CN103805691A - Preparation method and application of nucleic acid lateral flow test strip for detecting Shigella - Google Patents
Preparation method and application of nucleic acid lateral flow test strip for detecting Shigella Download PDFInfo
- Publication number
- CN103805691A CN103805691A CN201310361652.3A CN201310361652A CN103805691A CN 103805691 A CN103805691 A CN 103805691A CN 201310361652 A CN201310361652 A CN 201310361652A CN 103805691 A CN103805691 A CN 103805691A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- test strip
- detection
- primer
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a rapid nucleic acid test strip detection kit for detecting food-borne pathogenic microorganism Shigella flexneri and an application method thereof, and belongs to the fields of molecular biology and immunology. A preparation method of the rapid nucleic acid test strip detection kit comprises the following steps: combining high sensitivity of polymerase chain reaction in a nucleic acid test, a high-specificity method and an immunity colloid gold rapid detection technology in immunological detection, marking a unique designed primer, carrying out specific amplification on an extracted target DNA (deoxyribonucleic acid), and combining an amplification product and a gold labeling antibody fixed on a test strip in a developing solution, thus forming a detection band and a quality control band which are stable and visible. The rapid nucleic acid test strip detection kit can be used for realizing rapid and accurate detection of main food-borne pathogenic microorganisms.
Description
Technical field
The invention belongs to molecular biology and field of immunology, relate to food and the methods for making and using same of the nucleic acid amplification product lateral flow immunity colloidal gold test paper strip test kit of the middle shigella flexneri that processes raw material.
Background technology
For effectively controlling the food origin disease causing because of invasive organism in foodstuff production and foreign trade, guarantee the public safety of field of food, need to develop sensitive, convenient, food borne pathogenic microorganism detection method accurately.In food origin disease Hazard Factor, in the popular food origin disease of China, microorganism property food poisoning ranks first place, and in food borne pathogenic microorganism wherein most typical pathogenic bacterium be Shigellae, Enterobacter sakazakii, Staphylococcus aureus, Listeria monocytogenes, Escherichia coli O 157: the pathogenic bacterias such as H7.Shigellae is gram-positive microorganism, be distributed widely in nature or parasitize human body and animal body surface and body in, the virulence of streptococcus aureus is strong, often can cause the inflammation of skin, tissue and organ, and the enterotoxin of generation can cause food poisoning by contaminated food.
In traditional foodstuff production, quality surveillance and import and export inspection and quarantine, conventional microbial culture and authentication method, checking procedure is loaded down with trivial details, and round of visits is long, some bacterium cannot be provided fast and accurately and be identified, can not meet the requirement of quality control and import and export inspection and quarantine completely.Method detected object based on nucleic acid amplification is the DNA from pathogenic micro-organism, after specific amplification, carry out Product Identification, these class methods are because of highly sensitive, specificity is good, less consuming time and development rapidly, main method comprises common/fluorescent PCR and nucleic acid ring mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP) (patent of invention: the LAMP test kit of rapid detection Shigellae, publication number: CN102851382) method.Conventional PCR needs electrophoresis detection, bothersome longer, PCR product is carried out to also comprising of non-electrophoresis analytical method PCR product is carried out to dhplc analysis (denaturing high performance liquid chromatography, DHPLC) patent of invention " Salmonellas and Shigellae detection kit and detection method thereof in feed " (publication number: CN101624624A) and the detection method (" a kind of rapid identification method of food-borne pathogens ", publication number: CN101875967A) of tetra-sodium sequencing analysis.That fluorescent quantitative PCR technique has is highly sensitive, specificity and reliability stronger, can realize that multiple reaction, level of automation are high, nonstaining property, there is the feature