WO2008064413A1 - Plants with hexose accumulating tissues having an altered hexose concentration - Google Patents

Abstract

The invention relates to plants having an altered hexose concentration in hexose accumulating tissue (e.g., fruit) of the plant. The invention also relates to methods for providing such plants.

Description

PLANTS WITH HEXOSE ACCUMULATING TISSUES HAVING AN ALTERED HEXOSE CONCENTRATION

FIELD OF THE INVENTION

The invention relates to plants with hexose accumulating tissues having an enhanced or decreased hexose concentration. The invention further relates to methods for providing the plants.

BACKGROUND OF THE INVENTION

A key component of tomato fruit quality is the capacity of storage parenchyma cells of the pericarp to accumulate and store carbohydrate. Glucose and fructose are the principal soluble sugars accumulated and major contributors to soluble solids in ripe tomato fruit.

Sucrose is the principal photoassimilate imported into tomato fruit. During the early cell division/starch accumulation phase of fruit development, sucrose is transported symplasmically from the sieve element-companion cell (se-cc) complexes to storage parenchyma cells. However, during the cell expansion/hexose accumulation phase of fruit development, a symplasmic (intercellular) discontinuity develops between the se-cc complexes and the storage parenchyma cells (Ruan and Patrick, 1995). As a consequence, sugar accumulation by the storage parenchyma cells relies on membrane transport from the fruit apoplasm (extracellular space). Sucrose released to the fruit apoplasm from the se-cc complexes is converted into the hexoses, glucose and fructose, by an extracellular invertase. Hexose transporters in the plasma membranes of the storage parenchyma cells mediate the subsequent retrieval of hexoses from the fruit apoplasm.

The soluble solid content of processing tomatoes has been identified by the Australian Processing Tomato Research Council (APTRC) as a major factor determining processing costs. In addition, higher tomato fruit soluble solid concentrations, particularly sugar, have been linked to a more pleasing fresh fruit flavour. Although this issue is a focus for field-based research, soluble solid content in tomato fruit both within Australia and elsewhere in the world has remained essentially constant despite attempts of conventional breeding programs.

Field trials suggest that the most effective agronomic approach to increasing soluble solids is to impose water deficits or salinity treatments at critical times during fruit development to reduce fruit volume (i.e. fruit hexose concentration = hexose content/fruit volume). However, this approach results in lower fruit yields accompanied by proportional increases in soluble solid concentration with reduced fruit volume. These findings are supported by controlled environment studies, demonstrating that water or salt stress results in an increase in soluble solid content by reducing water delivery to the fruit.

In cultivated tomato species, accumulated hexoses account for about 60% of soluble solids. Of the nine quantitative trait loci (QTLs) found for fruit soluble solid content, seven match those involved in sugar accumulation and metabolism. The locus providing the largest alterations in soluble solid content, Brix9-2-5, has been intensively studied. Brix9-2-5 has now been identified as a single amino acid change in the cell wall invertase Lin5 (Baxter et al., 2005).

Sugar content is one of the key elements determining fruit flavour along with constituents such as lycopene, organic acids and carotenoids. Correlative physiological data obtained by comparing two cultivars of tomato, which differ in sugar accumulation by fruit, have indicated that the maximal activities of hexose/H⁺ symporters localised to fruit storage parenchyma cells contribute to the regulation of mature fruit hexose levels (Ruan et al., 1997). However, a subsequent report on genetic manipulation of the hexose transport system of tomato fruit indicated that while size of the fruit was affected there was no measurable change in fruit concentrations of hexoses or soluble solutes (Dibley et al., 2003). In this study, expression of the heterologous hexose transporter SpGHTβ from Schizosaccharomyces pombe in developing fruit, at approximately 50 times that of the endogenous hexose transporters, was found to enhance fruit ontogeny and growth (measured as fruit diameter). This resulted in higher fruit biomass at the red-ripe stage of development, but total fruit sugar levels only increased proportional to the increase in biomass. SUMMARY OF THE INVENTION

Broadly stated, the invention stems from the surprising finding that hexose concentration in sugar accumulating fleshy fruit may be altered by genetically manipulating hexose transporter activity in the fruit. This striking observation permits the rational design of plants with up regulated or down regulated fruit hexose concentrations, and the screening of plants to identify those with predetermined hexose transporter expression or activity for the production of fruit or hexose accumulating plant tissue with a desired hexose content.

In one aspect of the invention there is a method for providing a plant having an altered hexose concentration in hexose accumulating tissue of the plant, comprising:

(a) screening plant matter for predetermined hexose transporter expression or activity indicative of altered hexose accumulation in the tissue; (b) identifying plant matter having the hexose transporter expression or activity from the screening; and

(c) providing the plant on the basis of the identification in step (b).

Typically, a group of plants will be screened and at least one plant that exhibits, or which has the capacity to exhibit, the predetermined hexose transporter expression or activity will be selected from the group.

Typically also, the hexose transporter activity will be in a predetermined range or correlate with a predetermined hexose concentration. The predetermined hexose concentration can also be within a predetermined hexose concentration range, or be above or below a predetermined level. The plant can be a non-genetically modified plant, or be genetically modified to have up regulated or down regulated hexose transporter expression, or to express a heterologous hexose transporter. In the former instance, the screening may comprise screening for expression of a hexose transporter known to have up regulated or down regulated activity compared to other hexose transporters. The hexose transporter can for example be a mutant form of a wild-type hexose transporter of the plant, a polymorphic form of a wild-type hexose transporter of the plant, or a heterologous hexose transporter. Likewise, plant matter that has been subjected to mutagenesis or which has been grown or is derived from the mutagenized plant matter can be screened for the required hexose transporter expression or activity. Full or partial gene(s) or nucleic acid sequence(s) encoding for hexose transporter(s) or fragments thereof of plant material found to have the requisite hexose transporter activity compared to corresponding non- modified such plant matter, can then be isolated and/or sequenced to identify the mutation or sequence responsible for the observed change in hexose transporter activity.

Identification of mutation(s) in a hexose transporter gene such as a coding sequence or a regulatory nucleic acid sequence controlling expression that impact on the activity of the hexose transporter in fruit of the plant enables screening of naturally occurring plant populations for identification and isolation of wild-type plants(s) naturally carrying the mutation(s). The use of mutagenized plant matter in screening methods described herein, the identification of mutations or variations in the sequence of the hexose transporter gene responsible for up regulated or down regulated hexose transporter activity, and further screening for the identification of naturally occurring plants(s) carrying the mutation(s) or relevant sequence is expressly encompassed by the invention.

In another aspect of the invention there is a method for providing a plant having an altered hexose concentration in hexose accumulating tissue of the plant, comprising: transforming plant matter with a polynucleotide for altering hexose transporter expression or activity in the tissue; culturing the transformed plant matter to produce cultured plant material; and generating the plant from the cultured plant matter.

The plant matter utilized in a method embodied by the invention can be hexose accumulating tissue or other plant tissue.

Up regulation of hexose transporter activity can be achieved by over-expression of an endogenous hexose transporter or by expression of a heterologous hexose transporter as indicated above. Down-regulation of hexose transporter activity can be achieved by suppression or silencing of one or more endogenous hexose transporters. Hence, in the instance the hexose transporter activity is to be up-regulated, the polynucleotide with which the plant matter is transformed may comprise nucleic acid encoding a hexose transporter or a regulatory sequence which effects up -regulation of hexose transporter expression or activity. In the instance the hexose transporter activity is to be down -regulated, the polynucleotide comprises a nucleic acid which effects the suppression or silencing of one or more endogenous hexose transporters. Cells of the generated plant(s) can comprise single copies or multiple copies of the transfected polynucleotide.

In another aspect, there is provided an isolated plant with an altered hexose concentration in hexose accumulating tissue of the plant, the plant being modified to exhibit altered hexose transporter expression or activity in the tissue.

In another aspect there is a plant provided by a method of the invention. The plant can be any plant with hexose accumulating tissue the hexose concentration in which is mediated by hexose transporter expression and/or activity of the tissue. The plant can for example be a sugar accumulating fleshy fruit producing plant, or a vegetable or crop species. Hence, the hexose accumulating tissue will typically be the sugar accumulating fleshy fruit, hexose accumulating vegetable tubers or other plant parts of commercial importance. In a particularly preferred form, the plant is a sugar accumulating fleshy fruit producing plant.

Accordingly, in another aspect of the invention there is a method for providing a plant which produces sugar accumulating fleshy fruit having an altered hexose concentration, comprising: (a) screening for predetermined hexose transporter expression or activity in plant matter indicative of expression or activity of the hexose transporter in fruit;

(b) identifying plant matter with the hexose transporter expression or activity from the screening for provision of the plant from the screening; and

(c) providing the plant for production of the fruit with the altered hexose concentration on the basis of the identification in step (b).

In a yet further aspect the invention relates to a method for providing sugar accumulating fleshy fruit, comprising: providing at least one plant embodied by a method of the invention; growing the plant for production of the fruit; and harvesting the fruit from the plant. In another aspect there is provided a planted stand of stably reproducing plants having a stable heritable trait of an altered hexose concentration in hexose accumulating tissue of the plants, the plants being plants embodied by the invention.

