb gene which encoding HrpNEcb protein, followed by over-expression and purification of HrpNEcb protein.

1) The hrpNEcb gene was synthesized according to the nucleotide sequence (GenBank id DQ355519.1) which encoding HrpNEcb protein. The DNA sequence is:

1 atgettaatt ctcttggtgg eggtacttet ttgeaaatea egatcaaage gggeggtaac 61 ggegatttat ttcaatetca gtcttcacaa aatggcggag cgccctcgca gttggggttg 121 ggtggecage gtagcaatat tgeagaacag ttgtecgata teatgacgac catgatgtte 181 atgggcagea tgatgggcgg tggtctcggt ggtetcggtg gtatgggggg cggtttgggC 241 ggtgcgctcg gtggtttggg aagtagtctg ggcggattag gtggeggcct gtggggcaa 301 ggecttggtg gtggtttggc tggtggtcte ggcagtagec ttggcagtgg tttaggcgge 361 gegeteggeg gtggtttagg cggtgcgcta ggtgccggta tgaatgccat gaatccatca 421 gcaatgatgg gcagcctgct atttagtgeg ttggaggatc tgctgggtgg cggtatgtea 481 caacaacagg ggggcctgtt tggcaataag cagcctgeat caceggaaat tteggcgtat 541 acccagggeg ttaacgatac gttgtccgcg attttgggca acggcetgag tcaggcaaag 601 ggacagcatt caccgctaca attgggtaac aacggtctgc aaggcttgag cggegcaggg 661 gcgttcaace aactgggtag cacgttaggg atgggggttg ggcaaaaagc tggtttgeag 721 gagctaaaca acatcagcac gcacaatgge ageccgacce gttacttcgt ggataaggaa 781 gatcggggaa tggcgaaaga gattggtcag tttatggatc aatatctga agtcttcgge 841 aagccggaat accagaaaga taactggcag acggcgaagc aagatgacaa gtcctgggcc 901 aaagcgctga gcaagccaga tgacgatggc atgaccaaag gcagcatgga taaattcatg 961 aaggctgtcg gcatgatcaa gagcgeggta gcgggtgata ecggcaatac caacetgaac 1021 gctcgtggta acggcggggc ttccctgggt attgatgcgg cgatgategg tgaccgtate

1081 gtcaatatgg ggctgcagaa getctccagc taa

2) DNA was synthesized according to the above DNA sequence, BamHI and HindIl restriction sites were added to the 5 'and 3' of the gene, respectively to facilitate protein gene cloning. Gene synthesis was performed by GeneArt gene synthesis and services division of Thermo Fisher Scientific. The advantages of synthetic genes are: a) easy and the sequence can be guaranteed to be 100% correct; b) codons can be optimized to improve the efficiency of gene expression. Because each species prefers different codons, when heterologous proteins are expressed inE. coli, it is difficult for some proteins to be highly expressed. If the codon of the heterologous protein is changed to the codon preferred by E coli, the efficient expression will be achieved, which is suitable for large-scale industrial production. c) site-directed mutagenesis can be carried out to modify genes and improve the efficiency of proteins; d) researchers can engineer genes that are hard to get or even don't exist in nature as they wish.

3) The synthesized DNA fragment encoding HrpNEcb protein was cloned into the BamHI

HindIl site of expression vector PET28a(+) (with His-tag), and the accuracy of cloning was

ensured by DNA sequencing.

Preparation of HrpNEcb protein by bacteria fermentation using E.coli strain BL21(DE3)

harboring the plasmid containing the synthesized hrpNEcb gene. E.coli strain BL21(DE3)

harboring plasmid was grown in LB medium with 50 micrograms per liter of kanamycin. When

the bacterial cultures reached OD600=0. 7 at certain temperature, IPTG (isopropyl p-D-1

thiogalactopyranoside) was added to a final concentration of 1 mMol. The bacteria were

collected by centrifugation after 7-9 hours growth. The expressed HrpNEcb protein product was

analyzed by 10% SDS-PAGE polyacrylamide gel electrophoresis. A 36.64 kDa band appeared in

the lane of the electrophoresis gel, which was the expressed product of hrpNEcb protein.

45°C. The optimal temperature is 37-38°C.

The concentration of glucose in the liquid medium for fermentation and proliferation ranged from 3.00%-0.00% , preferably 3.00%-1.00%, preferably 0.00%-0.01%, preferably 1.00%-0.3%,

preferably 0.01%-0.05%. The best choice is 0.1% to 0.05%;

The concentration of glucose in liquid medium for target protein induction ranged from 3.00% 0.00%. Preferably 3.00%-1.00%, preferably 1.00%-0.3%, preferably 0.3-0.1%, preferably 0.1%

0.05%. The best choice is 0.05%-0.00%.

The lactose concentration range of protein induced liquid medium is 10.00%-0.00%. Preferably 10.00%-1.00%, preferably 0.00%-0.1%, preferably 1.00%-0.6%, preferably 0.1% to 0.3%. The

best choice is 0.5% to 0. 4 %.

Fermentation culture time range 0-24 hours. Preferably time is 0-2 hours, preferably time is 24 15 hours, preferably time is 2-6 hours, preferably time is 15-10 hours. The optimal time is 7-9 hours. 2) Post-treatment after fermentation. (1) sterilization, the bacterial culture was sterilized at 80°C for 30 minutes, and then rapidly cooled to below 30°C; (2) washing, wash with glucose Na2HPO4-KH2PO4 buffer (pH 5-5.5) with glucose (200-300 mmol). The bacteria were washed five to eight times in a continuous flow centrifuge. (3) break bacterial cells, the bacteria were diluted with Na2HPO 4-KH2PO4 buffer (pH 5-5.5) with glucose (200-300 mmol), and the fresh weight of the bacteria was adjusted to 20%- 3 0% of the diluent. The bacteria were introduced into the high pressure cell crusher, and the pressure of 800-100OMpa was continuously used to break the engineered bacteria. The broken bacteria solution was passed into a continuous flow centrifuge to remove the cell debris. The HrpNEcb multi epitopic-like ligand protein was present in the supernatant. 3) Purification of HrpNEcb multi epitopic-like ligand protein. HrpNEcb-His recombinant protein was purified using Ni-NTA agarose gel column. The protein purification was carried out according to the recommended method of Ni-NTA agarose gel column manufacturer.

The invention revealed that HrpNEcb protein preparation recognized and activated multi-class receptors, membrane proteins in humans or animals and subsequently induced multifunctional cascade biological effects through these receptors, membrane proteins involved signaling pathways. HrpNEcb protein preparation can be applied through any ways known to professionals in this field. The application ways include internal, topical, oral, injection, intramuscular, intravenous, intradermal, peritoneal, subcutaneous, nasal, mouth, rectal, topical, sublingual administration and percutaneous application or any means. HrpNEcb multi epitopic-like ligand protein can be administered by any convenient methods, such as by perfusion or rapid perfusion, absorption through the epithelium or the lining of the skin mucosa (e.g., the mucosa of the mouth, nasal cavity, stomach, rectum, and intestine, etc.). It may be applied sequentially, intermittently, or in the same composition with other bioactive agents. Depending on the site of treatment, the application may be topical, superficial, or systemic. Topical application to the area to be treated may, but is not limited to, local perfusion, surface application, by immersion, by injection, through catheters, through suppositories. Application may also include a controlled release system, including controlled release preparations and devices, such as by a pump. The appropriate approach in any given case will depend on the nature and severity of the disease or condition being treated and the nature of the specific composition used. Multiple known delivery systems can be used to deliver multi epitopic-like ligand proteins that can be encapsulated in liposomes, microparticles and microcapsules. In general, pharmaceutical compositions with multi epitopic-like ligand proteins may be prepared according to pharmaceutically acceptable compositions for use in patients in accordance with regulatory authority approval or in accordance with accepted pharmacopoeia. The invention revealed that HrpNEcb multi epitopic-like ligand protein recognized and activated multi-class receptors, membrane proteins in humans or animals and subsequently induced multifunctional cascade biological effects. The diversity biological effects and functions are broadly concerned with the diagnosis, or prevention, or treatment, or rehabilitation of diseases and conditions associated with multiple systems, tissues, organs, and cells, as well as with the pharmaceutical use of products or medicines. HrpNEcb multi epitopic-like ligand protein can also be used in food, antiseptic, cosmetic and health related uses.

The invention relates to pharmaceutical uses of HrpNEcb multi-epitope-ligand protein products or drugs in diagnosis, or prevention, or treatment, or rehabilitation of diseases and conditions of the nervous system, digestive system, motor system, circulatory system, respiratory system, endocrine system, immune system, urinary system, reproductive system.

dementia, Parkinson's disease, central nervous system disease, neuromuscular disease, epilepsy,

headache and neuralgia, peripheral neuropathy, attention deficit hyperactivity disorder, and tic

disorders, insomnia, depression, anxiety disorder, bipolar disorder, mental disorder,

neurodermatitis and nervous system related disease.

products or drugs in diagnosis, prevention, treatment, rehabilitation of digestive related diseases

and conditions such as gastric acid secretion disorders, gastrointestinal neurosis, gastrointestinal

motility, gastrointestinal mucositis, liver diseases, microecological disorders.

The invention relates to pharmaceutical uses of HrpNEcb multi epitopic-like ligand and protein

products or drugs in diagnosis, prevention, treatment, rehabilitation of sporting system diseases

and conditions such as arthritis, muscle cramps, pain, muscular dystrophy, muscle and nerve

damage, dehydration.

The invention relates to pharmaceutical uses of HrpNEcb multi epitopic-like ligand gand protein

products or drugs in diagnosis, prevention, treatment, rehabilitation of circulatory associated

diseases and conditions such as heart failure, arrhythmias, hypertension, myocardial injury,

ischemia, angina pectoris, hyperlipidemia, calcium channel block, vasospasm, hemagglutination,

hematologic abnormalities, and myocardial infarction.

products or drugs in diagnosis, prevention, treatment, rehabilitation of respiratory related

diseases and conditions such as asthma, chronic obstructive pulmonary disease, bronchiectasis,

allergen immunity, allergy, pneumonia, acute or chronic bronchitis, bronchial asthma,

gastroesophageal reflux, rhinitis.

products or drugs in diagnosis, prevention, treatment, rehabilitation of endocrine system related

diseases and conditions such as diabetes mellitus, thyroid diseases and pituitary diseases,

hyperprolactinemia, diabetes insipidus, adrenal diseases, parathyroid diseases and osteoporosis.

The invention relates to pharmaceutical uses of HrpNEcb multi epitopic-like ligand protein products or drugs in diagnosis, prevention, treatment, rehabilitation of skin system related diseases and conditions such as systemic skin nutrition, activate cells, regenerate, repair, clear smooth, delicate, ultraviolet melanin deposition, eczema, rough, crack, dark grain, dry and hard skin, dermatitis, allergies, neurodermatitis, injury, acne, acne, scar, dark heavy, mites, oily skin, inflammatory skin disease, autoimmune skin disease, pigment skin disease, skin atrophy, thin, dry Dryness, pigmentation, wrinkle hyperplasia, dermal dyskeratosis, xeroderma, contact dermatitis, anti-aging skin, improve skin function, whitening and freckle.

Preferably, preparation of the HrpNEch multi epitopic-like ligand proteins that recognize and activate multiclass receptors, membrane proteins and their signaling pathways in human or animal cells and induce multifunctional cascade biological effects.

The HrpNEch multi epitopic-like ligand Protein was prepared using a plasmid containing our registered hrpNEch gene (GenBank nucleotide: AY999000.1; Protein: AAY17519.1) cloned in the expression vector PET28a(+). HrpNEch multi epitopic-like ligand Protein was produced through bacterial fermentation and purification.

Preparation of HrpNEch protein by bacteria fermentation using E.coli strain BL21(DE3)

harboring the plasmid containing the synthesized hrpNEch gene. E.coli strain BL21(DE3)

collected by centrifugation after 7-9 hours growth. The expressed HrpNEch protein product was

analyzed by 10% SDS-PAGE polyacrylamide gel electrophoresis. A 34.15 kDa band appeared in

the lane of the electrophoresis gel, which was the expressed product of hrpNEch protein.

45°C. The optimal temperature is 37-38°C.

from 3.00%-0.00%, preferably 3.00%-1.00%, preferably 0.00%-0.01%, preferably 1.00%-0.3%

preferably 0.01%-0.05%. The optimal concentration is 0.1% to 0.05%;

0.05%. The best choice is 0.05%-0.00%.

best choice is 0.5% to 0. 4 %.

hours.

Na2HPO4-KH2PO4 buffer (pH 5-5.5) with glucose (200-300 mmol). The bacteria were washed

five to eight times in a continuous flow centrifuge. (3) break bacterial cells, the bacteria were

diluted with Na2HPO4-KH2PO4 buffer (pH 5-5.5) with glucose (200-300 mmol), and the fresh

weight of the bacteria was adjusted to 20%-30% of the diluent. The bacteria were introduced into

the high pressure cell crusher, and the pressure of 800-10O0Mpa was continuously used to break

the engineered bacteria. The broken bacteria solution was passed into a continuous flow

centrifuge to remove the cell debris. The HrpNEch multi epitopic-like ligand protein was present

in the supernatant.

3) Purification of HrpNEch multi epitopic-like ligand protein. HrpNEch-His recombinant protein

was purified using Ni-NTA agarose gel column. The protein purification was carried out

according to the recommended method of Ni-NTA agarose gel column manufacturer.

2, Preparation of the HrpNEch multi epitopic-like ligand protein. Further, HrpNEch multi

epitopic-like ligand protein can also be prepared by over-expression the "synthetic gene",

through fermentation and purification. First, synthesis of hrpNEch gene which encoding

HrpNEch protein, followed by over-expression and purification of HrpNEch protein.

1) The hrpNEch gene was synthesized according to the nucleotide sequence (GenBank AY999000) which encoding HrpNEch protein. The DNA sequence is: 1 atgcaaatta cgatcaaagc gcacatcgge ggtgatttgg ggtctccgg tctggggctg 61 ggtgctcagg gactgaaagg actgaattcc gcggcttcat cgctgggttc cagcgtggat 121 aaactgagca gcaccatga taagttgacc tccgcgctga cttcgatgat gtttggggc 181 gcgctggcgc aggggctggg cgccagctcg aaggggctgg ggatgagcaa tcaactgggc 241 cagtctttcg gaatggcgc gcagggtgcg ageaacctge tatccgtacc gaaatccggc 301 ggcgatggt tgtcaaaaat gtttgataaa gcgctggacg attgtggg tatgacacc 361 gtgaccaagc tgactaacca gagcaaccaa ctggctaatt caatgtgaaegecagcag 421 atgacccagg gtaatatgaa tgcgttcggc agcggtgtga acaacgcact gtcgtccatt 481 ctcggcaacg gtetcggeca gtcgatgagt ggcttctctc agccttctctgggggcaggc 541 ggcttgcagg gcctgagcgg cgcgggtga ttcaaccagt tgggtaatgc catggcatg 601 ggcgtggggc agaatgctgc gctgagtgcg ttgagtaacg tcagcaccca cgtagacggt 661 aacaaccgcc actttgtaga taaagaagat cgcggcatgg cgaaagagat cggccagttt 721 atggatcagt atccggaaat atteggtaaa ccggaatacc agaaagatgg ctggagttcg 781 ccgaagacgg acgacaaatc ctgggctaaa gcgctgagta aaccggatga tgacggtatg 841 accggegcca gcatggacaa atteegtcag gcgatgggta tgatcaaaag cgcggtggeg

901 ggtgataccg gcaataccaa cctgaacctg cgtggcgcgg geggtgcatc gctgggtate 961 gatgcggctg togtcggcga taaaatagcc aacatgtege tggtagetgecaacgctga

2) DNA was synthesized according to the above DNA sequence, BamHI and HindIII restriction sites were added to the 5 'and 3' of the gene, respectively to facilitate protein gene cloning. Gene synthesis was performed by GeneArt gene synthesis and services division of Thermo Fisher Scientific. The advantages of synthetic genes are: a) easy and the sequence can be guaranteed to be 100% correct; b) codons can be optimized to improve the efficiency of gene expression. Because each species prefers different codons, when heterologous proteins are expressed in E. coli, it is difficult for some proteins to be highly expressed. If the codon of the heterologous protein is changed to the codon preferred by E coli, the efficient expression will be achieved, which is suitable for large-scale industrial production. c) site-directed mutagenesis can be carried out to modify genes and improve the efficiency of proteins; d) researchers can engineer genes that are hard to get or even don't exist in nature as they wish.

3) The synthesized DNA fragment encoding HrpNEch protein was cloned into the BamHI-HindIII site of expression vector PET28a(+) (with His-tag), and the accuracy of cloning was ensured by DNA sequencing.

204) Preparation of HrpNEch protein by bacteria fermentation using E.coli strain BL21(DE3) harboring the plasmid containing the synthesized hrpNEch gene. E.coli strain BL21(DE3) harboring plasmid was grown in LB medium with 50 micrograms per liter of kanamycin. When the bacterial cultures reached OD600=0. 7 at certain temperature, IPTG (isopropyl p-D-1 thiogalactopyranoside) was added to a final concentration of 1 mMol. The bacteria were collected by centrifugation after 7-9 hours growth. The expressed HrpNEch protein product was analyzed by 10% SDS-PAGE polyacrylamide gel electrophoresis. A 34.15 kDa band appeared in the lane of the electrophoresis gel, which was the expressed product of HrpNEch protein.

Fermentation medium Na2HPO4-KH2PO4 buffer system pH range is 1-14. Preferably, pH 1-3,

45°C. The optimal temperature is 37-38°C.

from 3.00%-0.00% , preferably 3.00%-1.00%, preferably 0.00%-0.01%, preferably 1.00%-0.3%,

preferably 0.01%-0.05%; The best choice is 0.1% to 0.05%;

0.05%. The best choice is 0.05%-0.00%.

best choice is 0.5% to 0. 4 %.

hours.

diluted with Na2HPO 4-KH2PO4 buffer (pH 5-5.5) with glucose (200-300 mmol), and the fresh

weight of the bacteria was adjusted to 20%- 3 0% of the diluent. The bacteria were introduced into

the high pressure cell crusher, and the pressure of 800-100OMpa was continuously used to break

in the supernatant.

according to the recommended method of Ni-NTA agarose gel column manufacturer.

Compared with the existing technology, the beneficial effects of the invention are as

follows:

HrpN-type multi epitopic-like ligand proteins are a class of ligand molecules rich in multiple

linear and conformational epitope special structures. They can across species boundaries to

recognize and bind membrane receptors and membrane proteins in human or animal cells, and

subsequently multiple activate signal pathways and metabolic pathways. HrpN-type multi

epitopic-like ligand proteins are a kind of ligand proteins with special multi-epitope structure,

novel functions, novel mechanisms of action and novel application prospects. They can induce

multidirectional, multilayered, and multifaceted biological effects and functions. The diversity

biological effects and functions are broadly concerned with the diagnosis, or prevention, or

treatment, or rehabilitation of diseases and conditions associated with multiple systems, tissues,

organs, and cells, as well as with the pharmaceutical use of products or medicines. HrpN-type

multi epitopic-like ligand protein can also be used in food, antiseptic, cosmetic and health related

uses.

Figure legends:

Figure 1, SDS-PAGE electrophoresis of HrpNEcb multi epitopic-like ligand protein. The left

lane is molecular weight standards. Lane 1, cell lysis of E. coli BL21(DE3) expressing HrpNEcb;

lane 2, purified HrpNEcb.

Figure 2, hypersensitive reaction (HR) induced by HrpNEcb multi epitopic-like ligand protein in

tobacco leaves. A and C: HrpNEcb protein (250ptg/ml), B, D: water (control). Picture was taken

24 hours after infiltration.

Figure 3, HrpNEcb multi epitopic-like ligand protein can induce the differentially expressed

genes (DEGs) in mouse liver cell by oral administration or skin smear application. Volcano plots

showing DEGs of 6-hour or 24-hour after oral administration and 6-hour after skin smear

treatment in mouse liver cell as indicated. The x-axis shows log2fold-changes in expression and

y-axis shows statistical significance (-log10 of the p-value). Down-regulated transcripts are

plotted on the left, up-regulated transcripts on the right.

