AU2021100416A4 - Lateral flow test strip detection kit for detecting martes-derived ingredients in food and feed and application thereof - Google Patents

Abstract

The disclosure discloses a preparation method of a nucleic acid rapid detection kit for detecting martes ingredients in food and feed, and an application method thereof. The kit includes the following primers, wherein a sequence of an upstream primer martes-D-F is 5'-GCCCCATGCATATAAGCATGTACAT -3', and a sequence of a downstream primer martes-D-R is 5'- CCATTTGAAGGGTTAGTAGG -3', and 5' ends of the primer pair are respectively labeled for detection. The disclosure combines a high-sensitivity high-specificity method of a polymerase chain reaction in nucleic acid detection with an immunocolloidal gold rapid detection technology in immunological detection, designs a unique primer, marks the primer, performs specific amplification on an extracted target DNA, and combines an amplification product with a gold-labeled antibody fixed on a test strip in a developing solution to form stable and visible detection bands and quality control bands, thereby realizing rapid and accurate detection of martes-derived ingredients in food and feed. 1/2 1 2 3 4 5 6 7 FIG. 1 Blank Positive Negative Invalid FIG. 2 1 2 3 C T FIG. 3

Description

1/2

1 2 3 4 5 6 7

FIG. 1

Blank Positive Negative Invalid

FIG. 2

1 2 3 C T

FIG. 3

AUSTRALIA

Patents Act 1990

COMPLETE SPECIFICATION INNOVATION PATENT LATERAL FLOW TEST STRIP DETECTION KIT FOR DETECTING MARTES-DERIVED INGREDIENTS IN FOOD AND FEED AND APPLICATION THEREOF

The following statement is a full description of this invention, including the best

method of performing it

known to me:

LATERAL FLOW TEST STRIP DETECTION KIT FOR DETECTING MARTES-DERIVED INGREDIENTS IN FOOD AND FEED AND APPLICATION THEREOF TECHNICAL FIELD

[0001] The disclosure belongs to the fields of molecular biology and immunology,

and relates to PCR nucleic acid amplification of martes-derived DNA in food and feed,

and preparation and application methods of lateral flow immunocolloidal gold test

strip kit.

BACKGROUND

[0002] In order to prevent bovine spongiform encephalopathy (BSE) from being

spread through beefs and beef bones added into animal feed, the European Union in

1994 and the United States in 1997 formulated regulations prohibiting addition of a

ruminant-derived protein into ruminant feeds respectively. In 2000, the European

Union extended this prohibition to prohibit feeding processed mammalian, bird, and

fish protein ingredients to animals for food. The Administrative Measures on Safety

and Health of Animal-derived Feed Products promulgated by the Ministry of

Agriculture of China in 2004 stipulated that use of animal-derived feed products

(excluding milk and dairy products) in the ruminant feeds was prohibited, but a

phenomenon of artificially mixing meat and bone products of ruminants (mainly cattle

and sheep) in the animal feeds occurred from time to time.

[0003] In recent years, fake mutton, fake beef, and the like have emerged one after

another in the food markets at home and abroad, and people have increasingly

frightened by frequent occurrence of various food safety incidents such as adulteration

of animal-derived food. At the beginning of 2013, the "Horsemeat Scandal" in Europe

became more and more serious, which made consumers "turning pale at the mention

of a horse". After that, the Euramerican "Fishmeat Scandal" once again sounded the

alarm of food safety. To ensure the safety of food and feed, sensitive, convenient and accurate detection methods are needed to provide the basis,

[0004] Animal ingredients in traditional food and feed are mainly identified by

microscopic examination, protein detection-based immunological methods, and

various PCR methods based on nucleic acid detection. In recent years, a near infrared

reflectance spectroscopy (NIRS) detection method has also been developed. Various

animal-derived ingredients incorporated in food and feed ingredients are easy to be

destroyed during high-temperature treatment and processing, and protein sequences of

different species of animals are not much different and difficult to distinguish. The

inventive patent "Method for Identifying Animal-derived Ingredients in Meat and

Meat Products by Utilizing SDS-PAGE" (publication number: CN 102213720 A)

provides a method for identifying animal proteins of pigs, cattle, sheep, goose, and

fishes by performing SDS-PAGE on the proteins. However, electrophoresis bands of

proteins came from different sources and treated by different manners are different,

resulting in an obstacle to result determination, so that it is more difficult to identify

the animal ingredients in the feed.