By "stably reproducing" is meant the hexose transporter activity of the plant is a heritable trait which is stably passed from one generation of the plant to the next.

Accordingly, progeny and descendants of plants provided by methods described herein are also encompassed by the invention as are the seed and reproductive material of the plants. The term "reproductive material" is to be taken to expressly include pollen, plant spores, and plant sex cells and sex organs. In still another aspect there is provided the hexose accumulating tissue from a plant embodied by the invention.

Increasing hexose concentration in the hexose accumulating tissue of the plant may increase the level of soluble solids in the tissue. Moreover, higher levels of hexoses can enhance the taste of hexose accumulating fruit or vegetables increasing their desirability and market value. Similarly, increasing hexose concentration in crop species such as those used for bioethanol production may increase market value and volume of end product. Decreasing hexose concentration in some plant types may also be desirable for meeting market and consumer demands.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in this specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed in Australia or elsewhere before the priority date of this application. Throughout this specification the word "comprise", or variations thereof such as

"comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps .

The features and advantages of the present invention will become further apparent from the following detailed description of preferred embodiments together with the accompanying drawings. BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS

Figure 1 is a similarity plot of plant hexose transporter genes in relation to the location on LeHT3 (Genbank Accession Number AJ132225). The ihLeHrJ-COD region covers the conserved sequences either side of the large cytoplasmic loop, and shows a relatively high similarity between all plant hexose transporters, and thus was selected for suppression of the entire hexose transporter family in tomato. Similarity of hexose transporter sequences declined in the 3' -UTR to below half that of the coding region, and thus provided potential target sequence to achieve specific suppression of LeHT3 with the lhLeHπ-UTR region.

Figure 2 is a graph showing hexose concentration in pericarp tissue of RNAi tomato fruit compared to wild-type. Values are means ± SE for at least 6 fruit of each genetic line. *P<0.05.

Figure 3 is a set of graphs showing the biomass and water content of ripe fruit from wild type or ihpRNA lines. Surgically removed pericarp tissue was used for this analysis. Whole pericarp fresh weights (A) were measured directly after harvesting. A known percentage of the tissue was dried for three days at 80⁰C to determine dry weight (B). These values were then used to determine both the Relative Water Content (C) and water volume (D) of the pericarp. Values are means ± SE for at least 6 fruit of each genetic line. * P<0.05.

Figure 4 is a graph showing hexose accumulation in bulk pericarp sap of ripe fruit over-expressing AtSTP3 or SpGHTό under control of either constitutive (CaMV35S) or fruit- specific (2Al Ip) promotors. All values are mean ± SE of at least 10 fruit from each line. *P<0.05. Figure 5 is a graph showing the relationship between tomato pericarp sap hexose concentration and osmolality in fruit of wild type (■), fruit over-expressing AtSTP 3 or SpGHTό under the control of the fruit specific 2Al 1 promoter (•) and in fruit with endogenous hexose transporters suppressed by RNAi (♦). All values are mean ± SE of at least 6 fruit from each line. The slope of this line is significantly different to zero (P<0.05). DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION

The plant can be any crop, edible fruit or vegetable species that accumulates glucose and/or fructose as the principal soluble sugars by a membrane transport step. Examples of edible fleshy fruits can include fruit of kiwi plants, tomato vines, citrus trees including orange, lemon, grapefruit and mandarin trees, and grape vines. Examples of crop species which may be dependent on hexose transporter activity for determining hexose concentration in the context of the invention include vegetable species such as carrots and crop species suitable for production of bioethanol. Surprisingly, an increased hexose concentration can be obtained in fruit substantially without an increase in fruit volume.

Examples of plants bearing hexose accumulating fleshy fruit in which it may be desirable to reduce sugar concentrations in the fruit include grape vines particularly white grape producing varieties, where a low sugar content is preferred for producing low alcohol wines

Any suitable method of screening plants or plant matter for predetermined expression of a hexose transporter or hexose transporter activity can be employed in screening methods embodied by the invention. Known mutations in hexose transporter genes that impact on the activity of a hexose transporter can for instance be screened using labeled oligomers complementary to the region of the gene encoding the hexose transporter in which the mutation is located. For example, several mutations in HUPl (a monosaccharide/H⁺ symporter from Chlorella kessleri), such as N436I (asparagine 436 changed to isoleucine), G97C, I303N and G120D have previously been reported to change the activity of the transporter (Will et al., 1998). Likewise, the expression of heterologous and native wild-type hexose transporters can be identified by probing with oligomers complementary to the target nucleic acid sequence of interest. Protocols for the use of oligomers as probes are well known to the skilled addressee.

TILLING (Targeted Induced Local Lesions in Genomes) is a particularly preferred method of screening a germplasm collection for the presence of mutations in hexose transporters which confer up regulated or down regulated hexose transporter activity. Methodology for TILLING is for instance described in Henikoff et al. (2004), the contents of which is incorporated herein by reference in its entirety. Briefly, random mutations are introduced in a seed pool by chemical mutagenesis. Genomic DNA is collected from M2 individuals derived from the original mutagenized pool, and then polymerase chain reaction (PCR) with two gene-specific primers is used to screen the population of DNA to identify heteroduplexes between wild type and mutant samples. The heteroduplexes in the population are identified by nuclease digestion followed by electrophoretic analysis using any suitable conventionally known protocol. As will be understood, the specific mutations responsible for the observed up regulated or down regulated hexose transporter activity can be characterised by known nucleic acid sequencing methods from the isolated DNA fragments. Preferably, the mutagenesis step will be designed for introducing point mutations in the coding sequence of the target hexose transporter gene. However, any mutations which result in modulation of the activity of regulatory sequences of the hexose transporter gene such as the promoter are expressly encompassed.

Protocols for the mutagensis of plant seeds is for example described in International Patent Application No. PCT/AU99/00029, Manual on Mutation Breeding, 2nd Edition, I.A.E.A., Vienna 1977, and Plant Breeding, Principals and Prospects, Chapman and Hall, London 1993. Examples of plant mutagens include ethyl methanesulfonate (EMS), diepoxybutane (DEB), ethyl-2-chloroethyl sulfide, 2- chloroethyl-dimethylamine, ethylene oxide, ethyleneimine, dimethyl sulfonate, diethyl sulfonate, propylsulfone, beta-propiolactone, diazomethane, N-methyl-N- nitrosourethane, acridine orange and sodium azide. As also described in International Patent Application No. PCT/AU99/00029, exposure to X-rays or ionising radiation offer an alternative to chemical mutagenesis of seeds. See also Filippetti A. et al., "Improvement of seed yield in Vici baba L. using experimental mutagenesis II. Comparison of gamma-radiation and ethyl methanesulphonate (EMS) in production of morphological mutants", Euphytica 35 (1986) 49-59.

The M2 plants can be grown to maturity but it is preferable to screen plants at a much earlier stage of development. For example, genomic DNA could be extracted from leaves or cotyledons of seedlings 5-10 days old without seedling destruction and screened for mutations.

Plants identified to have up or down regulated hexose transporter activity via the TILLING approach can then be cultivated for large scale planting. Alternatively, screening of wild type plants can be conducted to identify naturally occurring plants harbouring the relevant mutation or polymorphism for selection of plant(s) for further evaluation of increased hexose concentration in tissue of the plant and/or large scale planting. A variation of the TILLING procedure known as EcoTILLING involves screening a germplasm collection to identify natural variation in a plant population. This approach may also be used as a means of identifying in a natural population mutations in hexose transporters which confer up regulated or down regulated hexose transporter activity. Methodology for EcoTILLING is for instance described in Comai et al. (2004), the contents of which are incorporated herein by reference in its entirety. Screening plants in this way has the advantage of selection of naturally derived/cultivated plants for subsequent large scale planting programs for the production of hexose accumulating tissue (eg., fruit) with an enhanced or reduced hexose concentration.

Up-regulation of hexose transporter activity as described herein can also be achieved using vectors incorporating a polynucleotide insert for intracellular expression of a heterologous hexose transporter or over-expression of an endogenous hexose transporter, or an active form of a heterologous or endogenous hexose transporter. Down- regulation of hexose transporter activity can be achieved using vectors expressing antisense sequences, plus-sense co-suppression, ribozyme or RNAi sequences that are specific for the gene encoding the target hexose transporter or to regulatory control sequences controlling expression of the hexose transporter. Polynucleotides encoding the hexose transporter or an active form thereof, or for the down-regulation of endogenous hexose transporter activity, can be introduced into plant cells for integration into genomic DNA by heterologous or homologous recombination events. The term "active form" with regard to a heterologous or endogenous hexose transporter encompasses a naturally occurring mutant hexose transporter, a mutagenised hexose transporter, a polymorphic or variant form of a hexose transporter, or a modified hexose transporter which retains hexose transporter activity. The active form may, for instance, be a truncated form or a homologue of the hexose transporter. An endogenous hexose transporter or a heterologous hexose transporter that is targeted for up-regulation can for example, be a wild-type hexose transporter including allelic variants, a naturally occurring mutant hexose transporter, a mutagenised hexose transporter, or a modified hexose transporter.