such as real-time and accuracy, particularly rely on the TaqMan method of probe combination, be widely used at present the field such as molecular biology research and medical research.Existing multiple patents provide different detection methods, and method (patent of invention " the Shigellae detection primer detecting from single culture, detection method, detection kit ", publication number: CN101153326 " Oligonucleolide primers of employing fluorescent quantitative PCR technique detection common pathogen and the method for detection common pathogen thereof and purposes ", publication number: CN101928773) recheck development to many bacterial classifications, as the publication number patent of invention that is CN102260740 " Salmonellas/Shigellae double fluorescent PCR detection kit ", publication number is that patent of invention " three kinds of multiple fast detection methods of food-borne pathogens and detect primer sets and test kit " and " quadruple fluorescent quantificationally PCR detecting kit and purposes " (publication number: CN102212618) of CN102206703 provides respectively double, triple and quadruple fluorescence PCR detecting method.More high-throughout detection method has comprised suspending chip and film/slide method for gene chip, as the publication number patent of invention " a kind of method for detecting Shigella sonnei by using suspension chip technology " that is CN101440404, patent " 13 kinds of pathogenic micro-organisms detection method simultaneously and rapidly in the water body of gene based on gene chip " that publication number is CN102827795 and patent of invention " for detection of gene chip and the test kit thereof of important pathogenic bacteria in fishery products " (CN102311993) provide respectively suspension and solid phase chip detection method.Real-time quantitative PCR and chip detection are strong to device dependence, are difficult to realize Site Detection.
Another kind of detection method is the immunological detection method based on double-antibody sandwich, its detected object is mainly protein molecule, the object that competition law detects is micromolecular compound and hapten molecule, these two kinds of immunological detection methods can be realized by the method for immunity colloidal gold test paper strip, it is the ordinary method of rapid detection, have advantages of quick, simple, with low costly, the patent of invention " Shigellae detection method and golden label fast diagnosis reagent box thereof and preparation method " that publication number is CN102135537 is these class methods.The above-mentioned antigen of immunology detection Main Basis of past pathogenic micro-organism and the association reaction of antibody, with Enzyme-linked Immunosorbent Assay (ELISA) method or immune colloid gold colloidal gold strip or complete detection.In immune colloid gold detects, utilize the feature of the specific binding of antigen and antibody, form antigen one antibody one coloured particle mixture and be enriched on coated line, form macroscopic coloured precipitation line, the detection of albumen is relied on to the acquisition of high-affinity and antibody with high specificity, in the time that pathogen is analyzed because rule and the degeneracy rule of genes encoding, DNA is easier to produce sequence difference compared with protein, this species diversity is also easier to accurately detect, detect the detection efficiency that can effectively improve nucleic acid product by the method for immunology detection being transplanted in nucleic acid product, just can realize the immunology detection of double-stranded product by introduce special marker in pcr amplification primer.
As mentioned above, can in its amplified production, introduce by the specific protein of primer mark or compound that pcr amplification is used the nucleic acid complexes that simultaneously comprises two kinds of compound/protein labelings, the product of this mark can detect in the mode of similar double-antibody sandwich by antibody or part, the immuno-gold labeling detection technique of the similar routine of this process, this method is used in the method for single nucleotide polymorphism and constant-temperature amplification target gene, publication number is that a kind of patent of invention-method based on nucleic acid transverse flow ELISA test strip single nucleotide polymorphism of CN 102134596 A carries out the detection of single nucleotide polymorphism with this method.And publication number is patent of invention-mono-increasing listeria spp nucleic acid chromatography detection