AU2021100656A4

AU2021100656A4 - A CTLA-4 Nanobody and Its Preparation Method and Application

Info

Publication number: AU2021100656A4
Application number: AU2021100656A
Authority: AU
Inventors: Chuangfu Chen; Yong Wang; Zhen Wang; Peng Wu; Chencheng Xiao
Original assignee: Shihezi University
Current assignee: Shihezi University
Priority date: 2021-02-02
Filing date: 2021-02-02
Publication date: 2021-04-15
Anticipated expiration: 2029-02-02

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to a cytotoxic T lymphocyte-associated antigen-4 (CTLA-4) nanobody, as well as its preparation method and application. The use of nanobody can improve or synergistically enhance the binding ability with antigen. Nanobody does not have a complete antibody structure, lacking Fc end and Y-shaped structure. Therefore, it is difficult for antigen to be recognized after binding with nanobody, that is, it can easily escape the capture of immune system. The invention mainly includes the following technical means. Connecting the antigen with vector and transferring it into competent cells to extract the recombinant plasmid, which is then transfected into host bacteria for expression. Next, using antigen protein to immunize camel animals, collecting peripheral blood, and extracting total RNA of lymphocyte sample, which is then reverse transcribed into cDNA and amplified to obtain VHH library fragment. Then antibody immune library is constructed by inserting VHH library fragment into expression vector and transforming it into competent cells. Finally, the nanobody in antibody immune library is screened and the binding ability of the nanobody with CTLA-4 antigen is verified. -1/11 Synthesis and amplification of PD-i immune antigen fragment After transferring the ligation solution into competent cells, extracting recombinant plasmids. Transfecting the recombinant plasmids into host bacteria to express the antigen Immunizing camel animals by the antigen protein Collection of peripheral blood of immunized camel animals and separation of lymphocytes. The total RNA of lymphocyte sample is extracted, and reverse transcribed to cDNA Amplfation of VHH fragment and insertion of expression vector Construction of an antibody immune library Biotinylated screening of nanobody Verification of the binding ability of the nanobody to antigen Figure 1 A flow chart of CTLA-4 nanobody construction.

Description

-1/11

Synthesis and amplification of PD-i immune antigen fragment

After transferring the ligation solution into competent cells, extracting recombinant plasmids.

Transfecting the recombinant plasmids into host bacteria to express the antigen

Immunizing camel animals by the antigen protein

Collection of peripheral blood of immunized camel animals and separation of lymphocytes.

The total RNA of lymphocyte sample is extracted, and reverse transcribed to cDNA

Amplfation of VHH fragment and insertion of expression vector

Construction of an antibody immune library

Biotinylated screening of nanobody

Verification of the binding ability of the nanobody to antigen

Figure 1

A flow chart of CTLA-4 nanobody construction.

A CTLA-4 Nanobody and Its Preparation Method and Application

TECHNICAL FIELD

The invention belongs to the technical field of biomedicine, and particularly relates to a

CTLA-4 nanobody and its preparation method and application.

BACKGROUND

CTLA-4 is a kind of T lymphocyte transmembrane protein, which was first discovered

when screening the cDNA library of killer T cells in mice. Because CTLA-4 can bind to

B7 receptor on antigen presenting cells or activated T cells, it has attracted great attention

in the field of immunotherapy.

Nanobody was first reported by Belgian scientists in Nature Journal in 1993. According

to the report, there is a kind of antibody with natural deletion of light chain in Alpaca

peripheral blood, Wherein, its variable domain of heavy chain of heavy-chain antibody

(VHH) crystal is 2.5 nm in width, 4 nm in length and 15 kD in molecular weight, so it is

also called nanobody.

Therefore, the preparation of CTLA-4 nanobody has broad application prospects in the

diagnosis and treatment of tumour diseases.

SUMMARY

In view of the problems existing in the prior art, the invention provides a CTLA-4

nanobody, a preparation method and an application thereof, aiming at solving or at least

alleviating a part of the problems in the prior art.

The sequence of the CTLA-4 nanobody is shown in SEQ ID NO. 9.

The preparation method of CTLA-4 nanobody is comprised of the following steps.

Si. Synthesis and amplification of CTLA-4 immune antigen fragment.

S2. Preparation of ligation solution. Connecting the amplified CTLA-4 product fragment

with a vector.

S3. After transferring the ligation solution into competent cells, extracting recombinant

plasmids.

S4. Transfecting the recombinant plasmids into host bacteria to express the antigen and

then the expressed antigen protein is purified.