[0005] Due to a degeneracy characteristic of a gene coding sequence and existence

of a non-coding sequence, a nucleic acid becomes a target molecule which is easier to

detect differences than a protein, especially a mitochondrial DNA, which has a high

copy number and a difference among species. Analysis of a different fragment thereof

is a main identification method, which develops rapidly due to high sensitivity, good

specificity, and less time consumption. Major methods include an ordinary/fluorescent

PCR method and a gene chip technology. When species identification is carried out

with a mitochondrial DNA sequence, commonly used regions include a Cytochrome b

gene (cytB) coding a cytochrome B, a coding sequence of a 12S ribosomal RNA (12S

ribosomal RNA), a coding gene coxI of a cytochrome C oxidase subunit I

(cytochrome C oxidase subunit I), atp8 and atp6 genes coding ATP8 and ATP6, and a

D-loop segment. Sequence variations of these regions are moderate, which not only

have a certain intraspecific conservative property, and but also show a certain

interspecific difference.

[0006] A fluorescence quantitative PCR technology is a highly sensitive nucleic acid

detection and quantification method, a basic principle of which is that a fluorescent

chemical substance is introduced in a real-time fluorescence quantitative PCR

reaction; with the progress of the PCR reaction, PCR reaction products are

accumulated continuously, and a fluorescence signal intensity is increased

proportionally. The fluorescence quantitative PCR technology makes qualitative

detection step up to a quantifiable level, and has the characteristics of a high

sensitivity, higher specificity and reliability, realization of multiple reactions, high

degree of automation, no pollution, real-time performance and accuracy, and the like.

Especially, a TaqMan method relying on probe combination has been widely used in

molecular biology research, medical research, and other fields. In an application

aspect of species identification, national standards or industry standards already

published in China cover mammals or aquatic organisms such as goose, sheep, deer,

camels, horses, donkeys, pigs, rabbits, dogs, fishes, and the like. The inventive patent

"Real-time Fluorescent PCR Detection Method of Martes-derived Ingredients in Food

and Feed" (publication number: CN101748216A) describes a method which can

select a gene sequence of a cytochrome b gene sequence of martes according to the

disclosure, design a set of specific primers and probes, use the primers and probes,

and adopt a real-time fluorescent PCR technology to detect the martes-derived

ingredients in the food and feed quickly, sensitively and specifically, with a main

purpose of preventing other animal-derived products from replacing the

martes-derived ingredients. A detection method for this purpose, for example, a

detection method in the invention "Multiplex PCR Rapid Detection Method for

Identifying Adulterated Meat and Products Thereof' with the publication number

CN103361422A, relates to a multiplex PCR rapid detection technology for rapidly

detecting whether the meat contains certain meat that is detected. The above methods

are all conventional PCR methods, which need to carry out image collection and

analysis after performing gel electrophoresis on the products, take a relatively long

time, and are difficult to ensure a detection sensitivity.

[0007] A detection efficiency of nucleic acid products can be effectively improved

by transplanting the immunological detection method to the nucleic acid product

detection. By labeling specific proteins or compounds with primers used in PCR

amplification, nucleic acid complexes including two compounds/proteins can be

introduced into the amplification products, and the labeled products can be detected

by antibodies or ligands in a manner similar to double antibody sandwich. This

process is similar to a conventional immunogold labeling detection technology. This

method has been used in single nucleotide polymorphism and isothermal

amplification of target genes, especially for identification of pathogenic

microorganisms or disease-related genes. The inventive patent "Nucleic Acid Cross

Flow Test Strip-based Method for Detecting Single Nucleotide Polymorphism" with

the publication number CN 102134596 A is used to detect the single nucleotide

polymorphism by using this method. The inventive patent "Listeria Monocytogenes

Nucleic Acid Chromatography Detection Kit and Detection Method and an

Application Thereof' with the publication number CN 102520172 A describes a

listeria monocytogenes genome detection method using biotin and digoxin labeled

primers respectively. Therefore, these methods only judge existence of the

amplification products, and do not confirm molecular weights of the products.