kit of CN 102520172 A and detection method thereof and application, a kind of Listeria monocytogenes detection method that adopts respectively vitamin H and digoxigenin labeled primer is described.Therefore class methods only judge having or not of amplified production, the molecular weight of product is not confirmed, therefore the interfering factors in amplified reaction is more more, the common false-positive reason that causes comprises: the abnormal renaturation between non-specific amplification, primer dimer, amplified production, the interference that solution primer dimer, abnormal annealing cause can be carried out from the several aspects of control of the selection of PCR polysaccharase, primer sequence optimization, dNTP substrate, crossover process.The archaeal dna polymerase that selection has warm start (Hot-start) function can obviously reduce the formation of primer dimer and non-specific amplification product.Aspect primer optimization, publication number is that patent of invention-" a pair of part reduces its dimeric method with order primer " of CN 102146432 A described a kind of primer design method of holding with short palindromic sequence at primer 5 ', recirculation under this primer normal temperature, avoid forming heterodimer, publication number is that patent of invention-" detecting the real-time fluorescence quantitative PCR reagent of HER2 gene expression dose " of CN 102719547 A also adopted the amplification of similar method for real-time quantitative PCR, publication number is that patent of invention-" using chimeric primers to reduce heterodimer forms " of CN 101842494 A described a kind of method that uses chimeric primers to increase, in to the optimization of reaction substrate, the patent of invention of publication number CN 101171343A " contain the close institute of false different cytostome nucleobase derivatives 3 ' modify few core former times acid and the application as primer or probe thereof " a kind of method that uses the Nucleotide of special modification to form to reduce primer dimer as substrate is provided, use probe or introduce internal control probe the interference that also can reduce non-specific amplification, publication number is that a kind of patent of invention-" method that adds internal control nucleic acid pathogen nucleic acid to be carried out to half-quantitative detection " of CN 101957373 A adopts internal control probe to reduce interference, in aforesaid method, using warm start technology and cyclisation primer is current method, all the other methods or adopted special synthetic substrate and substrate, or need to introduce crossover process for the second time by probe, capital increases the complexity of testing process, particularly probe hybridization method, because needing insulating process to lose the convenience of test strip method.
In design of primers of the present invention, keeping on specificity basis, to in primer pair and primer 5 ' and the free energy of 3 ' end annealing assess rear selection dimeric formation avoided in suitable region, for the dimeric disturbed condition of ELISA test strip method with suitable amplicon length, in cooperation expansion damping fluid, the concentration optimization of stain remover and denaturing agent, can realize effective removing of primer dimer and non-specific amplification product.
Summary of the invention
The nucleic acid molecule of biological micromolecule or compound mark can be identified by the antibodies specific of this small molecules or compound, thereby detect by immunological method.The common molecule that can be used for labeled nucleic acid molecule comprises hapten molecule vitamin H (Biotin), digoxin (Digoxin), luminescent dye molecule rhodamine (RBITC), fluorescein isothiocyanate (fluorescein isothiocyanate, FITC), Cy3, Cy5 etc.In above-mentioned tagged molecule, digoxin, fluorescein isothiocyanate are all easy to obtain special antibody, and biotin molecule and its part-streptavidin have the binding characteristic of high special, therefore these several molecules can be selected mark and the immunology detection for nucleic acid molecule.The present invention is intended to using few to antigen or haptens small molecules mark strand nucleic acid as primer, to target nucleic acid specific amplification to be checked, the complex molecule forming possesses two kinds of antigens or hapten-marked simultaneously, immunogenic, this mixture is to be availablely combined with specific antibody or sepcific ligands, and the immune colloid gold of realizing nucleic acid amplification product detects.
