AU2021382439A1

AU2021382439A1 - Methods for producing transgenic plants overexpressing non-symbiotic hemoglobin class-1 gene, and applications thereof

Info

Publication number: AU2021382439A1
Application number: AU2021382439A
Authority: AU
Inventors: Subhra Chakraborty; Jagadis Gupta KAPUGANTI; Pradeep Kumar PATHAK
Original assignee: National Institute Of Plant Genome Res; National Centre for Plant Genome Research
Current assignee: National Centre for Plant Genome Research
Priority date: 2020-11-18
Filing date: 2021-11-18
Publication date: 2023-06-22
Also published as: WO2022107165A1; AU2021382439A9; CA3199350A1

Abstract

The present disclosure discloses a recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2. The present disclosure further discloses recombinant vector, recombinant host comprising said recombinant vector. A method for obtaining transgenic plant is also disclosed. A transgenic plant expressing the polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2 is also disclosed herein. The transgenic plant exhibits an increase in fruit numbers as well a decrease in fruit weight relative to a non-transgenic plant of the same species.

Description

METHODS FOR PRODUCING TRANSGENIC PLANTS OVEREXPRESSING NON-SYMBIOTIC HEMOGLOBIN CLASS-1 GENE, AND APPLICATIONS THEREOF

FIELD OF INVENTION

[001] The subject matter disclosed herein broadly relates to the field of plant molecular biology, and in particular relates to the development of early yielding and enhanced fruiting transgenic plant lines.

BACKGROUND OF THE INVENTION

[002] Tomatoes and tomato products are one of the most familiar consumables in the normal human diet. Quantitatively, they are the most consumed non-starchy vegetable and are the most significant source of dietary lycopene. Tomatoes serves as a powerful antioxidant that has greater bioavailability after cooking and processing. In addition to the specific benefits of tomato consumption, it helps individuals to increase vegetable intake, leading to improved overall eating patterns, and ultimately, better health.

[003] As per the Monthly Report Tomato, January-2018 by the Ministry of Agriculture and farmers welfare (agricoop.nic.in/annual-report), the data for the yearly tomato prices shows unpredictable patterns, due to which the costing and availability also suffers for the common people. Helgi library data shows that India is becoming an emerging consumer of tomatoes and its name is not even mentioned in the list of tomato exporters or largest producers worldwide. Such differences between the production and the consumption patterns of our country could be a matter of concern considering the price of the vegetable for the common people.

[004] Leshem et al. (Non-invasive photoacoustic spectroscopic determination of relative endogenous nitric oxide and ethylene content stoichiometry during the ripening of strawberries Fragaria anannasa (Duch.) and avocados Per sea americana (Mill.), Journal of Experimental Botany, Volume 51, Issue 349, August 2000, Pages 1471-1473, https://doi.org/10.1093/jexbot/51.349.1471) have studied the relationship between nitric oxide and ethylene pathways. In post-harvest strawberries and avocados, it was observed that endogenous nitric oxide levels indirectly governed the fruit senescence by regulating the ethylene pathways that lead to fruit ripening and senescence. Although, extensive studies are coming up with similar results, but there still persists a need for such studies to solve problems for various climacteric fruits in regard to their low yield cost-effective prices.

[005] Despite the extensive research done in this field, the presently available techniques are not able to practically help the farmers producing crops in terms of yield, cost effectiveness and availability of such enhanced crops. Also, despite the substantial ongoing research on phytoglobins, hardly any reports are available on expression studies of phytoglobins in tomato plants. Thus, there is still a dire need in the state of art to develop rich tomato varieties, which could result in meeting the present-day consumption needs, alongside taking care of ease of availability of such crops at affordable prices.

SUMMARY OF THE INVENTION

[006] In an aspect of the present disclosure, there is provided a recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2.

[007] In another aspect of the present disclosure, there is provided a recombinant vector comprising the recombinant construct as described herein.

[008] In another aspect of the present disclosure, there is provided a recombinant host cell comprising the recombinant construct as described herein, or the recombinant vector as described herein.

[009] In another aspect of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with a recombinant vector comprising the recombinant construct as described herein or with a recombinant host cell comprising the recombinant vector or the recombinant construct as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2.

[0010] In another aspect of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: (a) transforming an explant with a recombinant vector comprising the recombinant construct as described herein or with a recombinant host cell comprising the recombinant vector or the recombinant construct as described herein, to obtain transgenic plant cells; and (b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non-transgenic plant of the same species.

[0011] In another aspect of the present disclosure, there is provided a method for obtaining a transgenic Solatium lycopersicum plant, said method comprising: a) obtaining a recombinant vector comprising the recombinant construct as described herein or a recombinant host cell comprising the recombinant vector or the recombinant construct as described herein; b) transforming a Solatium lycopersicum explant with the recombinant vector or with the recombinant host cell obtained in step (a), to obtain a transformed plant cell; and c) regenerating a transgenic Solatium lycopersicum plant from the transformed plant cell, wherein the transgenic Solatium lycopersicum plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic Solatium lycopersicum plant.

[0012] In another aspect of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: a) obtaining a recombinant vector comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2; b) introducing the recombinant vector obtained in step (a) into a plant cell, to obtain putative transformed plant cells; c) screening the putative transformants, to obtain transgenic plant cell; and d) regenerating the transgenic plant cell, for obtaining a transgenic plant, wherein the transgenic plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic plant of the same species.

[0013] In another aspect of the present disclosure, there is provided a transgenic plant cell comprising a nucleic acid fragment encoding a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2.

These and other features, aspects, and advantages of the present subject matter will be better understood with reference to the following description. This summary is provided to introduce a selection of concepts in a simplified form. This summary is not intended to identify key features or essential features of the claimed subject matter.

BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS

[0014] The following drawings form a part of the present specification and are included to further illustrate aspects of the present disclosure. The disclosure may be better understood by reference to the drawings in combination with the detailed description of the specific embodiments presented herein.

[0015] Figure la depicts the tissue culture grown transgenic tomato plants from the cotyledonary leaves of the explant; Figure lb depicts hardening of tissue culture grown transgenic tomato plants for 7 days; Figure 1c depicts transgenic tomato plants transferred to the soil for further growth, in accordance with an embodiment of the present disclosure.

[0016] Figure 2a depicts the gel-electrophoresis results from the PCR reaction done to screen transgenic tomato plants by using BASTA primers specific to the bar gene sequence present in the pEarleyGate 201 vector, as used in the present disclosure; Figure 2b depicts real-time PCR results done to screen transgenic tomato plants; Figure 2c depicts western blot results done to screen transgenic tomato plants, in accordance with an embodiment of the present disclosure.