The sequence identity between the amino acid sequences of two hexose transporters is determined by comparing amino acids at each position in the sequences when optimally aligned for the purpose of comparison. The sequences are considered identical at a position if the amino acids at that position are the same. A gap, that is, a position in an alignment where a residue is present in one sequence but not the other is regarded as a position with non-identical amino acid residues. Alignment of sequences can be performed using any suitable program or algorithm such as for instance, by the Needleman and Wunsch algorithm. Computer assisted sequence alignment can be conveniently performed using standard software programs such as GAP which is part of the Wisconsin Package Version 10.1 (Genetics Computer Group, Madison, Wisconsin, USA). Typically, an active form of a hexose tranpsorter will have overall amino acid sequence identity with the hexose transporter of at least about 60% or 70% or greater, preferably about 80% or 90% or greater and most preferably, about 95% or 98% or greater. It will be understood that all individual sequence identity values and ranges within the maximum and minimum values stated above are also expressly encompassed.

A modified hexose transporter can be provided by, or be the result of, the addition of one or more amino acid residue(s) to an amino acid sequence, deletion of one or more amino acids from an amino acid sequence and/or the substitution of one or more amino acids with another amino acid or amino acids. Inversion of amino acids and other mutational changes that result in alteration of an amino acid sequence are also encompassed. The modified hexose transporter can be prepared by introducing nucleotide changes in a polynucleotide sequence such that the desired amino acid changes are achieved upon expression of the mutagenised nucleic acid or for instance, by synthesising an amino acid sequence incorporating the desired amino acid changes.

The substitution of an amino acid may involve a conservative or non- conservative amino acid substitution. By conservative amino acid substitution is meant replacing an amino residue with another amino acid having similar sterochemical and/or chemical properties, which does not substantially affect the activity of the hexose transporter. Preferred modified forms of a hexose transporter include those having amino acid sequences in which one or more amino acids have been substituted with alanine or other neutrally charged amino acid residue(s), or to which one or more such amino acid residues have been added. A modified form of a hexose transporter may also incorporate an amino acid or amino acids not encoded by the genetic code.

The sequence identity of two nucleotide sequences may be determined using the same methodology as for determining sequence identity between amino acid sequences. It will be understood that in the instance RNA and DNA sequences are compared for sequence identity, thymine (T) in the DNA sequence will be considered for the purpose of the comparison to be the same as uracil (U) in the RNA sequence.

Broadly, the down regulation of hexose transporter activity can be obtained by introducing into the target plant cells a polynucleotide that interacts with the gene encoding the hexose transporter, or which when transcribed provides a nucleic acid molecule that interacts with the gene such that expression of the hexose transporter is inhibited.

Reference to a polynucleotide in this context is to be understood as a reference to any nucleic acid molecule which directly or indirectly facilitates the reduction, inhibition, suppression or other form of down-regulation of expression of the target hexose transporter. Polynucleotides which fall within the scope of this definition include antisense sequences transfected into the plant cells, and antisense sequences generated in situ which have sufficient complementarity with target sequence such as mRNA coding for the hexose transporter or for instance a transcription regulatory sequence controlling the transcription of the hexose transporter, to hybridize with the target sequence under intracellular conditions and thereby inhibit the expression of the hexose transporter.

The use of chimeric DNA constructs encoding RNA which forms double stranded RNA (dsRNA) by base pairing between antisense and sense RNA nucleotide sequences that are respectively complementary to corresponding strands of target sequences is particularly preferred. Such dsRNA is also referred to as hairpin RNA (hpRNA) or interfering RNA (RNAi). The design of dsRNA for down-regulating the expression of target nucleic acid sequence has previously been described in International Patent application No. WO 99/53050 and International Patent Application No. WO 03/076620, as well as for instance, in articles by Wesley S. V. et al., "Construct design for efficient, effective and high-throughput gene silencing in plants". The Plant Journal (2001) 27(6):581-590, and Wang M-B., and Waterhouse P.M., "Applications of gene silencing in plants", Curr. Opp. in Plant. Biol. (2002), 5(2): 146-150, all of which are herein incorporated by reference in their entirety.

More particularly, hpRNA constructs require at least two copies of target sequence in an inverted-repeat orientation which are sufficiently complementary to each other to hybridise together to produce dsRNA. The inverted-repeat sequences will typically be separated by a spacer sequence for forming the end loop region of the hpRNA. The spacer sequence may consist of, or include, an intron sequence that is subsequently spliced out leaving a shorter non-base pairing region that forms the loop. It is not necessary that the inverted repeats of the hairpin RNA be of the same length and one may be longer than the other such that an overhang sequence is produced.

The inclusion of an intron sequence in the chimeric construct encoding the hpRNA, preferably in the sense orientation, may enhance the efficiency of suppression of the expression of the target nucleic acid. Specifically, as used herein, an "intron" or intervening sequence refers to a DNA region between the sense and antisense sequences which is transcribed to yield an untranslated region in the nucleus but which is spliced out in the nucleoplasm of a cell. Intron sequences are flanked by splice sites, and synthetic introns may be made by joining appropriate splice sites to any non-coding sequence. Examples of introns include the pdk2 intron, catalase introns from Castor Bean, Delta 12 desaturase intron from Arabidopsis, ubiquitin intron sequences from maize, and SV40 introns.

The longer the total length of the sense nucleotide sequence is, the less stringent the requirements for sequence identity between the sense nucleotide sequence and the corresponding target sequence become. Accordingly, it is not necessary that the sense nucleotide sequence have total complementarity with its target sequence only that substantial complementarity exists for specificity and to allow hybridisation under cellular conditions. Preferably, the sense sequence will have a complementarity of about 70% or greater, more preferably about 80% or greater and most preferably, about 90%, 95%, or 98% or greater.

The length of the sense sequence may vary from 10 nucleotides up to a length equalling the length in nucleotides of the target nucleic acid. Preferably, the total length of the sense sequence will usually be about 15 nucleotides in length or greater, and preferably at least about 50, 60, 100, 150, 200, 250 or 300 nucleotides or more. Similarly, the length of the antisense nucleotide sequence is largely determined by the length of the sense sequence and generally, will be the same length as the sense sequence. However, an antisense sequence which differs in length by about 10% or more compared to the sense sequence may be utilised. Similarly, the nucleotide sequence of the antisense sequence is largely determined by the nucleotide sequence of the sense sequence and preferably, is entirely complementary to the sense nucleotide sequence. However, particularly with longer antisense regions, it is possible to use antisense sequences that are not entirely complementary and include some mismatched bases. Preferably, the antisense nucleotide sequence has at least about 75% sequence identity with the sense nucleotide sequence, more preferably at least about 80%, 85% or 90% sequence identity and most preferably at least about 95% sequence complementarity with the sense nucleotide sequence.

Nevertheless, the antisense nucleotide sequence will generally include a sequence of at least about 10 consecutive nucleotides, more preferably about 15, 20 or 50 nucleotides and most preferably at least about 100 or 150 nucleotides with 100% sequence identity to the corresponding region of the sense nucleotide sequences.

Rather than the inverted- repeats of the hpRNA comprising sense and antisense sequences of the target sequence, chimeric constructs may be designed for the generation of dsRNA comprising a single stranded RNA sequence specific for the target sequence and which is arranged adjacent to a potential hairpin -forming structure incorporating inverted repeats which do not hybridise with target sequence (adj-hpRNA). In this instance, the sequence encoding the hpRNA may be generic to the vector used while the specificity of the suppression is accomplished by the single stranded sequence.

The down-regulation of the hexose transporter gene will typically comprise substantially silencing the gene.

Examples of hexose transporter genes the expression of which may be down- regulated or over-expressed in accordance with embodiments of the invention include LeHT3 (see cDNA SEQ ID No. 13), LeHTl (see cDNA SEQ ID No. 11) from tomato (partial sequences for each are reported in Gear et al., 2000) and VvHTl from grapes (Fillion et al, 1999 ; Hayes et al. , 2007) and OsMST4 from rice (Wang et al. , 2007).

Polynucleotides for modulating hexose transporter activity will desirably be designed to be resistant to endogenous exonucleases and/or endonucleases to provide in vivo stability in target cells. Modification to the phosphate backbone, sugar moieties or nucleic acid bases may also be made to enhance solubility or other physical characteristics, and all such modifications are expressly encompassed. Such modifications include modification of the phosphodiester linkages between sugar moieties and the utilisation of synthetic nucleotides and substituted sugar moieties and the like.

The polynucleotide for modifying hexose transporter activity will typically first be introduced into a cloning vector and amplified in host cells, typically animal, insect or prokaryotic cells, prior to the nucleic acid being excised and incorporated into a suitable expression vector. Typical cloning vectors incorporate an origin of replication (on) for permitting efficient replication of the vector, a reporter or marker gene for enabling selection of host cells transformed with the vector, and restriction enzyme cleavage sites for facilitating the insertion and subsequent excision of the polynucleotide of interest. Preferably, the cloning vector will have a polylinker sequence incorporating an array of restriction sites.