S5. Immunizing camel animals by the antigen protein obtained in S4.

S6. Collection of peripheral blood of immunized camel animals and separation of

lymphocytes.

S7. The total RNA of lymphocyte sample is extracted, and reverse transcribed to cDNA.

Then amplifying it with primers CAL-leader and CAL-CH2 to obtain VHH library

fragment, wherein the sequences of primers CAL-leader and CAL-CH2 are shown in

SEQ ID NO: 4 and SEQ ID NO: 5 respectively.

S8. Construction of an antibody immune library by transforming the VHH library

fragment into competent cells after inserting it into an expression vector.

S9. Screening of nanobody in antibody immune library, adopting biotinylation method.

S10. Verification of the binding ability of the selected nanobody to CTLA-4 antigen.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 is a flow chart of CTLA-4 nanobody construction.

Figure 2 is the result of CTLA-4 PCR electrophoresis.

Figure 3 is the result of enzyme digestion electrophoresis of pcDNA3.1 vector.

Figure 4 is the result of CTLA-4 enzyme digestion electrophoresis.

Figure 5 is the Westem-blot detection result of CTLA-4 specificity.

Figure 6 is a graph of electrophoresis results of total RNA samples.

Figure 7 is a graph of electrophoresis results of VHH fragments.

Figure 8 is a graph of electrophoresis results of VHH fragments.

Figure 9 is the result of resistant plate culture after electro-transformation.

Figure 10 is a graph of electrophoresis results of colony PCR products.

Figure 11 is the SDS-PAGE detection result of CTLA-4.

DESCRIPTION OF THE INVENTION

Embodiment 1

CTLA-4 nanobody and its preparation method\

Si. Amplification of CTLA-4 immune antigen fragment.

The immune antigen sequence of CTLA-4 is shown in SEQ ID NO:1 and further as

shown in the following table and SEQ ID NO: 2 and SEQ ID NO: 3.

Primer name Primer sequence CTLA-4 upstream 5'-GACACGAATTCGCCACC-3', shown in SEQ ID NO: 2 primer CTLA-4 5'-GTGTCAAGCTTTCACTTATCGTCATCATCC-3', shown in downstream primer SEQ ID NO: 3 PCR system is as follows: (primer concentration is 1OD and dissolved in 400 uL ddH 20)

Component Volume Upstream primer 2 uL Downstream 2 uL primer Target gene 3 uL dNTP 1 uL(25 mM each) IOX pfu Buffer 5uL pfu 0.4 uL (5u/uL) ddH 20 Make up to 50 uL PCR program:

Temperature Time 95°C 3 min

95°C 22 sec 55°C 20 sec 22cycles 72°C 45 sec 72°C 5 min After PCR, 1% agarose gel electrophoresis was performed, and the fragments were

recovered according to the operation of recovery kit.

The PCR results are shown in Fig. 2, and the target bands with the same size were

obtained by PCR amplification. The target bands were clearly identified by 1% agarose

gel electrophoresis, and the result was consistent with the expected, indicating that the

target strip was successfully amplified, and the target fragment was 552 bp.

S2. Preparation of ligation solution. Connecting the amplified CTLA-4 fragment with a

vector.

At first, the recovered product in S was digested with enzyme, and the digestion system

was 50 uL, specifically as follows:

Components Volume Recovered fragments lug (20 uL) IOX FD Buffer 5 uL EcoRI I uL (1Ou/uL) HindIll 1 uL (1Ou/uL) ddH20 23 uL The above system was put into a constant temperature water bath at 37C to react for 2 h.

Thereafter, the vector was digested with enzyme. Wherein the used vector was

PCDNA3.1+ vector, and the enzyme digestion system of the vector was as follows:

Components Volume PCDNA3.1+ l ug IOX FD Buffer 5 uL EcoRI I uL (1Ou/uL) HindIll 1 uL (1Ou/uL) ddH 20 42 uL

The above system was put into a constant temperature water bath at 37C to react for 2 h,

and the vector fragment digested by enzyme was recovered according to the recovery kit.

The recovered vector fragments were detected by 1% agarose gel electrophoresis, and the

results are shown in Fig. 3, in which lanes 1 and 2 are both vector enzyme digestion

lanes. The obtained band is in the size of 5300 bp, consistent with the expected size,

indicating that the recovered fragment was digested successfully.

