AU2021100081A4 - Biomarker for diagnosis of bovine tuberculosis and application thereof - Google Patents
Biomarker for diagnosis of bovine tuberculosis and application thereof Download PDFInfo
- Publication number
- AU2021100081A4 AU2021100081A4 AU2021100081A AU2021100081A AU2021100081A4 AU 2021100081 A4 AU2021100081 A4 AU 2021100081A4 AU 2021100081 A AU2021100081 A AU 2021100081A AU 2021100081 A AU2021100081 A AU 2021100081A AU 2021100081 A4 AU2021100081 A4 AU 2021100081A4
- Authority
- AU
- Australia
- Prior art keywords
- tuberculosis
- biomarker
- cattle
- bovine tuberculosis
- bovine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- General Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a biomarker for diagnosis of bovine tuberculosis and application
thereof. The biomarker which can distinguish the negative and positive of bovine
tuberculosis is Lymphotoxin alpha (LT-a), which is screened by transcriptomics
technology and verified by fluorescence quantitative PCR technology. The diagnostic
biomarker for bovine tuberculosis provided by the invention can identify whether the
cattle to be detected are negative or positive for bovine tuberculosis, and can be used for
preparing a kit or reagent for detecting bovine tuberculosis, thus providing a new
detection target for the diagnosis of bovine tuberculosis, contributing to the timely
detection and elimination of tuberculosis cattle, and providing a guarantee for the
comprehensive prevention and control of bovine tuberculosis.
-1/4
5'
I~A
IM1i
Fig. 1
Structure of libraries and sequencing process of transcriptome.
Description
-1/4
5'
I~A
IM1i
Fig. 1
Structure of libraries and sequencing process of transcriptome.
Biomarker for diagnosis of bovine tuberculosis and application thereof
The invention relates to the technical field of animal disease detection, in particular to a
biomarker for diagnosis of bovine tuberculosis.
Bovine tuberculosis is mainly caused by M. bovis of Mycobacterium tuberculosis
complex (MTBC), which is a kind of chronic zoonosis infectious disease. Compared with
M. tuberculosis, M. bovis has a wider host range, which is most likely to infect cattle,
other domestic animals, primates, cats, dogs and wild ruminants, etc. It can also be
transmitted to people by inhaling aerosol containing bacteria or eating unpasteurized
milk, so as to be spread from person to animal and from person to person. Tuberculosis
cattle excrete pathogenic bacteria in the form of aerosol. The aerosol containing M. bovis
adheres to pastures, water tanks and other places. Healthy animals can cause infection by
inhaling 6-10 pathogenic bacteria. In addition, cattle with tuberculosis mastitis will
release a large amount of M. bovis when producing milk, which is enough to pollute the
total milk produced by 100 healthy cattle. Studies have shown that people with Human
Immunodeficiency Virus (HIV) are more likely to co-infect M. bovis and develop into
active tuberculosis, and it is easier to transmit M. bovis to people who are in close contact
with them. Tuberculosis has become the most important killer of HIV patients. Therefore,
bovine tuberculosis not only harms the healthy development of aquaculture, but also
causes serious public health safety problems and threatens people's health and life safety.
The effective prevention and control of the disease is directly related to human health.
Tuberculin Skin Test (TST) is the earliest method used to diagnose bovine tuberculosis,
and it is also the most widely used standard method for detecting bovine tuberculosis
recommended by the Office International des Epizooties (OIE) in the world. Interferon
gamma release assay (IGRA) can be used as an alternative detection method for TST and
is recommended by OIE for bovine tuberculosis detection. At present, the established
TST and IGRA have some practical problems, such as long time consuming, strong
subjectivity, poor sensitivity and high price. Serological detection method is very
convenient, but because the established serological diagnosis methods for bovine
tuberculosis have failed to achieve effective sensitivity and specificity, they have not
been recommended by the International Tuberculosis Research Organization. Nested
PCR can be used to detect M. bovis pathogens in nasal secretions, alveolar lavage fluid
and milk. Studies have shown that M. bovis pathogens can be detected in nasal swabs of
23%80% of tuberculosis-positive cattle, but this method has high requirements on
detection environment, technology and personnel, resulting in difficult popularize and
application at the grassroots level. Therefore, screening biomarkers of tuberculosis cattle
and establishing related diagnostic methods are helpful for timely detection and
elimination of tuberculosis cattle and comprehensive prevention and control of bovine
tuberculosis.
The purpose of the present invention is to provide a diagnostic marker for bovine
tuberculosis to identify tuberculosis cattle.
In order to achieve the above purpose, the invention firstly uses transcriptomics high
throughput screening technology to sequence 9 peripheral blood lymphocyte samples of tuberculosis positive cattle and healthy cattle, and finds that there are significant differences in the expression levels of 1802 mRNAs between tuberculosis cattle and healthy cattle. The fluorescence quantitative PCR technique is used to verify that 6 mRNAs have potential as diagnostic markers, which are CD69 molecule (CD69),
Lymphotoxin alpha (LT-a), Low density liporotein receptor-related protein 1 (LRP1),
Thrombospondin 1 (THBS1), Aminomethyltransferase (AMT), Interleukin 17 (IL17), and
the primer pairs for amplification are shown in Table 1.