[0017] Figure 3a depicts nitric oxide (NO) levels as per the diaminofluorescein- FM (DAF-FM) fluorescence test results of wild type (WT) and sample transgenic tomato plants; Figure 3b depicts quantified NO fluorescence intensity in the WT and the transgenic tomato plants; Figure 3c depicts gaseous NO levels measured by the gas -phase chemiluminescence in WT and transgenic tomato plants, in accordance with an embodiment of the present disclosure.

[0018] Figure 4 depicts the slightly hypoxic conditions of the fruits produced from the transgenic tomato plants, in accordance with an embodiment of the present disclosure. [0019] Figure 5 shows the increased number of cherry-like tomato fruits in transgenic tomato plants with reduced weight and diameter, in accordance with an embodiment of the present disclosure.

[0020] Figure 6a depicts regular fruit ripening in the wild type tomato plants having normal NO concentrations; Figure 6b depicts early fruit ripening in transgenic tomato plants having less NO concentrations from the resulting overexpression lines; Figure 6c depicts the representative images of average number of fruits per bunch from wild type tomato plants, and Figure 6d depicts the representative images of average number of fruits per bunch from nsHb over expression tomato plants, in accordance with an embodiment of the present disclosure.

[0021] Figure 7 depicts the delayed ripening process in wild types in comparison to transgenics overexpressing nsHb, suggesting that NO is involved in inhibition of fruit ripening in tomato, in accordance with an embodiment of the present disclosure.

[0022] Figure 8 depicts the pEarley Gate 201 expression recombinant vector map comprising the nucleic acid fragment nsHb, having a nucleic acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 1, in accordance with an embodiment of the present disclosure. [0023] Figure 9 depicts the gas chromatography-mass spectrometry (GC-MS) analysis used to detect metabolites of tomato fruits, in accordance with an embodiment of the present disclosure.

[0024] Figure 10 depicts the variation in the levels of sugars between WT and nsHb over expression tomato fruits, detected using untargeted metabolite analysis, in accordance with an embodiment of the present disclosure.

[0025] Figure 11 depicts the ICP-MS analysis of WT and nsHb over expression tomato fruits, in accordance with an embodiment of the present disclosure.

DETAILED DESCRIPTION OF THE INVENTION

[0026] Those skilled in the art will be aware that the present disclosure is subject to variations and modifications other than those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps, features, compositions, and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.

Definitions

[0027] For convenience, before further description of the present disclosure, certain terms employed in the specification, and examples are delineated here. These definitions should be read in the light of the remainder of the disclosure and understood as by a person of skill in the art. The terms used herein have the meanings recognized and known to those of skill in the art, however, for convenience and completeness, particular terms and their meanings are set forth below.

[0028] The articles “a”, “an” and “the” are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.

[0029] The terms “comprise” and “comprising” are used in the inclusive, open sense, meaning that additional elements may be included. It is not intended to be construed as “consists of only”. [0030] Throughout this specification, unless the context requires otherwise the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated element or step or group of element or steps but not the exclusion of any other element or step or group of element or steps.

[0031] The term “including” is used to mean “including but not limited to”. “Including” and “including but not limited to” are used interchangeably.

[0032] The term “at least one” used herein refers to one or more and thus includes individual components as well as mixtures/combinations.

[0033] The term “phytoglobins” refers to globular plant proteins classified into the globin superfamily, which contain a heme prosthetic group. Phytoglobins are ubiquitously distributed in plants as they have been identified in algae and land plants, including primitive bryophytes and evolved monocots and dicots.

[0034] As used herein, the term "recombinant construct" is a construct build by laboratory methods of genetic recombination to bring together genetic materials from multiple sources, creating sequences that would not otherwise be found in the genome. [0035] The term “vector”, as used herein, refers to a DNA molecule used as a vehicle to artificially carry foreign genetic material into another cell, where it can be replicated and/or expressed. The term “recombinant vector” refers to a vector containing foreign DNA sequence.

[0036] The term “transgenic plants” refers to a plant that is obtained by transforming the recombinant construct of recombinant vector of the present disclosure into a wildtype or a non-transgenic plant by artificially introducing the vector or the construct through genetic engineering techniques.

[0037] The term “transgenic Solatium lycopersicum plant” or “transgenic tomato plants” refers to the nsHb over expressing tomato plants that are obtained by transforming a wild-type or a non-transgenic plant by artificially introducing the vector or the construct through genetic engineering techniques as per the present disclosure. [0038] The term “transformation” refers to a process involving genetic alteration of a plant cell resulting from the direct uptake and incorporation of exogenous genetic material from its surroundings through the cell membrane.

[0039] The term “heterologous” refers to a transfected DNA part, that is not of the host’s autonomous DNA or simply isn’t a part of the host’s genetic material. The term “heterologous promoter” used herein refers to the constitutive promoter obtained from the other source than the host per se.

[0040] The term “OE” in the examples refer to the nsHb “over-expression” lines of transgenic tomato developed herein, as per the present disclosure.

Sequences used in the present disclosure:

[0041] SEQ ID NO: 1 depicts the nucleic acid sequence encoding non-symbiotic hemoglobin.

[0042] SEQ ID NO: 2 depicts the amino acid sequence of non-symbiotic hemoglobin class 1 gene (nsHbl).

>NP_001234498.1 non-symbiotic hemoglobin class 1 [Solarium lycopersicum] [0043] SEQ ID NO: 3 depicts the forward primer nucleic acid sequence used for amplification of Solanum lycopersicum non-symbiotic hemoglobin class 1 gene (SINSH1).

CACCATGAGTAGCTTTAGTGAAGA

[0044] SEQ ID NO: 4 depicts the reverse primer nucleic acid sequence used for amplification of Solanum lycopersicum non-symbiotic hemoglobin class 1 gene (SINSH1).

TAGCACACAAATTAGATTAT

[0045] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the disclosure, the preferred methods, and materials are now described. All publications mentioned herein are incorporated herein by reference.

[0046] As discussed in the background section of the present disclosure, the ratio between the consumption and production of tomato in India is not favorable for both farmers and consumers because being a highly disease susceptible variety, tomato face hurdles to successfully reaching the commercialization platform. Limited fruiting and the cropping cycles also hampers the process of mass production. Although, advanced tomato varieties have been developed to resist major problems including both abiotic and biotic stresses, but there still persists a dearth in further enhancing the tomato production to meet the current requirements and solving problems of ever-increasing prices of such basic vegetable.