Figure 4, HrpNEcb multi epitopic-like ligand protein can induce the differentially expressed

genes (DEGs) in mouse thalamus cell by oral administration or skin smear treatment. Volcano

plots showing DEGs of 6-hour or 24-hour after oral administration and 6-hour after skin smear

treatment in mouse thalamus cell as indicated. The x-axis shows log2fold-changes in expression

and y-axis shows statistical significance (-log10 of the p-value). Down-regulated transcripts are

plotted on the left, up-regulated transcripts on the right.

Figure 5, HrpNEcb multi epitopic-like ligand protein can induce the differentially expressed

genes (DEGs) in mouse heart cell by oral administration or skin smear treatment. Volcano plots

showing DEGs of 6-hour or 24-hour after oral administration and 6-hour or 12-hour after skin

smear treatment in mouse heart cell as indicated. The x-axis shows log2fold-changes in

expression and y-axis shows statistical significance (-log10 of the p-value). Down-regulated

transcripts are plotted on the left, up-regulated transcripts on the right.

Figure 6, HrpNEcb multi epitopic-like ligand protein can induce the differentially expressed

genes (DEGs) in mouse cerebral cortex cell by oral administration or skin smear treatment.

Volcano plots showing DEGs of 6-hour or 24-hour after oral administration and 6-hour or 12

hour after skin smear treatment in mouse cerebral cortex cell as indicated. The x-axis shows

log2fold-changes in expression and y-axis shows statistical significance (-log10 of the p-value).

Down-regulated transcripts are plotted on the left, up-regulated transcripts on the right.

Figure 7, HrpNEcb multi epitopic-like ligand protein can induce the differentially expressed

genes (DEGs) in mouse hippocampus cell by oral administration or skin smear treatment.

hour after skin smear treatment in mouse hippocampus cell as indicated. The x-axis shows

Figure 8, Heat map of transcriptomic response induced by HrpNEcb multi epitopic-like ligand

protein of 6-hour or 24-hour after oral administration and 6-hour after skin smear treatment in

mouse liver cell as indicated. The gene expression values were normalized as z-scores.

Figure 9, Heat map of transcriptomic response induced by HrpNEcb multi epitopic-like ligand

mouse thalamus cell as indicated. The gene expression values were normalized as z-scores.

Figure 10, Heat map of transcriptomic response induced by HrpNEcb multi epitopic-like ligand

protein of 6-hour or 24-hour after oral administration and 6-hour or 12-hour after skin smear

treatment in mouse hippocampus cell as indicated. The gene expression values were normalized

as z-scores.

Figure 11, Heat map of transcriptomic response induced by HrpNEcb multi epitopic-like ligand

treatment in mouse cerebral cortex cell as indicated. The gene expression values were

normalized as z-scores.

Figure 12, Top KEGG pathways of total DEGs in mouse liver cell treated by HrpNEcb multi

epitopic-like ligand protein (6-hour after oral administration).

Figure 13, Top KEGG pathways of total DEGs in mouse liver cell treated by HrpNEcb multi

epitopic-like ligand protein (24-hour after oral administration).

Figure 14, Top KEGG pathways of total DEGs in mouse liver cell treated by HrpNEcb multi

epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 15, Top KEGG pathways of up-regulated DEGs in mouse liver cell treated by HrpNEcb

multi epitopic-like ligand protein (6-hour after oral administration).

Figure 16, Top KEGG pathways of up-regulated DEGs in mouse liver cell treated by HrpNEcb

multi epitopic-like ligand protein (24-hour after oral administration).

Figure 17, Top KEGG pathways of up-regulated DEGs in mouse liver cell treated by HrpNEcb

multi epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 18, Top KEGG pathways of down-regulated DEGs in mouse liver cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after oral administration).

Figure 19, Top KEGG pathways of down-regulated DEGs in mouse liver cell treated by

HrpNEcb multi epitopic-like ligand protein (24-hour after oral administration).

Figure 20, Top KEGG pathways of down-regulated DEGs in mouse liver cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 21, Top KEGG pathways of total DEGs in mouse heart cell treated by HrpNEcb multi

epitopic-like ligand protein (6-hour after oral administration).

Figure 22, Top KEGG pathways of total DEGs in mouse heart cell treated by HrpNEcb multi

epitopic-like ligand protein (24-hour after oral administration).

Figure 23, Top KEGG pathways of total DEGs in mouse heart cell treated by HrpNEcb multi

epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 24, Top KEGG pathways of total DEGs in mouse heart cell treated by HrpNEcb multi

epitopic-like ligand protein (12-hour after skin smear treatment).

Figure 25, Top KEGG pathways of up-regulated DEGs in mouse heart cell treated by HrpNEcb

multi epitopic-like ligand protein (6-hour after oral administration).

Figure 26, Top KEGG pathways of up-regulated DEGs in mouse heart cell treated by HrpNEcb

multi epitopic-like ligand protein (24-hour after oral administration).

Figure 27, Top KEGG pathways of up-regulated DEGs in mouse heart cell treated by HrpNEcb

multi epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 28, Top KEGG pathways of up-regulated DEGs in mouse heart cell treated by HrpNEcb

multi epitopic-like ligand protein (12-hour after skin smear treatment).

Figure 29, Top KEGG pathways of down-regulated DEGs in mouse heart cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after oral administration).

Figure 30, Top KEGG pathways of down-regulated DEGs in mouse heart cell treated by

HrpNEcb multi epitopic-like ligand protein (24-hour after oral administration).

Figure 31, Top KEGG pathways of down-regulated DEGs in mouse heart cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 32, Top KEGG pathways of down-regulated DEGs in mouse heart cell treated by

HrpNEcb multi epitopic-like ligand protein (12-hour after skin smear treatment).

Figure 33, Top KEGG pathways of total DEGs in mouse hippocampus cell treated by HrpNEcb

multi epitopic-like ligand protein (6-hour after oral administration).

Figure 34, Top KEGG pathways of total DEGs in mouse hippocampus cell treated by HrpNEcb

multi epitopic-like ligand protein (24-hour after oral administration).

Figure 35, Top KEGG pathways of total DEGs in mouse hippocampus cell treated by HrpNEcb

multi epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 36, Top KEGG pathways of total DEGs in mouse hippocampus cell treated by HrpNEcb

multi epitopic-like ligand protein (12-hour after skin smear treatment).

Figure 37, Top KEGG pathways of up-regulated DEGs in mouse hippocampus cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after oral administration).

Figure 38, Top KEGG pathways of up-regulated DEGs in mouse hippocampus cell treated by

HrpNEcb multi epitopic-like ligand protein (24-hour after oral administration).

Figure 39, Top KEGG pathways of up-regulated DEGs in mouse hippocampus cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 40, Top KEGG pathways of up-regulated DEGs in mouse hippocampus cell treated by

Figure 41, Top KEGG pathways of down-regulated DEGs in mouse hippocampus cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after oral administration).

Figure 42, Top KEGG pathways of down-regulated DEGs in mouse hippocampus cell treated by

HrpNEcb multi epitopic-like ligand protein (24-hour after oral administration).

Figure 43, Top KEGG pathways of down-regulated DEGs in mouse hippocampus cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 44, Top KEGG pathways of down-regulated DEGs in mouse hippocampus cell treated by

Figure 45, Top KEGG pathways of total DEGs in mouse cerebral cortex cell treated by HrpNEcb

multi epitopic-like ligand protein (6-hour after oral administration).

Figure 46, Top KEGG pathways of total DEGs in mouse cerebral cortex cell treated by HrpNEcb

multi epitopic-like ligand protein (24-hour after oral administration).

Figure 47, Top KEGG pathways of total DEGs in mouse cerebral cortex cell treated by HrpNEcb

multi epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 48, Top KEGG pathways of total DEGs in mouse cerebral cortex cell treated by HrpNEcb

multi epitopic-like ligand protein (12-hour after skin smear treatment).

Figure 49, Top KEGG pathways of up-regulated DEGs in mouse cerebral cortex cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after oral administration).

Figure 50, Top KEGG pathways of up-regulated DEGs in mouse cerebral cortex cell treated by

HrpNEcb multi epitopic-like ligand protein (24-hour after oral administration).

Figure 51, Top KEGG pathways of up-regulated DEGs in mouse cerebral cortex cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 52, Top KEGG pathways of up-regulated DEGs in mouse cerebral cortex cell treated by

Figure 53, Top KEGG pathways of down-regulated DEGs in mouse cerebral cortex cell treated

by HrpNEcb multi epitopic-like ligand protein (6-hour after oral administration).

Figure 54, Top KEGG pathways of down-regulated DEGs in mouse cerebral cortex cell treated

by HrpNEcb multi epitopic-like ligand protein (24-hour after oral administration).

Figure 55, Top KEGG pathways of down-regulated DEGs in mouse cerebral cortex cell treated

by HrpNEcb multi epitopic-like ligand protein (12-hour after skin smear treatment).

Figure 56, Top KEGG pathways of total DEGs in mouse thalamus cell treated by HrpNEcb multi

epitopic-like ligand protein (6-hour after oral administration).

Figure 57, Top KEGG pathways of total DEGs in mouse thalamus cell treated by HrpNEcb multi

epitopic-like ligand protein (24-hour after oral administration).

Figure 58, Top KEGG pathways of total DEGs in mouse thalamus cell treated by HrpNEcb multi

epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 59, Top KEGG pathways of up-regulated DEGs in mouse thalamus cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after oral administration).

Figure 60, Top KEGG pathways of up-regulated DEGs in mouse thalamus cell treated by

HrpNEcb multi epitopic-like ligand protein (24-hour after oral administration).

Figure 61, Top KEGG pathways of up-regulated DEGs in mouse thalamus cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 62, Top KEGG pathways of down-regulated DEGs in mouse thalamus cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after oral administration).

Figure 63, Top KEGG pathways of down-regulated DEGs in mouse thalamus cell treated by

HrpNEcb multi epitopic-like ligand protein (24-hour after oral administration).

Figure 64, Top KEGG pathways of down-regulated DEGs in mouse thalamus cell treated by

HrpNEcb multi epitopic-like ligand protein (6-hour after skin smear treatment).

Figure 65, mRNA-seq experiment with HrpNEcb multi epitopic-like ligand protein treatments

flow chart.

Figure 66, mRNA sequencing data analysis with HrpNEcb multi epitopic-like ligand protein

treatments flow chart.

Figure 67, SDS-PAGE electrophoresis of HrpNEch multi epitopic-like ligand protein. The left

lane is molecular weight standards. Lane 1, cell lysis ofE.coli BL2(DE3) expressing HrpNEch;

lane 2, purified HrpNEch.

Figure 68, hypersensitive reaction (HR) induced by HrpNEcb multi epitopic-like ligand protein

in tobacco leaves. Up: water (control), down: HrpNEcb protein (250tg/ml). Picture was taken 24

hours after infiltration.

Figure 69, HrpNEch multi epitopic-like ligand protein can induce the differentially expressed

treatment in mouse kidney cell as indicated. The x-axis shows log2fold-changes in expression

plotted on the left, up-regulated transcripts on the right.

Figure 70, HrpNEch multi epitopic-like ligand protein can induce the differentially expressed

genes (DEGs) in mouse testis cell by oral administration or skin smear treatment. Volcano plots

plotted on the left, up-regulated transcripts on the right.

Figure 71, Heat map of transcriptomic response induced by HrpNEch multi epitopic-like ligand

mouse kidney cell as indicated. The gene expression values were normalized as z-scores.

Figure 72, Heat map of transcriptomic response induced by HrpNEch multi epitopic-like ligand

mouse testis cell as indicated. The gene expression values were normalized as z-scores.

Figure 73, Top KEGG pathways of total DEGs in mouse kidney cell treated by HrpNEch multi

epitopic-like ligand protein (6-hour or 24-hour after oral administration, 6-hour after skin smear

treatment, as indicated).

Figure 74, Top KEGG pathways of up-regulated DEGs in mouse kidney cell treated by HrpNEch

multi epitopic-like ligand protein (6-hour or 24-hour after oral administration, 6-hour after skin

smear treatment, as indicated).

Figure 75, Top KEGG pathways of down-regulated DEGs in mouse kidney cell treated by

HrpNEch multi epitopic-like ligand protein (6-hour or 24-hour after oral administration, 6-hour

after skin smear treatment, as indicated).

Figure 76, Top KEGG pathways of total DEGs in mouse testis cell treated by HrpNEch multi

treatment, as indicated).

Figure 77, Top KEGG pathways of up-regulated DEGs in mouse testis cell treated by HrpNEch

smear treatment, as indicated).

Figure 78, Top KEGG pathways of down-regulated DEGs in mouse testis cell treated by

after skin smear treatment, as indicated).

Figure 79, mRNA-seq experiment with HrpNEch multi epitopic-like ligand protein treatments

flow chart.

Figure 80, mRNA sequencing data analysis with HrpNEch multi epitopic-like ligand protein

treatments flow chart.

Embodiment:

In order to make the purpose, technical scheme and advantages of the invention clearer, the

invention is further explained in detail in combination with the attached drawings and examples.

The specific examples described herein are intended only to explain but not to qualify the

invention.

Example 1:

Comparison of the homology of HrpN-type proteins was already described in the instruction and

will not be repeated here. In the following examples, conventional experimental methods will be

used if not specifically mentioned. The materials and reagents used in the following examples

were obtained from the commercial sources if not specifically mentioned.

Example 2:

Preparation of the HrpNEcb protein, using E. coli strain BL21(DE3) containing

EcbCSL1OHrpNEcb gene (GenBank: DQ355519.1) cloned in expression vector PET28a(+),

through fermentation and purification. It includes the following steps:

was grown in LB medium with 50 micrograms per liter of kanamycin. When the bacterial

cultures reached OD600=0. 7 at certain temperature, IPTG (isopropyl p-D-1

thiogalactopyranoside) was added to a final concentration of 1 mMol. The bacteria were collected by centrifugation after 7-9 hours growth. The expressed HrpNEcb protein product was analyzed by 10% SDS-PAGE polyacrylamide gel electrophoresis. A 36.64 kDa band appeared in the lane of the electrophoresis gel, which was the expressed product of hrpNEcb protein.

the high pressure cell crusher, and the pressure of 800-1OOOMpa was continuously used to break

the engineered bacteria

3) The broken bacteria solution was passed into a continuous flow centrifuge to remove the cell

debris. The centrifugal force range was 1000-8000g, preferably, 1000-2000g, preferably, 2000

3500g, preferably, 8000-6000g, preferably, 6000-4500g. The optimal centrifugal force is 3500

4500g. The HrpNEcb multi epitopic-like ligand protein was present in the supernatant.

4) Purification of HrpNEcb multi epitopic-like ligand protein. HrpNEcb-His recombinant protein

according to the recommended method of NI-NTA agarose gel column manufacturer.

Example 3:

HrpNEcb protein is prepared by the expression of "synthetic gene", which includes the following

steps

Step 1: synthesis of hrpNEcb gene according to the nucleotide sequence (GenBank:

DQ355519.1) which encoding HrpNEcb protein. The DNA sequence is:

1 atgettaatt ctcttggtgg cggtacttet ttgcaaatca egatcaaagc gggcggtaac 61 ggegatttat ttcaatetca gtettcacaa aatggeggag cgcctogca gttggggttg 121 ggtggccagc gtagcaatat tgcagaacag ttgtcegata tcatgacgac catgatgttc 181 atgggcagea tgatgggcgg tggtctcggt ggtetcggtg gtatgggggg cggtttggge 241 ggtgcgctcg gtggtttggg aagtagtctg ggcggattag gtggeggcct gtggggcaa 301 ggecttggtg gtggtttggc tggtggtcte ggcagtagec ttggeagtgg tttaggegge 361 gegeteggeg gtggtttagg cggtgcgcta ggtgccggta tgaatgccat gaatccatca 421 gcaatgatgg gcagcctgct atttagtgcg ttggaggate tgctgggtgg cggtatgtca

481 caacaacagg ggggcctgtt tggcaataag cagcctgcat caccggaaat tteggcgtat 541 acccagggg ttaacgatac gttgtccgcg attttgggca acggectgag tcaggcaaag 601 ggacagcatt cacegetaca attgggtaac aacggttg aaggttgagcggcgcaggg 661 gcgttcaacc aactgggtag cacgttaggg atgggggttg ggcaaaaagc tggtttgcag 721 gagctaaaca acatcageac gcacaatggc agecegacce gttactegt ggataaggaa 781 gatcggggaa tggcgaaaga gattggtcag tttatggate aatatcctga agtcttggc 841 aagccggaat accagaaaga taactggcag acggcgaagc aagatgacaa gtcctgggcc 901 aaagcgctga gcaagccaga tgacgatggc atgaccaaag gcagcatgga taaattcatg 961 aaggctgtcg gcatgatcaa gagegeggta gcgggtgata ccggcaatac caacctgaac 1021 getegtggta acggcggggc ttccctgggt attgatggg cgatgatgg tgacgtatc 1081gtcaatatgg ggctgcagaa getetccage taa

Step 2: BamHI and HindIl restriction sites were added to the 5 'and 3' of the gene, respectively, to facilitate protein gene cloning.

Step 3: gene synthesis was performed by GeneArt gene synthesis and services division of Thermo Fisher Scientific. The synthesized DNA fragment encoding HrpNEcb protein was cloned into the BamHI-HindIIIsites of expression vector PET28a(+) (with His-tag), and the accuracy of cloning was ensured by DNA sequencing.

Step 4: preparation of HrpNEcb protein by bacteria fermentation using E.coli strain BL21(DE3)

Na2HPO4-KH2PO4 buffer system (pH6.5-5.5) was used in medium. The glucose concentration in

medium was 0.01%-0.05% and lactose concentration in medium was 0.5%-0.4%.

Step 5: post-treatment after fermentation. (1) sterilization, the bacterial culture was sterilized at

80°C for 30 minutes, and then rapidly cooled to below 30°C; (2) washing, wash with glucose

five to eight times in a continuous flow centrifuge. (3) break bacterial cells, the bacteria were diluted with Na2HPO4-KH2PO4 buffer (pH 5-5.5) with glucose (200-300 mmol), and the fresh weight of the bacteria was adjusted to 20%-30% of the diluent. The bacteria were introduced into the high pressure cell crusher, and the pressure of 800-1OMpa was continuously used to break the engineered bacteria. The broken bacteria solution was passed into a continuous flow centrifuge to remove the cell debris. The HrpNEcb multi epitopic-like ligand protein was present in the supernatant.

Step 6: purification of HrpNEcb multi epitopic-like ligand protein. HrpNEcb-His recombinant

protein was purified using NI-NTA agarose gel column. The protein purification was carried out

according to the recommended method of NI-NTA agarose gel column manufacturer.

The over-expressed and purified HrpNEcb protein-His recombinant protein was detected in 10%

SDS-PAGE gel electrophoresis, as shown in Figure 1. The left lane loaded with molecular

weight standards. lane 1 showed the cell lysis of E. coli BL21(DE3) expressing HrpNEcb. An

over-expressed 36.64kDa protein band was present which corresponding to the molecular weight

of HrpNEcb. lane 2 showed purified HrpNEcb protein with molecular mass of 36.64kDa.

Figure 2 showed hypersensitive reaction (HR) tests of purified HrpNEcb protein. The tobacco

leaf infiltrated with 100pL of HrpNEcb protein solution (300pg/ml) caused typical HR

symptoms (A and C) but water infiltration cause no reaction (B and D). These results

demonstrated that over-expressed and purified HrpNEcb protein remained biological function.

Furthermore, purified HrpNEcb multi epitopic-like ligand protein can generally trigger

hypersensitive reactions in leaves of various plants. The plant species to test HR reaction could

be tobacco, pepper, eggplant, tomatoe, potato, strawberry, cucumber, water spinach, cockscomb,

September chrysanthemum, pansy, rouge flower, petunias, grape, chinese rose, locust tree, pea,

peach, shower, towel gourd, green beans, broccoli, spinach, cole, yam, black-eyed peas, beans,

corn, rice, soybean, sowbread, mulberry, pumpkin, loquat, tree of heaven etc.