Therefore, on the one hand, the invention provides a kind of test strip method detect food borne pathogenic microorganism-shigella flexneri (
shigella flexneri) detection technique,, mainly comprise:
1) two unique amplimers of design, wherein forward primer ipaH-F has following sequence: 5'-GAATGGGATGATTGGGAGAAAC-3', with a kind of mark in antigen or hapten molecule vitamin H (Biotin), fluorescein isothiocyanate (FITC) or digoxin (Digoxin); The sequence of downstream primer ipaH-R is 5'-TGAAGGCAGTGTGGATAACC-3', to be different from a kind of mark of upstream primer; Under suitable amplification condition, the segment length that can increase is the DNA fragmentation of 370 bps; When without tested nucleic acid-templated existence, without specific nucleic acid fragment amplification product;
2) by a kind of universal antibody of standard, as crosslinked in anti-FITC mAb and colloid gold particle, form coated antibody at particle surface;
3) by the antibody of another kind of tagged molecule or part, as part-streptavidin molecule of anti digoxin antibody or biotin molecule is fixed on and forms detection line on film with linear;
4), in the time there is specific amplification products to be checked, because of the effect of upstream and downstream primer, in amplified production, simultaneously with two kinds of above-mentioned three kinds of mark species, form the mixture of tagged molecule 1-amplified production-tagged molecule 2;
5) by step 4) the mark 1-amplified production-mark 2 forming and the antibodies of the mark 1 of colloid gold particle pan coating, form anti-mark 1 antibody-mark 1-amplified production-mark 2 coloured particle mixtures;
6) by step 5) the coloured particle mixture that obtains travels up to and is coated with on the antibody of mark 2 or the lines of part along tunica fibrosa by capillarity in solution, mixture is because depositing with antibody (part) combination of mark 2, be trapped on detection line, form macroscopic colored line, be judged to be the positive; Or
7) in the time that specific amplification products does not exist, there is not above-mentioned steps 4)-6), can not form mark 1-amplified production-mark 2 mixtures, also just can not shape be deposited on the antibody (part) of mark 2 on detection line, do not form visible band, be judged to feminine gender.
On the other hand, the present invention also provides the developping solution detecting for nucleotide sequence, and this developping solution can reduce the interference of primer dimer to experimental result;
On the other hand, the invention provides the test strip for the rapid detection of food borne pathogenic microorganism, the liner that it is included in non-setting adhesive, has in order: 1: absorbent filter pad; 2: binding substances pad, with the antibody of the first nucleic acid markers or the particle that adds lustre to of part (Radioactive colloidal gold or latex); 3: lateral chromatography matrix (nitrocellulose filter or nylon membrane); 4: detect band, with the antibody of the second nucleic acid markers; 5: quality control band, having can be in conjunction with the antibody of specific Species origin antibody; 6: substrate; 7: absorbent pad.
On the other hand, the present invention also provides the universal standard test strip for detection of nucleic acid amplification product.
Finally, the present invention also provides above-mentioned detection method and the purposes of test strip in shigella flexneri detects.
The explanation of technical terms using in specification sheets of the present invention:
The initiator that primer: DNA is synthetic.Be generally the general acid of the few core of a pair of strand, after hybridizing with template, DNA is synthetic from its 3 ' end.
Mark: by detectable signaling molecule (as haptens, fluorescence, the radioactivity etc.) method mutually coupled with single stranded oligonucleotide.
Hybridization: refer in particular to complementary DNA single chain and form duplex structure by base pairing.
Launch: under the chromatography effect of expansion damping fluid, start by test strip absorbent pad bottom the process moving to detection line, nature controlling line direction through the PCR of amplified reaction product.
Nucleic acid: the common name of thymus nucleic acid (DNA) and Yeast Nucleic Acid (RNA).
Antigen and haptens: possess immunogenic material.Be generally macro-molecular protein or cellular component.But some small molecules also possesses immunogenicity, be called as haptens ((Hapten).Haptens is often used to label probe.
Antibody: the protein molecule that can be combined with antigen or hapten specificity.
Complex body: the binding substances of being formed by two or more molecular specificity.
Primer dimer: in the process of polymerase chain reaction (PCR), because of between primer pair or wall scroll primer mutually anneal form dimer molecule, the dimer being made up of two different primers is heterodimer, because causing with the combination of kind of an antibody (part) and cause false positive with two kinds of marks, the dimer being formed by single primer annealing is homodimer, only can not cause false positive with a kind of mark, but the meeting of formation of too much dimer reduces amplification efficiency.
Immunity test strip: for the medical tool of rapid detection.Be called again colour generation membrane chromatographic.