Marker genes particularly suitable for identification of transformed plant cells incude but are not limited to visual marker genes such as seed coat colour genes (e.g., the corn R-gene), the gene encoding dihydrofolate reductase (DHFR), sun flower albumin gene SF8g which enables a novel sunflower seed albumin to accumulate in seed, plant-expressable β-glucoronidase genes such as GUS an enzyme that is similar to the E-coli β-galactosidase enzyme but which instead uses glucuronides as substrate, the gene encoding green fluorescent protein (GFP), the lucif erase gene (the enzyme encoded by the gene catalyses a reaction in which luciferin is oxidised and ATP is converted to AMP, and light is produced which can be measured with a luminometer or detected using photographic film as is known in the art), the pat gene which confers Basta herbicide resistance and enables selection of transformed cells using the herbicide or the active ingredient phoshinothricin (PPT), and genes which confer paromomycin, hygromycin, kanamycin or spectinomycin resistance.

Suitable expression vectors include cosmids and plasmids such as the Ti- or Ri- plasmids of Agrobacterium capable of expression of a DNA (e.g., genomic DNA or cDNA) insert. An expression vector will typically include transcriptional regulatory control sequences to which the inserted nucleic acid sequence is operably linked. By "operably linked" is meant the nucleic acid insert is linked to the transcriptional regulatory control sequences for permitting transcription of the inserted sequence without a shift in the reading frame of the insert. Such transcriptional regulatory control sequences include promotors for facilitating and binding of RNA polymerase to initiate transcription, and expression control elements for enabling binding of ribosomes to transcribed mRNA.

More particularly, the term "regulatory control sequence" as used herein is to be taken to encompass any DNA that is involved in driving transcription and controlling (i.e., regulating) the timing and level of transcription of a given DNA sequence, such as a DNA coding for a protein or polypeptide. For example, a 5' regulatory control sequence is a DNA sequence located upstream of a coding sequence and which may comprise the promotor and the 5' untranslated leader sequence. A 3' regulatory control sequence is a DNA sequence located downstream of the coding sequence, which may comprise suitable transcription termination (and/or) regulation signals, including one or more polyadenylation signals.

As used herein, the term "promotor" encompasses any DNA which is recognised and bound (directly or indirectly) by a DNA-dependent RNA polymerase during initiation of transcription. A promotor includes the transcription initiation site, and binding sites for transcription initiation factors and RNA polymerase, and can comprise various other sites (e.g., enhancers), to which gene expression regulatory proteins may bind.

The promotor may be a constitutive promotor or for instance an inducible promotor the activity of which is enhanced by external or internal stimuli such as but not limited to hormones, chemical compounds, mechanical impulses, and abiotic or biotic stress conditions. The activity of the promotor may also be regulated in a temporal or spatial manner (e.g., tissue specific promotors and developmentally regulated promotors). In a particularly preferred form of the invention, the promotor is a plant- expressible promotor. The term "plant-expressible promotor" is to be taken to mean a DNA sequence that is capable of controlling (initiating) transcription in a plant cell. This includes any promotor of plant origin, but also any promotor of non-plant origin which is capable of directing transcription in a plant cell, such as certain promotors of viral or bacterial origin, e.g., the CaMV35S promotor, substerranean stunt clover virus promotor No. 4 or No. 7 (WO 96/06932), and T-DNA gene promotors.

Typically, a transgenic plant as described herein will be generated by transfecting target plant cells with a polynucleotide sequence encoding an endogenous or heterologous hexose transporter, or an active form of an endogenous or heterologous hexose transporter. Alternatively, the plant cells may be transfected with a strong promotor or other transcriptional control sequence for effecting up -regulated expression of an endogenous hexose transporter of the plant cells.

Suitable transcription termination and polyadenylation regions include but are not limited to the SV40 polyadenylation signal, the HSV TK polyadenylation signal, the nopaline synthase gene terminator of Agrobacterium tumefaciens, the terminator of the CaMV 35S transcript terminators of the subterranean stunt clover virus, the terminator of the Aspergillus nidulans trpC gene and the like.

Numerous expression vectors suitable for expression of the selected hexose transporter or active form thereof in plant cells are known in the art. For example, pART27, pBIN19, pGreen and pPZP200.

Any means for achieving the introduction of the polynucleotide into a target plant cell for altering the hexose transporter activity may be used. Transfer methods known in the art include viral and non- viral transfer methods. For non-plant cells, suitable virus into which appropriate viral expression vectors may be packaged for delivery to target cells include adenovirus, herpes viruses including Herpes Simplex Virus (HSV) and EBV, papovaviruses such as SV40, and adeno-associated viruses. As indicated above, polynucleotide transfer may also be carried out utilising a disarmed Ti- plasmid carried by Agrobacterium. Such transformations may for instance be carried out following protocols described in EP 0116718. Plant RNA virus-mediated transformation protocols are described in for example EP 0067553 and US 4,407,956.

Vectors incorporating polynucleotide inserts can also be intracellularly delivered in vitro using conventional cold or heat shock techniques or for instance, calcium phosphate coprecipitation or electroporation protocols. Alternatively, the polynucleotide or vector incorporating the polynucleotide may for instance be intracellularly delivered by microinjection, microprojectile bombardment utilising particles to which the expression vector or nucleic acid is adhered (Gordon-Kamm et al, 1990) or liposome mediated delivery. The vector or polynucleotide may be introduced into the host cell(s) with components that enhance nucleic acid uptake by the cell or for instance, stabilise annealed nucleic acid strands.

Vectors and constructs as described herein may be readily provided by conventional recombinant techniques and be delivered to cells using conventional protocols as described in for example, Sambrok et al. (1989) Molecular Cloning: A Laboratory Manual, Second Ed., Cold Spring Harbour Laboratory Press, New York; Ausubel et al. (1994) Current Protocols in Molecular Biology, USA, Vol.l and 2; and Plant Molecular Biology Labfax (1993) by R.D.D. Croy, BIOS Scientific Publications Limited (UK) and Blackwell Scientific Publications, UK.

Once transformation of the plant cells has been achieved, the cells can then be used to regenerate a transgenic plant using suitable conventionally known protocols (for example McCormick, 1991). The medium used for transformation and culturing the plant cells and tissues can comprise 19D also known as Callusing Medium (which contains B5 macronutrients, micronutrients, iron salts, vitamins and sucrose buffered with MES (2-[iV-morpholino] ethanesulfonic acid. However, any suitable medium that maintains pH in of a desirable range for transfection of the plant cells may be utilised. Normally, pH of the medium will be maintained in a range of from about pH 5.0 to about pH 7.0 and more preferably, in a range of from about pH 5.5 to 6.5. MES buffer will usually be utilised in the media at a final concentration of about 10 mM.

Alternatively, bis-Tris buffer may be utilised at a concentration of about 10 mM, or the ammonium and nitrate ion amount and ratio in the culture medium selected may be modified. For example, a ratio of nitrate ion to ammonium ion (NO₃VNH₄ ⁺) of 1:3 providing a combined nitrogen concentration of 30 mM may be utilised. In addition to helping control the medium pH during culture, the use of buffering agents may produce direct or indirect benefits to the process such as improving Agrobacterium-mediated nucleic acid transfer, Type II callus formation, and somatic embryo formation and development.

In order that the nature of the present invention may be more clearly understood, forms thereof will now be described with reference to the following non- limiting examples. EXAMPLE 1: Supression of hexose transporter activity in tomato fruit

The inventors have identified three hexose transporter genes (LeHTl, 2, and 3) expressed in tomato fruit, with LeHT3 and LeHTl having expression patterns correlating most closely with that expected for transporters having a role in regulating fruit hexose levels in mature fruit (Gear et al., 2000; Dibley et al., 2005). This correlation was confirmed by the inventors via reverse genetics studies whereby reducing the levels of expression of LeHT3 and LeHTl in young fruit using RNAi suppression technology was found to substantially reduce final hexose levels in mature fruit.

1.1 Methods

1.1.1 Production of intron -mediated hairpin RNA constructs

Construction of the ihpRNA vector, pHANNIBAL (Wesley et al, 2001) was designed to enable high -throughput production of silencing vectors by incorporating artificial restriction sites to clone gene-specific sequences generated by PCR. The strategy requires utilising two sets of primers for each construct, with each set having common gene-specific annealing sequences but differing in added restriction sites to enable insertion of the segment of gene-specific sequence into both sense and anti-sense MCSs of pHANNIBAL. The expression cassette of recombinant pHANNIBAL can then be sub-cloned into pART27 binary vector utilizing flanking Notl sites (Wesley et al., 2001).

1.1.2 Suppression of hexose transporter gene expression Approaches taken to discover the physiological role of H⁺/hexose transporters in determining hexose concentrations in developing tomato fruit were to target silencing of either a single transporter gene, LeHT3, or the entire hexose transporter family of tomato. LeHT3 was specifically targeted as it appears to be the main transporter responsible for hexose uptake into storage parenchyma cells of developing tomato fruit (Gear et al. , 2000; Dibley et al. , 2005). Specific suppression of LeHT3 was attempted by targeting the 3' untranslated region (UTR) of LeHT3 as template. Both the 5' and 3' UTRs of eukaryotic genes typically contain gene-specific sequences showing minimal homology to other members of a gene family (e.g., Friedberg and Rhoads, 2001). Analysis of alignments of the known LeHT sequences and a large number of other plant hexose transporter gene sequences showed that this prediction holds for the hexose transporter family. The 3' UTR of these genes show minimal similarity compared to the higher values seen across their coding regions (Figure 1). Low homology between transporter sequences in the 3' UTR suggested that this region provides a viable target for specific suppression of LeHT 3.