Then, the recovered target fragment was connected with the vector, and the connection

system is 20 uL, specifically:

Component Volume Target fragment s 8 uL Vector PCDNA3.1+ digested 4 uL by enzyme IOX T4 DNA ligase Buffer 2 uL T4 DNA ligase luL (5u/uL) ddH 20 Make up to 20uL The above connecting system was placed in a PCR instrument and treated at 22C for 1 h

to obtain ligation solution. The ligation solution was detected by 1% agarose gel

electrophoresis, and the result is shown in Fig. 4, indicating that the connection was

successful.

plasmids.

S4. Transfecting the recombinant plasmids into HEK293 cells to express the CTLA-4 and

then the expressed antigen protein is purified. The protein was identified by SDS-PAGE

and purified by nickel column.

Specific Westem-blot analysis showed that the primary antibody of CTLA-4 was Anti

CTLA-4 antibody (BNI3) (mouse monoclonal antibody BNI3 to CTLA-4, Anti-CTLA-4 antibody (BNI3) Abcam Company ab19792), and the secondary antibody was goat polyclonal antibody to mouse IgG-H&L (HRP) antibody (from Abcam ab6789).

The results of Western-blot test are shown in Fig. 6, and the Westem-blot test proves that

the protein possess specificity.

S5. Immunizing camel animals by the antigen protein obtained in S4.

Alpaca was selected as the immunized animal, and the immunization scheme was as

follows.

First immunization, including emulsification with 0.5 ml of Freund's complete adjuvant

and 0.5 ml of protein and subcutaneous and intradermal injection immunization. Then

0.25 ml of Freund's incomplete adjuvant and 0.25 ml of protein were emulsified evenly,

and alpacas were immunized subcutaneously in 28 days (second immunization), 49 days

(third immunization) and 70 days (fourth immunization), respectively. 0.125 ml of

Freund's incomplete adjuvant and 0.125 ml of protein were emulsified evenly, and the

alpacas were immunized in 91 days (fifth immunization), 112 days (sixth immunization)

and 133 days (seventh immunization) respectively. On day 144, lymphocytes were

isolated.

ELISA test. The antigens were 200 ng/well, and the secondary antibodies of anti-alpaca

were diluted with 0.5 x blocker based on 1:15000 and the added into the plate with 100

FL/well at 37 °C for a 1 h reaction. They were then stained with 100 L/well TMB for

min and terminated with 50 L/well 2m H2 SO 4 . The OD450-OD630 nm reading of the

microplate reader.

Test results are as follows:

12,800 25,600 51,200 102,400 204,800 409,600 PBS times times times times times times

Before CTLA-4 0.047 0.042 0.041 0.042 / / 0.039 immunization After CTLA-4 seventh OUT OUT 2.244 1.359 0.741 0.339 0.041 immunization Wherein, "OUT" means that the OD 4 5 0 value exceeds 3.000, and the OD value is too

high, which is a strong positive; "/"means that OD 450 value is lower than 0.042, signal is

lower than PBS control group, and OD value is too low, which is negative.

S6. Collection of peripheral blood of immunized camel animals and separation of

lymphocytes.

Then amplifying it with primers CAL-leader and CAL-CH2 to obtain VHH library

fragment, wherein the sequences of primers CAL-leader and CAL-CH2 are shown in

SEQ ID NO: 4 and SEQ ID NO: 5 respectively.

Sequence of primer CAL-leader: GTCCTGGCTGCTCTTCTACAAGG.

Sequence of primer CA-CH2: GGTACGTGCTGTTGAACTGTTCC.

Trizol was used to resuspend and extract total RNA from alpaca peripheral blood

lymphocyte samples, and the quality of total RNA was detected by agarose gel

electrophoresis. Results as shown in Fig. 6, M is DL2000 DNA marker, and the total

RNA sample is slightly degraded. Wherein, the 28S, 18S and 5S rRNA bands are clearly

visible, and the brightness of the 28S band is greater than 18S, indicating that the

integrity of RNA is better. The concentration of RNA samples was determined by

Nanodrop, and the results are shown in the following table:

Sample name Concentration OD260/OD280 (ng/pL) CTLA-4 792.2 2.04

The results show that the concentration and purity of RNA samples meet the

requirements. In each project, 10 g of total RNA was used as template, and cDNA was

synthesized by reverse transcription.

Then, taking cDNA as template, alpaca antibody fragment was amplified by using

primers CAL-leader and CAL-CH2, and appropriate amount of PCR products were taken

for 1% agarose gel electrophoresis detection.

PCR system:

Using pfu high fidelity DNA polymerase (TransStart FastPfu DNA Polymerase, AP221

01).