Nucleic acid polymerase: the enzyme of nucleic acid long-chain.Be divided into archaeal dna polymerase and the large class of RNA polymerase two.
beneficial effect:
Because the present invention is the gene fragment with the primer amplified suitable length of mark, can guarantee the high degree of specificity of detection, thereby guarantee the accuracy of detected result.Novel part of the present invention has been avoided the flow processs such as amplified production dilution and probe hybridization, keep immune colloid gold (test strip) technology directly perceived, fast, convenient, maturation, the advantage such as cheap, possesses again the feature of pcr amplification method height sensitivity, high degree of specificity, therefore, method of the present invention is a kind of desirable shigella flexneri detection means.
The current techique platform detecting as a nucleic acid amplification product, method of the present invention and test strip thereof can be widely used in food borne pathogenic microorganism clinical detection, husbandry and foodstuffs industry, customs inspection quarantine, the fields such as environment measuring.Common important pathogenic bacteria is as salmonella, Vibrio parahemolyticus, Bacillus cereus, streptococcus aureus, Clostridium botulinum, listeria monocytogenes, the EHEC in campylobacter jejuni and meat product and vegetables etc.These can be the objects that nucleic acid amplification product Test paper of the present invention detects.
The invention of nucleic acid test strip detection method is by the trace routine of greatly simplifying after nucleic acid amplification.Result interpretation simple and clear, directly perceived (detecting signal result as accompanying drawing 2).
This food borne pathogenic microorganism test strip Fast Detection Technique that specially patent is applied for as a kind of novel nucleic acid amplification after detection technique, have the following advantages:
Simple to operate: only the sample after nucleic acid amplification directly need to be dripped to nucleic acid reagent and detect version above, not need professional to operate, not only can be used for large hospital, also applicable to rural area, side area and basic hospital;
Quick: to detect sentence read result after 5 minutes;
Sensitive: compared with agarose gel electrophoresis, detection sensitivity improves nearly 100～200 times;
Specificity is high: be specificity labeled primers due to what add use in testing process, make result more accurate;
Low price: expense is significantly less than traditional gel electrophoresis and ELISA detects.
Following embodiment illustrates detection method of the present invention and detects effect.Embodiment is only used for for example, not forming any restriction to protection domain of the present invention, and protection scope of the present invention illustrates at appending claims.
brief description of drawings
Accompanying drawing 1 shows the basic structure of the test strip of amplification of nucleic acid sequences product detection of the present invention;
Accompanying drawing 3 is the methods that show with embodiment 1, adopts specificity labeled primers to detect the detected result of Enterobacter sakazakii PCR-test strip;
Accompanying drawing 4 is the methods that show with embodiment 2, adopts the detected result of the specific PCR-test strip that detects Enterobacter sakazakii specificity labeled primers;
Embodiment
1 materials and methods
Shigellae DNA
1.2 design of primers
1.3 pcr amplification systems:
Reaction conditions:
Get respectively 3 μ l simultaneously and detect and get 3 μ L amplified productions for nucleic acid test strip, join in 97 μ L developping solutions and carry out check point in sample pad, observations after 5 minutes.
1.4 PCR specificity experiments
The PCR reaction system that utilization is set up is to A. Shigella flexneri 2. negative control bacterium, 1) streptococcus aureus 2) Listeria monocytogenes, 3) yersinia entero-colitica, 4) intestinal bacteria, 5) Salmonellas, 6) O-157,3. negative contrast (water), verifies its specificity.
2 results
2.1 PCR reaction system and conditions
The HS Taq DNA polymerase that adopts TAKARA company, total reaction system is 20 μ l.Detect with Bio-Rad PCR instrument, reaction parameter is: 94 ℃ of 5 min, and 94 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 80 s increases, and proceeds to 72 ℃ of 5 min, 4 ℃ of preservations after 30 circulations.Get 5 μ l products carrying out electrophoresis containing in 2% agarose gel electrophoresis of ethidium bromide, after electrophoresis, judge and have or not specific band.After nucleic acid amplification, the detected result of test strip and gel electrophoresis is shown in accompanying drawing 4.