Example 4:

mRNA sequencing (mRNA-Seq) of cells from mice treated with HrpNEcb multi epitopic-like

ligand protein. mRNA-seq is a powerful tool to analyze the cell transcriptome profile. The

research object of mRNA sequencing is all the RNAs with ploy-A tail that can be transcribed by

a specific cell in a certain functional state, mainly for mRNA. The mRNAs produced by the cell

are converted to cDNA by reverse transcription process for library preparation. The resulting

DNA is then sequenced and, from the observed abundance of a particular DNA, the original

amount of mRNA in the cell is inferred to find genes or transcripts whose transcript levels have

changed under the experimental conditions, that is, differentially expressed. By finding these

differentially expressed genes (DEGs) and transcripts, the abundance of almost all mRNA

expression in a specific tissue or organ of a species in a certain state can be obtained

comprehensively and rapidly. mRNA-Seq technique has been widely used in biologic researchs

and drug development. Using mRNA-seq technology, we demonstrated that HrpNEcb multi

epitopic-like ligand protein induced differential expression of multiple genes in multiple mouse

organs.

1, Experimental animal samples:

The experiments were carried out by the Protein Spectrum Technology Platform of Shanghai

Huayin Biomedical Technology Co., LTD.

Experimental samples treatment: twelve of 8-week-old balb/C mice were used for HrpNEcb

multi epitopic-like ligand protein treatment group, divided into 3 mice each treatment of oral

administration for 6-hour, 24-hour and skin smear application for 6-hour and 12-hour. Four mice

were used in the blank control group. The sham-operated group (buffer without HrpNEcb

protein) including 4 treatments of oral administration for 6 hours, 24 hours and skin smear

application for 6 hours and 12 hours, with 4 mice in each treatment. Mice in experimental

treatment group were treated as oral administration or skin smear application with HrpNEcb

multi epitopic-like ligand protein (600mg/L) in buffer. The mice in sham-operated group were

treated as oral administration or skin smear application with buffer without HrpNEcb protein.

The mice in blank control group mice without any treatment. Under the same feeding condition

and at different time points, the cerebral cortex, thalamus, hippocampus, liver, heart and other tissues of mice were respectively harvested for mRNA seq experiments. All experiments were performed with three replicates.

2, mRNA-Seq:

Experiments were performed as shown in the flow chart in figure 65.

1. RNA extraction and quality inspection.

Total RNAs were extracted using miRNeasy Micro Kit (Qiagen Cat# 1071023) according to

manufacturer provided procedures. Total RNAs was examined by NanoDrop ND-2000

spectrophotometer and Agilent Bioanalyzer 4200 (Agilent technologies, Santa Clara, CA, US)

and used for subsequent sequencing experiments.

11. Library construction and quality inspection.

Since most mRNAs in eukaryotes contain polyA tails, the mRNA with polyA tail can be

enriched by Oligo(dT). The enriched mRNAs were used to construct the libraries through

fragmentation, cDNA synthesis, end repairing, adding adenine base to the 3 'end, ligating to the

adaptor, and amplification. The constructed libraries were detected by Qubit@ 2.0 Fluorometer

for concentration and Agilent2100 for size.

III. Sequencing.

The libraries were sequenced by Illumina. The sequence information of the fragments to be

tested was obtained by capturing the fluorescence signals and transforming the optical signals

into sequencing peak by computer software.

IV. Analysis of mRNA sequencing data.

Analysis was performed were performed as shown in the flow chart figure 66.

3. Data analysis. Identification of differentially expressed genes (DEGs) induced by HrpNEcb multi epitopic-like ligand protein. Firstly, fragment counts were normalized. P-value was calculated according to the hypothesis test model, and finally p-value multiple hypothesis test was corrected to obtain FDR value. The

Fold-change of FP KM value was calculated using edgeR software. DEGs selecting conditions were p-value < 0.05 and fold-change > 2.

Volcano plots of DEGs induced by HrpNEcb multi epitopic-like ligand protein.

Volcano plots of DEGs were used to show the overall distribution of genes with significant expression differences induced by HrpNEcb multi epitopic-like ligand proteins. The x-axis shows log2fold-changes in expression and y-axis shows statistical significance (-log10 of the p value). Down-regulated transcripts are plotted on the left, up-regulated transcripts on the right. Figure 3-7 shows the volcano plots of DEGs induced by oral administration and skin smear application of HrpNEcb multi epitopic-like ligand in liver, thalamus, heart, cerebral cortex and hippocampus of mice, respectively. HrpNEcb is abbreviated as Ni in the figures.

Heat map of the transcriptomic response induced by HrpNEcb multi epitopic-like ligand protein.

The DEGs sets were clustered and analyzed. Grouping genes with similar expression patterns together suggests that genes share a common function or are involved in a common signaling pathway. The logO(FPKM+1) value was transformed into a normalized scale number and clustered. Figure 8-11 showed the clustering heat map of differentially expressed genes in liver, thalamus, hippocampus and cerebral cortex, respectively. HrpNEcb is abbreviated as Ni in the figures.

Gene Ontology (GO) enrichment of DEGs induced by HrpNEcb multi epitopic-like ligand protein. Gene Ontology is a widely used ontology in the field of bioinformatics. Gene ontology is a description of genes in different dimensions and levels, covering biological process, cellular component and molecular function. Biological process explains that the gene is involved in what biological process. Cellular component explains where the gene is present. The locations relative to cellular structures in which a gene product performs a function, either cellular compartments or stable macromolecular complexes of which they are parts. Molecular function explains what is the function of the gene at the molecular level, describes its activity in individual molecular biology, such as catalytic activity or binding activity. The Gene Ontology knowledgebase is the world's largest source of information on the functions of genes. This knowledge is both human- readable and machine-readable, and is a foundation for computational analysis of large-scale molecular biology and genetics experiments in biomedical research. Gene Ontology is constructed by the GO organization (Gene Ontology Consortium) in 2000. The aim is to establish a standard vocabulary system for the knowledge of genes and their products. It covers the biological process, cellular component and molecular function of genes. Term is the basic description unit in GO. GO terms are used to describe the function of a gene product. Through GO enrichment analysis of DEGs, genes can be classified according to different functions, so as to achieve the purpose of annotation and classification of the base factors. We performed GO term enrichment analysis on DEGs induced by HrpNEcb multi epitopic-like ligand proteins. The results demonstrated that HrpNEcb multi epitopic-like ligand protein is a kind of ligand protein with multiple epitope special structures, novel functions, novel mechanism of action and novel application prospects. It induced differential expression of multiple genes in liver, thalamus, heart, cerebral cortex and hippocampus of treated mice. These differentially expressed genes covered biological process, cellular component and molecular function. The results of GO enrichment analysis of differentially expressed genes induced by HrpNEcb multi epitopic-like ligand protein were further described as follows: biological process related DEGs included reproduction, cell death, immune system process, behavior, metabolic process, cellular process, reproductive process, biological adhesion, signaling, multicellular biological process, developmental process, growth, movement, individual tissue process, biological phase, rhythmic process, positive regulation of biological process, negative regulation of biological process, regulation of biological process, stimulus response, localization, bioregulation, cellular component organization or biogenesis, cell aggregation, detoxification, and presynaptic process involved in synaptic transmission, etc. (Table 1-6). Cellular component related DEGs included nuclear membrane, virus particles, cells and extracellular matrix, cell membrane closed cavity, complex macromolecules and organelles, extracellular matrix components, extracellular region, organelles parts, components, virus particles membrane components, synapses, cell components, synapses, and cellular supramolecular fibers etc. (Table 1-6). DEGs related to molecular function included transcription factor activity, protein and nucleic acid in combination with the activity of transcription factors, catalytic activity, signal sensor, molecular structure, transport, binding, electronic carrier activity, forming activity, antioxidant activity, metal chaperone activity, protein markers, chemical enticement, translational control, chemical repellent activity, Active molecular sensor, molecular function regulation etc. (Table 1-6).

Table 1, up-regulated DEGs numbers in GO categories biological process, cellular component

and molecular function induced by HrpNEcb multi epitopic-like ligand proteins in heart (6 and

24 hours after oral administration or 6 and 12hours after skin smear application) Heart, oral, Heart, oral, Heart, skin, Heart, skin, 6-hr 24-hr 6-hr 12-hr GO Term GO category Gene number Gene number Gene number Gene number

reproduction biologicalprocess 2 8 25 13

transcription factor activity, protein binding molecularfunction 2 2 2 2

nucleic acid binding transcription factor activity molecular_function 3 4 11 8

cell killing biologicalprocess 3 2 4 2

immune system process biologicalprocess 12 25 29 12

catalytic activity molecularfunction 14 38 58 35

signal transducer activity molecular_function 5 6 23 16

structural molecule activity molecularfunction 3 2 8 4

transporter activity molecular_function 7 9 17 10

binding molecular_function 35 78 188 110

extracellular region cellularcomponent 14 25 73 47

cell cellularcomponent 39 72 186 106

behavior biologicalprocess 5 3 28 9

metabolic process biologicalprocess 28 56 129 72

electron carrier activity molecularfunction 3 2 2 2

nucleoid cellularcomponent

cellular process biologicalprocess 35 70 177 105

morphogen activity molecular_function membrane cellularcomponent 24 47 116 54 antioxidant activity molecularfunction 2 metallochaperone activity molecularfunction virion cellularcomponent 2 reproductive process biologicalprocess 2 8 25 13 biological adhesion biologicalprocess 8 9 26 13 signaling biologicalprocess 15 19 95 45 cell junction cellularcomponent 2 3 24 14 extracellular matrix cellularcomponent 2 3 13 11 protein tag molecularfunction 2 membrane-enclosed lumen cellularcomponent 7 12 27 11 multicellular organismal process biologicalprocess 20 26 109 48 developmental process biologicalprocess 19 19 98 41 macromolecular complex cellularcomponent 12 16 45 29 growth biologicalprocess 3 5 22 12 locomotion biologicalprocess 6 2 25 11 chemoattractant activity molecularfunction 2 organelle cellularcomponent 30 57 149 77 other organism cellularcomponent 7 2 other organism part cellularcomponent 7 extracellular matrix component cellularcomponent 5 extracellular region part cellularcomponent 14 22 66 40 organelle part cellularcomponent 19 32 71 42 virion part cellularcomponent 2 membrane part cellularcomponent 22 31 95 45 synapse part cellularcomponent 3 21 10 cell part cellularcomponent 39 72 185 104 single-organism process biologicalprocess 30 54 176 96 biological phase biologicalprocess 2 translation regulator activity molecularfunction synapse cellularcomponent 3 24 12 chemorepellent activity molecularfunction rhythmic process biologicalprocess 4 7 4 positive regulation of biological process biologicalprocess 17 18 86 32 negative regulation of biological process biologicalprocess 16 24 60 38 regulation of biological process biologicalprocess 27 44 142 73 response to stimulus biologicalprocess 21 44 121 57 localization biologicalprocess 16 18 75 40 multi-organism process biologicalprocess 9 22 26 13 molecular transducer activity molecularfunction 3 5 17 15 biological regulation biologicalprocess 28 46 149 77 cellular component organization or biogenesis biologicalprocess 12 15 76 40 cell aggregation biologicalprocess detoxification biologicalprocess 2 2 molecular function regulator molecularfunction 5 10 16 8 supramolecular fiber cellularcomponent 3 13 8 presynaptic process involved in synaptic transmission biologicalprocess 2 7 2

Table 2, up-regulated DEGs numbers in GO categories biological process, cellular component

and molecular function induced by HrpNEcb multi epitopic-like ligand proteins in liver and

cerebral cortex (6 and 24 hours after oral administration or 6 and 12 hours after skin smear

application) Cerebral Cerebral Cerebral Cerebral Liver, 6-hr, Liver, 24- Liver, 6- cortex, 6- cortex,24- cortex, 6- cortex, 12 oral, hr, oral, hr, skin, hr, oral, hr, oral, hr, skin, hr, skin, gene gene gene gene gene gene gene Term biological domain number number number number number number number reproduction biologicalprocess 34 31 14 5 24 34 10

transcription factor activity, protein binding molecular-function 8 11 3 2 9 12 2

nucleic acid binding transcription factor activity molecularfunction 12 21 9 8 27 37 15

cell killing biologicalprocess 2 4 2 3 2 5 2

immune system process biologicalprocess 44 88 38 16 46 51 13

catalytic activity molecularfunction 104 147 48 18 118 115 18

signal transducer activity molecularfunction 33 25 12 8 38 48 7

structural molecule activity molecularfunction 13 19 5 4 15 14 4

transporter activity molecular_function 46 50 20 10 38 36 8

binding molecularfunction 311 375 149 72 338 353 68

extracellular region cellularcomponent 94 155 61 19 102 113 23

cell cellularcomponent 322 369 138 73 315 348 64

behavior biologicalprocess 40 28 17 4 19 29 6

metabolic process biologicalprocess 200 271 112 40 224 238 46 electron carrier activity molecularfunction 2 4 2 2 nucleoid cellularcomponent 2 cellular process biologicalprocess 312 354 140 60 303 328 66 morphogen activity molecularfunction 2 membrane cellularcomponent 213 224 74 40 197 212 32 antioxidant activity molecularfunction 3 7 3 3 2 metallochaperone activity molecularfunction virion cellularcomponent 2 reproductive process biologicalprocess 34 31 14 5 24 34 10 biological adhesion biologicalprocess 33 62 16 14 49 46 9 signaling biologicalprocess 162 142 60 28 119 143 28 cell junction cellularcomponent 44 42 15 5 37 42 4 extracellular matrix cellularcomponent 11 21 6 2 16 16 5 protein tag molecularfunction 13 membrane enclosed lumen cellularcomponent 48 58 24 36 41 44 11 multicellular organismal process biologicalprocess 161 210 73 165 195 38 developmental process biologicalprocess 138 174 65 29 144 167 35 macromolecular complex cellularcomponent 94 104 38 21 70 71 16 growth biologicalprocess 27 33 13 3 27 31 9 locomotion biologicalprocess 45 54 34 10 40 43 10 chemoattractant activity molecularfunction 4 4 4 2 2 organelle cellularcomponent 236 292 113 49 229 245 47 other organism cellularcomponent 2 2 2 other organism part cellularcomponent 2 2 2 extracellular matrix component cellularcomponent 4 5 2 4 3 extracellular region part cellularcomponent 78 134 58 16 84 96 19 organelle part cellularcomponent 125 159 54 29 105 115 15 virion part cellularcomponent 2 membrane part cellularcomponent 174 179 64 35 163 175 26 synapse part cellularcomponent 43 30 11 3 24 23 3 cell part cellularcomponent 321 365 137 73 311 344 62 single-organism process biologicalprocess 296 350 132 57 300 330 62 biological phase biologicalprocess translation regulator activity molecularfunction synapse cellularcomponent 49 36 11 3 30 27 4 chemorepellent activity molecularfunction 9 12 5 2 2 rhythmic process biologicalprocess 2 8 8 2 positive regulation of biological process biologicalprocess 124 145 51 27 128 142 31 negative regulation of biological process biologicalprocess 113 129 64 22 93 122 29 regulation of biological process biologicalprocess 238 257 104 52 237 261 53 response to stimulus biologicalprocess 186 216 84 39 178 199 39 localization biologicalprocess 158 186 74 35 141 139 28 multi-organism process biologicalprocess 42 58 29 12 39 41 15 molecular transducer activity molecular_function 32 29 13 10 43 52 9 biological regulation biologicalprocess 252 280 114 55 252 278 56 cellular component organization or biogenesis biologicalprocess 137 138 54 24 112 115 23 cell aggregation biologicalprocess 2 2 2 2 detoxification biologicalprocess 3 6 4 2 molecular function regulator molecular-function 27 36 12 3 21 22 3 supramolecular fiber cellularcomponent 18 24 8 4 12 10 2 presynaptic process involved in synaptic transmission biologicalprocess 11 11 5 2 10 9 2

Table 3, up-regulated DEGs numbers in GO categories biological process, cellular component

and molecular function induced by HrpNEcb multi epitopic-like ligand proteins in thalamus and

hippocampus (6 and 24 hours after oral administration or 6 and 12 hours after skin smear

application) thalamus, thalamus, hippocamp hippocam hippocam hippocam thalamus, 6- 24-hr, 6-hr, us, 6-hr, pus,24-hr, pus, 6-hr, pus, 12-hr, hr, oral, oral, skin, oral, oral, skin, gene skin, gene gene gene gene gene gene number number Term biological domain number number number number number reproduction biologicalprocess 14 32 12 15 10 3 10 transcription factor activity, protein binding molecularfunction 5 6 6 2 2 2 nucleic acid binding transcription factor activity molecularfunction 15 20 14 15 6 3 10 cell killing biologicalprocess 2 3 2 immune system process biologicalprocess 25 48 9 21 14 5 14 catalytic activity molecularfunction 45 56 28 33 19 13 37 signal transducer activity molecularfunction 10 37 8 16 10 7 11 structural molecule activity molecularfunction 4 5 3 8 3 6 transporter activity molecularfunction 13 30 10 14 6 6 17 binding molecularfunction 110 204 74 117 62 47 113 extracellular region cellularcomponent 40 88 34 51 22 21 43 cell cellularcomponent 114 194 79 101 55 51 110 behavior biologicalprocess 12 27 4 6 6 4 6 metabolic process biologicalprocess 95 153 62 84 40 30 89 electron carrier activity molecularfunction 2 3 2 nucleoid cellularcomponent cellular process biologicalprocess 110 210 75 108 53 45 111 morphogen activity molecularfunction membrane cellularcomponent 64 123 43 69 37 30 71 antioxidant activity molecularfunction 4 5 2 2 2 metallochaperone activity molecularfunction 2 virion cellularcomponent 2 2 2 reproductive process biologicalprocess 14 32 12 15 10 3 10 biological adhesion biologicalprocess 17 39 7 22 12 4 17 signaling biologicalprocess 41 109 28 49 24 12 38 cell junction cellularcomponent 7 17 6 17 5 3 11 extracellular matrix cellularcomponent 6 19 6 12 4 6 7 protein tag molecularfunction membrane enclosed lumen cellularcomponent 19 25 15 13 9 5 15 multicellular organismal process biologicalprocess 58 114 50 73 32 24 62 developmental process biologicalprocess 55 92 44 66 21 16 53 macromolecular complex cellularcomponent 25 44 23 30 12 13 21 growth biologicalprocess 14 17 9 11 4 4 12 locomotion biologicalprocess 15 38 17 17 11 3 12 chemoattractant activity molecularfunction 3 2 organelle cellularcomponent 86 139 68 78 42 37 81 other organism cellularcomponent 2 other organism part cellularcomponent 2 extracellular matrix component cellularcomponent 3 2 5 2 3 extracellular region part cellularcomponent 34 78 29 47 20 19 40 organelle part cellularcomponent 38 52 30 33 19 16 35 virion part cellularcomponent 2 2 2 membrane part cellularcomponent 56 106 35 57 33 27 60 synapse part cellularcomponent 7 14 3 2 cell part cellularcomponent 111 193 78 101 55 50 110 single-organism process biologicalprocess 104 202 73 105 51 45 104 biological phase biologicalprocess 2 2 4 translation regulator activity molecularfunction 2 2 2 2 synapse cellularcomponent 7 19 4 4 2 3 2 chemorepellent activity molecularfunction rhythmic process biologicalprocess 9 8 2 4 3 2 2 positive regulation of biological process biologicalprocess 43 88 35 50 23 16 39 negative regulation of biological process biologicalprocess 35 79 30 46 20 14 37 regulation of biological process biologicalprocess 73 159 58 85 42 31 80 response to stimulus biologicalprocess 59 150 50 68 35 26 61 localization biologicalprocess 46 102 38 44 22 14 48 multi-organism process biologicalprocess 17 38 18 16 13 5 13 molecular transducer activity molecularfunction 11 38 8 18 11 5 16 biological regulation biologicalprocess 77 170 60 90 43 37 85 cellular component organization or biogenesis biologicalprocess 24 70 25 44 17 17 38 cell aggregation biologicalprocess 2 2 detoxification biologicalprocess 2 3 2 2 molecular function regulator molecular_function 7 26 8 11 7 3 9 supramolecular fiber cellularcomponent 3 6 3 4 2 2 6 presynaptic process involved in synaptic transmission biologicalprocess 3 4 2