[0047] In order to address the aforementioned limitations, the present disclosure discloses a method for obtaining a transgenic Solatium lycopersicum plant, developed through Agrobacterium mediated transformation. The transgenic lines involve the overexpression of phytoglobin gene nsHb (said gene encoding a polypeptide having an amino acid sequence having at least 95% identity to SEQ ID NO: 2) resulting in reduced nitric oxide (NO) levels, as phytoglobin 1 functionally scavenges nitric oxide which plays a role in regulating ethylene levels in fruits. On overexpression of phytoglobin gene, the produced transgenic plant shows increased number of fruits per plant as compared to wild type Solatium lycopersicum (tomato) plant. The transgenic plants developed from the method as disclosed herein also shows accelerated fruit setting time and the fruits obtained are of cherry-like appearance. As per the disclosure, the increased fruit number from the developed transgenic lines can enhance tomato production to satisfy consumption needs. Shortened time period for fruit ripening can also help in producing multiple crops every year from the view of urban agricultural form. Enhanced yield from the present transgenic lines will also help to negotiate the damages or spoilage incurred to the total yield due to disease/infection or transportation. Early ripening of fruits will also help in reducing the use of artificial ripening agents that are generally used in case of tomatoes. Cherry like tomatoes are comparatively smaller than the wild type tomatoes, which saves the tomatoes from getting fruit cracks due to their smaller sizes, minimizing the additional yield damages. The relatively smaller sized tomatoes developed from the transgenic plants by the method disclosed herein are uniform in shape, which can also help in easy transportation and marketing in small packets with minimal losses. Further, the transgenic tomato plant as per the present disclosure produces tomato which have cherry-like in appearance, thereby, providing tomatoes that have high value in terms of their sensorial attributes and are a requirement in culinary decoration and as an ingredient in many dishes. The present disclosure thus provides a recombinant construct comprising a nucleic acid sequence as set forth in SEQ ID NO: 1 linked to a heterologous promoter. The present disclosure further discloses a recombinant vector comprising the recombinant construct as described herein. The heterologous promoter disclosed herein is not limited to single CaMV promoter, it extends to CaMV promoter and double 35S promoter. A bacterial recombinant host cell is disclosed which comprises either a recombinant construct or a recombinant vector as disclosed herein. The present disclosure further discloses a method of obtaining a transgenic plant cell that is developed by transforming an explant with either a recombinant vector or by a recombinant host cell to obtain a transformed plant cell, transformed plant cells are further screened for the transgenic plant cells , which produces the polypeptide sequence having amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2. A method for obtaining a transgenic plant is further disclosed, which comprises transforming an explant with a recombinant vector or a recombinant host cell as disclosed herein to obtain a transgenic plant cell, followed by regenerating obtained transgenic cells to get transgenic plants which exhibit altered fruit phenotype, and early ripening of the fruits relative to a non-transgenic plant of the same species. The transgenic tomato plants also exhibit enhanced nutritional properties by enhancement of certain elements such as Myo-Inositol, Na, Mg, K and Ca, as compared to wild type tomato plants. Further, a higher accumulation of sugars such as glucose, sucrose, and fructose are also observed in transgenic tomato plants as compared to wild type tomato plants. Hence, owing to the enhanced nutritional properties, transgenic tomato plants is suitable for human consumption and can also be deployed in a food product.

[0048] The present disclosure also discloses a method for obtaining a transgenic tomato plant in particular, said method comprises, obtaining a recombinant vector or a recombinant host cell as described herein, to transform the tomato explant to get transformed plant cell. The transformed plant cell is subjected to regeneration to obtain a transgenic tomato plant showing early ripening and altered fruit phenotype relative to a non-transgenic tomato plant. As per the present disclosure, the transgenic plants also exhibit increase in fruit number and decrease in fruit weight relative to non- transgenic plants. The method of transformation as per the present disclosure is not limited to Agrobacterium mediated transformation, but also extends to particle gun bombardment method, in-planta transformation method, liposome mediated transformation method, protoplast transformation method, microinjection, and macro injection method. Also, methods of producing transgenic plant cells or plants per se is not restricted to tomato. The present disclosure extends further to production of other climacteric plants such as banana, mango, sugar apple, peach, apricot and the like.

[0049] The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only. Functionally-equivalent products, compositions, and methods are clearly within the scope of the disclosure, as described herein.

[0050] In an embodiment of the present disclosure, there is provided a recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2. In another embodiment of the present disclosure, the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95.5%, or 96%, or 96.5%, or 97%, or 97.5%, or 98%, or 98.5%, or 99%, or 99.5%, or 99.9% identity to the sequence as set forth in SEQ ID NO: 2.

[0051] In an embodiment of the present disclosure, there is provided a recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2, In another embodiment of the present disclosure, the nucleic acid fragment encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2.

[0052] In an embodiment of the present disclosure, there is provided a recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 1. In another embodiment, the nucleic acid fragment is having a nucleic acid sequence with at least 95.5%, or 96%, or 96.5%, or 97%, or 97.5%, or 98%, or 98.5%, or 99%, or 99.5% identity to the sequence as set forth in SEQ ID NO: 1.

[0053] In an embodiment of the present disclosure, there is provided a recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence as set forth in SEQ ID NO: 1.

[0054] In an embodiment of the present disclosure, there is provided a recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2.

[0055] In an embodiment of the present disclosure, there is provided a recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence as set forth in SEQ ID NO: 1.

[0056] In an embodiment of the present disclosure, there is provided a recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2, and wherein the heterologous promoter is selected from the group consisting of CaMV promoter, double 35 S promoter, a single 35 S promoter. In another embodiment of the present disclosure, the heterologous promoter is CaMV promoter. In yet another embodiment of the present disclosure, the heterologous promoter is double 35 S promoter. In one another embodiment of the present disclosure, the heterologous promoter is a single 35 S promoter. [0057] In an embodiment of the present disclosure, there is provided a recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter having an amino acid sequence as set forth in SEQ ID NO: 2, and wherein the heterologous promoter is selected from the group consisting of CaMV promoter, double 35 S promoter.

[0058] In an embodiment of the present disclosure, there is provided a recombinant vector comprising a recombinant construct, said recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2.

[0059] In an embodiment of the present disclosure, there is provided a recombinant vector comprising a recombinant construct, said recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2.

[0060] In an embodiment of the present disclosure, there is provided a recombinant vector comprising a recombinant construct, said recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 1.

[0061] In an embodiment of the present disclosure, there is provided a recombinant vector comprising a recombinant construct, said recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence as set forth in SEQ ID NO: 1. [0062] In an embodiment of the present disclosure, there is provided a recombinant vector comprising a recombinant construct, said recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2, and wherein the heterologous promoter is selected from the group consisting of CaMV promoter, double 35 S promoter, and single 35 S promoter.

[0063] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a recombinant vector, said recombinant vector comprising a recombinant construct, as described herein.

[0064] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a recombinant construct, said recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2.

[0065] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a recombinant construct, said recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2.

[0066] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant vector as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2.

[0067] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant vector as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2.