2.2 specific test
The PCR method that the present invention sets up has good specificity to Shigellae, to no cross reactions such as other kind bacterium and enterobacteriaceae lactobacteriaceaes.
The susceptibility of nucleic acid test strip detection method, by pcr template with 1,1/10,1/10
2, 1/10
3, 1/10
4, 1/10
5, 1/10
6, 1/10
7, 1/10
8, 1/10
9, 1/10
10dilution proportion after, increase by the PCR system of having set up.
1 materials and methods
Shigellae DNA
1.2 design of primers
1.3 pcr amplification systems:
Reaction conditions:
Get respectively 5 μ l for agarose gel electrophoresis.Gel electrophoresis condition is: 1X tbe buffer liquid, voltage 100V, 30 points of electrophoresis times.Get respectively 3 μ l simultaneously and detect for nucleic acid test strip, get 3 μ l sample spot and join in 97 μ L developping solutions and detect in sample pad, observations after 5 minutes.
2 results
2.1 PCR reaction system and conditions
The HS Taq DNA polymerase that adopts TAKARA company, total reaction system is 20 μ l.Detect with Bio-Rad PCR instrument, reaction parameter is: 94 ℃ of 5 min, and 94 ℃ of 30s, 56.5 ℃ of 30s, 72 ℃ of 80 s increases, and proceeds to 72 ℃ of 5 min, 4 ℃ of preservations after 30 circulations.Get 5 μ l products carrying out electrophoresis containing in 2% agarose gel electrophoresis of ethidium bromide, after electrophoresis, judge and have or not specific band.Compared with traditional gel electrophoresis, its susceptibility increases by 100～200.
The invention discloses quick nucleic acid test strip detection kit and the application method thereof of food borne pathogenic microorganism, PCR detection method for the specific nucleic acid sequence amplification product of Shigellae is also disclosed, the test strip detecting for nucleic acid amplification product is also disclosed, and the purposes of test strip.Method of the present invention is used specific nucleic acid sequence amplification product to can be used for detecting several object amplification of nucleic acid sequences products in any source, and its specificity is guaranteed by amplimer.
1. Shigellae detects
Shigellae is template, and PCR result directly detects, and the results are shown in Figure 3.Show, PCR detects and detects with 3 μ l amplified productions, now detected result, and positive strain detection line is positive; Negative control, negative control test line are negative.
2. specific detection
(1) belong to other bacterial strain together: bacterial strain is shown in test strain 1, strain number is identical with result numbering, and detected result is 3 μ l amplified productions, all negative, sees Fig. 4, and wherein a is Shigellae reference culture Shigella flexneri.
(2) negative control bacterium: bacterial strain is enterobacteriaceae lactobacteriaceae, refers to test strain 2, and strain number is identical with result numbering, and detected result is 3 μ l amplified production direct-detections, all negative, sees Fig. 4 part, and wherein a is Shigella flexneri reference culture.
a kind of preparation method and application thereof of the nucleic acid lateral flow test strip that detects Shigellae
The sequence of Shigellae Ipah-F/R
GAATGGGATGATTGGGAGAAACAGGGGTTACCGGAAGAACAGCGTACTGAGGCGGTAAGAAGACTTCGTGCATGTCTTACCTCTAAGGGGCATAAACTGGACCTGCGAGCCTTGGCGCTTTCCTCGTTACCTGTACTCCCTGCTTGCATTAAAAAGCTTGATGTGAGCTGTAATAAATTAACCATCCTTACTGATTTACCTGAAAATATTAAAGAACTTATTGCAAGAGATAATTTCTTAACACATATATCTGCATTACCACATTATCTAATAACTTTGGATGTGTCCGAAAATCAATTAGAGAATCTGCCGTTATTACCAGACACCATCAAATCACTAAGCGCAGAGTATAATAGGTTATCCACACTGCCTTCA。
Claims (7)
1. the invention provides a kind of food borne pathogenic microorganism-shigella flexneri (
shigella flexneri) test strip method for quick.