Component Volume Final Concentration 5xpfu Buffer 10 [L 1x dNTPs (2.5 mM each) 4 pL 0.2 mM CAL-leader(10 M) 1 L 0.2 M CAL-CH2(10 [M) 1 L 0.2 M cDNA 2 tL pfu DNA polymerase 1 L 2.5 units DdH 20 31 L PCR program:

Number of cycles Temperature Time 1 cycle 95°C 2 min 95°C 30s 30 cycles 56°C 30s 72°C 1 min 1 cycle 72°C 5 min 1 cycle 4°C 0 The electrophoresis results are shown in Fig. 7. Electrophoresis was carried out on

sufficient PCR products, and the main band of 600 bp was recovered by gel cutting,

which was used as the template for subsequent PCR. VHH was amplified by VHH-back

and PMCF primers, and the sequences were detailed in SEQ ID NO: 6 and SEQ ID NO:

7. Results as shown in Fig. 8, the target band with molecular weight of about 400 bp was

obtained by PCR amplification, which was the same as expected.

Sequence of primer VHH-back: GATGTGCAGCTGCAGGAGTCTGGRGGAGG.

Sequence of primer PMCF: CTAGTGCGGCCGCTGAGGAGACGGTGACCTGGGT.

PCR system:

Component Volume Final Concentration 5xpfu Buffer 10 [L 1x dNTPs (2.5 mM each) 4 [L 0.2 mM PMCF (10 [M) 1 L 0.2 M VHH-back (10 [M) 1 L 0.2 [M Template X L 50 ng/50 L system pfu DNA polymerase 1 L 2.5 units DdH 20 Add to 50 L PCR program:

Number of cycles Temperature Time 1 cycle 95°C 2 min 95°C 30s 25 cycles 58°C 30s 72°C 1 min 1 cycle 72°C 5 min 1 cycle 4°C 0 S8. Construction of an antibody immune library by transforming the VHH library

fragment into competent cells after inserting it into an expression vector.

Electro-transformation experimental scheme:

1) Preparation ofE.coli TG1 electro-transformation competent cells.

2) The purified connecting product was added to a proper amount of TG1 competent

cells, mixed evenly, and then packed into 0.2 cm electro-transformation cup.

3) Transformation conditions: 2.5 kV, 25 F, 200 Q, recommended by BIORAD.

4) Adding 2YT culture medium into the electro-transformation cup, resuspending

competent cells at 37C, and resuscitating them at 150 rpm for 30 min.

In Fig. 9, J, K and L are the growth conditions of ampicillin resistant plate with 10-4, 10-1

and 106 gradient dilutions, respectively. Wherein, the clone numbers of -5 and -6

gradients in CTLA-4 library are -1700 and 230 respectively, so the storage capacity is

[230x15x106+ (1700+230) x15x10 ]+2=3.2x109.

Quality analysis of immune library: 20 monoclonal antibodies were randomly selected

from gradient dilution plates of each library, and colony PCR was performed with

primers MP57 and PMCF, and agarose gel electrophoresis was used for detection and

analysis. The sequence of primer MP57 (TTATGCTTCCGGCTCGTATG) is shown in

SEQ ID NO: 8, and these clones were sent to a third-party company for sequencing.

PCR system:

Using Taq DNA polymerase (2xTaq Plus MasterMix, CW2849M).

Component Volume Final Concentration 2x Tag Plus MasterMix 25 L 1x MP57 (10 [M) 2 L 0.4 [M PMCF (10 [M) 2 L 0.4 [M Template 1 L DdH 20 20 [tL PCR program:

Number of cycles Temperature Time 1 cycle 94°C 2 min 94°C 30s 27 cycles 57°C 30s 72°C 1 min 1 cycle 72°C 2 min 1 cycle 4°C 0 The result is shown in Fig. 10. All of the clones had a specific band with molecular

weight of about 500 bp, indicating that these clones were positive. These clones were

sequenced by primer MP57, and 20 effective clones were obtained from CTLA-4 library.

The amino acid sequences of VHH fragments were compared and analyzed, and the amino acid distribution at 37 / 44 / 45 / 47 was examined. The analysis results showed that the library had high capacity and the sequenced fragments had no duplication.

Further, the CTLA-4 was screened for three rounds.

The experimental results are as follows:

The antiserum titer of CTLA-4 project was high, reaching 1: 102,400. CTLA-4 protein

samples were subjected to SDS-PAGE, Western blot, biotin labeling as well as

directional screening in vitro.