[0068] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant vector as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence as set forth in SEQ ID NO: 1.

[0069] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant vector as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 1.

[0070] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant vector as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence as set forth in SEQ ID NO: 1.

[0071] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant host cell as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2.

[0072] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant host cell as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2.

[0073] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant host cell as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 1.

[0074] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant host cell as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 1, and wherein the nucleic acid encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence as set forth in SEQ ID NO: 1.

[0075] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant host cell as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence as set forth in SEQ ID NO: 1.

[0076] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant construct as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2.

[0077] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant construct as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2.

[0078] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell, said method comprising: (a) transforming an explant with the recombinant construct as described herein, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, and wherein the nucleic acid fragment is having a nucleic acid sequence as set forth in SEQ ID NO: 1. [0079] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant cell as described herein, wherein the transgenic plant cell is Solarium lycopersicum cell.

[0080] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: (a) transforming an explant with the recombinant vector as described herein, to obtain transgenic plant cells; and (b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non- transgenic plant of the same species.

[0081] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: (a) transforming an explant with the recombinant host cell as described herein, to obtain transgenic plant cells; and (b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non- transgenic plant of the same species.

[0082] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: (a) transforming an explant with the recombinant vector as described herein, to obtain transgenic plant cells; and (b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non- transgenic plant of the same species, and wherein transforming is done by a method selected from the group consisting of Agrobacterium mediated transformation method, particle gun bombardment method, in-planta transformation method, liposome mediated transformation method, protoplast transformation method, microinjection, and macro injection. In another embodiment of the present disclosure, transforming is done by Agrobacterium mediated transformation method.

[0083] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: (a) transforming an explant with the recombinant host cell as described herein, to obtain transgenic plant cells; and (b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non- transgenic plant of the same species, and wherein transforming is done by a method selected from the group consisting of Agrobacterium mediated transformation method, particle gun bombardment method, in-planta transformation method, liposome mediated transformation method, protoplast transformation method, microinjection, and macro injection.

[0084] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: (a) transforming an explant with the recombinant vector as described herein, to obtain transgenic plant cells; and (b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non- transgenic plant of the same species, and wherein the transgenic plant is Solarium lycopersicum.

[0085] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: (a) transforming an explant with the recombinant vector as described herein , to obtain transgenic plant cells; and (b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non- transgenic plant of the same species, and wherein the transgenic plant is Solarium lycopersicum.

[0086] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: (a) transforming an explant with the recombinant host cell as described herein, to obtain transgenic plant cells; and (b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non- transgenic plant of the same species, and wherein the transgenic plant is Solanum lycopersicum.

[0087] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: (a) transforming an explant with the recombinant vector as described herein, to obtain transgenic plant cells; and (b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non- transgenic plant of the same species, and wherein the transgenic plant exhibits an increase in fruit numbers relative to a non-transgenic plant of the same species.

[0088] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: (a) transforming an explant with the recombinant vector comprising the recombinant construct further comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, to obtain transgenic plant cells; and (b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non-transgenic plant of the same species.

[0089] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: (a) transforming an explant with the recombinant vector as described herein or with the recombinant host cell comprising the recombinant vector further comprising the recombinant construct further comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2, and wherein recombinant construct comprises of the nucleic acid that encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2 or the recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2, and wherein recombinant construct comprises of the nucleic acid that encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, and wherein the recombinant host cell is a bacterium, to obtain transgenic plant cells; and (b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non-transgenic plant of the same species.

[0090] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic plant, said method comprising: (a) transforming an explant with the recombinant vector as described herein or with the recombinant host cell as described herein, to obtain transgenic plant cells; and (b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non-transgenic plant of the same species, wherein the transgenic plant is selected from the group consisting of tomato, banana, mango, sugar apple, peach, apricot. In another embodiment of the present disclosure, the transgenic plant is tomato.

[0091] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic Solatium lycopersicum plant, said method comprising: a) obtaining the recombinant vector as described herein; b) transforming a Solatium lycopersicum explant with the recombinant vector obtained in step (a), to obtain a transformed plant cell; and c) regenerating a transgenic Solatium lycopersicum plant from the transformed plant cell, wherein the transgenic Solatium lycopersicum plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic Solatium lycopersicum plant.

[0092] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic Solatium lycopersicum plant, said method comprising: a) obtaining the recombinant vector as described herein; b) transforming a Solatium lycopersicum explant with the recombinant vector obtained in step (a), to obtain a transformed plant cell; and c) regenerating a transgenic Solatium lycopersicum plant from the transformed plant cell, wherein the transgenic Solarium lycopersicum plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic Solarium lycopersicum plant.

[0093] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic Solarium lycopersicum plant, said method comprising: a) obtaining the recombinant vector as described herein; b) transforming a Solarium lycopersicum explant with the recombinant vector obtained in step (a), to obtain a transformed plant cell; and c) regenerating a transgenic Solarium lycopersicum plant from the transformed plant cell, wherein the transgenic Solarium lycopersicum plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic Solarium lycopersicum plant, and wherein transgenic Solarium lycopersicum plant produces the polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2.

[0094] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic Solarium lycopersicum plant, said method comprising: a) obtaining the recombinant vector as described herein; b) transforming a Solarium lycopersicum explant with the recombinant vector obtained in step (a), to obtain a transformed plant cell; and c) regenerating a transgenic Solarium lycopersicum plant from the transformed plant cell, wherein the transgenic Solarium lycopersicum plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic Solarium lycopersicum plant, and wherein transgenic Solarium lycopersicum plant produces the polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2.

[0095] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic Solarium lycopersicum plant, said method comprising: a) obtaining the recombinant vector as described herein; b) transforming a Solarium lycopersicum explant with the recombinant vector obtained in step (a), to obtain a transformed plant cell; and c) regenerating a transgenic Solanum lycopersicum plant from the transformed plant cell, wherein the transgenic Solanum lycopersicum plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic Solanum lycopersicum plant, and wherein transgenic Solanum lycopersicum plant produces the polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, and wherein the polypeptide is encoded by a nucleic acid fragment having a nucleic acid sequence as set forth in SEQ ID NO: 1.

[0096] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic Solanum lycopersicum plant, said method comprising: a) obtaining the recombinant host cell as described herein; b) transforming a Solanum lycopersicum explant with the recombinant host cell obtained in step (a), to obtain a transformed plant cell; and c) regenerating a transgenic Solanum lycopersicum plant from the transformed plant cell, wherein the transgenic Solanum lycopersicum plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic Solanum lycopersicum plant.

[0097] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic Solanum lycopersicum plant as described herein, wherein the transgenic Solanum lycopersicum plant exhibits an increase in fruit numbers relative to a non-transgenic plant of the same species, and wherein the transgenic plant exhibits a decrease in fruit weight relative to a non-transgenic plant of the same species.