Suppression of the entire hexose transporter gene family in tomato was attempted by targeting a highly conserved section of the coding region (COD) of LeHT3 as template. The section between bases 140 and 541 of LeHT3 (GenBank Accession Number AJ132225; http://www.ncbi.nlm.nih.gov/Genbank/index.html) displayed the highest identity to other known hexose transporters in tomato and higher plant hexose transporters generally (Figure 1). The level of similarity between known hexose transporters over this region, in addition to the length of sequence included, should provide a suitable target for suppressing all plasma membrane-localized hexose transporter genes in tomato.

1.1.3 LeHT3-specific RNAi suppression cassette

The 3' UTR of LeHT3 was targeted to specifically suppress LeHT3 (see Section 1.1.2). Primers with appropriate additional restriction site sequences were designed to amplify from base 659 to 860 of LeHT3 (Gear et al, 2000). Two separate gene fragments of this LeHT3 region were generated by PCR using the following primer sets: (i) insertion into sense MCS: X/røI-THT3-UTRs-ihFP2 and £cøRI-THT3-UTRs-ihRP2 (Table 1); (ii) insertion into antisense MCS: 5amHI-THT3-UTRas-ihFP2 and Hm<ϋII- TΗT3-UTRas-ihRP2 (Table 1). These reactions resulted in amplification of 201 bp products designated THT3-UTRs and THT3-UTRas, respectively. Table 1: Properties of the primers used in the production of RNAi suppression constructs

Gene Primer Name Sequence (5 '-3') Sequence ID No.

Target

X/!oI-THT3- GGGCTCGAGCCTCTGCTTTGACTGGTGC SEQ ID No,l

CODs-FP

LeHT3 £cσRI-THT3- GGGGAATTCATCGGAACTCCCTTCGTTTC SEQ ID No.2

CODs-RP

Coding

Bαm HI-THT3- GGGGGATCCCCTCTGCTTTGACTGGTGC SEQ ID No.3

Region CODas-FP ffi«ΛII-THT3- GGGAAGCTTATCGGAACTCCCTTCGTTTC SEQ ID No .4

CODas-RP

XhoI-THTΪ- GGGCTCGAGTTTCGGAGGATCAACAAG SEQ ID No.5

UTRs-FP

£coRI-THT3- GGGGAATTCCAAAATATCATTTCACTCGTG SEQ ID No.6

LeHT 3 y UTRs-RP

UTR Bαm HI-THT3- GGGGGATCCTTTCGGAGGATCAACAAG SEQ ID No.7

UTRas-FP ffi«ΛII-THT3- GGGAAGCTTCAAAATATCATTTCACTCGTG SEQ ID No.8

UTRas-RP

Production of ihpRNA expression cassettes required two separate subcloning events. The THT3-UTRs fragment was inserted into pHANNIBAL, first by digesting both fragment and vector with EcoRI and Xhol, and then ligating THT3-UTRs into the plasmid backbone. Digesting the resulting recombinant plasmid, pHANNIBAL.THT3- UTRs, with EcoRI produced a fragment of approximately 6 kb, confirming presence of the insert. Next, both this newly generated plasmid and the PCR product, THT3-UTRas, were double digested with BamHI and Hindlll, and then ligated together.

1.1.4 LeHT family -targeted RNAi suppression cassette

A 401 bp sequence conserved amongst all known tomato hexose transporters (from base 140 to 541 of LeHT3; GenBank Accession Number AJ132225; Figure 1) was targeted to achieve RNAi suppression of all LeHT family members. Primers with appropriate restriction sites designed to amplify this fragment (Table 1) were as follows: X/røI-THT3-CODs-ihFP3 and EcαKI-THT3-CODs-ihRP3 (fragment THT3-CODs), and HmdIII-THT3-CODas-ihFP3 and βαmHI-THT3-CODas-ihRP3 (fragment THT3- CODas). The 400 bp fragment was amplified from a phage cDNA library of developing tomato fruit (donated by Dr. C. Chevalier [Unite de Physiologie Vegetale, Centre de Recherche INRA, Bordeaux, France] ). The 400 bp fragment generated from this PCR was gel purified and cloned into the two MCSs of pHANNIBAL in either the sense or anti-sense orientation using appropriate restriction sites added to each fragment.

1.1.5 Transfer to a binary vector

Expression cassettes were transferred into a binary vector for eventual Agrobacterium-mediated transformation into tomato. The pHANNIBAL vector system was designed in conjunction with the binary vector pHELLSGATE (Wesley et αl., 2001). However, at the time of vector construction, pHELLSGATE was not available for release from CSIRO Plant Industry. The pHANNIBAL-pHELLSGATE vector system is based on the pART7-pART27 vector combination (Gleave, 1992) and the flanking Notl restriction sites utilized in pART7-pART27 remain in pHANNIBAL. Therefore, Notl digestion of both plasmids described excised the ihTHT3-UTR and ihTHT3-COD expression cassettes (3.37 kb and 3.95 kb, respectively) to enable subcloning into pART27.

1.1.6 Transformation of Agrobαcterium tumefαciens

Following the production of the two ihpRNAi constructs in pART27, the constructs were transformed into A. tumefαciens strain LBA4404 via electroporation using a BioRad Gene Pulsar based on the manufacturer's instructions (BioRad). Briefly, a 3 mL liquid culture of Agrobαcterium was initiated from a fresh colony, and grown in YEP media [1% (w/v) peptone, 1% (w/v) yeast extract and 0.5% (w/v) NaCl, pH 7.0] supplemented with 100 μg/mL streptinomycin and 15 μg/mL rifampicin (selection agents for strain LBA4404) with shaking (215 rpm) at 27⁰C overnight. The culture was divided into 2 x 1.5 mL Eppendorf tubes and cells collected by centrifugation at 10,000 x g for 15 s. The supernatant was removed and cells washed three times with 1 mL of ice-cold 1 mM HEPES (pH 7.0). Cells were washed again with 500 μL of ice-cold 10%

(v/v) glycerol. The Agrobαcterium cells were finally resuspended in 20 μL of ice-cold 10% (v/v) glycerol, and suspension cultures from both tubes were combined. To the washed cell suspension culture, 200-500 ng of plasmid DNA was added and mixed by flicking the side of the tube. The mixture was rested on ice for 2 min and transferred to a pre-chilled 0.2 cm gap electroporation cuvette. The Gene Pulsar was set to the following conditions: 2.5 kV, 25 μF and 400 Ω. The outside of the cuvette was wiped dry, placed in the Gene Pulsar apparatus and pulsed. The cuvette was removed and cells resuspended in 1 mL of ice-cold YEP medium, transferred to a 13 mL culture tube and incubated at 27⁰C for 1 h with shaking (215 rpm). Cells were transferred to an Eppendorf tube, pelleted by a 15 s centrifugation at 10,000 x g, and resuspended in 200 μL of YEP. Aliquots were plated onto YEP agar plates (YEP + 1.5% agar) supplemented with the appropriate selection agents (typically at 100 μg/mL). Plates were incubated at 27⁰C for 1-3 days and colonies were tested for the presence of the plasmid by colony PCR or by restriction enzyme digestion of extracted plasmid DNA.

1.1.7 Plant transformation The two ihpRNAi constructs in LBA4404 were respectively transfected into

Lycopersicon esculentum Mill, cv. Moneymaker cultivars via an Agrobacterium tumefaciens based protocol (McCormick, 1991).

1.2 Results

1.2.1 Expression of endogenous hexose/H⁺ symporters

Expression of LeHTl and LeHT3 was decreased in ihpRNA fruit, while neither construct showed statistically-significant effects on LeHT2 expression levels. LeHTl expression was only detected in 20 days after anthesis (DAA) old fruit, matching the temporal pattern found in Floradade (Gear et ah, 2000), and was equally suppressed by both constructs. LeHT3, the transporter predicted to play a major role in fruit hexose accumulation (Dibley et ah, 2005), displayed the highest expression levels in both stages of fruit development analysed. These expression levels were significantly reduced by either construct at both stages of fruit development. The ihp LeHT3- Specific lines elicited decreases of between 61-67%, while ihpLeHT-Family lines displayed 77% reductions in expression levels. 1.2.2 Effects on hexose accumulation

The majority of sugars are accumulated and stored as hexoses in outer pericarp tissue of tomato fruit. Fruit from lines containing the ihpLeHTJ-Specific construct demonstrated a 30% reduction in hexose concentrations compared to those of wild type (Figure 2). This drop in hexose concentration resulted from equal reductions in both glucose and fructose concentrations (glucose:fructose ratio remained the same as those of wild type fruit; data not shown). The reduction in hexose concentration was matched by a 42% reduction in absolute hexose content in these fruit (Figure 2B). Similar to gene suppression, hexose decreases in ihpLeHT-Family fruit were comparable to that of ihpLeHTJ-Specific fruit. Hexose concentrations in ihpLeHT- Family lines were decreased by 37% compared to wild type, while absolute hexose content was 55% lower (Figure 2A and B, respectively). The reduction in hexose levels of ihpLeHT-Family lines was linked with an unaltered glucose:fructose ratio (data not shown), showing that each hexose was reduced equally.