Table 4, down-regulated DEGs numbers in GO categories biological process, cellular component

24 hours after oral administration or 6 and 12 hours after skin smear application) Heart, oral, Heart, oral, Heart, skin, 6-hr 24-hr 6-hr Heart, skin, 12-hr GO Term GO category Gene number Gene number Gene number Gene number

reproduction biologicalprocess 30 45 3 3

transcription factor activity, protein binding molecularfunction 5 2 2 4

nucleic acid binding transcription factor activity molecularfunction 25 22 4 2

cell killing biologicalprocess 3 3 2

immune system process biologicalprocess 37 58 7 12

catalytic activity molecular-function 68 125 13 13 signal transducer activity molecularfunction 37 52 2 9 structural molecule activity molecularfunction 10 16 3 3 transporter activity molecularfunction 29 52 5 4 binding molecularfunction 237 400 31 46 extracellular region cellularcomponent 84 199 9 14 cell cellularcomponent 241 374 31 42 behavior biologicalprocess 32 47 3 7 metabolic process biologicalprocess 164 255 22 26 electron carrier activity molecularfunction 2 2 nucleoid cellularcomponent 2 cellular process biologicalprocess 239 394 30 42 morphogen activity molecularfunction membrane cellularcomponent 165 269 24 31 antioxidant activity molecularfunction 4 5 4 metallochaperone activity molecularfunction virion cellularcomponent reproductive process biologicalprocess 30 45 3 3 biological adhesion biologicalprocess 37 63 4 10 signaling biologicalprocess 124 193 7 21 cell junction cellularcomponent 24 43 2 6 extracellular matrix cellularcomponent 12 49 2 2 protein tag molecularfunction membrane enclosed lumen cellularcomponent 22 40 6 6 multicellular organismal process biologicalprocess 141 243 15 24 developmental process biologicalprocess 121 212 16 22 macromolecular complex cellularcomponent 57 98 7 10 growth biologicalprocess 21 46 2 3 locomotion biologicalprocess 37 60 4 10 chemoattractant activity molecularfunction 3 2 2 organelle cellularcomponent 164 283 25 23 other organism cellularcomponent other organism part cellularcomponent extracellular matrix component cellularcomponent 3 14 extracellular region part cellularcomponent 76 171 8 14 organelle part cellularcomponent 68 131 12 13 virion part cellularcomponent membrane part cellularcomponent 135 236 21 26 synapse part cellularcomponent 16 28 3 cell part cellularcomponent 241 372 31 42 single-organism process biologicalprocess 231 398 28 38 biological phase biologicalprocess translation regulator activity molecularfunction 4 2 synapse cellularcomponent 18 39 3 chemorepellent activity molecularfunction 3 rhythmic process biologicalprocess 9 16 2 positive regulation of biological process biologicalprocess 107 163 9 14 negative regulation of biological process biologicalprocess 83 139 7 10 regulation of biological process biologicalprocess 188 297 16 31 response to stimulus biologicalprocess 152 255 16 27 localization biologicalprocess 102 182 10 18 multi-organism process biologicalprocess 41 49 4 8 molecular transducer activity molecularfunction 39 58 4 10 biological regulation biologicalprocess 197 313 18 32 cellular component organization or biogenesis biologicalprocess 88 168 10 16 cell aggregation biologicalprocess 2 4 detoxification biologicalprocess 2 2 molecular function regulator molecularfunction 28 31 3 4 supramolecular fiber cellularcomponent 9 19 2 presynaptic process involved in synaptic transmission biologicalprocess 6 3 2 2

Table 5, down-regulated DEGs numbers in GO categories biological process, cellular component

application)

Cerebral Cerebral Cerebral Cerebral

Liver, 6- Liver, 24- Liver, 6- cortex, 6- cortex,24- cortex, 6- cortex, 12 hr, oral, hr, oral, hr, skin, hr, oral, hr, oral, hr, skin, hr, skin, gene gene gene gene gene gene gene Term biological domain number number number number number number number

reproduction biologicalprocess 24 17 30 58 96 92 40

transcription factor activity, protein binding molecular_function 10 8 13 13 20 20 11

nucleic acid binding transcription factor activity molecularfunction 25 18 25 30 58 56 25

cell killing biologicalprocess 2 4 2 3 2 2

immune system process biologicalprocess 40 41 44 57 95 87 40

catalytic activity molecularfunction 153 117 103 107 212 227 95

signal transducer activity molecularfunction 26 33 24 60 117 117 63

structural molecule activity molecularfunction 5 5 7 9 19 21 7

transporter activity molecular-function 31 22 31 48 89 100 49 binding molecularfunction 300 238 233 365 721 760 308 extracellular region cellularcomponent 98 63 54 120 240 209 90 cell cellularcomponent 297 247 236 360 679 741 304 behavior biologicalprocess 15 17 20 45 100 97 58 metabolic process biologicalprocess 254 202 185 237 484 493 199 electron carrier activity molecularfunction 4 2 3 2 nucleoid cellularcomponent 3 cellular process biologicalprocess 290 228 226 365 707 728 307 morphogen activity molecularfunction membrane cellularcomponent 177 143 140 246 477 511 216 antioxidant activity molecularfunction 2 2 2 2 3 4 3 metallochaperone activity molecularfunction 2 virion cellularcomponent 2 2 reproductive process biologicalprocess 24 17 30 58 96 92 40 biological adhesion biologicalprocess 22 27 40 54 94 86 35 signaling biologicalprocess 124 89 98 177 356 348 157 cell junction cellularcomponent 24 17 19 34 81 89 33 extracellular matrix cellularcomponent 13 9 12 23 48 33 15 protein tag molecularfunction membrane enclosed lumen cellularcomponent 55 47 43 41 77 88 34 multicellular organismal process biologicalprocess 150 111 113 226 411 411 185 developmental process biologicalprocess 134 101 100 183 351 340 151 macromolecular complex cellularcomponent 64 49 62 84 158 167 72 growth biologicalprocess 19 19 17 35 69 60 29 locomotion biologicalprocess 20 23 31 55 110 102 52 chemoattractant activity molecularfunction 2 2 3 2 2 organelle cellularcomponent 233 191 182 250 482 510 205 other organism cellular component 2 2 other organism part cellularcomponent 2 2 extracellular matrix component cellularcomponent 3 3 3 9 14 11 6 extracellular region part cellularcomponent 83 57 45 95 190 161 68 organelle part cellularcomponent 131 106 98 115 222 246 106 virion part cellularcomponent 2 2 membrane part cellularcomponent 137 112 113 210 413 437 184 synapse part cellularcomponent 9 8 9 24 50 53 23 cell part cellularcomponent 296 246 236 358 677 739 304 single-organism process biologicalprocess 295 224 209 357 688 703 299 biological phase biologicalprocess 2 2 2 2 translation regulator activity molecularfunction 2 synapse cellularcomponent 11 12 11 31 65 68 29 chemorepellent activity molecularfunction 2 2 2 4 2 3 rhythmic process biologicalprocess 8 15 15 16 32 34 19 positive regulation of biological process biologicalprocess 123 86 101 143 300 294 130 negative regulation of biological process biologicalprocess 96 77 89 131 254 237 104 regulation of biological process biologicalprocess 213 148 166 281 549 548 228 response to stimulus biologicalprocess 185 153 143 221 433 428 195 localization biologicalprocess 99 70 98 161 301 308 146 multi-organism process biologicalprocess 30 32 42 58 91 87 40 molecular transducer activity molecularfunction 23 32 22 61 112 114 62 biological regulation biologicalprocess 226 158 174 298 584 584 247 cellular component organization or biogenesis biologicalprocess 103 76 71 134 258 259 123 cell aggregation biologicalprocess 2 2 6 4 2 detoxification biologicalprocess 2 2 2 2 2 2 molecular function regulator molecularfunction 29 17 22 28 80 74 29 supramolecular fiber cellularcomponent 11 14 8 12 19 25 9 presynaptic process involved in synaptic transmission biologicalprocess 3 2 2 8 16 14 11

Table 6, down-regulated DEGs numbers in GO categories biological process, cellular component and molecular function induced by HrpNEcb multi epitopic-like ligand proteins in thalamus and hippocampus (6 and 24 hours after oral administration or 6 and 12 hours after skin smear application) thalamus, hippocam hippocam hippocam hippocamp thalamus, 24-hr, thalamus, pus, 6-hr, pus,24-hr, pus, 6-hr, us, 12-hr, 6-hr, oral, oral, 6-hr, skin, oral, oral, skin, gene skin, gene gene gene gene gene gene number number Term GOnamespace number number number number number

reproduction biologicalprocess 13 32 12 15 10 3 10

transcription factor activity, protein binding molecularfunction 4 6 6 2 2 2

nucleic acid binding transcription factor activity molecularfunction 11 20 14 15 6 3 10

cell killing biologicalprocess 3 2

immune system process biologicalprocess 19 48 9 21 14 5 14

catalytic activity molecular_function 14 56 28 33 19 13 37

signal transducer activity molecularfunction 12 37 8 16 10 7 11

structural molecule activity molecular_function 2 5 3 8 3 6

transporter activity molecularfunction 11 30 10 14 6 6 17

binding molecularfunction 76 204 74 117 62 47 113

extracellular region cellularcomponent 23 88 34 51 22 21 43

cell cellularcomponent 72 194 79 101 55 51 110

behavior biologicalprocess 6 27 4 6 6 4 6

metabolic process biologicalprocess 51 153 62 84 40 30 89 electron carrier activity molecular-function 2 2 3 2 nucleoid cellularcomponent cellular process biologicalprocess 72 210 75 108 53 45 111 morphogen activity molecularfunction membrane cellularcomponent 45 123 43 69 37 30 71 antioxidant activity molecularfunction 5 2 2 2 metallochaperone activity molecularfunction 2 virion cellularcomponent 2 2 2 reproductive process biologicalprocess 13 32 12 15 10 3 10 biological adhesion biologicalprocess 8 39 7 22 12 4 17 signaling biologicalprocess 36 109 28 49 24 12 38 cell junction cellularcomponent 8 17 6 17 5 3 11 extracellular matrix cellularcomponent 2 19 6 12 4 6 7 protein tag molecularfunction membrane enclosed lumen cellularcomponent 13 25 15 13 9 5 15 multicellular organismal process biologicalprocess 38 114 50 73 32 24 62 developmental process biologicalprocess 32 92 44 66 21 16 53 macromolecular complex cellularcomponent 20 44 23 30 12 13 21 growth biologicalprocess 7 17 9 11 4 4 12 locomotion biologicalprocess 12 38 17 17 11 3 12 chemoattractant activity molecularfunction 2 organelle cellularcomponent 53 139 68 78 42 37 81 other organism cellularcomponent 2 other organism part cellularcomponent 2 extracellular matrix component cellularcomponent 3 2 5 2 3 extracellular region part cellularcomponent 20 78 29 47 20 19 40 organelle part cellularcomponent 23 52 30 33 19 16 35 virion part cellularcomponent 2 2 2 membrane part cellularcomponent 38 106 35 57 33 27 60 synapse part cellularcomponent 6 14 3 2 cell part cellularcomponent 72 193 78 101 55 50 110 single-organism process biologicalprocess 70 202 73 105 51 45 104 biological phase biologicalprocess 2 4 translation regulator activity molecular-function 2 2 2 synapse cellularcomponent 6 19 4 4 2 3 2 chemorepellent activity molecularfunction 2 rhythmic process biologicalprocess 3 8 2 4 3 2 2 positive regulation of biological process biologicalprocess 36 88 35 50 23 16 39 negative regulation of biological process biologicalprocess 33 79 30 46 20 14 37 regulation of biological process biologicalprocess 61 159 58 85 42 31 80 response to stimulus biologicalprocess 48 150 50 68 35 26 61 localization biologicalprocess 32 102 38 44 22 14 48 multi-organism process biologicalprocess 12 38 18 16 13 5 13 molecular transducer activity molecularfunction 13 38 8 18 11 5 16 biological regulation biologicalprocess 62 170 60 90 43 37 85 cellular component organization or biogenesis biologicalprocess 27 70 25 44 17 17 38 cell aggregation biologicalprocess 2 2 detoxification biologicalprocess 2 3 2 2 molecular function regulator molecularfunction 9 26 8 11 7 3 9 supramolecular fiber cellularcomponent 2 6 3 4 2 2 6 presynaptic process involved in synaptic transmission biologicalprocess 4 2

5. KEGG pathways enrichment of DEGs induced by HrpNEcb multi epitopic-like ligand protein. Kyoto encyclopedia of genes and genomes (KEGG) is a database for systematic analysis of gene function and genome information. It integrates genomics, biochemistry and phylogenomics information, and facilitates researchers to study genes and their expression processes as a network. The key feature of KEGG is to link genes with various biochemical reactions, providing integrated metabolic pathways. KEGG is an integrated database resource consisting of sixteen databases. They are classified into three categories: systematic information, genomic information and chemical information. In organisms, different gene products coordinate with each other to perform biological functions. Pathway annotation analysis of differentially expressed genes is helpful for further understanding of gene functions. KEGG pathways enrichment of DEGs induced by HrpNEcb multi epitopic-like ligand protein were performed to obtain the roles (upstream and downstream relationships) and biological functions of these DEGs in signaling pathways, and further understand the relationship between genes and functions.

The results demonstrated that HrpNEcb multi epitopic-like ligand protein, as a kind of ligand

protein with multi-epitope special structure, novel function, novel mechanism of action and

novel application prospect, induced the differential expression of multiple genes in multiple

organs of mice (liver, thalamus, heart, cerebral cortex and cerebral hippocampus, etc.). These

DEGs were involved in cellular process, environmental information processing and genetic

information processing, metabolism, organismal systems and other functional pathways. The

results of KEGG enrichment analysis of differentially expressed genes induced by HrpNEcb

multi epitopic-like ligand protein revealed that those DEGs involved in the following KEGG

categories: (1) cellular process: enriched DEGs were involved in cellular processes such as

transport and catabolism, cell population, cell activity, cell growth and death (see Figure 12 to

Figure 64 for details); (2) environmental information processing: enriched DEGs were involved

in signal molecules and interactions, signal transduction, membrane transport and other

environmental information processing processes (see Figure 12 to Figure 64 for details); (3)

genetic information processing: enriched DEGs were involved in the biological processes of

translation, replication and repair, folding, classification and degradation (see Figure 12 to Figure

64 for details); (4) metabolism: enriched DEGs were involved in biological degradation and

metabolism, nucleotide metabolism and other amino acid metabolism, metabolism of cofactors

and vitamins, lipid metabolism, biosynthesis and metabolism of sugar, global and overview map,

energy metabolism, carbohydrate metabolism and metabolic processes such as amino acid

metabolism (see figure 12 to figure 64 for details); (5) organismal systems: enriched DEGs were

involved in the sensory system, nervous system, immune system, excretory system,

environmental adaptation, endocrine system, digestive system, developmental circulatory system

and other cellular processes (see Figure 12 to Figure 64 for details). The number of DEGs in

each KEGG pathway was counted and graphically displayed in Figure 12 to Figure 64.

Example 5,

pull-down assay of HrpNEcb protein recognition and binding to receptor proteins and membrane

proteins.

1. Sample preparation and processing.

1). Purification of HrpNEcb multi-epitope ligand protein

The HrpNEcb-His recombinant protein was purified using NI-NTA agarose gel column. The

protein purification was performed according to the manufacturer provided method. Purified

HrpNEcb-His recombinant protein was used in pull-down experiments (hereinafter referred to as

capture protein or target protein).

2). Extraction of cultured hepatocyte total protein (hereinafter referred to as bait protein).

I. Total protein extraction of cultured hepatocytes: (1) lysate (IP specific lysate with 1xcocktail

protease inhibitors) was added the cells using pipette followed by sonication and kept on ice for

more than 2 hours to lysis the cells. (2) sonication was performed as sonicating for 2 sec and set

on ice for 5 sec, total 1 min. The samples were set on ice for more than 2h (oscillating using

oscillator at 30 min interval). (3) the cell lysates were centrifuged at 13,000rpm for 15 min at

4°C, and the supernatant was transferred to a new 1.5mL EP tube and kept on ice. (4) the protein

extracts were centrifuged again at 1,3000rpm for 5 min at 4°C, and the solution in the middle

layer was carefully sucked out and transferred to a new 1.5 mL EP tube. The solution was kept at

4°C until use.

II. Measure protein concentration: The concentration of extracted protein solution was measured

using BCA protein concentration measure kit.

NO. Sample Experiment concentration volume(L Total protein name number ( tg/pL) (Qpg)

1 HEPG2 HEPG2 8.34 2,500 20,861.30

2. pull-down experiment procedure

1), Immobilized streptavidin preparation. (1), Prepare the PierceTM spin columns and collection tubes. (2), Thoroughly resuspend the Immobilized Streptavidin by inverting the tube several times. Pipette 50L of the gel slurry into each labeled spin column and place them in the Collection Tubes, plug the bottom plug of columns and put it in the collection tubes. (3), Add 250pL of the TBS to each of the spin columns. Place the top screw caps on the columns and mix by gently inverting the columns 4 times. (4), Remove the columns' screw caps. Place columns in the Collection Tubes, and centrifuge at 1,250 x g for 50 sec, discard the liquid in the collection tube, and reinsert the spin column into the collection tube. (5) Repeat Steps 3 and 4 two additional times. Apply bottom plugs to the columns.

2), Bait Protein Immobilization. (1) Add biotin and biotinylated bait protein to the spin column tube, tighten the top cap and bottom plug. (2) Shake gently on a rotating platform, incubate at 4°C for 60 min. (3), After the incubation, remove the top cover and bottom plug of the spin columns and put them into the collection tubes. (4) After centrifugation at 1,250 x g for 60 sec, put the spin column tube back into the collection tube.

3), Biotin Blocking. (1), Add 250 pl of biotin blocking solution to the spin colums. Tighten the top cover and bottom plug, gently invert 4 times to mix well. (2), Incubate at room temperature for 5 min. Remove the top cover, place the spin column into collecting tubes, and centrifuge at 1,250 x g for 50 sec. (3) Repeat step 1 and step 2. (4), Add 250 l TBS to the spin columns. Place the top screw caps on the columns and mix by gently inverting the column 4 times. (5) Remove top screw caps from columns. Place columns in collection tubes and centrifuge at 1,250 g for 50 sec. (6) Repeat Step 3 and Step 4 twice and put the spin columns back into the collection tubes.

4), Biotin labeling. Prey protein capture. (1), Add 300 pL (1 mg protein) of prey protein (target protein) sample solution to the spin columns and tighten the top cap. (2), Incubate at 4°C overnight with gentle rocking motion on rotating platform. (3), After incubation, remove top cap from the spin columns, then remove the bottom plug from the columns and place into the pre labeled tubes. (4),_Centrifuge tube at 1,250 g for 60 seconds, mark the collection tubes as prey flow-through (B). (5), Remove spin columns from the collection tubes (B), secure the caps and set the tubes aside for later evaluation. Place the spin columns in separate collection tubes for washing.

5), Spin Column Wash. Elution of the prey protein and target protein complex. (1), Add 250tL

of Wash Buffer to each spin column. Secure the top screw caps onto the columns and mix by

gently inverting the columns 6 times. (2), Incubate spin columns for 1 minute at room

temperature. Remove the top screw caps from the columns, place columns in

"waste" collection tubes and centrifuge at 1,250g for 50 sec. Repeat Steps 1-2, three additional

times. (3), During the washing steps, label a series of collection tubes "wash 1 ... , wash 3.

(4), For the last wash, 200 tl Wash Buffer was added and the liquid in tube was transferred to

1.5 mL tube along with the beads. (5), In a new centrifuge tube, 170 tl supernatant was

discarded after centrifugation, and this step was repeated three times. (6),

5), Examination: (1), After remove the liquid above Sepharose, add 20pl x protein

electrophoresis loading buffer, boil for 5 min and put into -20°C refrigerator for later use. (2),

The samples were examined by SDS-PAGE and Western blot analysis.