The constructed immune library was used for three rounds of screening for b-CTLA-4,

and the strategies and results are as follows:

Round Conditions Input Output Enriching factor Target protein: b-CTLA-4 (10 g) Blocking: 2% Milk-PBS 1S t-P Washing: 0.1% Tween20-PBS, 10 times 1.0x10" 2.6x107 3.8x105 Elution: 0.2 M Glycine-HCl, pH 2.2 Pre-counter select: None Target protein: b-CTLA-4 (5 g) Blocking: 2% Milk-PBS 2 nd-P Washing: 0.2% Tween20-PBS, 15 times 2.1x1012 1.Ox108 2.1x104 Elution: 0.2 M Glycine-HCl, pH 2.2 Pre-counter select: None Target protein: b-CTLA-4 (1 g) Blocking: 2% Milk-PBS 3 rd-P Washing: 0.2% Tween20-PBS, 20 times 1.0x1012 5.8x108 1.7x10 Elution: 0.2 M Glycine-HCl, pH 2.2 Pre-counter select: None The results showed that the enrichment was obvious in the second round of screening,

and there was a certain degree of enrichment in the third round.

The sequence ID No: 9 of the selected nanobody is as follows.

CGGTTTGGGCGGGATACATTTCACAAGCTTAAGGAGACAGTACATATGAAAT ACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCC ATGGCCCAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGG GGTCTCTGAGACTCTCCTGTGCAGCCTCTGGATTCAGTTTGGATTATCGCATA GGCTGGTTCCGTCGGGCCCCAGGGAAGGAGCGTGAGGGGGTCTCATGTATAA GTACGACCGGTGGTACCACAACGTATGCAGACTCCGTGAAGGGCCGATTCAC CATCTCCAAAGACAACGCCAAGAAGACGGCTTATCTGCAAATGAACAGCCTG AAACCTGAGGACACAGGCGTTTATTACTGTGCAGCCGCCTTCGGTGGTGCCG ATTACGTTTGTTCTGACCAAGGGTATAACTACTGGGGCCAGGGGACCCAGGT CACCGTCTCCTCAGCGGCCGCATACCCGTACGACGTTCCGGACTACGGTTCCC ACCACCATCACCATCACTAGACTGTTGAAAGTTGTTTAGCAAAACCTCATACA GAAAATTCATTTACTAACGTCTGGAAAGACGACAAAACTTTAGATCGTTACG CTAACTATGAGGGCTGTCTGTGGAATGCTACAGGCGTTGTCGTTTGTACTGGT GACGAAACTCAGTGTTACGGTACATGGGTTCCTATTGGGCTTGCTATCCCTGA AAATGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTTCTGAG GGTGGCGGTACTAAACCTCCTGAGTACGGTGATACACCTATTCCGGGCTATA CTTATATCAACCCTCTCGACGGCACTTATCCGCCTGGTACTGAGCAAAACCCC GCTAATCCTAATCCTTCTCTTGAGGAGTCTCAGCCTCTTAATACTTTCATGTTT CAGATAATAGGTTCCGAAATAGGCAGGGTGCATTAACTGTTTATACGGGCAC TGTTACCTCAAGGCACTGACCTCGTTAAAACCT

Identification method

1) Monoclonal phage ELISA analysis

230 clones were selected from the enriched products eluted in the second and third

rounds for Monoclonal phage ELISA verification, and coated with CTLA-4 and BSA

control at 200ng/well respectively.

2) Soluble ELISA analysis

CTLA-4 clones with unique sequence (in E.coli TG1) was induced and expressed by

IPTG at 30 °C. After centrifugation, the bacteria were collected for periplasmic cavity

extraction. The periplasmic cavity extract samples were diluted 10 times with 0.5 x

blocker and added to the coated and sealed CTLA-4 and BSA. Meanwhile, the

periplasmic cavity extract of TG1 (without phagemid) was set as the negative control.

Mouse anti-HA tag monoclonal antibody (proteintech, 1:5000 dilution) was used as the

second antibody and sheep anti mouse-HRP (1:5000 dilution) as the third antibody to

detect the activity of soluble nanobody.

Construction of pET28a-SUMO vector expression and purification can improve the

expression and activity of nanobody. A living nanobody CTLA-4 was cloned and

constructed into pET28a-SUMO vector for intracellular expression, which was then

purified by Ni column after ultrasonic sterilization.