1.2.3 Biomass production

Transgenic fruit with suppressed levels of expression for LeHTl and LeHT3 showed decreased sugar content (Figure 2), but no differences in size throughout development. In contrast, however, the biomass of transgenic red ripe fruit was decreased compared to wild-type (Figure 3), although these differences were not statistically significant. Relative decreases in dry weight were approximately twice that of fresh weight in fruit from transgenic lines (ihpLeHO-Specific [13% FW, 20% DW] and ihp LeHT- Family [19% FW, 29% DW]; Figure 3). In contrast, relative water content remained unchanged (Figure 3C) but the absolute volume of water in the pericarp of each transgenic fruit dropped by 13% (ihpLeHTJ-Specific) or 22% (ihpLeHT-Family; Figure 3D).

1.3 Discussion

Selective suppression of tomato hexose transporter genes using ihpRNA has enabled further elucidation of their physiological role in hexose accumulation during fruit development. In the present study, two different ihpRNA constructs were created, both using LeHT3 sequence information and designed to specifically suppress LeHT3 alone (ihp LeHT3- Specific) or suppress the entire family (ihpLeHT-Family) of LeHT genes in tomato.

1.3.1 Equal suppression of LeHTl and LeHT3 by RNAi constructs

The two ihpRNA constructs were designed to suppress LeHT3 specifically or suppress all members of the LeHT gene family. However, analysis of transcript levels in both leaves (data not shown) and fruit (Figure 2) revealed that LeHTl and LeHT3 were comparably suppressed irrespective of the RNAi construct. Furthermore, neither construct had a significant effect on LeHTl expression levels in either leaves (data not shown) or fruit (Figure 2).

For LeHT3, expression levels were reduced to between 60 and 77% of wild type levels in fruit at 20 DAA or red ripe, respectively (Figure 2). In 20 DAA fruit, LeHTl levels of expression were reduced by 85 and 89%. LeHTl expression was not detected in red ripe fruit (Figure 2B). The levels of suppression measured for LeHTl and LeHT3 were not significantly different between either construct at each fruit age analysed.

However, ihpLeHT-Family lines consistently demonstrated slightly lower transcript levels (Figure X). In both ihpRNA constructs, target sequence lengths of 400 and 201 nucleotides (ihpLeHT-Family and ihpLeHT3 -Specific, respectively) were well within the range of 98 to 853 nucleotides used by Wesley et al. (2001) to successfully impose ihpRNA suppression in plants.

The observation that the ihpLeHTJ-Specific construct also caused strong suppression of LeHTl levels in 20 DAA fruit (Figure 2) questions the ability of ihpRNA to selectively inhibit expression of individual members of a gene family. It is not uncommon for related genes to be suppressed using traditional antisense technology. For example, grape hexose transporter VvHTl sequence has been used to suppress tobacco hexose transporters and an antisense version of ACC-oxidase from apple reduced endogenous levels in tomato. The reduction in LeHTl expression by both ihpRNA constructs used in this study, together with the examples presented above, suggests that high sequence homology may not be required for successful gene targeting. In contrast to this conclusion, however, expression levels of either LeHTl were not reduced in either of the ihpRNA lines (Figure 2). Sequence similarity is unlikely to be the entire causal agent, as the similarity of LeHT2 to LeHT3 is equivalent to that of LeHTl with LeHT3 but LeHTl expression was unaffected. Short regions of high sequence similarity, which form microRNAs that control gene silencing (Brennecke et al, 2005), may be more important than complete sequence similarity.

Therefore, while differential suppression was not achieved between the two ihpRNA constructs, strong suppression of both LeHTl and LeHT3 during fruit development was achieved in both. ihpRNA suppression of both provided an experimental opportunity to directly test the activity of these genes with sugar accumulation in fruit.

1.3.2 Fruit hexose concentration is decreased by transporter suppression

Fruit produced from ihpLeHT3 -Specific and ihpLeHT- Family plant lines demonstrated strong reductions in both hexose concentration and total amount accumulated in pericarp tissue (Figure 2). In both ihpRNA lines, this reduction was comparable for glucose and fructose (data not shown). Importantly, the 30-37% reductions in hexose concentration in the ihpRNA fruit showed some correlation with the reductions in total LeHT expression, which were 60-66% lower in ihpRNA than wild type fruit at 20 DAA.

Previous genetic manipulation approaches to altering sugar levels in tomato fruit by targeting sucrose metabolising enzymes achieved reductions in fruit hexose concentrations but these reductions were counteracted by increases in sucrose. Consequently, total sugar concentration in these fruit remained unchanged. In contrast, the increased levels of sucrose measured in the ihpLeHTJ-Specific and ihpLeHT-Family fruit analysed in this study were insignificant compared to the reductions in hexose concentration (data not shown). Therefore, this result demonstrates that in contrast to changes in sugar composition achieved previously, suppression of hexose transporters leads to an absolute reduction in total sugar concentration in fruit. Reductions in LeHT3 expression in leaves had no adverse affects on net photosynthetic rates under saturating light conditions in ihpRNA plants (data not shown). In addition, leaf surface area was unaffected. Similarly, no differences were observed in rates of leaf appearance or numbers. Collectively, these results showed that the photosynthetic capacity of ihpRNA plants remained the same as wild type levels, and thus the observed differences in fruit sugar accumulation could not be attributed to reduced capacity of source tissues to produce sucrose for phloem export to the fruit. Both the temporal expression patterns of LeHTl and LeHT3 (Dibley et al.,

2005), together with the observation that targeted suppression of these two genes correlates with reduced sugar levels, provides strong evidence that either LeHTl, LeHT3, or most likely both, are responsible for hexose accumulation in developing tomato fruit. Furthermore, reductions in intracellular hexose concentration correlated with predicted V max values for ihpRNA pericarp tissue indicates that the number of hexose transporters in the plasma membrane of storage parenchyma cells is the major regulatory factor determining hexose levels in mature fruit.

1.4 Conclusions

Strong reductions in LeHTl and LeHT3 expression during fruit development resulted in mature fruit with a 30-37% reduction in hexose concentration. This result clearly established the essential role of hexose/H⁺ symporters in fruit sugar accumulation, as suggested by gene expression (Dibley et al., 2005) and physiological correlations (Ruan et al., 1997), and provides direct evidence that LeHTl and LeHT3 are the major hexose transporters involved in this process. Furthermore, reductions in pericarp Vmax produced as a result of gene suppression is likely the basis of the reduced hexose concentrations in these fruit.

EXAMPLE 2: Over-expression of hexose transporters in tomato fruit

Four expression constructs were designed to over-express heterologous hexose transporters exhibiting high K_m values for membrane transport of hexoses. Specifically, constructs were synthesized to over-express the Arabidopsis transporter AtSTP3 (Genbank Accession No. AJ001363; http://www.ncbi.nlm.nih.gov/Genbank/index.html) and the yeast transporter SpGHTό (Genbank Accession Number No. AF098076; http://www.ncbi.nlm.nih.gov/Genbank/index.html) in fruit storage parenchyma cells during the rapid phase of fruit hexose accumulation. These constructs were then transformed into the tomato cultivar Moneymaker.

The transgenes were found to be expressed at high relative levels without affecting the expression of endogenous LeHT genes. This over-expression resulted in increased hexose accumulation and sap osmotic content while fruit fresh weight was not altered.

2.1 Methods

2.1.1 Preparation of constructs

(i) Cloning AtSTP: AtSTP3 was cloned by PCR amplification from an Arabidopsis young seedling cDNA library using specific primers AtSTP3-FPl (GGTAAACATGGTAGCAGAAGAAGC)(SEQ ID NO.9) and AtSTP3-RP2 (TGTTTTCAATGGCTAAGAATGGTGG) (SEQ ID No.10). These primers were designed to amplify from the start (ATG) to stop (TGA) codons of AtSTP3.

Thermostable DNA polymerase Pfu Turbo (Promega) was used for this PCR due to its 3'— >5' exonuclease and proof reading capabilities, and a program of 30 cycles of 95⁰C for 30 sees, 55⁰C for 30 sees and 72⁰C for 1.5 min. The 1.55 kB fragment generated was 'A-tailed' using Taq polymerase at 7O⁰C for 20 mins and then cloned into the pDrive PCR cloning vector system (Qiagen).

Sequencing of the cloned AtSTP 3 identified three nucleotide changes from the published sequence (Genbank Accession Number AJ001363; http://www.ncbi.nlm.nih.gov/Genbank/index.html). Two of the mutations (G441A and C 1098T) were silent, in that they produced no change in predicted amino acid sequence. The third change (G812A) caused a mutation in the predicted amino acid sequence of

AtS TP3 protein (Gly269Asp). This mutation was assumed not to cause changes in transport kinetics oϊAtSTP3.