[0098] In an embodiment of the present disclosure, there is provided a method for obtaining a transgenic Solanum lycopersicum plant, said method comprising: a) obtaining the recombinant host cell as described herein; b) transforming a Solanum lycopersicum explant with the recombinant host cell obtained in step (a), to obtain a transformed plant cell; and c) regenerating a transgenic Solanum lycopersicum plant from the transformed plant cell, wherein the transgenic Solanum lycopersicum plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic Solanum lycopersicum plant, wherein transgenic Solarium lycopersicum plant produces the polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2.

[0099] In an embodiment of the present disclosure, there is provided a transgenic plant obtained by the methods as described herein, wherein the transgenic plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic plant of the same species. In another embodiment, the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95.5%, or 96%, or 96.5%, or 97%, or 97.5%, or 98%, or 98.5%, or 99%, or 99.5%, or 99.9% identity to the sequence as set forth in SEQ ID NO: 2.

[00100] In an embodiment of the present disclosure, there is provided a transgenic plant comprising a nucleic acid fragment encoding a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2.

[00101] In an embodiment of the present disclosure, there is provided a transgenic plant comprising a nucleic acid fragment encoding a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, wherein the nucleic acid fragment has a nucleic acid sequence as set forth in SEQ ID NO: 1.

[00102] In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein the plant is selected from the group consisting of tomato, banana, mango, sugar apple, peach, apricot. In another embodiment of the present disclosure, the plant is tomato.

[00103] In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein the transgenic plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic plant of the same species.

[00104] In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein the transgenic plant exhibits an increase in fruit numbers relative to a non-transgenic plant of the same species, and wherein the transgenic plant exhibits a decrease in fruit weight relative to a non-transgenic plant of the same species. [00105] In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein the transgenic plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic plant of the same species, wherein the transgenic plant exhibits an increase in fruit numbers relative to a non-transgenic plant of the same species, and wherein the transgenic plant exhibits a decrease in fruit weight relative to a non-transgenic plant of the same species.

[00106] In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein the transgenic plant exhibits enhanced nutritional properties relative to a non-transgenic plant.

[00107] In an embodiment of the present disclosure, there is a food product comprising the transgenic plant, wherein the transgenic plant produces the polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2.

[00108] Although the subject matter has been described in considerable detail with reference to certain embodiments thereof, other embodiments are possible. As such, the spirit and scope of the disclosure should not be limited to the description of the embodiments contained herein.

EXAMPLES

[00109] The disclosure will now be illustrated with the working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one ordinary person skilled in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein. It is to be understood that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may apply. Materials and Methods

[00110] For the purpose of the present disclosure, Tomato seeds used for transgenic preparation was from Pusa Ruby variety (PR) of tomato plants. Variety was developed by The Indian Agricultural Research Institute (IARI), Delhi

[00111] Tomato (Solanum lycopersicum) seeds were used for growing explants that were subjected to Agrobacterium tumefaciens transformation to study the nsHb over expression in the developed transgenic tomato lines. The construct preparation step involved the use of set of primers, pEarley Gate 201 expression vector, Trizol reagent (Thermo Fisher Scientific), Verso cDNA Synthesis Kit (Thermo Fisher Scientific), Phusion® High-Fidelity DNA Polymerase (M0530). The transformation step involved the use of reagents like 100% ethanol, 4% sodium hypochlorite solution, MS media (Murashige and Skoog, 1962), pre-incubation media (3% (w/v) sucrose, lOOpM acetosyringone and 2mg/l BAP), shoot induction medium (2mg/E zeatin and 250 mg/ml cefotaxime, 3% (w/v) sucrose and 2 mg/E BASTA (plant selection), rooting media (2mg/E indole acetic acid and 250 mg/ml cefotaxime, 3% (w/v) sucrose and 2 mg/E BASTA), sterile double distilled water and Whatman filter paper for drying explants. Electrophoresis, real-time PCR and western blot analysis were performed for screening of transgenic tomato plants. 4-Amino-5-Methylamino-2',7'- Difluorofluorescein diacetate (DAF-FM DA) test was performed to assess NO levels inside the plants and parts.

EXAMPLE 1

Construction of nsHb over expressing transgenic tomato plants

[00112] Construct preparation: Solanum lycopersicum non-symbiotic hemoglobin class 1 (SINSH1) gene having the nucleic acid fragment as set forth in SEQ ID NO: 1 was amplified by using forward CACCATGAGTAGCTTTAGTGAAGA (SEQ ID NO: 3) and reverse TAGCACACAAATTAGATTAT (SEQ ID NO: 4) primer. The PCR product obtained was then cloned behind CaMV2x35S promoter in pEarley Gate 201 expression vector as shown in the Figure 8 of the present disclosure, to make the nsHb over expression construct (recombinant construct as per the present disclosure). RNA was isolated by Trizol reagent (Thermo Fisher Scientific) according to manufacturer’s instructions. Total 1 μg of RNA was used to perform reverse transcription by using Verso cDNA Synthesis Kit (Thermo Fisher Scientific). The cDNA (1 μg) obtained was then used to amplify DNA fragments in a 50 μg reaction with Phusion® High-Fidelity DNA Polymerase (M0530) by using semi-quantitative PCR. The confirmation of the nsHb over expression construct was done by PCR (gene specific primers) and sequencing before the transformation. For more stringent confirmation, western blot analysis under normal and hypoxic conditions were performed.