The purified nanobody was diluted with 0.5x blocker gradient and added to coated and

sealed CTLA-4 and BSA (200 ng/well), and PBS was set as negative control. Use mouse

anti-HA tag monoclonal antibody (ProteinTech, diluted 1:5000) as the second antibody

and the Goat anti Mouse -HRP (diluted 1: 5000) was used as the tertiary antibody to

detect the activity of soluble purified nanobody.

Appraisal result

1) Monoclonal phage ELISA analysis

ELISA results showed that the positive rate was about 64%. 50 strong positive clones

were selected and sequenced, and there were 7 unique sequence clones.

2) Soluble ELISA analysis

The results are shown in the table below. The nanobody showed soluble expression and

good activity. The clones with the same background color had higher sequence similarity.

Serial number CTLA-4 (200 ng/well) BSA (200 ng/well) CTLA-4 0.452 0.033 E.coli TGJ 0.052 0.046 The above description is only a better embodiment of the invention and is not intended to

limit the invention. Any modification, equivalent substitution and improvement made

within the spirit and principle of the invention shall be included in the protection scope of

the invention.

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

1. The CTLA-4 nanobody has a sequence as shown in SEQ ID No.9.

2. The preparation method of CTLA-4 nanobody, characterized by comprising the

following steps.

Sl. Synthesis and amplification of CTLA-4 immune antigen fragment.

with a vector.

plasmids.

then the expressed antigen protein is purified.

S5. Immunizing camel animals by the antigen protein obtained in S4.

S6. Collection of peripheral blood of immunized camel animals and separation of

lymphocytes.

Then amplifying it with primers CAL-leader and CAL-CH2 to obtain VHH library

fragment, wherein the sequences of primers CAL-leader and CAL-CH2 are shown in

SEQ ID NO: 4 and SEQ ID NO: 5 respectively.

S8. Construction of an antibody immune library by transforming the VHH library

fragment into competent cells after inserting it into an expression vector.

3. The preparation method of CTLA-4 nanobody according to Claim 2, characterized in

that in Sl, when amplifying the synthesized CTLA-4 immune antigen sequence fragment,

the used primers are CTLA-4 upstream primer and CTLA-4 downstream primer,

respectively. Specifically, the sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3.

4. The preparation method of CTLA-4 nanobody according to Claim 2, characterized in

that in S2, the vector is PCDNA3.1+ vector.

5. The preparation method of CTLA-4 nanobody according to Claim 2, characterized in

that in S3, the competent cell is HEK293 competent cell.

6. The preparation method of CTLA-4 nanobody according to Claim 2, characterized in

that in S4, the host bacteria are HEK293 cells.

7. The preparation method of CTLA-4 nanobody according to Claim 2, characterized in

that the sequence of the nanobody screened by biotinylation method is shown in SEQ ID

NO:9.

8. The invention provides the CTLA-4 nanobody prepared by the preparation method of

any one of Claims 2-6.

9. The invention includes the application of the CTLA-4 nanobody as stated in Claim 1 or

Claim 8 in preparing tumor inhibitors or tumor cell inhibitors.

10. The invention further includes the application of the CTLA-4 nanobody as stated in

Claim 1 or Claim 8 in preparing immunologic adjuvant for improving immune level of

animals or immunopotentiator when viruses and/or bacteria spread.

-1/11- 02 Feb 2021 2021100656

Figure 1

A flow chart of CTLA-4 nanobody construction.

-2/11- 02 Feb 2021 2021100656

Figure 2

The result of CTLA-4 PCR electrophoresis.

-3/11- 02 Feb 2021 2021100656

Figure 3

The result of enzyme digestion electrophoresis of pcDNA3.1 vector.

-4/11- 02 Feb 2021 2021100656

Figure 4

The result of CTLA-4 enzyme digestion electrophoresis.

-5/11- 02 Feb 2021 2021100656

Figure 5

The Western-blot detection result of CTLA-4 specificity.

-6/11- 02 Feb 2021 2021100656

Figure 6

A graph of electrophoresis results of total RNA samples.

-7/11- 02 Feb 2021 2021100656

Figure 7

A graph of electrophoresis results of VHH fragments.

-8/11- 2021100656

Figure 8

A graph of electrophoresis results of VHH fragments.

-9/11- 2021100656

Figure 9

The result of resistant plate culture after electro-transformation.

-10/11- 02 Feb 2021 2021100656

Figure 10

A graph of electrophoresis results of colony PCR products.

-11/11- 02 Feb 2021 2021100656

Figure 11

The SDS-PAGE detection result of CTLA-4.