(ii) SpGHTό: S. pombe hexose transporter clone SpGHTό was provided by Dr. Hella Litchenberg, Universitat Bonn, Germany. SpGHTό was contained within pBSK, which contained HindlII restriction sites flanking the gene of interest. 2.1.2 Production of over-expression constructs

Cloned AtSTP3 and SpGHTό sequences were ligated into the plant expression vector pART27. This vector drives strong constitutive expression from a CaMV35S promotor. The resulting plasmids were named pART27-35S-A^STP3 and pART27-35S- SpGHTό.

To achieve fruit specific expression of both AtSTP3 and SpGHTό, the CaMV35S promotor in pART27 was replaced with the tomato fruit specific promotor 2Al 1 (Pear et ah, 1989). The 2Al 1 promotor sequence used in this work was not the complete 2Al 1 gene as reported in Pear et al. (1989), but rather a truncated 1.3 kb fragment. This fragment has been identified by deletion studies to have high-level, fruit- specific expression (Van Haaren and Houck, 1991). The 1.3 kb fragment of 2A11 promotor (hence referred to as 2Al Ip) has since been used in several transformation studies in tomato, producing reliable, fruit -specific expression. The 1.3 kb fragment of the 2Al 1 promotor was supplied by Seminis Vegetable Seeds Inc., in pT7-Blue plasmid (Novagen, USA).

Following construction of pART27-2Al lp, both AtSTP3 and SpGHTό were cloned into this modified pART27 vector to produce pART27-2Al lp-AtSTP3 and pART27-2Al Ip-SpGHTo. All four over-expression constructs (pART27-2Al Ip- AtSTP3; pART27 -lAl lp-SpGHTό; pART27-35S-AtSTP3; pART27-35S-SpGHT6) were subsequently transformed into Agrobacterium tumefaciens (strain ABI), as described in Example 1 above. The electroporation procedure was carried out using a BioRad Gene Pulsar based on the manufacturer's instructions (BioRad) as also described in Example 1.

2.1.3 Plant transformation

The four over-expression constructs in LBA4404 were respectively transfected into Lycopersicon esculentum Mill, cv. Moneymaker cultivars via an Agrobacterium tumefaciens based protocol (McCormick, 1991) (see Example 1). T₁ seeds of transformed lines were collected for analysis. 2.2 Results

Levels of transgene expression varied widely depending on the promotor used. The constitutive over-expressing lines (35S.AtSTP3 and 35S.SpGHT6) showed transcript levels approximately 1000 -fold higher than that seen with the fruit- specific promotor 2Al Ip (2Allp.SpGHT6 and 2AlIpAtSTPJ). Each promotor drove expression of either AtSTP3 or SpGHTό transcript levels to equivalent levels. Over-expression of the heterologous transporters did not affect expression levels of endogenous LeHT genes (data not shown).

2.2.1 Increased sugar accumulation in transgenic fruit

Measurement of hexose levels in ripe fruit revealed that all over-expressing lines exhibited higher hexose concentrations compared to wild type fruit (see Figure 4), with increases between 29% and 40%.

2.2.2 Soluble solid levels change in relation to altered hexose levels Dissolved solid concentrations (measured as sap osmolality) in the pericarp tissue of transgenic fruit demonstrated a positive correlation between hexose levels and sap osmolality (Figure 5). Over-expressing lines with increased hexose concentrations (Figure 4) also showed increases of between 14% and 18%. This relationship also holds for lines with suppressed hexose transporters that accumulate hexoses to lower concentrations (Figure 2) also showing osmolality decreases of between 6% and 16% (Figure 5).

2.2.3 Over-expression of heterologous hexose transporters does not adversely affect rates of fruit maturation.

The onset of fruit ripening may potentially be altered in over-expressing lines by alterations in sugar levels causing changes in signalling regulating fruit maturation processes. However, the time between fruit set and the onset of ripening, together with the length of the ripening process, remained unchanged in all over-expressing lines, resulting in transgenic fruit reaching red ripe by the same time as wild type (see Table 2). Table 2: Fruit chronological age at red ripe for wild type, AtSTP3 and SpGHTό over-expressing plants. All values are mean ± SE for at least 10 separate fruit.

Construct Fruit Age at Red Ripe (days)

Wild type 58.1 + 2.5

35SΛtSTP3 58.3 + 1.7

35 S. SpGHTό 56.6 + 2.9

2Allp.SpGHT6 53.3 + 1.2

2Allp.AtSTP3 53.8 + 1.7

2.2.4 Over-expression of heterologous hexose transporters does not adversely affect fruit volume

Analysis of flower and fruit numbers, flower abortion rates, and general fruit morphology showed no alterations in any of the over-expressing lines compared to wild type (data not shown). Equal numbers of fruit developed to those on wild type plants. At red ripe, transgenic fruits showed no changes in fresh weight and hence fruit volume. All values are mean + SE for at least nine separate fruit. * P<0.05, ** P<0.005, *** P<0.001.

Table 3: Fruit fresh weight at red ripe in lines over-expressing AtSTP 3 and SpGHTό.

Construct Fresh Weight (g)

Wild type 56.5 + 2.8

35SAtSTP3 55.8 + 3.2

35S.SpGHT6 56.2 + 3.2

2Allp.SpGHT6 57.4 + 2.9

2Allp.AtSTP3 50.9 + 3.7 2.3 Discussion

Over-expression of low-affinity heterologous hexose/H⁺ symporters was used to address the industry imperative of increasing mature fruit soluble solids through an increase in hexose concentration. Four expression constructs utilising AtSTP3 or SpGHTβ, under the control of either the CaMV35S or 2Al 1 promotors, were designed and produced to accomplish this task.

2.3.1 Heterologous transporters increase hexose uptake

The two heterologous hexose transporters selected for over-expression in developing tomato fruit have a demonstrated low affinity for glucose, and in the case of SpGHTβ, for fructose also. The low (2Al Ip) and high (CaMV35S) over-expression of these transporters during tomato fruit development provided potential for increased capacity by fruits to accumulate and store free hexoses. This potential was realised with hexose concentrations of 29% to 40% higher than wild type being found in mature fruits of the transgenic plants (Figure 4). These data establish that the over-expression of AtSTP3 or SpGHTό produces fruit capable of accumulating higher amounts of hexose than wild type. While other genetic manipulation studies of sugar accumulation in tomato fruit have managed only to change sugar composition between sucrose and hexoses, this work provides the first example of using genetic manipulation approaches of hexose transporter gene expression to increase sugar concentrations in mature fruit.

Increased glucose uptake capacity from the fruit apoplasm in heterologous transporter over-expressing fruit could occur via increases in membrane maximal velocity (Vmax) due to higher protein densities, and/or through changes to substrate binding efficiencies (K_m values).

2.3.2 Transgenic plants show an improved stress tolerance The analysis of tomato plants grown under optimal glasshouse conditions over- expressing AtSTP 3 and SpGHTό revealed favourable fruit characteristics of higher sugar concentration (Figure 4). This change occured without a reduction in fresh weight and hence volume (Table 3). To further investigate positive effects of the over-expression strategies on fruit development, an examination of responses to root-induced stress was undertaken. Increased hexose transporter capacity brought about by over-expressing heterologous transporters may effect stress responses, as membrane proteins are known to be involved in responses to biotic and abiotic stresses. The pathway for sugar accumulation in tomato fruit has numerous points potentially affected by abiotic stress. For example, stress may affect expression and activity levels of hexose transporters, extra-cellular invertase, plasma membrane H⁺-ATPase and sucrose synthase.

35S.SpGHT6 plants placed under root stress were able to accumulate more hexoses in their fruits than wild type (data not shown). However, in contrast to plants grown in 9 L pots (reducing abiotic stress), the increased accumulation of hexose in stressed fruit (grown in 4 L pots) did not result in increased hexose concentrations. Instead, increases in absolute hexose levels resulted in an equivalent rise in pericarp water volume retaining concentration at wild type levels. Higher rates of water influx also explain the observed increases in cell and fruit size in comparison to wild type (data not shown). This osmoregulation through water influx most likely occurs in these fruit due to an inhibition of hexokinase sugar signalling and mineral ion transporters by stress hormones produced as a result of the imposed pot treatment. Such effects may shut down the putative osmoregulation mechanisms acting under normal conditions which retain cellular volume at wild type levels in transgenic fruit. Accordingly, growing

35S.SpGHT6 plants in 9 L pots reduced abiotic stress levels sufficiently obtaining an increase in hexose concentration in the fruit compared to wild type. As such, plants embodied by the invention are grown under conditions selected for sufficiently reducing abiotic stress (e.g. in sufficiently large pots or plot conditions) to a level to obtain increased hexose concentration in the sugar accumulating tissue of the plant (e.g. fruit).

2.4 Conclusions

Energy-coupled uptake of hexoses from the fruit apoplasm regulates mature fruit hexose levels (Ruan et ah, 1997). Increased glucose uptake (Figure 4) achieved by over-expressing either AtSTP3 or SpGHTό during fruit development provided a mechanism for removing this regulation to the limitation to hexose accumulation. The resulting increase in V max and apparent decrease in K_m, achieved by over-expression of the heterologous transporters produced fruit containing higher concentrations of stored hexoses without any alterations in fruit volume (Table 3). This outcome demonstrates the ability to control final levels of hexose accumulation via manipulating hexose/H⁺ symporter uptake capacity. Together with increased stress tolerance, these transgenic fruit provide a potentially more desirable product for the fresh and processing markets.