[00113] Tomato transformation: To prepare transgenic plants, tomato transformation was achieved by Agrobacterium tumefaciens infection method. For the purpose of the present disclosure, the Agrobacterium tumefaciens (host cell) comprising the recombinant vector, wherein the recombinant vector comprised the overexpression construct (recombinant construct) was used. To carry out tomato transformation, tomato seeds were surface sterilized in 100% ethanol for 3 minutes, and then rinsed three times with sterile double distilled water, and sequentially placed in 4% sodium hypochlorite solution for 5 minutes. The seeds were again rinsed with sterile double distilled water and plated on half-strength MS media (Murashige and Skoog, 1962) for germination. After 10 days, when the cotyledons were completely opened, seedlings were suitable to be used as explants for the Agrobacterium tumefaciens transformation. Single colony of Agrobacterium tumefaciens (EHA 105) carrying nsHb over expression construct (recombinant construct) were grown at 28°C with 200 rpm shaking for 48 hours. The cultures were centrifuged at 9,000 g for 10 minutes and the pellet was resuspended in liquid MS medium to OD₆₀₀ = 0.6. Cotyledon edges were cut from both ends, and the central part of the cotyledons was used as explants for transformation. Cotyledons were then incubated for 2 days in pre-incubation media (3% (w/v) sucrose, lOOpM acetosyingone and 2mg/l BAP). After pre-incubation, all explants were dipped into Agrobacterium tumefaciens (EHA105) suspensions and gently shaken for 20 minutes to ensure a full contact between the explants and the bacterial cells. Explants were dried on sterilized Whatman filter paper and then transferred to the co-cultivation medium followed by incubation for 2 days in the dark at 26°C. Pre-incubation medium and co-cultivation medium have the same composition as mentioned in the materials and methods of the present disclosure. After 2 days of co-culture with Agrobacterium (EHA105), explants were transferred to the shoot induction medium containing 2mg/L zeatin and 250 mg/ml cefotaxime, 3% (w/v) sucrose and 2 mg/L BASTA (plant selection). The plates were then incubated at 28 °C with a 16 hours photoperiod. Explants were then sub-cultured to fresh media every 12 days. Shoots regenerated from shoot induction medium were transferred to rooting media (2mg/L IAA and 250 mg/ml cefotaxime, 3% (w/v) sucrose and 2 mg/L BASTA) and after rooting occurs in the plants, they were transferred to pots for further growth as shown step wise in Figure la, lb and 1c.

EXAMPLE 2

Screening of transgenic tomato plants

[00114] In the previous example, the transgenic tomato plants were developed by using pEarleyGate 201 vector, which encoded a kanamycin resistance cassette for plasmid selection in bacteria along with a bar gene cassette encoding herbicide resistance. The bar gene sequence in the T-DNA, was meant for the selection of transformed plants. The bar gene from Streptomyces hygroscopicus encodes the enzyme phosphinothricin acetyltransferase and confers resistance to herbicides containing phosphinothricin or glufosinate. Glufosinate is an inhibitor of glutamine synthetase, which acts as a central enzyme for nitrogen metabolism in plants. Based on the factual knowledge about phosphinothricin being an active ingredient of the commercial herbicide Basta, the present disclosure has employed polymerase chain reaction to screen transgenic tomato plants by using BASTA primers specific to the bar gene as the positively transformed lines has a bar gene cassette as a part of T-DNA which provided confirmation for successful transformation. GoTaq Green Master Mix (M712) was used to conduct the PCR reaction according to manufacturer instruction. DNA (100-200 ng) was mixed with nuclease free water to make up the reaction mixture volume up to 12.5 μg for the loading purpose. 1% Agarose gel was made, and the reaction mixtures were loaded onto the gel for electrophoresis. Figure 2a depicts the gel pictures of the electrophoresis conducted as a confirmatory test. Real-time PCR and western blot were also performed to confirm the developed transgenic lines as shown in Figure 2b and 2c respectively. The transgenic lines thus obtained were capable of producing the non-symbiotic hemoglobin (SEQ ID NO: 2) which can be observed in Figure 2c.

EXAMPLE 3

Resulting features of transgenic tomato plants

[00115] Reduced nitric oxide: Transgenic tomato plants showed reduced nitric oxide (NO) levels because of their ability to scavenge NO. NO levels were monitored using 4-Amino-5-Methylamino-2,7-Difluorofluorescein diacetate (DAF-FM DA) test. DAF- FM DA test detects and quantifies low concentrations of nitric oxide as when DAF- FM reacts with NO, it produces fluorescent benzotriazole that can be detected by any fluorescein detector. The results from the DAF-FM DA test carried out in the present example, showed that the transgenic tomato plants exhibit reduced levels of NO as compared to wild type (WT) tomato plants. Figure 3a shows the NO levels as per the DAF-FM fluorescence test results of wild type (WT) and sample transgenic tomato plants. The difference between the WT and the transgenic tomato plants was seen in relative difference of quantified NO fluorescence intensity in the WT and the sample overexpression lines as shown in Figure 3b. Gaseous NO levels were also measured by gas-phase chemiluminescence in both the WT and transgenic tomato plants to study the NO level differences as shown in Figure 3c. Hypoxic conditions inside the developed fruits from the transgenic tomato plants were confirmed from the observations recorded for a decrease in internal oxygen with time as shown in Figure

4.

[00116] Increased fruit number, reduced fruit size and weight: The observed phenotype of fruits developed from transgenic tomato plants (transgenic plant as per the present disclosure) showed a decrease in fruit size. The number of fruits increased per plant in transgenic tomato plants as shown in Figure 5 and Table 1. It can be observed from Table 1 that the transgenic plant - nsHb over expressing tomato transgenic line 7 (OE7) shows the number of tomato fruits which is at least 2-3 folds as compared to the non- transgenic or WT tomato plant.

[00117] It can be observed from Table 2 that the average weight of tomato produced by the nsHb over expressing tomato transgenic plant lines OE7 and OE5 is more than two folds lesser than the wild type plants, therefore, providing fruits that were lighter in size as compared to that of the wild types.

[00118] The nsHb over expressing transgenic tomato plants (OE7 and OE5) also showed reduction in diameter of fruits giving cherry like appearance as shown in Figure

5. Table 3 data shows the extent of difference between the diameter of tomato fruits produced from transgenic tomato plants and WT plants. It can be observed that in some cases (Table 3), that the extent of reduction in diameter of the tomato fruits is as high as 9 folds in the transgenic plants as compared to that of the wild type.

[00119] Table 1. Number of fruits per plant in wild type plants and nsHb over expressing transgenic tomato plant lines.

[00120] Table 2. Fruit weight (gm) of fruits in wild type plants and nsHb over expressing transgenic tomato plant lines. [00121] Table 3. Fruit diameter in in wild type plants and nsHb over expressing transgenic tomato plant lines. [00122] Early fruit ripening: In the present disclosure, the developed transgenic tomato plants showed early ripening of fruits which may be due to lesser nitric oxide (NO) levels in the transgenic plants overexpressing non-symbiotic hemoglobin gene. It suggests that the NO was involved in the ripening of tomato fruits which inhibits ethylene production. Therefore, reduced NO levels in the fruits from the developed transgenic tomato plants triggered the early ripening phenomenon. Figure 6b and Figure 6d of the present disclosure showed images for the early ripening of tomato fruits from the OE lines 7 & 5 as disclosed herein. For a better comparison to highlight the early ripening and higher yield of tomato fruits in nsHB overexpressing lines, images of fruits developed from the wild type tomato lines were shown in Figure 6a and 6c respectively. The fruits obtained from developed transgenic tomato plants as shown in Figures 6b and 6d, were matured 3-4 weeks before than wild type (WT).