2. detection method as claimed in claim 1, adopt the primer PCR of two unique design to carry out amplified reaction, wherein the sequence of upstream primer ipaH-F is: 5'-GAATGGGATGATTGGGAGAAAC-3', the sequence of downstream primer ipaH-R is 5'-TGAAGGCAGTGTGGATAACC-3', and 5 ' end of upstream primer and downstream primer carries out respectively haptens or fluorescein molecule mark.
3. detection method as claimed in claim 1 is used and completes the chromatography in test strip with the expansion damping fluid of nucleic acid denaturation agent, and its composition is: 10mM Tris, 1% BSA, 1% Tween 20 and concentration are respectively the NaOH of 0.05mol/L to 0.5mol/L.
4. the test strip detecting for nucleic acid amplification product claimed in claim 1, wherein coloured particle is colloid gold particle or latex particle, described tunica fibrosa is nitrocellulose filter or nylon membrane.
5. PCR process as claimed in claim 2, its primer pair can be selected two kinds of diverse ways marks in biotin molecule (Biotin), fluorescein isothiocyanate (FITC) or digoxin (Digoxin).
6. PCR process as claimed in claim 2, its reaction conditions is: 95 ℃ of denaturation 5 min, 94 ℃ of sex change 30 sec; 57 ℃ of annealing 30 sec; 72 ℃ are extended 30sec, 30 circulations of increasing, and last 72 ℃ are extended 5 min.
7. PCR-immunity colloidal gold test paper strip claimed in claim 1 is for the amplification of food borne pathogenic microorganism shigella flexneri and the purposes detecting by immune colloidal gold technique.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310361652.3A CN103805691A (en) | 2013-08-19 | 2013-08-19 | Preparation method and application of nucleic acid lateral flow test strip for detecting Shigella |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310361652.3A CN103805691A (en) | 2013-08-19 | 2013-08-19 | Preparation method and application of nucleic acid lateral flow test strip for detecting Shigella |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103805691A true CN103805691A (en) | 2014-05-21 |
Family
ID=50703075
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310361652.3A Pending CN103805691A (en) | 2013-08-19 | 2013-08-19 | Preparation method and application of nucleic acid lateral flow test strip for detecting Shigella |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103805691A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106544424A (en) * | 2016-10-31 | 2017-03-29 | 中国疾病预防控制中心传染病预防控制所 | The constant-temperature amplifications that intersect combine the method that gold nano bio-sensing detects shigella dysenteriae more |
| CN108611402A (en) * | 2018-05-12 | 2018-10-02 | 浙江工商大学 | Shigella flexneri visible detection method based on aptamers magnetic capture and direct LAMP |
| CN110346553A (en) * | 2018-04-04 | 2019-10-18 | 南京东纳生物科技有限公司 | A kind of PCR product paramagnetic particle method purifying joint rapid fluorescence immue quantitative detection reagent box and its detection method |
| CN112342305A (en) * | 2019-08-09 | 2021-02-09 | 沈阳祥伴科技有限公司 | Kit for rapidly detecting target organism or target gene |
| CN114525352A (en) * | 2022-03-24 | 2022-05-24 | 郑州轻工业大学 | Method for detecting pathogenic bacteria at high flux by combining multiple PCR and colloidal gold test strip |
-
2013
- 2013-08-19 CN CN201310361652.3A patent/CN103805691A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106544424A (en) * | 2016-10-31 | 2017-03-29 | 中国疾病预防控制中心传染病预防控制所 | The constant-temperature amplifications that intersect combine the method that gold nano bio-sensing detects shigella dysenteriae more |
| CN110346553A (en) * | 2018-04-04 | 2019-10-18 | 南京东纳生物科技有限公司 | A kind of PCR product paramagnetic particle method purifying joint rapid fluorescence immue quantitative detection reagent box and its detection method |
| CN108611402A (en) * | 2018-05-12 | 2018-10-02 | 浙江工商大学 | Shigella flexneri visible detection method based on aptamers magnetic capture and direct LAMP |