3. Results analysis.

1), HrpNEcb multi-epitope ligand protein recognizes and binds to membrane receptors including

HLA-A major histocompatibility complex, class I, A receptors, LGALS3BP galactose-3 binding

protein (receptor), LAMP2 lysosomal associated membrane protein 2 receptor, GNB2 G guanine

nucleotide binding protein subunit Beta 2 receptor, LRRC15 (Leucine-rich repeat-containing

protein 15) receptor, KTN1 (Kinectin 1).

2), HrpNEcb multi-epitope ligand protein recognizes and binds to 11 membrane proteins

including DSG4 desmosomal core protein, ANXA4 annexin A4, CAPRIN1 cyclin, lUTRN

dystrophin protein, PININ desmosomal associated protein, VAMP Vesicle associated membrane

proteins, VCL vinculin, Ezrin Ezeze-epithelial cadherin, PKP3 Plakophilin-3, TM9SF2 transmembrane 9 superfamily member 2 and NAALAD2 N-acetylated a-linked acid dipeptidase 2.

3), HrpNEcb multi-epitope ligand protein recognized and bound membrane proteins involved in 13 signaling pathways: Including hsa04152: AMPK signaling pathway, hsa03460: Fanconi anemia pathway, hsa03320: PPAR signaling pathway, hsa04O71: sphingolipid signaling pathway, hsa04014: Ras signaling pathway, hsa04151: PI3K-Akt signaling pathway, hsa04310: Wnt signaling pathway, hsa04062: chemokine signaling pathway, hsa04015: Rap1 signaling pathway, hsa04024: cAMP signaling pathway, hsa04915: estrogen signaling pathway, hsa04910: insulin signaling pathway, hsa04390: hippo signaling pathway.

4), HrpNEcb multi-epitope ligand protein recognized and bound membrane proteins involved 23 metabolic pathways related to antiviral, anti-bacterial, anti-foreign body and anti-inflammation. They are: hsa04144 endocytosis, hsa04145 phagosomes, hsa04142 lysosomes, hsa01130: biosynthesis of antibiotics, hsa05131: Shigellosis, hsa04612: Antigen handling and presentation, hsa05130: pathogenic Escherichia coli infection, and hsa05100: bacterial invasion of epithelial cells, hsa05132: Salmonella infection, hsa05169: Barr virus infection, hsa05168: herpes simplex virus 1 infection, hsa05203: viral carcinogenesis, hsa05166: HTLV-I infection, hsa05164: influenza A, hsa05134: Legionnaires' disease, hsa05160: hepatitis C, hsa05162: measles, hsa05133: whooping cough, hsa05322: systemic lupus erythematosus, hsa04670: transepithelial migration of leukocytes, hsa05146: Amoebiasis, hsa05142: Chagas disease, hsa05200: Pathway in cancer.

5), HrpNEcb multi-epitope ligand protein recognized, and bound membrane proteins involved three important metabolic pathways related to neurological diseases including hsa05012: Parkinson's disease, hsa05016: Huntington's Disease, and hsa05010: Alzheimer's disease.

6), HrpNEcb multi-epitope ligand protein recognized, and bound membrane proteins involved in 30 pathways involved in nucleic acid, protein, amino acid, sugar and fat metabolism. These are hsa03420: nucleotide excision repair, hsa00970: aminoacyl biosynthesis, hsa03430: mismatch repair, HSA01210:2-oxocarboxylic acid metabolism, hsa03440: homologous recombination, hsa04360: axonal guidance, hsaOO051: fructose and mannose metabolism, and hsa005 65: ether lipid metabolism, hsa00510: N-polysaccharide biosynthesis, and hsa04110: cell cycle, hsa03030: DNA replication, hsa03013: RNA transport, hsa03018: RNA degradation, hsa03O4O: spliceosome, hsa03010: ribosome, hsa04141: ER protein processing, hsa04810: Regulation of the actin skeleton, hsa03O5: proteasome, hsa01230: amino acid biosynthesis, hsa00190: Oxidative phosphorylation, hsa049 32: Non-alcoholic fatty liver disease (NAFLD), hsaOO020: citric acid cycle, hsa00564: Glycerol phospholipid metabolism, hsa03008: Biogenesis of eukaryotic ribosomes, hsa03015: mRNA monitoring pathway, hsa01200: carbon metabolism, hsa00520: amino sugar and nucleotide sugar metabolism, hsa05034: alcoholism, hsa04120: Ubiquitin mediated proteolysis, hsa05205: Proteoglycans in cancer, hsa05206: micro RNAs in cancer.

7), HrpNEcb multi-epitope ligand protein recognized, and bound membrane proteins involved in 19 metabolic pathways related to cell connection, nerve connection, vascular, endocrine and reproductive system including hsa04723: Retrograde neural signaling, hsa04726: Serotonin activated synapses, hsa00900: Backbone of terpenoid biosynthesis, hsa04520: Adhesion knot, hsa05032: Morphine addiction, and hsa04510: focal adhesion, hsa04724: Glutamatergic synapses, hsa04530: tightjunctions, hsaOO830: retinol metabolism, hsa04l14: oocyte meiosis, hsa04728: dopaminergic synapses, hsa00100: steroid biosynthesis, hsa04261: adrenergic signaling in cardiomyocytes, hsa047 27: Neuronal synapse, hsa04725: cholinergic synapse, hsa04540: gap junction, hsa04971: Gastric acid secretion, hsa04713: circadian entrainment, hsa04931: insulin resistance.

As a class of ligand protein molecules rich in special multiple linear and conformational epitope structures, HrpNEcb multi-epitope ligand protein can across species boundaries to recognize and bind multiple types of membrane receptors and membrane protein that involved in signal pathways and metabolic pathways. Further analysis of the location, structure, properties, mechanism of action and function of these membrane receptors, membrane proteins, signal pathways and metabolic pathways revealed thatthey widely involve and affect life basic properties including growth, development, metabolism, defense and programmed cell death. They also widely involved in diagnosis, prevention, treatment, rehabilitation of diseases and conditions of nervous system, digestive system, sports system, circulatory system, respiratory system, endocrine system, immune system, urinary system, reproductive system and dermal system. Thus, HrpNEcb protein is a special multi-epitope ligand protein with novel functions, novel mechanisms of action and novel application prospects.

Example 6.

Preparation of the HrpNEch protein, using E. coli strain BL21(DE3) harboring EcbCSL101hrpNEch gene (GenBank: AY999000.1) cloned in expression vector PET28a(+), through fermentation and purification. It includes the following steps:

1) Fermentation. Preparation of HrpNEch protein by bacteria fermentation using E.coli strain BL21(DE3) harboring the plasmids encoding genes of HrpNEch proteins (including, but not limited to, genes from biological samples, synthesis genes, genetically modified recombinant genes, similar genes and their gene modifications). BL21(DE3) harboring plasmid was grown in LB medium with 50 mg/L of kanamycin. When the bacterial culture reached OD600=0. 7 at certain temperature, IPTG (isopropyl p-D-1-thiogalactopyranoside) was added to a final concentration of 1 mMol. The bacteria were collected by centrifugation after 7-9 hours growth. The expressed HrpNEch protein product was analyzed by 10% SDS-PAGE polyacrylamide gel electrophoresis. A 34.15 kDa band appeared in the lane of the electrophoresis gel, which was the expressed product of HrpNEch protein.

2) Post-treatment after fermentation. (1) sterilization, the bacterial culture was sterilized at 80°C for 30 minutes, and then rapidly cooled to below 30°C; (2) washing, wash with glucose Na2HPO4-KH2PO4 buffer (pH 5-5.5) with glucose (200-300 mmol). The bacteria were washed five to eight times in a continuous flow centrifuge. (3) break bacterial cells, the bacteria were diluted with Na2HPO4-KH2PO4 buffer (pH 5-5.5) with glucose (200-300 mmol), and the fresh weight of the bacteria was adjusted to 20%-30% of the diluent. The bacteria were introduced into the high pressure cell crusher, and the pressure of 800-10Mpa was continuously used to break the engineered bacteria

3) The broken bacteria solution was passed into a continuous flow centrifuge to remove the cell debris. The centrifugal force range was 1000-8000g, preferably, 1000-2000g, preferably, 2000-

3500g, preferably, 8000-6000g, preferably, 6000-4500g. The optimal centrifugal force is 3500 4500g. The HrpNEch multi epitopic-like ligand protein was present in the supernatant.

4) Purification of HrpNEcb multi epitopic-like ligand protein. HrpNEch-His recombinant protein was purified using NI-NTA agarose gel column. The protein purification was carried out according to the recommended method of NI-NTA agarose gel column manufacturer.

Example 7

HrpNEch protein is prepared by the expression of "synthetic gene", which includes the following steps

Step 1: synthesis of hrpNEch gene according to the nucleotide sequence (GenBank: AY999000.1) which encoding HrpNEch protein. The DNA sequence is:

1 atgcaaatta egatcaaage geacategge ggtgatttgg gegtetegg tctggggctg 61 ggtgctcagg gactgaaagg actgaattec geggcttcat cgctgggttecagegtggat 121 aaactgaga geaccatga taagttgacc tccgcgctga cttcgatgat gtttggcggc 181 gcgctggcgc aggggctggg cgccagtcg aaggggctgg ggatgagcaa tcaactgggc 241 cagtctttcg gaatggcgc gagggtgcg agcaacctgc tatccgtacc gaaatccggc 301 ggcgatggt tgtcaaaaat gtttgataaa gcgctggacg atctgtggg tatgacacc 361 gtgaccaagc tgactaacca gagcaaccaa ctggctaatt caatgtgaaegccagcag 421 atgacecagg gtaatatgaa tgcgtteggc agcggtgtga acaacgcact gtcgtccatt 481 ctcggcaacg gtctcggcca gtcgatgagt ggcttctctc ageettetet gggggcagg 541 ggcttgcagg geotgagegg cgcgggtga ttcaaccagt tgggtaatgc catggcatg 601 ggcgtggggc agaatgctgc gctgagtgcg ttgagtaacg teagcaccca cgtagacggt 661 aacaaccgcc actttgtaga taaagaagat cgcggcatgg cgaaagagat cggccagttt 721 atggatcagt atccggaaat atteggtaaa ccggaatacc agaaagatgg ctggagtteg 781 ccgaagacgg acgacaaatc ctgggctaaa gegetgagta aaccggatga tgacggtatg 841 accggcgcca gcatggacaa atteegtcag gegatgggta tgatcaaaag cgcggtggcg 901 ggtgataccg gcaataccaa cctgaacctg cgtggcgcgg gcggtgcatc gctgggtatc 961 gatgcggctg tcgtcggcga taaaatagcc aacatgtcgc tggtagctgc caacgctga

Step 2: BamHI and HindlI restriction sites were added to the 5 'and 3' of the gene, respectively, to facilitate protein gene cloning.

Step 3: gene synthesis was performed by GeneArt gene synthesis and services division of Thermo Fisher Scientific. The synthesized DNA fragment encoding HrpNEch protein was cloned into the BamHI-HindIIIsites of expression vector PET28a(+) (with His-tag), and the accuracy of cloning was ensured by DNA sequencing.

Step 4: preparation of HrpNEch protein by bacteria fermentation using E.coli strain BL21(DE3)

Na2HPO4-KH 2PO 4 buffer system (pH6.5-5.5) was used in medium. The glucose concentration in

medium was 0.01%-0.05% and lactose concentration in medium was 0.5%-0.4%.

Na2HPO4-KH 2PO 4 buffer (pH 5-5.5) with glucose (200-300 mmol). The bacteria were washed

diluted with Na 2HPO 4-KH 2PO4 buffer (pH 5-5.5) with glucose (200-300 mmol), and the fresh

the high pressure cell crusher, and the pressure of 800-1000Mpa was continuously used to break

in the supernatant.

Step 6: purification of HrpNEch multi epitopic-like ligand protein. HrpNEch-His recombinant

according to the recommended method of NI-NTA agarose gel column manufacturer.

The over-expressed and purified HrpNEch protein-His recombinant protein was detected in 10%

SDS-PAGE gel electrophoresis, as shown in Figure 67. The left lane loaded with molecular weight standards. lane 1 showed the cell lysis of E. coli BL21(DE3) expressing HrpNEch. An over-expressed 34.15kDa protein band was present which corresponding to the molecular weight of HrpNEch. lane 2 showed purified HrpNEch protein with molecular mass of 34.15 kDa.

Figure 68 showed hypersensitive reaction (HR) tests of purified HrpNEch protein. The tobacco leaf infiltrated with 100pL of HrpNEch protein solution (300pg/ml) caused typical HR symptoms (upper half leaf) but water infiltration cause no reaction (lower half leaf). These results demonstrated that over-expressed and purified HrpNEch protein remained biological function.

Furthermore, purified HrpNEch multi epitopic-like ligand protein can generally trigger hypersensitive reactions in leaves of various plants. The plant species to test HR reaction could be tobacco, pepper, eggplant, tomatoe, potato, strawberry, cucumber, water spinach, cockscomb, September chrysanthemum, pansy, rouge flower, petunias, grape, chinese rose, locust tree, pea, peach, shower, towel gourd, green beans, broccoli, spinach, cole, yam, black-eyed peas, beans, corn, rice, soybean, sowbread, mulberry, pumpkin, loquat, tree of heaven etc.

Example 8 mRNA sequencing (mRNA-Seq) of cells from mice treated with HrpNEch multi epitopic-like ligand protein. mRNA-seq is a powerful tool to analyze the cell transcriptome profile. The research object of mRNA sequencing is all the RNAs with ploy-A tail that can be transcribed by a specific cell in a certain functional state, mainly for mRNA. The mRNAs produced by the cell are converted to cDNA by reverse transcription process for library preparation. The resulting DNA is then sequenced and, from the observed abundance of a particular DNA, the original amount of mRNA in the cell is inferred to find genes or transcripts whose transcript levels have changed under the experimental conditions, that is, differentially expressed. By finding these differentially expressed genes (DEGs) and transcripts, the abundance of almost all mRNA expression in a specific tissue or organ of a species in a certain state can be obtained comprehensively and rapidly. mRNA-Seq technique has been widely used in biologic researchs and drug development. Using mRNA-seq technology, we demonstrated that HrpNEch multi epitopic-like ligand protein induced differential expression of multiple genes in multiple mouse organs.

1, Experimental animal samples:

Huayin Biomedical Technology Co., LTD.

Experimental samples treatment: Twelve of 8-week-old balb/C mice were used for HrpNEch

were used in the blank control group. The sham-operated group (buffer without HrpNEch

treatment group were treated as oral administration or skin smear application with HrpNEch

treated as oral administration or skin smear application with buffer without HrpNEch protein.

and at different time points, the cerebral cortex, thalamus, hippocampus, liver, heart and other

tissues of mice were respectively harvested for mRNA seq experiments. All experiments were

performed with three replicates.

2, mRNA-Seq:

Experiments were performed as shown in the flow chart in figure 79.

1. RNA extraction and quality inspection.

manufacturer provided procedures. Total RNAs was examined by NanoDrop ND-2000

and used for subsequent sequencing experiments.

II. Library construction and quality inspection.

adaptor, and amplification. The constructed libraries were detected by Qubit® 2.0 Fluorometer

for concentration and Agilent2100 for size.

III. Sequencing.

into sequencing peak by computer software.

IV. Analysis of mRNA sequencing data.

Analysis was performed were performed as shown in the flow chart figure 80.

3. Data analysis. Identification of differentially expressed genes (DEGs) induced by HrpNEch multi epitopic-like ligand protein. Firstly, fragment counts were normalized. P-value was calculated according to the hypothesis test model, and finally p-value multiple hypothesis test was corrected to obtain FDR value. The Fold-change of FP KM value was calculated using edgeR software. DEGs selecting conditions were p-value < 0.05 and fold-change > 2. Volcano plots of DEGs induced by HrpNEch multi epitopic-like ligand protein.

Volcano plots of DEGs were used to show the overall distribution of genes with significant

expression differences induced by HrpNEch multi epitopic-like ligand proteins. The x-axis

shows log2fold-changes in expression and y-axis shows statistical significance (-log10 of the p

value). Down-regulated transcripts are plotted on the left, up-regulated transcripts on the right.

Figures 69-70 show volcano plots of DEGs induced by oral administration and skin smear

application of HrpNEch multi epitopic-like ligand in testis and kidney of mice, respectively.

HrpNEch is abbreviated as N2 in the figures.

Heat map of the transcriptomic response induced by HrpNEch multi epitopic-like ligand protein.

The DEGs sets were clustered and analyzed. Grouping genes with similar expression patterns together suggests that genes share a common function or are involved in a common signaling pathway. The logO(FPKM+1) value was transformed into a normalized scale number and clustered. Figure 71-72 showed the clustering heat map of differentially expressed genes in testis and kidney, respectively. HrpNEch is abbreviated as N2 in the figure. Gene Ontology (GO) enrichment of DEGs induced by HrpNEch multi epitopic-like ligand protein. Gene Ontology is a widely used ontology in the field of bioinformatics. Gene ontology is a description of genes in different dimensions and levels, covering biological process, cellular component and molecular function. Biological process explains that the gene is involved in what biological process. Cellular component explains where the gene is present. The locations relative to cellular structures in which a gene product performs a function, either cellular compartments or stable macromolecular complexes of which they are parts. Molecular function explains what is the function of the gene at the molecular level, describes its activity in individual molecular biology, such as catalytic activity or binding activity. The Gene Ontology knowledgebase is the world's largest source of information on the functions of genes. This knowledge is both human readable and machine-readable, and is a foundation for computational analysis of large-scale molecular biology and genetics experiments in biomedical research. Gene Ontology is constructed by the GO organization (Gene Ontology Consortium) in 2000. The aim is to establish a standard vocabulary system for the knowledge of genes and their products. It covers the biological process, cellular component and molecular function of genes. Term is the basic description unit in GO. GO terms are used to describe the function of a gene product. Through GO enrichment analysis of DEGs, genes can be classified according to different functions, so as to achieve the purpose of annotation and classification of the base factors. We performed GO term enrichment analysis on DEGs induced by HrpNEch multi epitopic-like ligand proteins. The results demonstrated that HrpNEch multi epitopic-like ligand protein is a kind of ligand protein with multiple epitope special structures, novel functions, novel mechanism of action and novel application prospects. It induced differential expression of multiple genes in liver, thalamus, heart, cerebral cortex and hippocampus of treated mice. These differentially expressed genes covered biological process, cellular component and molecular function. The results of GO enrichment analysis of differentially expressed genes induced by HrpNEch multi epitopic-like ligand protein were further described as follows: biological process related DEGs included reproduction, cell death, the immune system, behavior, metabolism, cell processes, reproductive process, biological adhesion, signals, cell biological processes, development, growth, movement, individual tissue process, the process of biofacies, rhythmic process, positive regulation of biological process, negative regulation of biological process, regulation of biological process, stimulus response, localization, bioregulation, cellular component organization or biogenesis, cell aggregation, detoxification, and presynaptic process involved in synaptic transmission, etc.

(Table 8-11). Cellular component related DEGs included nuclear membrane, virus particles, cells

and extracellular matrix, cell membrane closed cavity, complex macromolecules and organelles,

extracellular matrix components, extracellular region, organelles parts, components, virus

particles membrane components, synapses, cell components, synapses, and cellular

supramolecular fibers etc. (Table 8-11). DEGs related to molecular function included

transcription factor activity, protein and nucleic acid in combination with the activity of

transcription factors, catalytic activity, signal sensor, molecular structure, transport, binding,

electronic carrier activity, forming activity, antioxidant activity, metal chaperone activity, protein

markers, chemical enticement, translational control, chemical repellent activity, Active

molecular sensor, molecular function regulation etc. (Table 8-11).