Therefore, there are more interference factors in the amplification reaction. The

common causes for false positives include: nonspecific amplification, primer dimers,

and abnormal renaturation between the amplification products. An interference caused

by the primer dimers and the abnormal annealing may be solved by selection of a

PCR polymerase, optimization of a primer sequence, a dNTP substrate, control of a

hybridization process, and other aspects. Formation of the primer dimers and the

nonspecific amplification products can be obviously reduced by selecting a DNA

polymerase with a Hot-start (Hot-start) function. In the aspect of primer optimization,

the inventive patent "Method for Reducing Dimers of Pair of Partially Homologous

Primers" with the publication number CN 102146432 A describes a primer design

method with a short palindrome sequence at a 5' end of a primer, wherein the primer is self-cyclized at a normal temperature to avoid forming a heterodimer, and a similar method is also used in the inventive patent "Real-time Fluorescence Quantitative PCR

Kit for Detecting HER2 Gene Expression Level" with the publication number CN

102719547 A for real-time quantitative PCR amplification. The inventive patent

"Chimeric Primer Used for Reducing Formation of Heterodimer" with the publication

number CN 101842494 A describes a method for amplifying with the chimeric primer.

In the optimization of the reaction substrate, the inventive patent "3' Modified

Oligonucleotides Containing Pseudoisocytosine Nucleobase Derivatives and

Applications thereof as Primers or Probes" with the publication number CN

101171343 A provides a method of using a specially modified nucleotide as a

substrate to reduce the formation of the primer dimer, and the interference of the

nonspecific amplification can also be reduced by using a probe or introducing an

internal control probe. The inventive patent "Method for Semi-quantitatively

Detecting Pathogenic Nucleic Acid by Adding Internally Piloting Nucleic Acid" with

the publication number CN 101957373 A is to use the internally piloting probe to

reduce the interference. In the above methods, the hot-start technology and the

cyclized primer are general methods. The rest methods either use specially

synthesized substrates or need to introduce a second hybridization process through a

probe, which may increase a complexity of the detection process. Especially, the

probe hybridization method loses convenience of the strip method since a heat

preservation process is needed.

[0008] A nucleic acid molecule labeled with a biological micromolecule or

compound may be specifically recognized by an antibody of the micromolecule or

compound, and thus detected by an immunological method. Common molecules that

may be used for nucleic acid molecular labeling include hapten molecule biotin

(Biotin) and digoxin (Digoxin), fluorescent dye molecule rhodamine (RBITC),

fluorescein isothiocyanate (fluorescein isothiocyanate, FITC), Cy3, Cy5, or the like.

In the above labeled molecules, both the digoxin and the fluorescein isothiocyanate

are easy to obtain specific antibodies, while the biotin molecule has a highly specific binding characteristic with a ligand-streptavidin thereof, so these molecules can be selected for nucleic acid molecule labeling and immunological detection. In the primer design of the disclosure, on the basis of maintaining the specificity, annealing free energy in the primer pairs and at 5' and 3' ends in the primers is evaluated, and then appropriate regions are selected to avoid the formation of the dimer. Aiming at the interference situation of the dimer in the strip detection method, the primer dimer and the nonspecific amplification products may be effectively eliminated by an appropriate amplicon length cooperated with concentration optimization of a detergent and a denaturant in a buffer.

SUMMARY

[0009] The disclosure aims to use a single-stranded oligonucleic acid labeled by an antigen or hapten micromolecule as a primer to specifically amplify a target nucleic acid to be detected, and a formed complex molecule has two antigen or hapten markers at the same time. The complex is immunogenic, and may be combined with a specific antibody or specific ligand to realize immunocolloidal gold detection of a nucleic acid amplification product.