While a number of embodiments have been described, it will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

REFERENCES

Baxter CJ, Carrari F, Bauke A, Overy S, Hill SA, Quick PW, Fernie AR, and Sweetlove LJ (2005) Fruit Carbohydrate Metabolism in an Introgression Line of Tomato with Increased Fruit Soluble Solids. Plant Cell Physiol. 46:425-437.

Brennecke J, Stark A, Russell RB, and Cohen SM (2005) Principles of microRNA -target recognition. PLoS Biol. 3:e85-e99.

Comai L, Young K, Till BJ, Reynold SH, Greene EA, Codomo CA, Enns LC, Johnson JE, Burtner C, Odden AR, and Henikoff S (2004) Efficient discovery of DNA polymorphisms in natural populations by Ecotilling. Plant J. 37:778-786.

Dibley SJ, Gear ML, Yang X, Rosche EG, Offler CE, McCurdy DW, and Patrick JW (2005) Temporal and spatial expression of hexose transporters in developing tomato (Lycopersicon esculentum) fruit. Fund. Plant Biol. 32:777-785.

Fillion L, Ageorges A, Picaud S, Coutos-Thevenot P, Lemoine R, Romieu C, and Delrot S (1999) Cloning and expression of a hexose transporter gene expressed during the ripening of grape berry. Plant Physiol. 120:1083-1093.

Friedberg F and Rhoads AR (2001) Sequence homology of the 3 '-untranslated region of calmodulin III in mammals. Molec.Biol.Rep. 28:27-30.

Gear ML, McPhillips ML, Patrick JW, and McCurdy DW (2000) Hexose transporters of tomato: molecular cloning, expression analysis and functional characterization. Plant MoI. Biol. 44:687-697.

Gleave AP (1992) A versatile binary vector system with a T-DNA organisational structure conductive to efficient integration of cloned DNA into the plant genome. Plant Mol.Biol. 20:1203-1207. Gordon-Kamm WJ, Spencer TM, Mangano ML, Adams TR, Daines RJ, Start

WG, O'Brien JV, Chambers SA, Adams WRJr, Willets NG, Rice TB, Mackey CJ, Krueger RW, Kausch AP, and Lemaux PG (1990) Transformation of maize cells and regeneration of fertile transgenic plants. Plant Cell 2:603-618.

Hayes MA, Davies C, and Dry IB (2007) Isolation, functional characterization, and expression analysis of grapevine (Vitis vinifera L.) hexose tranporters: differential roles in sink and source tissues. J.Exp.Bot. 58: 1985-1997.

Henikoff S, Till BJ, and Comai L (2004) TILLING. Traditional mutagenesis meets functional genomics. Plant Physiol. 134:630-636.

Ho LC and Hewitt JD (1986) Fruit development, in The Tomato Crop: a Scientific Basis for Improvement (Atherton JG and Rudich J eds) pp 202-226, Chapman and Hall, London. McCormick S (1991) Transformation of tomato with Agrobacterium tumefaciens. Plant Tissue Culture Manual, Fundamentals and Applications, K. Lindsey (ed), Kluwer, Volume B6: 1-9.

Pear JP, Ridge N, Rasmussen R, Rose RE, and Houck CM (1989) Isolation and characterization of a fruit- specific cDNA and the corresponding genomic clone from tomato. Plant Mol.Biol. 13:639-651.

Ruan Y-L and Patrick JW (1995) The cellular pathway of postphloem sugar transport in developing tomato fruit. Planta 196:434-444.

Ruan Y-L, Patrick JW, and Brady CJ (1997) Protoplast hexose carrier activity is a determinate of genotypic difference in hexose storage in tomato fruit. Plant Cell Env. 20:341-349.

Van Haaren MJJ and Houck CM (1991) Strong negative and positive elements contribute to the high-level fruit- specific expression of the tomato 2Al 1 gene. Plant Mol.Biol. 17:615-630.

Wang YQ, Xu H, Wei XL, Chai CL, Xiao YG, Zhang Y, Chen B, Xiao G, Ouwerkerk PBF, Wang M, and Zhu Z (2007) Molecular cloning and expression analysis of a monosaccharide transporter gene OsMST4 from rice (Oryza sativa L.). Plant MoI. Biol. 65:439-451.

Wesley SV, Helliwell CC, Smith NA, Wang M, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, and Waterhouse PM (2001) Construct design for efficient, effective and high -throughput gene silencing in plants. Plant J. 27:581-590.

Will A, Graβl R, Erdmenger J, Caspari T, and Tanner W (1998) Alteration of substrate affinities and specificities of the Chlorella hexose/H⁺ symporters by mutations and construction of chimeras. J.Biol.Chem. 273:11456-11462.

Claims

47.CLAIMS

1. A method for providing a plant having an altered hexose concentration in hexose accumulating tissue of the plant, comprising: (a) screening plant matter for predetermined hexose transporter expression or activity indicative of altered hexose accumulation in the tissue;

(b) identifying plant matter having the hexose transporter activity or activity from the screening; and

(c) providing the plant on the basis of the identification in step (b).

2. A method according to claim 1 wherein step (a) comprises screening for a hexose transporter having up regulated or down regulated activity compared to a reference hexose transporter.

3. A method according to claim 1 or 2 wherein the screening comprises screening for expression of a mutant or wild-type hexose transporter of the plant, or a heterologous hexose transporter.

4. A method according to any one of claims 1 to 3 wherein the plant is non- genetically modified.

5. A method according to any one of claims 1 to 4 wherein the plant has been subjected to mutagenesis, or is grown or derived from mutagenized plant matter.

6. A method according to any one of claims 1 to 3 wherein the plant is genetically modified to have up regulated or down regulated hexose transporter expression, or to express a heterologous hexose transporter.

7. A method according to any one of claims 1 to 6 wherein the plant is a sugar accumulating fleshy fruit producing plant.

8. A method according to claim 7 wherein the plant is a tomato plant and the hexose accumulating tissue of the plant is tomato fruit.

9. A method for providing a plant having an altered hexose concentration in hexose accumulating tissue of the plant, comprising: transforming plant matter with a polynucleotide for altering hexose transporter expression or activity in the tissue; culturing the transformed plant matter to produce cultured plant matter; and generating the plant from the cultured plant matter.

48.

10. A method according to claim 9 wherein the hexose transporter is encoded by one or more of the hexose transport genes LeHTl, LeHT2, LeHT3, AtSTP3 and SpGHTό.

11. A method according to claim 9 or 10 wherein the hexose transporter expression or activity is up regulated.

12. A method according to claim 9 wherein the hexose transporter expression or activity is down regulated.

13. A method according to claim 12 wherein the polynucleotide comprises nucleic acid which effects the suppression or silencing of one or more endogenous hexose transporters.

14. A method according to any one of claims 9 to 11 wherein an increase in hexose concentration in the hexose accumulating tissue of the plant results in an increase in the level of soluble solids in the tissue.

15. A method according to any one of claims 9 to 13 wherein the plant material that is transformed with the polynucleotide is hexose accumulating tissue.

16. A plant according to any one of claims 9 to 15 wherein the plant is a sugar accumulating fleshy fruit producing plant or a vegetable or crop species.

17. A method according to any one of claims 9 to 16 wherein the plant is a tomato plant and the hexose accumulating tissue is tomato fruit.

18. A plant provided by a method as defined in any one of claims 1 to 17.

19. An isolated plant with an altered hexose concentration in hexose accumulating tissue of the plant, the plant being modified to exhibit altered hexose transporter expression or activity in the tissue.

20. A plant according to claim 19, wherein the plant is a sugar accumulating fleshy fruit producing plant.

21. A plant according to claim 19 or 20 being a tomato plant, and wherein the hexose accumulating tissue of the plant is tomato fruit.

22. A method for providing a plant which produces sugar accumulating fleshy fruit having an altered hexose concentration, comprising:

(a) screening for predetermined hexose transporter expression or activity in plant matter indicative of expression or activity of the hexose transporter in fruit;

(b) identifying plant matter with the hexose transporter expression or activity from the screening for provision of the plant from the screening; and

49.

(c) providing the plant for production of the fruit with the altered hexose concentration on the basis of the identification in step (b).

23. A method according to claim 22 wherein the plant is a tomato plant and the sugar accumulating fleshy fruit is tomato fruit.

24. A method for providing sugar accumulating fleshy fruit, comprising: providing at least one plant by a method as defined in any one of claims 1 to 17 and 22; growing the plant for production of the fruit; and harvesting the fruit from the plant.

25. A planted stand of stably reproducing plants having a stable heritable trait of an altered hexose concentration in hexose accumulating tissue of the plants, the plants being plants provided by a method as defined in any one of claims 1 to 17 and 22; 26. Hexose accumulating tissue from a plant provided by a method as defined in any one of claims 1 to 17 and 22. 27. Reproductive material of a plant provided by a method as defined in any one of claims 1 to 17 and 22.