Table 8, up-regulated DEGs numbers in GO categories biological process, cellular component

and molecular function induced by HrpNEch multi epitopic-like ligand proteins in kidney (6 and

24 hours after oral administration or 6 hours after skin smear application) Kidney, oral, kidney, oral, kidney, skin, 6-hr 24-hr 6-hr GO Term GO category Gene number Gene number Gene number

reproduction biologicalprocess 131 3 12

cell killing biologicalprocess 11

immune system process biologicalprocess 262 8 16

behavior biologicalprocess 109 6 10

metabolic process biologicalprocess 817 37 84 cellular process biologicalprocess 1137 47 102 reproductive process biologicalprocess 131 3 12 biological adhesion biologicalprocess 206 16 12 signaling biologicalprocess 547 26 47 multicellular biologicalprocess 664 32 56 organismal process developmental process biologicalprocess 607 28 46 growth biologicalprocess 111 6 9 locomotion biologicalprocess 207 13 8 single-organism biologicalprocess 1094 45 102 process biological phase biologicalprocess 3 rhythmic process biologicalprocess 39 2 3 positive regulation of biologicalprocess 531 23 37 biological process negative regulation of biologicalprocess 433 19 39 biological process regulation of biological biologicalprocess 883 39 80 process response to stimulus biologicalprocess 732 35 63 localization biologicalprocess 527 20 45 multi-organism process biologicalprocess 212 9 15 biological regulation biologicalprocess 924 39 86 cellular component biologicalprocess 449 16 25 organization or biogenesis cell aggregation biologicalprocess 5 2 detoxification biologicalprocess 3 presynaptic process biologicalprocess 11 involved in synaptic transmission extracellular region cellularcomponent 435 24 39 cell cellularcomponent 1138 45 118 nucleoid cellularcomponent 3 membrane cellularcomponent 774 36 84 virion cellularcomponent 2 2 cell junction cellularcomponent 131 8 15 extracellular matrix cellularcomponent 93 11 4 membrane-enclosed cellularcomponent 139 6 19 lumen macromolecular cellularcomponent 288 13 29 complex organelle cellularcomponent 865 32 95 other organism cellularcomponent 7 other organism part cellularcomponent 7 extracellular matrix cellularcomponent 35 7 3 component extracellular region part cellularcomponent 389 20 34 organelle part cellularcomponent 407 12 48 virion part cellularcomponent 2 2 membrane part cellularcomponent 617 32 71 synapse part cellularcomponent 64 2 6 cell part cellularcomponent 1136 44 118 synapse cellularcomponent 78 4 8 supramolecular fiber cellularcomponent 47 5 transcription factor molecularfunction 29 4 active- ty, protein binding nucleic acid binding molecularfunction 100 4 7 trans- cription fac- tor activity catalytic activity molecularfunction 374 20 48 signal transducer molecular_function 139 9 14 activity structural molecule molecular-function 57 3 6 activity transporter activity molecular_function 116 3 15 binding molecularfunction 1179 53 116 electron carrier activity molecularfunction 7 morphogen activity molecular_function 2 antioxidant activity molecularfunction 7 2 3 metallochaperone molecularfunction activity protein tag molecularfunction 2 chemoattractant activity molecularfunction 7 translation regulator molecular-function 2 2 activity chemorepellent activity molecularfunction 5 2 molecular transducer molecular_function 138 10 14 activity molecular function molecularfunction 107 6 13 regulator

Table 9, up-regulated DEGs numbers in GO categories biological process, cellular component

and molecular function induced by HrpNEch multi epitopic-like ligand proteins in testis (6 and

24 hours after oral administration or 6 hours after skin smear application) testis, oral, testis, oral, testis, skin, 6-hr 24-hr 6-hr GO Term GO category Gene number Gene number Gene number

reproduction biologicalprocess 2 3 5

cell killing biologicalprocess

immune system process biologicalprocess 8 4 5 behavior biologicalprocess 2 3 metabolic process biologicalprocess 29 24 23 cellular process biologicalprocess 35 38 34 reproductive process biologicalprocess 2 3 5 biological adhesion biologicalprocess 4 4 7 signaling biologicalprocess 16 14 16 multicellular organismal biologicalprocess 20 11 18 process developmental process biologicalprocess 13 11 16 growth biologicalprocess 4 2 locomotion biologicalprocess 6 3 single-organism process biologicalprocess 30 30 35 biological phase biologicalprocess rhythmic process biologicalprocess 2 3 positive regulation of biologicalprocess 13 9 9 biological process negative regulation of biologicalprocess 6 8 9 biological process regulation of biological biologicalprocess 27 29 23 process response to stimulus biologicalprocess 25 22 22 localization biologicalprocess 15 10 10 multi-organism process biologicalprocess 4 4 4 biological regulation biologicalprocess 28 29 23 cellular component biologicalprocess 10 6 8 organization or biogenesis cell aggregation biologicalprocess detoxification biologicalprocess presynaptic process biologicalprocess 2 involved in synaptic transmission extracellular region cellular-component 10 12 15 cell cellular-component 36 34 43 nucleoid cellular-component membrane cellular-component 33 30 33 virion cellular-component cell junction cellular-component 4 2 2 extracellular matrix cellular-component 2 2 membrane-enclosed cellular-component 2 3 5 lumen macromolecular cellular-component 7 7 9 complex organelle cellular-component 18 21 27 otherorganism cellular-component other organism part cellular-component extracellular matrix cellular-component component extracellular region part cellular-component 9 8 11 organelle part cellular-component 9 7 10 virion part cellular-component membrane part cellular-component 31 21 30 synapse part cellular-component 5 2 cell part cellular-component 36 34 43 synapse cellular-component 5 3 supramolecular fiber cellular-component 2 transcription factor molecularfunction activity, protein binding nucleic acid binding molecularfunction 2 6 4 transcription factor activity catalytic activity molecularfunction 16 11 17 signal transducer activity molecularfunction 8 7 9 structural molecule molecularfunction 3 4 activity transporter activity molecularfunction 7 5 4 binding molecularfunction 37 40 42 electron carrier activity molecularfunction 3 2 morphogen activity molecularfunction antioxidant activity molecularfunction metallochaperone molecularfunction activity protein tag molecularfunction chemoattractant activity molecularfunction translation regulator molecularfunction activity chemorepellent activity molecularfunction molecular transducer molecularfunction 8 7 10 activity molecular function molecularfunction 2 3 2 regulator

Table 10, down-regulated DEGs numbers in GO categories biological process, cellular

component and molecular function induced by HrpNEch multi epitopic-like ligand proteins in

kidney (6 and 24 hours after oral administration or 6 hours after skin smear application) Kidney, oral, kidney, oral, kidney, skin, 6-hr 24-hr 6-hr GO Term GO category Gene number Gene number Gene number

reproduction biologicalprocess 2 133 31

cell killing biologicalprocess 3 immune system process biologicalprocess 7 15 47 behavior biologicalprocess 4 10 19 metabolic process biologicalprocess 26 270 181 cellular process biologicalprocess 41 349 253 reproductive process biologicalprocess 2 133 31 biological adhesion biologicalprocess 8 15 33 signaling biologicalprocess 16 53 103 multicellular organismal biologicalprocess 15 178 129 process developmental process biologicalprocess 13 169 117 growth biologicalprocess 2 10 17 locomotion biologicalprocess 4 46 33 single-organism process biologicalprocess 40 315 227 biological phase biologicalprocess rhythmic process biologicalprocess 2 4 7 positive regulation of biologicalprocess 15 65 92 biological process negative regulation of biologicalprocess 11 62 80 biological process regulation of biological biologicalprocess 28 162 187 process response to stimulus biologicalprocess 23 107 147 localization biologicalprocess 16 104 104 multi-organism process biologicalprocess 4 131 44 biological regulation biologicalprocess 31 174 200 cellular component biologicalprocess 8 130 84 organization or biogenesis cell aggregation biologicalprocess 2 2 detoxification biologicalprocess 2 presynaptic process biologicalprocess 2 3 involved in synaptic transmission extracellular region cellular component 16 91 91 cell cellular component 45 430 233 nucleoid cellular component membrane cellular component 32 195 149 virion cellular component 2 cell junction cellular component 6 9 27 extracellular matrix cellular component 9 24 membrane-enclosed lumen cellular component 8 57 36 macromolecular complex cellular-component 11 95 64 organelle cellular component 35 361 159 other organism cellular component 2 other organism part cellular component 2 extracellular matrix cellular component 4 10 component extracellular region part cellular component 13 63 75 organelle part cellular component 16 185 79 virion part cellular component 2 membrane part cellular component 29 161 124 synapse part cellular-component 4 4 17 cell part cellular component 45 430 232 synapse cellular component 5 4 23 supramolecular fiber cellular-component 2 30 8 transcription factor molecularfunction 8 5 activity, protein binding nucleic acid binding molecularfunction 4 17 24 transcription factor activity catalytic activity molecularfunction 16 178 82 signal transducer activity molecular_function 8 6 33 structural molecule activity molecularfunction 12 13 transporter activity molecularfunction 11 29 34 binding molecular_function 47 446 262 electron carrier activity molecularfunction 2 5 3 morphogen activity molecular_function antioxidant activity molecular_function 2 6 3 metallochaperone activity molecularfunction protein tag molecular_function chemoattractant activity molecular_function 2 translation regulator molecularfunction 3 activity chemorepellent activity molecularfunction molecular transducer molecular_function 6 8 33 activity molecular function molecular_function 3 18 24 regulator

Table 11, down-regulated DEGs numbers in GO categories biological process, cellular component and molecular function induced by HrpNEch multi epitopic-like ligand proteins in testis (6 and 24 hours after oral administration or 6 hours after skin smear application) testis, oral, testis, oral, testis, skin, 6-hr 24-hr 6-hr GO Term GO category Gene number Gene number Gene number

reproduction biologicalprocess 7 7 3

cell killing biologicalprocess 2 4

immune system process biologicalprocess 11 20 13

behavior biologicalprocess 5 7 7

metabolic process biologicalprocess 43 57 65

cellular process biologicalprocess 58 74 81

reproductive process biologicalprocess 7 7 3 biological adhesion biologicalprocess 9 14 6 signaling biologicalprocess 25 34 36 multicellular organismal biologicalprocess 27 32 39 process developmental process biologicalprocess 22 25 29 growth biologicalprocess 4 5 6 locomotion biologicalprocess 7 11 8 single-organism process biologicalprocess 47 72 73 biological phase biologicalprocess rhythmic process biologicalprocess 2 4 3 positive regulation of biologicalprocess 22 34 32 biological process negative regulation of biologicalprocess 18 25 26 biological process regulation of biological biologicalprocess 46 57 62 process response to stimulus biologicalprocess 28 44 49 localization biologicalprocess 21 33 26 multi-organism process biologicalprocess 9 12 9 biological regulation biologicalprocess 50 58 66 cellular component biologicalprocess 18 28 23 organization or biogenesis cell aggregation biologicalprocess detoxification biologicalprocess presynaptic process biologicalprocess 2 2 3 involved in synaptic transmission extracellular region cellular-component 17 33 28 cell cellular-component 61 67 86 nucleoid cellular-component membrane cellular-component 42 47 42 virion cellular-component cell junction cellular-component 5 8 3 extracellular matrix cellular-component 3 6 5 membrane-enclosed cellular-component 8 8 10 lumen macromolecular complex cellular-component 20 19 15 organelle cellular-component 38 46 59 other organism cellular-component other organism part cellular-component 3 extracellular matrix cellular-component 2 2 component extracellular region part cellular-component 16 28 26 organelle part cellular-component 20 25 29 virion part cellular-component membrane part cellular-component 42 42 35 synapse part cellular-component 4 4 4 cell part cellular component 61 67 85 synapse cellular-component 5 4 4 supramolecular fiber cellular component 4 transcription factor molecularfunction 2 4 activity, protein binding nucleic acid binding molecularfunction 5 8 6 transcription factor activity catalytic activity molecularfunction 12 26 30 signal transducer activity molecularfunction 15 10 13 structural molecule molecularfunction 2 5 2 activity transporter activity molecularfunction 11 8 7 binding molecularfunction 63 68 73 electron carrier activity molecular_function 2 morphogen activity molecularfunction antioxidant activity molecular_function 2 3 metallochaperone activity molecularfunction protein tag molecularfunction chemoattractant activity molecularfunction 2 2 translation regulator molecularfunction activity chemorepellent activity molecularfunction 2 2 molecular transducer molecularfunction 14 10 14 activity molecular function molecularfunction 6 6 5 regulator

5. KEGG pathways enrichment of DEGs induced by HrpNEch multi epitopic-like ligand protein.

Kyoto encyclopedia of genes and genomes (KEGG) is a database for systematic analysis of gene

function and genome information. It integrates genomics, biochemistry and phylogenomics

information, and facilitates researchers to study genes and their expression processes as a

network. The key feature of KEGG is to link genes with various biochemical reactions,

providing integrated metabolic pathways. KEGG is an integrated database resource consisting of

sixteen databases. They are classified into three categories: systematic information, genomic

information and chemical information. In organisms, different gene products coordinate with

each other to perform biological functions. Pathway annotation analysis of differentially

expressed genes is helpful for further understanding of gene functions. KEGG pathways

enrichment of DEGs induced by HrpNEch multi epitopic-like ligand protein were performed to

obtain the roles (upstream and downstream relationships) and biological functions of these DEGs

in signaling pathways, and further understand the relationship between genes and functions.

The results demonstrated that HrpNEch multi epitopic-like ligand protein, as a kind of ligand

protein with multi-epitope special structure, novel function, novel mechanism of action and novel application prospect, induced the differential expression of multiple genes in multiple organs of mice (liver, thalamus, heart, cerebral cortex and cerebral hippocampus, etc.). These

results of KEGG enrichment analysis of differentially expressed genes induced by HrpNEch

transport and catabolism, cell population, cell activity, cell growth and death (see Figure 73 to

Figure 78 for details); (2) environmental information processing: enriched DEGs were involved

environmental information processing processes (see Figure 73 to Figure 78 for details); (3)

translation, replication and repair, folding, classification and degradation (see Figure 73 to Figure

78 for details); (4) metabolism: enriched DEGs were involved in biological degradation and

metabolism (see figure 73 to figure 78 for details); (5) organismal systems: enriched DEGs were

and other cellular processes (see Figure 73 to Figure 78 for details). The number of DEGs in

each KEGG pathway was counted and graphically displayed in Figure 73 to Figure 78.

Example 9

pull-down assay of HrpNEch protein recognition and binding to receptor proteins and membrane

proteins.

1. Sample preparation and processing.

1). Purification of HrpNEch multi-epitope ligand protein

The HrpNEch-His recombinant protein was purified using NI-NTA agarose gel column. The

HrpNEch-His recombinant protein was used in pull-down experiments (hereinafter referred to as

capture protein or target protein).

I. Total protein extraction of cultured hepatocytes: (1) lysate (IP specific lysate with1xcocktail

more than 2 hours to lysis the cells. (2) sonication was performed as sonicating for 2 see and set

4°C until use.

using BCA protein concentration measure kit.

Experiment concentration volume(L Total protein NO. Sample name number (tg/tL) (pIg)

1 HEPG2 HEPG2 8.34 2,500 20,861.30

2. pull-down experiment procedure

1), Immobilized streptavidin preparation. (1), Prepare the PierceTM spin columns and collection

tubes. (2), Thoroughly resuspend the Immobilized Streptavidin by inverting the tube several

times. Pipette 50pL of the gel slurry into each labeled spin column and place them in the

Collection Tubes, plug the bottom plug of columns and put it in the collection tubes. (3), Add

250tL of the TBS to each of the spin columns. Place the top screw caps on the columns and mix

by gently inverting the columns 4 times. (4), Remove the columns' screw caps. Place columns in

the Collection Tubes, and centrifuge at 1,250 x g for 50 see, discard the liquid in the collection

tube, and reinsert the spin column into the collection tube. (5) Repeat Steps 3 and 4 two

additional times. Apply bottom plugs to the columns.

2), Bait Protein Immobilization. (1) Add biotin and biotinylated bait protein to the spin column

tube, tighten the top cap and bottom plug. (2) Shake gently on a rotating platform, incubate at

4°C for 60 min. (3), After the incubation, remove the top cover and bottom plug of the spin

columns and put them into the collection tubes. (4) After centrifugation at 1,250 x g for 60 sec,

put the spin column tube back into the collection tube.

3), Biotin Blocking. (1), Add 250 pl of biotin blocking solution to the spin colums. Tighten the

top cover and bottom plug, gently invert 4 times to mix well. (2), Incubate at room temperature

for 5 min. Remove the top cover, place the spin column into collecting tubes, and centrifuge at

1,250 x g for 50 sec. (3) Repeat step 1 and step 2. (4), Add 250 pl TBS to the spin columns.

Place the top screw caps on the columns and mix by gently inverting the column 4 times. (5)

Remove top screw caps from columns. Place columns in collection tubes and centrifuge at 1,250

g for 50 sec. (6) Repeat Step 3 and Step 4 twice and put the spin columns back into the collection

tubes.

4), Biotin labeling. Prey protein capture. (1), Add 300 pL (1 mg protein) of prey protein (target

protein) sample solution to the spin columns and tighten the top cap. (2), Incubate at 4°C

overnight with gentle rocking motion on rotating platform. (3), After incubation, remove top cap

from the spin columns, then remove the bottom plug from the columns and place into the pre

labeled tubes. (4),_Centrifuge tube at 1,250 g for 60 seconds, mark the collection tubes as prey

flow-through (B). (5), Remove spin columns from the collection tubes (B), secure the caps and

set the tubes aside for later evaluation. Place the spin columns in separate collection tubes for

washing.

5), Spin Column Wash. Elution of the prey protein and target protein complex. (1), Add 250pL

temperature. Remove the top screw caps from the columns, place columns in

(4), For the last wash, 200 pl Wash Buffer was added and the liquid in tube was transferred to

1.5 mL tube along with the beads. (5), In a new centrifuge tube, 170pl supernatant was

discarded after centrifugation, and this step was repeated three times. (6),

(2), The samples were examined by SDS-PAGE and Western blot analysis.

3. Results analysis.

1), HrpNEch multi-epitope ligand protein recognizes and binds to membrane receptors including

GNG12 the G protein subunit gamma 12, annexinA5,ANXA2annexinA2,ANXAlannexin

Al, IGHG2 Immunoglobulin Heavy Constant Gamma 2, Immunoglobulin Heavy Constant

Mu, CACNAlS Calcium Voltage-Gated Channel Subunit alphal S, ZNF185 Zinc Finger Protein

185, class I and A receptors, LAMP2 Lysosomal associated membrane Protein 2, GNB2 G G

Protein Subunit Beta 2, KTN1 kinectin 1.

2), HrpNEch multi-epitope ligand protein recognizes and binds to 16 membrane proteins DSC3

desmocollin 3, ANXA8/ANXA8L1 annexin A8/annexin A8 Like 1, EVPL envoplakin, POFIB

actin-binding protein, CTNNA1 catenin alpha 1, TGMI transglutaminase 1, BAIAP2 BAR/IMD

domain containing adaptor protein 2, RAB29 RAS oncogene family member, CLDN19 claudin

19, STXBP2 syntaxin binding protein 2, VAMP vesicle associated protein A, VCL inculin, Ezrin

Eze-epithelial cadherin, PKP3 plakophilin 3, NAALAD2 N acetylated a-linked acid dipeptidase

2, PKP1 plakophilin 1 and SPRR1A small Proline rich protein 1A.

3), HrpNEch multi-epitope ligand protein recognized and bound membrane proteins involved in

22 signaling pathways including hsa03320: PPAR signaling pathway, hsa05120: epithelial cell

signaling in Helicobacter pylori infection, hsa04O71: sphingolipid signaling pathway, hsa04014:

Ras signaling pathway, hsa04151: PI3K-Akt signaling pathway, hsa04O7O: phosphatidylinositol

signaling system, hsa04O10: MAPK signaling pathway, hsa04310: Wnt signaling pathway,

hsa04062: chemokine signaling pathway, hsa04015: Rapt signaling pathway, hsa04024: cAMP

signaling pathway, hsa04915: estrogen signaling pathway, hsa04910: insulin signaling pathway,

hsa04390: hippo signaling pathway, hsa04922: glucagon signaling pathway, hsa04912:

gonadotropin signaling pathway, hsa04022: cGMP-PKG signaling pathway, hsa04921: oxytocin

signaling pathway, hsa04722: neurotrophin signaling pathway, hsa04723: retrograde nerve

signaling pathway, hsa04066: HIF-1 signaling pathway, hsa04O2O: calcium signaling pathway.