[0010] The technical solution for realizing the objectives of the disclosure is as follows:

[0011] A detection kit for detecting martes-derived ingredients in food and feed by a test strip method includes the following primers, wherein a sequence of an upstream primer martes-D-F is 5'- GCCCCATGCATATAAGCATGTACAT -3', and a sequence of a downstream primer martes-D-R is 5' CCCATTTGAAGGGTTAGTAGG -3', and 5'ends of the primer pair are respectively labeled for detection.

[0012] In addition, ingredients of the kit buffer are: 10 mM Tris, 1% BSA, 1% Tween 20 and NaOH with concentrations of 0.05 mol/L to 0.5 mol/L respectively.

[0013] Moreover, the kit includes colored particles which are colloidal gold particles or latex particles, and a fiber membrane of the kit is a nitrocellulose membrane or a nylon membrane.

[0014] Moreover, the primer pair is labeled by two different methods from a biotin

molecule (Biotin), a fluorescein isothiocyanate (FITC) or a digoxin (Digoxin).

[0015] In addition, reaction conditions of the kit are: pre-denaturation at 95°C for 5

min and denaturation at 94°C for 30 sec; annealing at 55°C for 30 sec; extension at

72°C for 30 sec, amplification for 30 cycles, and finally extension at 72°C for 5 min.

[0016] The disclosure provides an application of the detection kit for detecting

martes-derived ingredients in food and feed by a test strip method in amplification of

martes-derived ingredients in food and feed and detection by an immunocolloidal gold

technology.

[0017] A detection method for detecting martes-derived ingredients in food and feed

by a test strip method mainly includes:

[0018] (1) designing two unique amplification primers, wherein a forward primer

martes-D-F has the following sequence of 5'

GCCCCATGCATATAAGCATGTACAT -3', which is labeled with one of an antigen

or hapten molecule biotin (Biotin), a fluorescein isothiocyanate (FITC) or a digoxin

(Digoxin); a sequence of a downstream primer martes-D-R is 5'

GCCCCATGCATATAAGCATGTACAT -3', which is labeled in a different form

from the upstream primer; under suitable amplification conditions, a DNA segment

with a length of 238 bps in a D-loop region of a martes mitochondrial genome may be

amplified; and in the presence of a detected nucleic acid template, a specific nucleic

acid segment amplification product does not exist;

[0019] (2) cross-linking a standard universal antibody, such as an anti-FITC

antibody, with a colloidal gold particle to form a coated antibody on a surface of the

particle;

[0020] (3) fixing an antibody or ligand of another labeled molecule, such as a

digoxin antibody or a ligand-streptavidin molecule of a biotin molecule, on a

membrane in a linear shape to form a detection line;

[0021] (4) in the presence of a specific amplification product to be detected, due to the action of the upstream and downstream primers, carrying, by the amplification product, two of the above three labels at the same time to form a complex of labeled molecule 1-amplification product-labeled molecule;

[0022] (5) combining the label 1-amplification product-label 2 formed in step (4)

with the antibody of the label 1 coated on the surface of the colloidal gold particle to

form a colored particle complex of anti-label 1 antibody-amplification product-label

2;

[0023] (6) flowing upwards the colored particle complex obtained in step (5) along a

fiber membrane to the line coated with the antibody or ligand of the label 2 through

capillary phenomenon in a solution, wherein the complex is deposited due to the

combination with the antibody (ligand) of the label 2, and stays on the detection line

to form a colored line visible to a naked eye, which is judged as positive; and

[0024] (7) when no specific amplification product exists, the above steps (4) to (6)

doing not occur, and a complex of label1-amplification product-label 2 being

incapable of being formed, and being incapable of being deposited on the antibody

(ligand) of the label 2 on the detection line, and no visible band being formed, which

is judged as negative.

[0025] According to another aspect, the disclosure further provides a developing

solution for detecting a nucleic acid sequence, wherein the developing solution can

reduce interference of a primer dimer on experimental results.