[00123] To establish the fact of obtaining early ripened tomatoes from the developed transgenic lines as per the present disclosure, a virtual test was conducted for six consecutive days to record the relative ripening progress in the wild type (WT) and developed transgenic tomato plants (transgenic plants as per the present disclosure), the transgenic produce showed early ripening in the test against the WT as in over expression line 7, the prominent start of ripening was visible from the fourth day itself, while in the WT, the fruit was not even partially ripened on the sixth day, however the fruits from over expression line 7 were fully ripened at the end of sixth day as shown in Figure 7.

EXAMPLE 4

GC-MS analysis of tomato fruits

[00124] Lyophilized leaf and fruits samples of both wild type (WT) and developed transgenic tomato plants of the present disclosure, were weighed and extracted according to a method as described in Kundu, A., Mishra, S., & Vadassery, J. (2018). Spodoptera litura-mediated chemical defense is differentially modulated in older and younger systemic leaves of Solanum lycopersicum. Planta, 248(4), 981-997, with a slight modification. In brief, 20 mg lyophilized leaf/ fruits were extracted in 480 pl of GC grade methanol (MERCK, USA), and 20 pl of 0.2 mg/ml ribitol (adonitol) was added to it as an internal standard, to obtain a mixture. Mixture produced was vigorously shaken for 2-3 min and then incubated at 70 °C for 15 min. Thereafter, 500 pl of water was added and vigorously shaken for few times, followed by the addition of 250 μg of chloroform (MERCK, USA) and mixed thoroughly. The mixture was centrifuged at 2200g for 10 min at room temperature (~ 28 °C). Thereafter, the upper aqueous phase was carefully taken out and dried in speed vacuum at 45 °C. Dried fraction was then re-dissolved by vortexing in 40 pl of 20 mg/ml methoxamine hydrochloride in pyridine and then incubated at 37 °C for 90 min. Thereafter, 60 μg of MSTFA (N-methyl-N-(trimethylsilyl) trifluoroacetamide) was added to the mixture and incubated at 37 °C for 30 min. Following derivatization, 2 μg of the sample was used to perform gas chromatography-mass spectrometry (GC-MS) analysis employing a Shimadzu GC-MS-QP2010™ coupled with an auto sampler-auto injector (AOC- 20si). Analysis was conducted by exploiting Rtx-5® capillary column (Restek Corporation, USA) and helium was used as a carrier gas. The method consisted of 80 °C isothermal heating for 2 min, followed by ramp rate of 5 °C min^-1 to 250 °C, a withhold of 2 min and a final ramp of 10 °C min^-1, a withhold time of 24 min. Chromatogram integration and mass spectra analysis was done by using GC-MS solution software (Shimadzu®) and NIST14s. WILEY8 spectral library was used to identify derivatized metabolites, wherein the derivatives of glucose, sucrose, and fructose were confirmed for identification with authentic standards analyzed in GC- MS. Metabolites that were derivatized by different numbers of trimethylsilyl (TMS) were considered as a different metabolite. For the metabolite having multiple peaks, summation of the peak area was done after confirming spectral data according to the Lisec J, Schauer N, Kopka J, Willmitzer L, Fernie AR (2006) Gas chromatography mass spectrometry-based metabolite profiling in plants. Nat Protoc 1: 1-10. Peak area of each of the compounds was normalized by dividing by peak area of internal standard (ribitol) in each run.

[00125] RESULTS

[00126] Untargeted metabolite analysis was performed from the fully ripened fruits of WT and nsHb OE plants (Figure 9), wherein five replicates per plant were taken from four plants (both WT and transgenic tomato plants). Referring to Figure 9, it can be observed that most of the metabolites from WT and nsHb OE fruits did not show a significant difference, however, the major source of variation was found in the levels of sugars. Figure 10 shows a comparison in the levels of sugars found in the fruits of WT and transgenic tomato plants. Referring to Figures 10a to Figure lOd, it can be observed that sugars such as Sucrose, D-Allose, Mannobiose, D-Arabinose, D- glucofuranoside were highly accumulated in the fruits of nsHB overexpressing (OE) plants (transgenic tomato plant) in comparison to the fruits of WT plants. It was also observed that there was a higher accumulation of myo-inositol (1, 2, 3, 4, 5, 6 Hexa-0 Trimethelsilyl Myo-Insositol) fruits of nsHB overexpressing (OE) plants (transgenic tomato plant) in comparison to the fruits of WT plants. Such a higher accumulation of myo-inositol can be helpful to regulate Insulin levels, and hence the tomato fruit of the transgenic plant can be useful as food for people with Type-2 Diabetes. Similarly, Ribofuranose and Galactopyranose showed higher accumulation in nsHb OE fruits in comparison to WT fruits. Hence, the fruit of the transgenic tomato plant of the present can be deployed in a food product.

EXAMPLE 5

Inductively coupled plasma mass spectrometry (ICP-MS)

[00127] To perform ICP-MS (Agilent 7800), lyophilized powdered samples of tomato fruits (from both WT and transgenic plant of the present disclosure) were subjected to microwave-assisted acid digestion. Briefly, 0.2 g of each lyophilized powdered sample was accurately weighed and inserted directly into microwave digestion vessels, followed by the addition of 8.0 ml of concentrated nitric acid (70%). The digestion procedure was performed under the following parameters: Power used was 1200 W, ramp time was 20 min, hold time was of 20min and temperature of the oven was 180 °C. After cooling, the contents of the tubes were transferred to 50 ml self-standing polypropylene volumetric tubes (Tarsons, India). The contents were made up to 50 ml with water (Malique). Subsequently, the samples were filtered with 0.23p syringe filter and diluted in the ratio of 1: 10 with 2% HNO3. For phosphate analysis, samples were diluted at the ratio of 1:100. Processed samples were then analysed.

[00128] RESULTS

[00129] To investigate the effect of over-expression of nsHbl gene (SEQ ID NO: 1) upon nutritional value of tomato fruits, ICPMS analysis of fully ripened fruits of WT and nsHbl over-expression plants (transgenic tomato plants of the present disclosure) was performed. Results of the ICPMS analysis as depicted in Figure 11 show that elements like Sodium (Na), Magnesium (Mg), Potassium (K) and calcium (Ca) were higher in nsHbl over-expression fruits as compared to WT fruits, however, no significant difference was found in the concentrations of Nickle (Ni), Couper (Cu) and Zinck (Zn). Contrary to the higher concentration of some of the elements as mentioned above, a reduced concentration of Arsenic (As) was found in nsHbl over-expression fruits in comparison to WT tomato fruits. This indicates that the expression of nsHbl gene (SEQ IN NO: 1) in the fruits from the transgenic tomato plant leads to enhanced nutritional value by enhancement of Myo-Inositol, Na, Mg, K and Ca useful for consumption.