| CN112342305A (en) * | 2019-08-09 | 2021-02-09 | 沈阳祥伴科技有限公司 | Kit for rapidly detecting target organism or target gene |
| CN114525352A (en) * | 2022-03-24 | 2022-05-24 | 郑州轻工业大学 | Method for detecting pathogenic bacteria at high flux by combining multiple PCR and colloidal gold test strip |
| CN114525352B (en) * | 2022-03-24 | 2024-05-17 | 郑州轻工业大学 | Method for detecting pathogenic bacteria by combining multiple PCR and colloidal gold test strip with high flux |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wu et al. | A sensitive aptasensor for the detection of Vibrio parahaemolyticus | |
| Du et al. | A rapid Salmonella detection method involving thermophilic helicase-dependent amplification and a lateral flow assay | |
| Jiang et al. | Multiplex loop-mediated isothermal amplification-based lateral flow dipstick for simultaneous detection of 3 food-borne pathogens in powdered infant formula | |
| CN103805691A (en) | Preparation method and application of nucleic acid lateral flow test strip for detecting Shigella | |
| CN103255217A (en) | Side direction current test strip detection kit for detecting canis familiaris component in feed and application thereof | |
| Zhou et al. | An effective established biosensor of bifunctional probes-labeled AuNPs combined with LAMP for detection of fish pathogen Streptococcus iniae | |
| CN109913565B (en) | Kit, primer pair, probe and method for detecting vibrio parahaemolyticus | |
| CN109136408A (en) | Detection reagent, kit and its application of African swine fever virus | |
| CN103740803A (en) | Food borne pathogenic organism nucleic acid lateral flow test strip detection kit and application thereof | |
| Lu et al. | Ultrasensitive microchip electrophoretic detection of the mecA gene in methicillin-resistant Staphylococcus aureus (MRSA) based on isothermal strand-displacement polymerase reaction | |
| CN103773847B (en) | Lateral flow test strip detection kit for detection of bovine-derived components in foods and feeds and application of kit | |
| CN108060209A (en) | A kind of kit and detection method of recombinase constant-temperature amplification combination immunity colloidal gold test paper strip detection salmonella | |
| CN103773848A (en) | Preparation method and application of nucleic acid lateral flow test strip for detecting listeria monocytogenes | |
| KR20170078456A (en) | A method and test kit for detecting microorganisms using lamp product | |
| CN106755358B (en) | Method for detecting vibrio parahaemolyticus by combining multi-cross amplification with gold nano biosensing | |
| EP3902929A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| Li et al. | Review in isothermal amplification technology in food microbiological detection | |
| CN103773850B (en) | In a kind of food and feeds, chicken derived components detects lateral flow ELISA test strip test kit and application thereof | |
| CN110734993A (en) | nucleic acid detection test paper strip for distinguishing Brucella vaccine strain S19 from naturally infected strain | |
| EP3108007B1 (en) | A method of detecting a microorganism in a sample by a fluorescence based detection method using somamers | |
| CN103725772A (en) | Preparation method and application of nucleic acid lateral flow test strip for detecting cronobacter sakazakii | |
| CN103773849A (en) | Preparation and applications of nucleic acid lateral flow test strip kit for detecting EHEC O157 | |
| CN104342496B (en) | A kind of quick detection, identify that Liszt belongs to the method for bacterium | |
| CN103773846B (en) | In a kind of food and feeds, goose derived components detects lateral flow ELISA test strip kit and application thereof | |
| CN103789404A (en) | Preparation method of nucleic acid lateral flow test strip for detecting yersinia enterocolitica and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140521 |