[0026] According to another aspect, the disclosure provides a test strip for rapidly

detecting martes-derived ingredients in food and feed, which includes a pad with an

adhesive sticker and sequentially includes: 1. a water absorbing filter paper pad; 2. a

conjugate pad, attached with chromogenic particles (colloidal gold or latex) of an

antibody or ligand of the first nucleic acid label; 3. a lateral chromatography matrix

(nitrocellulose membrane or nylon membrane); 4. a detection band attached with an

antibody of the second nucleic acid label; 5. a quality control band attached with an

antibody that can bind to an antibody from specific species; 6. a substrate; and 7. an

absorbent pad.

[0027] According to another aspect, the disclosure further provides a universal

standard test strip for detecting a nucleic acid amplification product.

[0028] Finally, the disclosure further provides applications of the detection method

and the test strip mentioned above in detecting martes-derived ingredients in food and

feed.

[0029] The beneficial effects of the disclosure are as follows:

[0030] The disclosure uses the labeled specific primers to amplify the gene segments

with appropriate length, the high specificity of detection can be ensured, thus ensuring

the accuracy of the detection results. The disclosure has the novelties of avoiding the

processes of amplification product dilution and probe hybridization, keeping the

advantages of immunocolloidal gold (test strip) technology, such as intuition, rapidity,

convenience, maturity and low price, and has the characteristics of high sensitivity

and high specificity of the PCR amplification method; therefore, the method of the

disclosure is an effective method for detecting martes-derived animal ingredients.

[0031] Asa general technical platform for detecting nucleic acid amplification

products, the method and the test strip according to the disclosure can be widely used

for the identification of animal-derived components in feed and the detection of

food-derived pathogenic microorganisms, and have wide application prospects in

agriculture and animal husbandry as well as customs inspection and quarantine. At

present, although there are many PCR-based methods for identification of

animal-derived ingredients, the primer design and product segments thereof are

suitable for a probe method or gel electrophoresis, but there is no necessary

consideration for reducing the primer dimers and removing nonspecific renaturation

interference in the colloidal gold test strip method, and the solutions are not applicable.

The disclosure aims at providing the PCR primer as well as the amplification and

detection method for detecting the martes-derived animal ingredients based on the

immunocolloidal gold method, and the application of the method. Other common

species, such as sheep, pigs, cattle, donkeys, rabbits, camels, sheep, chicken, ducks

and deer, can be identified by using similar methods.

[0032] The invention of the nucleic acid test strip detection method will greatly

simplify the detection procedure after nucleic acid amplification. Results are simple,

clear and intuitive to interpret (see FIG. 2 for the schematic detection results).

[0033] As a new detection technology after nucleic acid amplification, the rapid

detection technology of the martes-derived ingredients in food and feed by a test strip

applied in this patent has the following advantages:

[0034] simple operation: only the sample after nucleic acid amplification needs to be

directly dropped on a nucleic acid reagent detection plate, which does not require

professional operation and is convenient for popularization;

[0035] rapid: the results are interpreted after 5 minutes of detection;

[0036] sensitive: compared with agarose gel electrophoresis, the detection sensitivity

is improved by nearly 100 to 200 times;

[0037] high specificity: because specific labeled primers are used in the detection

process, the results are more accurate; and

[0038] cheap price: the cost is much lower than the traditional gel electrophoresis

and ELISA detection.

BRIEF DESCRIPTION OF THE DRAWINGS

[0039] FIG. 1 shows a basic structure of a test strip for detecting a nucleic acid

sequence amplification product according to the disclosure;

[0040] FIG. 2 is a schematic diagram of detection results of the test strip for nucleic

acid detection;

[0041] FIG. 3 shows detection results of a PCR-test strip for detecting martes

ingredients by using specific labeled primers with a method according to Embodiment

1;

[0042] FIG. 4 shows detection results of a specific PCR-test strip for detecting

martes-specific labeled primers by a method according to Embodiment 2; in FIG. 4-1,

M refers to DNA marker; and 1 to 18 refer to blank control, chicken, goose, quail, dog,

pig, horse, cow, buffalo, sheep, donkey, deer, camel, rabbit, duck, carrot, cabbage and martes; in FIG. 4-2, 1 refers to blank control; and 2 to 18 refer to martes, chicken, goose, quail, dog, pig, horse, cow, buffalo, sheep, donkey, deer, camel, rabbit, duck, carrot and Chinese cabbage; and

[0043] FIG. 5 shows results of sensitivity comparison between the test strip after

nucleic acid amplification and a gel electrophoresis detection method by using the

method according to Embodiment 2.