[00130] Therefore, it can be concluded that the transgenic tomato plants overexpressing nsHbl gene (SEQ ID NO: 1) leads to: (i) early ripening of tomato fruits; (ii) reduction in NO levels, (iii) increase in fruit number; (iv) reduced size; (v) reduced weight; (vi) higher accumulation of sugars, such as derivatives of glucose, sucrose, and fructose; and (vii) tomato fruits with better nutritional properties, as compared to WT tomato fruits. Due to the enhanced nutritional properties, the fruit from the transgenic plant is suitable for consumption in the form of a food product, suitable for human consumption.

[00131] Although, the examples are shown with tomato, however, it can be contemplated that overexpression of non-symbiotic hemoglobin gene in climacteric fruit-bearing plants could show similar phenotypic effects as shown by tomato. For example, overexpression of non-symbiotic hemoglobin gene in banana would yield in a transgenic plant having early ripening banana fruits. Similar methods can be followed for other plants like mango, sugar apple, peach, and apricot.

Advantages of the present disclosure

[00132] The above-mentioned implementation examples as described on this subject matter and its equivalent thereof have many advantages, including those which are described.

[00133] The developed transgenic tomato plants (transgenic plants as per the present disclosure) shows increased number of fruits per plant, which can be directly correlated with the enhanced yield per plant. Enhanced yield per plant will clearly help the farmers and the consumer sector as well. Higher yield can also solve the problem to balance a ratio between the fruit production and consumption to match the present-day needs. Early ripening achieved in the developed transgenic lines will help farmers to grow multiple crops every year due to the shorter life span of the developed lines. In fact, early ripening of fruits will also minimize the use of harmful artificial ripening agents which poses deteriorating impacts on the human health. Cherry-like appearance of the transgenic fruits as per the present disclosure will help to satisfy the needs of various consumer segments in particular, as it can be specifically used in salads or pizzas, etc. Since it is a well-known fact that tomatoes with cherry-like appearance are preferred for culinary decoration, therefore, the transgenic tomato lines as per the present disclosure would satisfy the requirements of cherry tomatoes in hotels, and restaurants. Since cherry tomatoes are difficult to produce and much harder to maintain, the transgenic tomato plant as per the present disclosure has a significant advantage in terms of the uniform production of cherry-sized tomato fruits and can be an economically viable option as compared to cherry tomatoes. The reduced size and fruit weight will also help in the effective transportation of the final product. High yield will be very impactful in minimizing the losses incurred through spoilage of the fruits during transportation, high yield will compensate for the damages occurred. The small size of the tomatoes will also help to reduce the spoilage through fruit cracks as generally seen in wild tomatoes.

Claims

I/We Claim:

1. A recombinant construct comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2.

2. The recombinant construct as claimed in claim 1, wherein the nucleic acid encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2.

3. The recombinant construct as claimed in claim 1, wherein the nucleic acid fragment is having a nucleic acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 1.

4. The recombinant construct as claimed in claim 2, wherein the nucleic acid fragment is having a nucleic acid sequence as set forth in SEQ ID NO: 1.

5. The recombinant construct as claimed in any one of the claims 1 or 2, wherein the heterologous promoter is selected from the group consisting of CaMV promoter, double 35 S promoter, and single 35 S promoter.

6. A recombinant vector comprising the recombinant construct as claimed in any one of the claims 1-5.

7. A recombinant host cell comprising the recombinant vector as claimed in claim 6 or the recombinant construct as claimed in any one of the claims 1 or 2.

8. The recombinant host cell as claimed in claim 7, wherein the recombinant host cell is a bacterium.

9. A method for obtaining a transgenic plant cell, said method comprising:

(a) transforming an explant with the recombinant vector as claimed in claim 6 or with the recombinant host cell as claimed in claim 7, to obtain transformed plant cells; and (b) screening the transformed plant cells to obtain a transgenic plant cell, wherein the transgenic plant cell produces the polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2.

10. A method for obtaining a transgenic plant, said method comprising:

(a) transforming an explant with the recombinant vector as claimed in claim 6 or with the recombinant host cell as claimed in claim 7, to obtain transgenic plant cells; and

(b) regenerating a transgenic plant from the transgenic plant cell, wherein the transgenic plant exhibits altered fruit phenotype, and early ripening of the fruits relative to a non-transgenic plant of the same species.

11. The method as claimed in any one of the claims 9 or 10, wherein transforming is done by a method selected from the group consisting of Agrobacterium mediated transformation method, particle gun bombardment method, in-planta transformation method, liposome mediated transformation method, protoplast transformation method, microinjection, and macro injection.

12. The method as claimed in claim 9, wherein the transgenic plant cell is Solarium lycopersicum cell.

13. The method as claimed in claim 10, wherein the transgenic plant is Solarium lycopersicum.

14. The method as claimed in claim 10, wherein the transgenic plant exhibits an increase in fruit numbers relative to a non-transgenic plant of the same species.

15. The method as claimed in claim 10, wherein the transgenic plant exhibits a decrease in fruit weight relative to a non-transgenic plant of the same species.

16. A method for obtaining a transgenic Solarium lycopersicum plant, said method comprising: a) obtaining the recombinant vector as claimed in claim 6 or the recombinant host cell as claimed in claim 7 ; b) transforming a Solanum lycopersicum explant with the recombinant vector or with the recombinant host cell obtained in step (a), to obtain a transformed plant cell; and c) regenerating a transgenic Solanum lycopersicum plant from the transformed plant cell, wherein the transgenic Solanum lycopersicum plant exhibits early ripening and altered fruit phenotype relative to a non -transgenic Solanum lycopersicum plant.

17. A method for obtaining a transgenic plant, said method comprising: a) obtaining a recombinant vector comprising a nucleic acid fragment operably linked to a heterologous promoter, wherein the nucleic acid fragment encodes a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2; b) introducing the recombinant vector obtained in step (a) into a plant cell, to obtain putative transformed plant cells; and c) screening the putative transformants, to obtain transgenic plant cell; and d) regenerating the transgenic plant cell, for obtaining a transgenic plant, wherein the transgenic plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic plant of the same species.

18. The method as claimed in claim 17, wherein the plant is selected from the group consisting of tomato, banana, mango, sugar apple, peach, apricot.

19. A transgenic plant cell comprising a nucleic acid fragment encoding a polypeptide having an amino acid sequence with at least 95% identity to the sequence as set forth in SEQ ID NO: 2.

20. A transgenic plant obtained by the method as claimed in any one of the claims 10, 16, or 17, wherein the transgenic plant exhibits early ripening and altered fruit phenotype relative to a non-transgenic plant of the same species. The transgenic plant as claimed in claim 19 or 20, wherein the transgenic plant exhibits an increase in fruit numbers relative to a non-transgenic plant of the same species, and wherein the transgenic plant exhibits a decrease in fruit weight relative to a non-transgenic plant of the same species.