4), HrpNEch multi-epitope ligand protein recognized and bound membrane proteins involved 29

metabolic pathways related to antiviral, anti-bacterial, anti-foreign body and anti-inflammation.

They are: hsa04144: endocytosis, hsa04145: phagosome, hsa04142: lysosome, hsa04666: Fc

gamma R-mediated phagocytosis, hsa01130: Antibiotic biosynthesis, hsa05131: Shigellosis, hsa04612: Antigen handling and presentation, hsa05130: Pathogenic Escherichia coli infection, hsa05100: Bacterial invasion of epithelial cells, hsa05132: Salmonella infection, hsa0516 9: Barr virus infection, hsa05203: viral carcinogenesis, hsa05134: Legionnaires' disease, hsa05160: hepatitis C, hsa05162: measles, hsa05133: whooping cough, hsa05322: systemic lupus erythematosus, hsa04670: leukocyte migration across the endothelium, hsa0515 2: Tuberculosis, hsa05150: Staphylococcus aureus infection, hsa05146: amoebiasis, hsa05142: Chagas disease, hsa05200: Pathway in cancer, hsa05143: African trypanosomiasis, hsa04750: Regulation of inflammatory mediators of TRP channels, hsa04916: bactericidal effect, hsa05230: central carbon metabolism in cancer, hsa05214: glioma, hsa05212: pancreatic cancer.

5), HrpNEch multi-epitope ligand protein recognized, and bound membrane proteins involved

three important metabolic pathways related to neurological diseases including hsa05012:

Parkinson's disease, hsa05016: Huntington's Disease, and hsa05010: Alzheimer's disease.

6), HrpNEch multi-epitope ligand protein recognized, and bound membrane proteins involved in

39 pathways involved in nucleic acid, protein, amino acid, sugar and fat metabolism. These are

hsa03013: RNA transport, hsa03018: RNA degradation, hsa03O4O: spliceosome, hsa03010:

ribosome, hsa04141: ER protein processing, hsa04810: actin skeleton modulation hsa03050:

proteasome, hsa01230: amino acid biosynthesis, hsa00190: oxidative phosphorylation,

hsa00230 : purine metabolism, hsa04932: non-alcoholic fatty liver disease, hsaOO020: citric acid

cycle, hsa03008: biogenesis of eukaryotic ribosomes, hsa00240: pyrimidine metabolism,

hsa00650: methyl butyrate metabolism, hsa01200: carbon metabolism, hsa00520: amino sugar

and nucleotide sugar metabolism, hsa05034: alcoholism, hsaOO071: fatty acid degradation,

hsa04120: Ubiquitin mediated proteolysis, hsa05205: proteoglycans in cancer, hsa05206:

MicroRNAs in cancer, hsa00410: alanine metabolism, hsa00340: histidine metabolism,

hsa00910: nitrogen metabolism, hsa00250: alanine, aspartic acid, glutamate metabolism,

hsa00350: tyrosine metabolism, hsa04726: serotonin-activated synapses, hsa00900: backbone of

terpenoid biosynthesis, hsa046 10: complement and coagulation cascade, hsa00330: arginine and

proline metabolism, hsa04520: adhesion junction, hsaOO860: porphyrin and chlorophyll

metabolism, hsaOOO10: glycolysis and glycogenesis, hsa00982: drug metabolism cytochrome

P450, hsa00980: metabolism of xenobiotics by cytochrome P450, hsa04962: vasopressin

regulates water reabsorption, hsa00983 : drug metabolism - other enzymes.

7), HrpNEch multi-epitope ligand protein recognized, and bound membrane proteins involved in

19 metabolic pathways related to cell connection, nerve connection, vascular, endocrine and

reproductive system including hsa04510: focal adhesion, hsa 04724: glutamatergic synapses,

hsa04530: tightjunctions, hsa00830: retinol metabolism, hsa04114: oocyte meiosis, hsa04728:

dopamine synapses, hsa00140: steroid hormone biosynthesis, hsa04261: adrenergic signaling in

cardiomyocytes, hsa04 727: y-aminobutyric acid synapses, hsa04725: cholinergic synapses,

hsa04540: gap junctions, hsa04971: gastric acid secretion, hsa04713: circadian entrainment,

hsa04931: insulin resistance, hsa05031: amphetamine addiction, hsa04924: renin secretion,

hsa0492 5: aldosterone synthesis and secretion, hsa00590: arachidonic acid metabolism,

hsa04270: vascular smooth muscle contraction, hsa00760: niacin and nicotinamide metabolism,

hsa04740: olfactory conduction, hsa04260: myocardial contraction, hsa04720: long-term

potential difference phenomenon, hsa04744: light conduction, hsa04966: collection of duct acid

secretions, hsa05412: arrhythmogenic right ventricular cardiomyopathy, hsa05410: hypertrophic

cardiomyopathy, hsa04146: peroxisome, hsa05414: dilated cardiomyopathy, hsa04970:

salivation, hsa04611: platelet stimulation Live, hsa05204: chemical carcinogenesis, hsa04721:

synaptic vesicle cycling.

As a class of ligand protein molecules rich in special multiple linear and conformational epitope

structures, HrpNEch multi-epitope ligand protein can across species boundaries to recognize and

bind multiple types of membrane receptors and membrane protein that involved in signal

pathways and metabolic pathways. Further analysis of the location, structure, properties,

mechanism of action and function of these membrane receptors, membrane proteins, signal

pathways and metabolic pathways revealed that they widely involve and affect life basic

properties including growth, development, metabolism, defense and programmed cell death.

They also widely involved in diagnosis, prevention, treatment, rehabilitation of diseases and

conditions of nervous system, digestive system, sports system, circulatory system, respiratory

system, endocrine system, immune system, urinary system, reproductive system and dermal

system. HrpNEch Protein is a special multi-epitope ligand protein with novel functions, novel

mechanisms of action and novel application prospects.

Present invention described use of HrpN-type multi-epitope ligand proteins in food, cosmetics,

health care products and pharmaceutical industry. HrpN-type multi-epitope ligand proteins such as HrpNEcb and HrpNEch can across species boundaries to recognize and active receptors and membrane proteins which involved in multiple signal pathways, causing cascade biological effects in animal (including human). Furthermore, pull-down experiments showed that HrpNEcb and HrpNEch multi-epitope ligand proteins recognized and bound multiple classes of receptors, membrane proteins and signaling pathway proteins in animals. Those receptors, membrane proteins and signaling pathway proteins were widely involved in organism's growth and development, defense, immunity, bactericidal and anti-inflammatory function, endocrine, multi type molecular metabolism function and programmed cell death function. They were also widely involved in the regeneration, repairing and cleaning from structure to function of different biological systems, organs, tissues, cells, subcells, molecules and submolecules. Furthermore,

GO Term enrichment analysis of mRNA sequencing results demonstrated that HrpNEcb and

HrpNEch multi-epitope ligand proteins induced significant differential expression of relevant

functional genes at three levels of cell components, molecular functions and biological processes

in different organs and tissues. KEGG pathway enrichment analysis of mRNA sequencing results

demonstrated that HrpNEcb and HrpNEch multi-epitope ligand proteins induced significant

differential expression of relevant functional genes involved in five biological processes,

including cellular process, environmental information process, genetic information process,

metabolism and biological system process in different organs and tissues. The functional gene

groups were significantly differentially expressed in experimental animals which were treated by

oral administration and skin smear. Those genes were widely involved in the expression and

regulation of organism's growth and development, defense, metabolism and programmed cell

death. They were also widely involved in the regeneration, repairing and cleaning from structure

to function of different biological systems, organs, tissues, cells, subcells, molecules and

submolecules. Furthermore, HrpN-type multi-epitope ligand protein production such as

HrpNEcb and HrpNEch, can be widely used in food, cosmetics and health care products by oral

or skin smeared treatment. The auxiliary conditioning functions of HrpN-type multi-epitope

ligand protein mainly include (1) enhance immune function, (2) auxiliary function of lowering

blood lipid, (3) auxiliary hypoglycemic function, (4) antioxidant function, (5) assist to improve

memory, (6) relieve visual fatigue, (7) promote the function of lead release, (8) throat clearing,

(9) auxiliary antihypertensive effects, (10) improve sleep, (11) promote lactation, (12) relieve physical fatigue, (13) improve hypoxia tolerance, (14) auxiliary protection function for radiation hazards, (15) weight loss, (16) improve growth and development, (17) increase bone mineral density f, (18) improve the function of nutritional anemia, (19) auxiliary protective function on chemical liver injury, (20) acne removing, (21) remove chloasma, (22) improve skin moisture,

(23) improve oily skin, (24) regulate the function of intestinal flora, (25) promote digestive, (26)

defecation, (27) auxiliary protective function on gastric mucosa injury.

Furthermore, the present invention described use of HrpN-type multi-epitope ligand protein

products in food products that assist in regulating the growth, development, defense, metabolism

and programmed cell death. The food products mentioned here includes all finished products and

raw materials intended for human consumption or drinking.

products in cosmetics that assist in regulating the growth, development, defense, metabolism and

programmed cell death. The cosmetics production mentioned here Includes products applied on

any part of the human body Including skin, hair, nails and lips by rubbing, spraying or other

methods for cleaning, odor elimination, skin care, beauty and grooming purposes. Those

cosmetics include general purpose cosmetics and special purpose cosmetics.

products in health products that assist in regulating the growth, development, defense,

metabolism and programmed cell death. The health products Include health function food, a kind

of food with general food commonality and able to recuperate one's bodily function but not for

treatment of diseases. Those health products are suitable for specific group of people to

consumption.

The above embodiments express only the specific embodiments of this application. The

description is specific and detailed, but it is not to be construed as limiting the scope of

protection of this application. It should be noted that for ordinary technicians in this field, there

are a number of variations and improvements that can be made without deviating from the idea

of the technical scheme of this application, which fall within the scope of protection of this

application.

Sequence Listing 1 Sequence Listing Information 1-1 File Name 2023-134714.xml 1-2 DTD Version V1_3 1-3 Software Name WIPO Sequence 1-4 Software Version 2.3.0 1-5 Production Date 2023-07-18 1-6 Original free text language en code 1-7 Non English free text language code 2 General Information 2-1 Current application: IP WO Office 2-2 Current application: PCT/CN2021/134714 Application number 2-3 Current application: Filing 2021-12-01 date 2-4 Current application: AU2301059H-PCT Applicant file reference 2-5 Earliest priority application: CN IP Office 2-6 Earliest priority application: 202011633925.1 Application number 2-7 Earliest priority application: 2020-12-31 Filing date 2-8en Applicant name Kunming ruiside Technology CO., LTD 2-8 Applicant name: Name Latin 2-9en Inventor name 2-9 Inventor name: Name Latin 2-10en Invention title Use of HrpN-type multi epitopic-like ligand protein in food, cosmetics, health products and pharmaceutical industry 2-11 Sequence Total Quantity 2

3-1 Sequences 3-1-1 Sequence Number [ID] 1 3-1-2 Molecule Type AA 3-1-3 Length 370 3-1-4 Features source 1..370 Location/Qualifiers mol_type=protein organism=Pectobacterium betavasculorum EcbCSL101 DOMAIN 170..370 note=conserved domain DOMAIN 44..64 note=Alpha-helical domain DOMAIN 110..118 note=Alpha-helical domain DOMAIN 139..155 note=Alpha-helical domain DOMAIN 174..192 note=Alpha-helical domain DOMAIN 221..243 note=Alpha-helical domain DOMAIN 259..260 note=Alpha-helical domain DOMAIN 262..274 note=Alpha-helical domain DOMAIN 276..279 note=Alpha-helical domain DOMAIN 284..285 note=Alpha-helical domain DOMAIN 298..303 note=Alpha-helical domain DOMAIN 313..330 note=Alpha-helical domain DOMAIN 347..349 note=Alpha-helical domain DOMAIN 353..368 note=Alpha-helical domain DOMAIN 10..15 note=beta-folded junction domain DOMAIN 255..256 note=beta-folded junction domain DOMAIN 1..11 note=IDPs - domain DOMAIN 13..43 note=IDPs - domain DOMAIN 67..95 note=IDPs - domain DOMAIN 99..139 note=IDPs - domain DOMAIN 157..174 note=IDPs - domain DOMAIN 197..216 note=IDPs - domain DOMAIN 340..341 note=IDPs - domain DOMAIN 364..370 note=IDPs - domain NonEnglishQualifier Value 3-1-5 Residues MLNSLGGGTS LQITIKAGGN GDLFQSQSSQ NGGAPSQLGL GGQRSNIAEQ LSDIMTTMMF 60 MGSMMGGGLG GLGGMGGGLG GALGGLGSSL GGLGGGLLGQ GLGGGLAGGL GSSLGSGLGG 120 ALGGGLGGAL GAGMNAMNPS AMMGSLLFSA LEDLLGGGMS QQQGGLFGNK QPASPEISAY 180 TQGVNDTLSA ILGNGLSQAK GQHSPLQLGN NGLQGLSGAG AFNQLGSTLG MGVGQKAGLQ 240 ELNNISTHNG SPTRYFVDKE DRGMAKEIGQ FMDQYPEVFG KPEYQKDNWQ TAKQDDKSWA 300 KALSKPDDDG MTKGSMDKFM KAVGMIKSAV AGDTGNTNLN ARGNGGASLG IDAAMIGDRI 360 VNMGLQKLSS 370 3-2 Sequences 3-2-1 Sequence Number [ID] 2 3-2-2 Molecule Type AA 3-2-3 Length 339 3-2-4 Features source 1..339 Location/Qualifiers mol_type=protein organism=Dickeya dadantii CSCL006 DOMAIN 9..334 note=conserved domain DOMAIN 39..62 note=Alpha-helical domain DOMAIN 105..118 note=Alpha-helical domain DOMAIN 131..134 note=Alpha-helical domain DOMAIN 147..163 note=Alpha-helical domain DOMAIN 192..213 note=Alpha-helical domain DOMAIN 233..245 note=Alpha-helical domain DOMAIN 268..273 note=Alpha-helical domain DOMAIN 2..7 note=beta-folded junction domain DOMAIN 204..205 note=beta-folded junction domain DOMAIN 1..2 note=IDPs - domain DOMAIN 8..11 note=IDPs - domain DOMAIN 13..40 note=IDPs - domain DOMAIN 66..100 note=IDPs - domain DOMAIN 131..139 note=IDPs - domain DOMAIN 173..177 note=IDPs - domain DOMAIN 339 note=IDPs - domain NonEnglishQualifier Value 3-2-5 Residues MQITIKAHIG GDLGVSGLGL GAQGLKGLNS AASSLGSSVD KLSSTIDKLT SALTSMMFGG 60 ALAQGLGASS KGLGMSNQLG QSFGNGAQGA SNLLSVPKSG GDALSKMFDK ALDDLLGHDT 120 VTKLTNQSNQ LANSMLNASQ MTQGNMNAFG SGVNNALSSI LGNGLGQSMS GFSQPSLGAG 180 GLQGLSGAGA FNQLGNAIGM GVGQNAALSA LSNVSTHVDG NNRHFVDKED RGMAKEIGQF 240 MDQYPEIFGK PEYQKDGWSS PKTDDKSWAK ALSKPDDDGM TGASMDKFRQ AMGMIKSAVA 300 GDTGNTNLNL RGAGGASLGI DAAVVGDKIA NMSLVAANA 339

Claims

1. Use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products, or

pharmaceutical industry, wherein the HrpN-type multi epitopic-like ligand proteins are able to

recognize and activate multiclass receptors and/or membrane proteins and signaling pathways

involved thereby and cause cascading biological effects.

2. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products, or

pharmaceutical industry according to claim 1, wherein the HrpN-type multi epitopic-like ligand

proteins comprise one or more structural groups or epitopes with hydrophobic nonpolar amino

acid residues, one or more structural groups or epitopes with polar uncharged amino acid residues,

one or more structural groups or epitopes with amido-containing polar uncharged amino acid

residues, and one or more structural groups or epitopes with acidic positively charged or basic

negatively charged amino acid residues; the hydrophobic nonpolar amino acid residues comprise

valine, leucine, isoleucine, alanine, phenylalanine, and methionine residues, the polar uncharged

amino acid residues comprise serine residues, the amido-containing polar uncharged amino acid

residues comprise asparagine and glutamine residues, and the acidic positively charged or basic

negatively charged amino acid residues comprise aspartate, glutamic acid, lysine, histidine, and

arginine residues; a proportion of the hydrophobic nonpolar amino acid residues, the polar

uncharged amino acid residues, the amido-containing polar uncharged amino acid residues, and

the acidic positively charged or basic negatively charged amino acid residues in total sequence of

each of the HrpN-type multi epitopic-like ligand proteins is 62.3% to 73.7%, a proportion of these

amino acid residues in conserved domain of each of the HrpN-type multi epitopic-like ligand

proteins is 61% to 74%, and a proportion of these amino acid residues in a-helical structure of

each of the HrpN-type multi epitopic-like ligand proteins is 66.2% to 79%; and the one or more

structural groups or epitopes with hydrophobic nonpolar amino acid residues, the one or more

structural groups or epitopes with polar uncharged amino acid residues, the one or more structural

groups or epitopes with amido-containing polar uncharged amino acid residues, and the one or

more structural groups or epitopes with acidic positively charged or basic negatively charged

amino acid residues allow complementarity, interaction, and specific recognition, activation, and binding of ligand, receptor molecular space structure, and electrical properties through hydrogen bonds, ionic bonds, and hydrophobic, non-polar, polar, and van der Waals forces, and form tight binding surfaces or complexes with multiclass receptors, which causes changes in conformation, energy, electricity, and information of receptor molecule to trigger amplified cascading biological effects through signal transduction.

3. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products, or

proteins comprise HrpNEcc, HrpNEca, HrpNEcb, HrpNEch, HrpNDaz, HrpNDada, HrpNDasp,

HrpNad, HrpNDaf, HrpNEa, HrpNSam, HrpNBag, HrpNPas, and HrpNEnt.

4. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products, or

pharmaceutical industry according to claim 3, wherein an amino acid sequence of HrpNEcb

protein is shown in SEQ ID NO: 1.

5. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products, or

pharmaceutical industry according to claim 3, wherein an amino acid sequence of HrpNEch

protein is shown in SEQ ID NO: 2.

6. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products, or

pharmaceutical industry according to claim 1 or 3, wherein the HrpN-type multi epitopic-like

ligand proteins are HrpNEcb multi epitopic-like ligand proteins, and recognize and bind to

multiclass receptors comprising one or more selected from the group consisting of LRRC15

Leucine-rich repeat-containing protein 15, HLA-A major histocompatibility complex, class I, A

receptor, LGALS3BP galactose-3-binding protein, LAMP2 lysosomal associated membrane

protein 2, and GNB2 G guanine nucleotide binding protein subunit Beta 2.

7. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products, or

pharmaceutical industry according to claim 1 or 3, wherein the HrpN-type multi epitopic-like ligand proteins are HrpNEch multi epitopic-like ligand proteins, and recognize and bind to multiclass receptors comprising one or more selected from the group consisting of GNG12 guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit y-12, ANXA5 annexin A5, ANXA2 annexin

A2, ANXA1 annexin Al, IGHG2 Immunoglobulin heavy constant 72, IGHM immunoglobulin

heavy constant mu, CACNAlS calcium voltage-gated channel subunit alS, ZNF185 zinc finger

protein 185, HLA-A major histocompatibility complex, class I, A receptor, LAMP2 lysosomal

associated membrane protein 2, GNB2 G guanine nucleotide binding protein subunit Beta 2, and

KTN1 kinectin 1.

8. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products, or

membrane proteins comprising one or more selected from the group consisting of DSG4

desmoglein-4, ANXA4 annexin A4, CAPRIN1 cell cycle associated Protein 1, 1UTRN dystrophin

protein, Pinin desmosome associated Protein, VAMP associated protein A, VCL vinculin, Ezrin

Eze-epithelial cadherin, PKP3 plakophilin 3, TM9SF2 transmembrane 9 superfamily member 2,

and NAALAD2 N-acetylated a-linked acid dipeptidase 2.

9. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products, or

ligand proteins are HrpNEch multi epitopic-like ligand proteins, and recognize and bind to

membrane proteins comprising one or more selected from the group consisting of DSC3

actin-binding protein, CTNNA1 catenin alpha 1, TGM1 transglutaminase 1, BAIAP2 BAR/IMD

19, STXBP2 syntaxin Binding Protein 2, VAMP vesicle-associated membrane protein-associated

protein A, VCL vinculin, Ezrin Eze-epithelial cadherin, PKP3 plakophilin 3, NAALAD2 N

acetylated a-linked acid dipeptidase 2, PKP1 plakophilin 1, and SPRR1A small proline rich protein

1A.

10. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

or pharmaceutical industry according to claim 1 or 3, wherein the HrpN-type multi epitopic-like

signaling pathways comprising one or more selected from the group consisting of hsa04152

AMPK signaling pathway, hsa03460 fanconi anemia pathway, hsa03320 PPAR signaling pathway,

hsa04071 sphingolipid signaling pathway, hsa04014 Ras signaling pathway, hsa04151 PI3K-Akt

signaling pathway, hsa04310 Wnt signaling pathway, hsa04062 chemokine signaling pathway,

hsa04015 Rapt signaling pathway, hsa04024 cAMP signaling pathway, hsa04915 estrogen

signaling pathway, hsa04910 insulin signaling pathway, and hsa04390 hippo signaling pathway.

11. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

ligand proteins are HrpNEch multi epitopic-like ligand proteins, and recognize and activate

signaling pathways comprising one or more selected from the group consisting of hsa03320 PPAR

signaling pathway, hsa05120 epithelial cell signaling in Helicobacterpylori infection, hsa04071

sphingolipid signaling pathway, hsa04014 Ras signaling pathway, hsa04151 PI3K-Akt signaling

pathway, hsa04O7O phosphatidylinositol signaling system, hsa04010 MAPK signaling pathway,

hsa04310 Wnt signaling pathway, hsa04062 chemokine signaling pathway, hsa04015 Rapt

signaling pathway, hsa04024 cAMP signaling pathway, hsa04915 estrogen signaling pathway,

hsa04910 insulin signaling pathway, hsa04390 hippo signaling pathway, hsa04922 glucagon

signaling pathway, hsa04912 gonadotropin signaling pathway, hsa04022 cGMP-PKG signaling

pathway, hsa04921 oxytocin signaling pathway, hsa04722 neurotrophin signaling pathway,

hsa04723 retrograde neural signaling pathway, hsa04066 HIF-1 signaling pathway, and hsa04020

calcium signaling pathway.

12. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

ligand proteins recognize and activate signaling pathways comprising metabolic signaling pathways; and the metabolic signaling pathways comprise antiviral, anti-bacterial, anti-foreign body, and anti-inflammatory metabolic pathways; important metabolic pathways for neurological diseases; nucleic acid, protein, amino acid, sugar, and fat metabolic pathways; and cell connection, nerve connection, vascular, endocrine, and reproductive system metabolic pathways.

13. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

or pharmaceutical industry according to claim 12, wherein the HrpN-type multi epitopic-like

ligand proteins are HrpNEcb multi epitopic-like ligand proteins, and recognize and activate

membrane proteins, wherein the membrane proteins participate in the following antiviral, anti

bacterial, anti-foreign body, and anti-inflammatory metabolic pathways: hsa04144 Endocytosis,

hsa04145 phagosome, hsa04142 lysosome, hsa01130 antibiotic biosynthesis, hsa05131 shigellosis,

hsa04612 antigen processing and presentation, hsa05130 pathogenic Escherichia coli infection,

hsa05100 bacterial invasion of epithelial cells, hsa05132 Salmonella infection, hsa05169 Barr

virus infection, hsa05168, herpes simplex virus 1 infection, hsa05203 viral carcinogenesis,

hsa05166 HTLV-I infection, hsa05164 Influenza A, hsa05134 Legionnaires' disease, hsa05160

hepatitis C, hsa05162 measles, hsa05133 pertussis, hsa05322 systemic lupus erythematosus,

hsa04670 transepithelial leukocyte migration, hsa05146 amoebiasis, hsa05142 Chagas disease,

and hsa05200 pathways in cancer; the membrane proteins participate in the following important

metabolic pathways for neurological diseases: hsa05012 Parkinson's disease, hsa05016

Huntington's disease, and hsa05010 Alzheimer's disease; the membrane proteins participate in the

following nucleic acid, protein, amino acid, sugar, and fat metabolic pathways: hsa03420

nucleotide excised repair, hsa00970 aminoacyl biosynthesis, hsa03430 mismatch repair,

HSA01210 2-oxocarboxylic acid metabolism, hsa03440 homologous recombination, hsa04360

axonal guidance, hsaOO051 fructose and mannose metabolism, hsa00565 ether lipid metabolism,

hsa00510 N-polysaccharide biosynthesis, hsa04110 cell cycle, hsa03O3O DNA replication,

hsa03013 RNA transport, hsa03018 RNA degradation, hsa03040 spliceosome, hsa0301: ribosome,

hsa04141 ER protein processing, hsa04810 regulation of the actin skeleton, hsa03O5O proteasome,

hsa0123: amino acid biosynthesis, hsaOO190 oxidative phosphorylation, hsa04932 non-alcoholic

fatty liver disease (NAFLD), hsaOO020 citric acid cycle, hsa00564 glycerol phospholipid metabolism, hsa03008 biogenesis of eukaryotic ribosomes, hsa03015 mRNA monitoring pathway, hsa01200 carbon metabolism, hsa00520 amino sugar and nucleotide sugar metabolism, hsa05034: alcoholism, hsa04120: ubiquitin mediated proteolysis, hsa05205 proteoglycans in cancer, and hsa05206 micro RNAs in cancer; and the membrane proteins participate in the following cell connection, nerve connection, vascular, endocrine, and reproductive system metabolic pathways: hsa04723 retrograde neural signaling, hsa04726 serotonin-activated synapses, hsa00900 backbone of terpenoid biosynthesis, hsa04520 adhesion knot, hsa05032 morphine addiction, hsa04510 adhesion spot, hsa04724 glutamatergic synapses, hsa04530 tight junctions, hsaOO830 retinol metabolism, hsa04114 oocyte meiosis, hsa04728 dopaminergic synapses, hsa00100 steroid biosynthesis, hsa04261 adrenergic signaling in cardiomyocytes, hsa04727 neuronal synapse, hsa04725 cholinergic synapse, hsa04540 gap junction, hsa04971 gastric acid secretion, hsa04713: circadian entrainment, and hsa04931 insulin resistance.

14. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

hsa04145 phagosome, hsa04142 lysosome, hsa04666 Fc gamma R-mediated phagocytosis,

hsa01130 antibiotic biosynthesis, hsa05131 Shigellosis, hsa04612 antigen processing and

presentation, hsa05130 pathogenic Escherichia coli infection, hsa05100 bacterial invasion of

epithelial cells, hsa05132 Salmonella infection, hsa05169 Barr virus infection, hsa05203 viral

carcinogenesis, hsa05134 Legionnaires' disease, hsa05160 hepatitis C, hsa05162 measles,

hsa05133 pertussis, hsa05322 systemic lupus erythematosus, hsa04670 leukocyte migration across

the endothelium, hsa05152 tuberculosis, hsa05150 Staphylococcus aureus infection, hsa05146

amoebiasis, hsa05142 Chagas disease, hsa05200 pathway in cancer, hsa05143 African

trypanosomiasis, hsa04750 regulation of inflammatory mediators of TRP channels, hsa04916

bactericidal effect, hsa05230:central carbon metabolism in cancer, hsa05214:glioma, hsa05212

pancreatic cancer; the membrane proteins participate in the following important metabolic pathways for neurological diseases: hsa05012 Parkinson's disease, hsa05016 Huntington's disease, and hsa05O10 Alzheimer's disease; the membrane proteins participate in the following nucleic acid, protein, amino acid, sugar, and fat metabolic pathways:_hsa03O13 RNA transport, hsa03018 RNA degradation, hsa03O4O spliceosome, hsa03010 ribosome, hsa04141 ER protein processing, hsa04810 regulation of the actin skeleton, hsa03O5O proteasome, hsa01230 amino acid biosynthesis, hsa00190 oxidative phosphorylation, hsa00230 purine metabolism, hsa04932 non alcoholic fatty liver disease, hsaOO020 citric acid cycle, hsa03008 biogenesis of eukaryotic ribosomes, hsa00240 pyrimidine metabolism, hsa00650 butanoate metabolism, hsa01200 carbon metabolism, hsa00520 amino sugar and nucleotide sugar metabolism, hsa05034 alcoholism, hsaOO071 fatty acid degradation, hsa04120 ubiquitin mediated proteolysis, hsa05205 proteoglycans in cancer, hsa05206 microRNA in cancer, hsa00410 alanine metabolism, hsa00340 histidine metabolism, hsa00910 nitrogen metabolism, hsa00250 alanine, aspartic acid, and glutamic acid metabolism, hsa00350 tyrosine metabolism, hsa04726 serotonin-activated synapses, hsa00900 backbone of terpenoid biosynthesis, hsa04610 complement and coagulation cascade, hsa00330 arginine and proline metabolism, hsa04520 adhesion knot, hsa00860 porphyrin and chlorophyll metabolism, hsaOOO10 glycolysis and glycogenesis, hsa00982 drug metabolism cytochrome P450, hsa00980 cytochrome P450 metabolism of exogenous drugs, hsa04962 vasopressin regulates water reabsorption, and hsa00983 drug metabolism - other enzymes; and the membrane proteins participate in the following cell connection, nerve connection, vascular, endocrine, and reproductive system metabolic pathways: hsa04510 sticky spots, hsa04724 glutamatergic synapses, hsa04530 tightjunctions, hsa00830 retinol metabolism, hsa04114 oocyte meiosis, hsa04728 dopaminergic synapses, hsaOO140 steroid hormone biosynthesis, hsa04261 adrenergic signaling in cardiomyocytes, hsa04727 7-aminobutyric acid synapses, hsa04725 cholinergic synapses, hsa04540 gap junction, hsa04971 gastric acid secretion, hsa04713 circadian entrainment, hsa04931 insulin resistance, hsa05031 amphetamine addiction, hsa04924 renin secretion, hsa04925 aldosterone synthesis and secretion, hsa00590 arachidonic acid metabolism, hsa04270 vascular smooth muscle contraction, hsa00760 niacin and nicotinamide metabolism, hsa04740 olfactory conduction, hsa04260 myocardial contraction, hsa0472: long-term potential difference phenomenon, hsa04744 light conduction, hsa04966 collection of duct acid secretions, hsa05412 arrhythmogenic right ventricular cardiomyopathy, hsa05410 hypertrophic cardiomyopathy, hsa04146 peroxisome, hsa05414 dilated cardiomyopathy, hsa04970 salivation, hsa04611 platelet stimulation, hsa05204 chemical carcinogenesis, and hsa04721 synaptic vesicle cycling.

15. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

ligand proteins are HrpNEcb multi epitopic-like ligand proteins; and cascading biological effects

of the HrpNEcb proteins comprise cellular processes, environmental information processing,

genetic information processing, metabolism, and biological systems, wherein the cellular

processes comprise transport, catabolism, cell population, cell activity, and cell growth and death

involving multiple differentially expressed genes (DEGs) induced by the HrpNEcb multi epitopic

like ligand proteins; the environmental information processing comprises signal molecules and

interactions thereof, signal transduction, and membrane transport involving multiple DEGs

induced by the HrpNEcb multi epitopic-like ligand proteins; the genetic information processing

comprises translation, replication, repair, folding, classification, and degradation involving

multiple DEGs induced by the HrpNEcb multi epitopic-like ligand proteins; the metabolism

comprises biodegradation and metabolism, nucleotide metabolism, amino acid metabolism,

metabolic cofactors and vitamins, lipid metabolism, sugar biosynthesis and metabolism, energy

metabolism, carbohydrate metabolism, and amino acid metabolism involving multiple DEGs

induced by the HrpNEcb multi epitopic-like ligand proteins; and the biological systems comprise

sensory system, nervous system, immune system, excretory system, environmental adaptation,

endocrine system, digestive system, and developmental circulatory system involving multiple

DEGs induced by the HrpNEcb multi epitopic-like ligand proteins.

16. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

ligand proteins are HrpNEch multi epitopic-like ligand proteins; and cascading biological effects

of the HrpNEch proteins comprise cellular processes, environmental information processing, genetic information processing, metabolism, and biological systems, wherein the cellular processes comprise transport, catabolism, cell population, cell activity, and cell growth and death involving multiple DEGs induced by the HrpNEch multi epitopic-like ligand proteins; the environmental information processing comprises signal molecules and interactions thereof, signal transduction, and membrane transport involving multiple DEGs induced by the HrpNEch multi epitopic-like ligand proteins; the genetic information processing comprises translation, replication, repair, folding, classification, and degradation involving multiple DEGs induced by the HrpNEch multi epitopic-like ligand proteins; the metabolism comprises biodegradation and metabolism, nucleotide metabolism, amino acid metabolism, metabolic cofactors and vitamins, lipid metabolism, sugar biosynthesis and metabolism, energy metabolism, carbohydrate metabolism, and amino acid metabolism involving multiple DEGs induced by the HrpNEch multi epitopic-like ligand proteins; and the biological systems comprise sensory system, nervous system, immune system, excretory system, environmental adaptation, endocrine system, digestive system, and developmental circulatory system involving multiple DEGs induced by the HrpNEch multi epitopic-like ligand proteins.

17. The useof HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

of the HrpNEcb multi epitopic-like ligand proteins further comprise significant differential

expression results of gene function groups induced by the HrpNEcb multi epitopic-like ligand

proteins, comprising: biological process-associated DEGs: involving breeding, cell death, immune

system process, behavior, metabolism, cellular process, reproductive process, biological adhesion,

signals, cell biological processes, development, growth, movement, a single organization process,

a process of biofacies, rhythmic process, positive regulation of biological process, negative

regulation of biological process, biological process adjustment, stimulus-response, positioning,

biological control, cellular component organization or biogenesis, cell aggregation, detoxification,

and presynaptic processes involved in synaptic transmission; cell composition-associated DEGs:

involving cells and extracellular region, nucleoid, membrane, virus particles, cells and extracellular matrix, cell membrane closed cavity, complex macromolecules, organelles, extracellular matrix components, extracellular region, organelle parts, virus particle parts, membrane parts, synapse parts, cell parts, synapses, and supramolecular fiber cells; and molecular function-associated DEGs: involving transcription factor activity, protein binding, nucleic acid binding transcription factor activity, catalytic activity, signal sensor activity, molecular structure activity, transport activity, electron carrier activity, formins activity, antioxidant activity, metal chaperone activity, protein markers, chemical enticement activity, translational control, chemical repellent activity, activity molecular sensors, and regulation of molecular function.

18. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

of the HrpNEch multi epitopic-like ligand proteins further comprise significant differential

expression results of gene function groups induced by the HrpNEch multi epitopic-like ligand

involving cells and extracellular region, nucleoid, membrane, virus particles, cells and

extracellular matrix, cell membrane closed cavity, complex macromolecules, organelles,

extracellular matrix components, extracellular region, organelle parts, virus particle parts,

membrane parts, synapse parts, cell parts, synapses, and cell supramolecular fibers; and molecular

function-associated DEGs: involving transcription factor activity, protein binding, nucleic acid

binding transcription factor activity, catalytic activity, signal sensor activity, molecular structure

activity, transport activity, bingding, electron carrier activity, formins activity, antioxidant activity, metal chaperone activity, protein markers, chemical enticement activity, translational control, chemical repellent activity, activity molecular sensors, and regulation of molecular function.

19. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

or pharmaceutical industry according to claim 1 or 3, wherein a dosage form of a product or drug

of the HrpN-type multi epitopic-like ligand proteins in the pharmaceutical industry is liquid,

powder, tablets, or capsules.

20. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

or pharmaceutical industry according to claim 19, wherein the HrpN-type multi epitopic-like

ligand proteins are HrpNEcb multi epitopic-like ligand proteins; and the product or drug is mainly

prepared from purified HrpNEcb with a mass content of 0.001% to 100%.

21. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

ligand proteins are HrpNEch multi epitopic-like ligand proteins; and the product or drug is mainly

prepared from purified HrpNEch with a mass content of 0.001% to 100%.

22. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

or pharmaceutical industry according to any one of claims 1 to 21, wherein the HrpN-type multi

epitopic-like ligand proteins are purified HrpN-type proteins.

23. The use of HrpN-type multi epitopic-like ligand proteins in food, cosmetics, health products,

or pharmaceutical industry according to claim 22, wherein the HrpN-type multi epitopic-like

ligand proteins are purified by the following steps:

step 1: crushing engineered bacteria with a high-pressure crushing machine under a high

pressure of 800 Mpa to 1,000 Mpa, and passing a crushed bacteria solution through a butterfly

continuous flow centrifuge to remove cell wall debris; and step 2: purifying HrpN-His recombinant proteins with Ni-NTA agarose gel column to obtain purified HrpN-type multi epitopic-like ligand protein product.

24. A method for purifying HrpN-type multi epitopic-like ligand proteins, comprising the

following steps:

continuous flow centrifuge to remove cell wall debris; and

step 2: purifying HrpN-His recombinant proteins with Ni-NTA agarose gel column to obtain

purified HrpN-type multi epitopic-like ligand protein product.

25. The method for purifying HrpN-type multi epitopic-like ligand proteins according to claim 24,

wherein the HrpN-type multi epitopic-like ligand proteins each comprise one or more structural

groups or epitopes with hydrophobic nonpolar amino acid residues, one or more structural groups

or epitopes with polar uncharged amino acid residues, one or more structural groups or epitopes

with amido-containing polar uncharged amino acid residues, and one or more structural groups or

epitopes with acidic positively charged or basic negatively charged amino acid residues; the

hydrophobic nonpolar amino acid residues comprise valine, leucine, isoleucine, alanine,

phenylalanine, and methionine residues, the polar uncharged amino acid residues comprise serine

residues, the amido-containing polar uncharged amino acid residues comprise asparagine and

glutamine residues, and the acidic positively charged or basic negatively charged amino acid

residues comprise aspartate, glutamic acid, lysine, histidine, and arginine residues; a proportion of

the hydrophobic nonpolar amino acid residues, the polar uncharged amino acid residues, the

amido-containing polar uncharged amino acid residues, and the acidic positively charged or basic

negatively charged amino acid residues in total sequence of each of the HrpN-type multi epitopic

like ligand proteins is 62.3% to 73.7%, a proportion of these amino acid residues in conserved

domain of each of the HrpN-type multi epitopic-like ligand proteins is 61% to 74%, and a

proportion of these amino acid residues in a-helical structure of each of the HrpN-type multi

epitopic-like ligand proteins is 66.2% to 79%; and the one or more structural groups or epitopes with hydrophobic nonpolar amino acid residues, the one or more structural groups or epitopes with polar uncharged amino acid residues, the one or more structural groups or epitopes with amido containing polar uncharged amino acid residues, and the one or more structural groups or epitopes with acidic positively charged or basic negatively charged amino acid residues allow complementarity, interaction, and specific recognition, activation, and binding of ligand, receptor molecular space structure, and electrical properties through hydrogen bonds, ionic bonds, and hydrophobic, non-polar, polar, and van der Waals forces, and form tight binding surfaces or complexes with multiclass receptors, which causes changes in conformation, energy, electricity, and information of receptor molecule to trigger amplified cascading biological effects through signal transduction.

26. The method for purifying HrpN-type multi epitopic-like ligand proteins according to claim 24,

wherein the HrpN-type multi epitopic-like ligand proteins comprise HrpNEcc, HrpNEca,

HrpNEcb, HrpNEch, HrpNDaz, HrpNDada, HrpNDasp, HrpNad, HrpNDaf, HrpNEa, HrpNSam,

HrpNBag, HrpNPas, and HrpNEnt.