DETAILED DESCRIPTION

[0044] The following embodiments illustrate the detection method of the disclosure

and the detection effects thereof. The embodiments are only for illustration, and do

not constitute any limitation on the protection scope of the disclosure, and the

protection scope of the disclosure is stated in the appended claims.

[0045] Embodiment 1

[0046] 1 Material and method

[0047] Mitochondrial DNA of martes

[0048] 1.2 Primer design

[0049] 1.3 PCR amplification system:

[0050] Template DNA: Mitochondrial DNA of martes 1.0 1

[0051] PrimerF/R 0.8 1

[0052] dNTP 2.0 1

[0053] 1OX PCRbuffer 2.0 1

[0054] HS Taq DNA polymerase 0.2 1

[0055] ddH20 13.2 1

[0056] Total volume 20 1

[0057] Reaction conditions:

[0058] 95°C 5 min

[0059] 94°C 30 sec

[0060] 55°C 30 sec

[0061] 72°C 30 sec

[0062] 72°C 5 min

[0063] 30 cycles in total

[0064] 5 pl was respectively taken for nucleic acid test strip detection at the same

time, then 5 1 of amplification product was taken, and added to 95 1 of developing

solution and detected on a sample pad, and the results were observed after 5 minutes.

[0065] 1.4 PCR specificity experiment

[0066] An established PCR reaction system was used to verify specificity of I to 18:

blank control (water), chicken, goose, quail, dog, pig, horse, cow, buffalo, sheep,

donkey, deer, camel, rabbit, duck, carrot, cabbage and martes.

[0067] 2 Results

[0068] 2.1 PCR reaction system and conditions

[0069] HS Taq DNA polymerase from TaKaRa Company was used, and the total

reaction system was 20 d. A Bio-Rad PCR amplifier was used for detection, wherein

reaction parameters were as follows: amplified at 94°C for 5 min, 94°C for 30 s, 55°C

for 30 s, 72°C for 30 s, then transferred to 72°C for 5 min and stored at 4°C after 30

cycles. 5 l of the product was taken for electrophoresis in 2% agarose gel

electrophoresis containing ethidium bromide, and the presence or absence of specific

bands was judged after electrophoresis. Detection results of the test strip after nucleic

acid amplification and the gel electrophoresis were shown in FIG. 4.

[0070] 2.2 Specificity experiment

[0071] The PCR method established according to the disclosure had better

specificity to martes genomic DNA, and had no cross reaction to other mammals and

poultries.

[0072] Embodiment 2

[0073] Sensitivity of nucleic acid test strip detection method: martes meat/beef

mixed simulation samples were prepared, mixed evenly according to a mass

percentage (W/W) of martes meat powder as 100%, 50%, 25%, 10%, 5%, 1%, 0.1%,

0.01%, and 0.001%, then genomic DNA was extracted, and a DNA concentration was

adjusted to ng/ l, and amplification was carried out according to the established PCR system.

[0074] 1 Material and method

[0075] Mitochondrial DNA of martes

[0076] 1.2 Primer design

[0077] 1.3 PCR amplification system:

[0078] Template DNA: Plasmid DNA 10 1

[0079] Upstream primer 0.8 1

[0080] Downstream primer 0.8 1

[0081] dNTP 2.0 1

[0082] 1OX PCRbuffer 2.0 1

[0083] HS Taq DNA polymerase 0.2 1

[0084] ddH20 4.2 1

[0085] Total volume 20 1

[0086] Reaction conditions:

[0087] 95°C 5 min

[0088] 94°C 30 sec

[0089] 57°C 30 sec

[0090] 72°C 30 sec

[0091] 72°C 5 min

[0092] 30 cycles in total

[0093] 5 pl was respectively taken for agarose gel electrophoresis. Gel

electrophoresis conditions were: IX TBE buffer, a voltage of 100 V, and an

electrophoresis time of 30 min. 5 1 was respectively taken for nucleic acid test strip

detection at the same time, then 5 1 of sample points was taken to a sample pad, and

added to 95 1 of developing solution for detection, and the results were observed

after 5 minutes.

[0094] 2 Results

[0095] 2.1 PCR reaction system and conditions

[0096] HS Taq DNA polymerase from TaKaRa Company was used, and the total reaction system was 20 d. A Bio-Rad PCR amplifier was used for detection, wherein reaction parameters were as follows: amplified at 94°C for 5 min, 94°C for 30 s,

56.5°C for 30 s, 72°C for 80 s, then transferred to 72°C for 5 min and stored at 4°C

after 30 cycles. 5 1 of the product was taken for electrophoresis in 2% agarose gel

electrophoresis containing ethidium bromide, and the presence or absence of specific

bands was judged after electrophoresis. results of sensitivity comparison between test

strip after nucleic acid amplification and the gel electrophoresis were shown in FIG. 5.

It can be seen from the results in FIG. 5 that the sensitivity is increased by more than

10 to 102 times in comparison to the traditional gel electrophoresis.

[0097] Technical terms used in the specification of the disclosure are explained as

follows:

[0098] Primer: an initiator of DNA synthesis, refers a pair of single-stranded

oligonucleotide generally, and the DNA synthesis starts from a 3' end of the primer

after hybridization with a template.

[0099] Labeling: refers to a method of coupling a detectable signal molecule (such

as hapten, fluorescence, radioactivity) with the single-stranded oligonucleotide.

[00100] Hybridization: particularly refers to the formation of a double-stranded

structure by base pairing of complementary DNA single strands.

[00101] Expansion: refers to a process that a PCR product after amplification reaction

moves from a bottom end of the absorbent bed of the test strip to the detection line

and the quality control line under the chromatographic action of an expansion buffer.

[00102] Nucleic acid: refers to a general term of a deoxyribonucleic acid (DNA) and

a ribonucleic acid (RNA).

[00103] Antigen and haptin: refer to substances with immunogenicity, and usually

refer to macromolecular proteins or cellular ingredients. However, some

micromolecules also have immunogenicity, which are called Hapten (Hapten). The

haptin is often used to label probes.

[00104] Antibody: refers to a protein molecule that can specifically bind to an antigen

or a hapten.

[00105] Complex: refers to a conjugate specifically combined by two or more

molecules.

[00106] Primer dimer: refers to a dimer molecule formed by annealing between

primer pairs or annealing of a single primer during the process of a polymerase chain

reaction (PCR), wherein a dimer formed by two different primers is a heterodimer,

which may be bond with an antibody (ligand) by carrying two labels to possibly cause

false positive. A dimer formed by annealing of a single primer is a homodimer, which

only carries one label without causing false positive, but excessive dimer formation

will reduce the amplification efficiency.

[00107] Immune test strip: refers to a medical tool for rapid detection, which is also

known as chromogenic thin film chromatography.

[00108] Nucleic acid polymerase: refers to an enzyme that synthesizes long nucleic

acid chains, which is divided into a DNA polymerase and an RNA polymerase.

Claims (7)

The claims for defining the invention are as follows:

1. A detection kit for detecting martes-derived ingredients in food and feed by a test

strip method, comprising the following primers, wherein a sequence of an upstream

primer martes-D-F is 5'-GCCCCATGCATATAAGCATGTACAT -3', and a sequence

of a downstream primer martes-D-R is 5'-CCCATTTGAAGGGTTAGTAGG -3', and

' ends of the primer pair are respectively labeled for detection.

2. The detection kit for detecting martes-derived ingredients in food and feed by a

test strip method according to claim 1, wherein ingredients of the kit buffer are 10

mM Tris, 1% BSA, 1% Tween 20 and NaOH with concentrations of 0.05 mol/L to 0.5

mol/L respectively.

3. The detection kit for detecting martes-derived ingredients in food and feed by a

test strip method according to claim 1, wherein the kit comprises colored particles

which are colloidal gold particles or latex particles, and a fiber membrane of the kit is

a nitrocellulose membrane or a nylon membrane.

4. The detection kit for detecting martes-derived ingredients in food and feed by a

test strip method according to claim 1, wherein the primer pair is labeled by two

different methods from a biotin molecule (Biotin), a fluorescein isothiocyanate (FITC)

or a digoxin (Digoxin).

5. The detection kit for detecting martes-derived ingredients in food and feed by a

test strip method according to claim 1, wherein reaction conditions of the kit are

pre-denaturation at 95°C for 5 min and denaturation at 94°C for 30 sec; annealing at

°C for 30 sec; extension at 72°C for 30 sec, amplification for 30 cycles, and finally

extension at 72°C for 5 min.

6. An application of the detection kit for detecting martes-derived ingredients in food and feed by a test strip method according to claim 1 in amplification of martes-derived ingredients in food and feed and detection by an immunocolloidal gold technology.

7. A detection method for detecting martes-derived ingredients in food and feed by a test strip method, comprising the following steps of: (1) designing two unique amplification primers, wherein a forward primer martes-D-F has the following sequence of 5'- GCCCCATGCATATAAGCATGTACAT -3', which is labeled with one of an antigen or hapten molecule biotin, a fluorescein isothiocyanate or a digoxin; a sequence of a downstream primer martes-D-R is 5' CCCATTTGAAGGGTTAGTAGG -3', which is labeled in a different form from the upstream primer; under suitable amplification conditions, a DNA segment with a length of 238 bps in a D-loop region of a martes mitochondrial genome may be amplified; and in the presence of a detected nucleic acid template, a specific nucleic acid segment amplification product does not exist; (2) cross-linking a standard universal antibody, such as an anti-FITC antibody, with a colloidal gold particle to form a coated antibody on a surface of the particle; (3) fixing an antibody or ligand of another labeled molecule, such as a digoxin antibody or a ligand-streptavidin molecule of a biotin molecule, on a membrane in a linear shape to form a detection line; (4) in the presence of a specific amplification product to be detected, due to the action of the upstream and downstream primers, carrying, by the amplification product, two of the above three labels at the same time to form a complex of labeled molecule 1-amplification product-labeled molecule; (5) combining the label 1-amplification product-label 2 formed in step (4) with the antibody of the label 1 coated on the surface of the colloidal gold particle to form a colored particle complex of anti-label 1 antibody-amplification product-label 2; (6) flowing upwards the colored particle complex obtained in step (5) along a fiber membrane to the line coated with the antibody or ligand of the label 2 through capillary phenomenon in a solution, wherein the complex is deposited due to the combination with the antibody (ligand) of the label 2, and stays on the detection line to form a colored line visible to a naked eye, which is judged as positive; and

(7) when no specific amplification product exists, the above steps (4) to (6) doing

not occur, and a complex of label 1-amplification product-label 2 being incapable of

being formed, and being incapable of being deposited on the antibody (ligand) of the

label 2 on the detection line, and no visible band being formed, which is judged as

negative.

1/2 03 Mar 2021

FIG. 1 2021100416

FIG. 2

1 2 3 C T

FIG. 3

2/2 03 Mar 2021

4-1 2021100416

4-2

FIG. 4

FIG. 5

Nucleotide sequence list

1. A sequence of martes-D-loop-F/R is: GCCCCATGCATATAAGCATGTACATACTATGCTTGACTTTGCATTCGTGCACT TCACTTAGATCACGAGCTTAATCACCAAGCCTCGAGAAACCATCAACCCTT 2021100416

GCCCGATGTGTACCTCTTCTCGCTCCGGGCCCATAACATGTGGGGGTTTCTA GACTGAAACTATACCTGGCATCTGGTTCTTACTTCAGGGCCATGAAAGTCCT CAATCCAATCCTACTAACCCTTCAAATGGG

2. A sequence of an upstream primer martes-D-F is: 5′- CCCCATGCATATAAGCATGTACAT -3′,

3. A sequence of a downstream primer martes-D-R is: 5′- CCCATTTGAAGGGTTAGTAGG -3′