Table 1 Primer Name, Sequence and Amplified Product Size
Primer pairs Gene symbol Gene name Strand Sequence (5'-3') Amplicon size (bp) Primer pair 1 ACTB Actin p Forward CGAGATGAGATTGACATTGC 159 Reverse CCACTGCCACATTGTAGAA Primer pair 2 LRP1 LDL receptor related protein 1 Forward CCTGGAACCTGTAACCTAC 103 Reverse ACTTGTCGCCTGTGTAAC Primer pair 3 CD69 CD69 molecule Forward CATCACCACTCTCATTATAGC 127 Reverse GTGTCCAATCCAATCATCTG Primer pair 4 IL17 Interleukin 17 Forward ACCTCACCTTGGACTCTC 102 Reverse GCCTTCAGCATTGATACAG Primer pair 5 THBS1 Thrombospondin 1 Forward TGAGAGCAGGTAGTTGAGA 102 Reverse ATCATCCAGTCTAAGCACAA Primer pair AMT Aminomethyltransferase Forward GGAGAGTCTAGTGGTTGGA 110 Reverse CGCTGGTCACAATCAAGT Primer pair 6 LT-a Lymphotoxin alpha Forward CCTAAGAAGGACTTGTCC 133 1_ 1 Reverse AGATGCCATGACGGACAA Then, 34 cattle are taken as independent samples for clinical population expansion
verification by RT-qPCR, and finally a diagnostic biomarker of bovine tuberculosis, LT-a,
is obtained, which is proposed for the first time.
The invention provides an application of LT-a in preparing a kit for diagnosing bovine
tuberculosis, which is used to diagnose negative or positive bovine tuberculosis.
In an embodiment of the invention, it is found that the mRNA expression level of LT-a in
peripheral blood lymphocytes under the condition of PPD-B stimulation is significantly
higher in tuberculosis positive cattle than in healthy cattle, and it is judged that tuberculosis is positive when the relative expression amount is 2AACt> 2.952; when the relative expression of LT-a mRNA in peripheral blood lymphocytes stimulated by PPD-B is <2.952, it is judged that tuberculosis is negative. The accuracy of detection threshold may be affected by different sample sizes, but after careful screening and statistics, the inventor find that the relative expression 2-AACtof LT-a in peripheral blood lymphocytes stimulated by PPD-B of tuberculosis cattle is over 2.952, which is significantly higher than that of negative cattle.
Preferably, the relative expression 2-Act of LT-a in peripheral blood lymphocytes of
tuberculosis cattle after PPD-B specific stimulation is above 5, which is significantly
higher than that of negative cattle. The receiver operator characteristic curve (ROC curve)
shows that LT-a (AUC= 0.9982) has high diagnostic application value and can well
distinguish tuberculosis cattle from healthy cattle.
The method has the beneficial effects that biomarkers related to bovine tuberculosis
infection are screened by transcriptomics technology, and the biomarkers are verified by a
fluorescent quantitative PCR method, so that the most potential biomarker of bovine
tuberculosis, namely LT-a, is obtained, and the detection time is shortened by more than
hours compared with IGRA, so that the method has the advantage of being used as a
biomarker of bovine tuberculosis. According to the invention, LT-a can be used as a
diagnostic biomarker of bovine tuberculosis for the first time.
The invention constructs a fluorescent quantitative PCR detection method for bovine
tuberculosis by LT-a, which detects the mRNA content of LT-a in peripheral blood
lymphocytes stimulated by M. bovis specific antigen (PPD-B), and the LT-a of
tuberculosis positive cattle is significantly higher than that of healthy cattle (the relative expression content of LT-a in peripheral blood lymphocytes is above 5). The detection method can improve the diagnostic efficiency of bovine tuberculosis, help to detect and eliminate tuberculosis cattle in time, and be beneficial to prevent, control and purify bovine tuberculosis in China.
Fig. 1 Structure of libraries and sequencing process of transcriptome.
Fig. 2 Heat map of bTB cattle and healthy cattle transcriptional expression profiles.
Fig. 3 Validation the expression level of LT-a mRNAs as biomarker for bTB diagnosis.
Fig. 4 ROC analysis of bTB diagnosis biomarker LT-a.
The present invention will be further explained with specific examples below. These
examples are only used to illustrate the present invention and are not used to limit the
scope of the present invention.
Example 1 Detection and collection of clinical samples related to the present invention
1. TST
According to Diagnostic CriteriaforBovine Tuberculosis (GB/T 18645-2002), TST was
carried out. 1/3 of cattle neck was shaved, and 0.1 mL of PPD-B, with 250 IU/head was
injected intradermally. The skin thickness of injection site was measured by vernier
caliper by the same operator before injection and 72 h after injection, and the skin
thickness difference was calculated. When the skin thickness difference is greater than or
equal to 4 mm, the cattle is positive for tuberculosis; when the skin thickness difference is
less than 2 mm, it is judged that tuberculosis is negative; when the skin thickness
difference is between 2-4 mm, it is judged as suspicious, and TST should be carried out days after the first test. If the second skin thickness difference of the test is greater than or equal to 2 mm, it is judged as tuberculosis positive.
2. IGRA
Heparin lithium anticoagulant 10 ml was collected and transported to the laboratory at
room temperature (22+4C) within 16 h. First, anticoagulant was added to 24-well tissue
culture plate, 1.5 ml/well. Then 100 pl of purified bovine tuberculin (PPD-B), avian
tuberculin (PPD-A) and PBS were aseptically added to each well. After shaking and
mixing, the cells were incubated in C02 incubator at 37 °C for 20-24 h. Carefully
sucking up 200 pl of upper plasma, transferring it into a 1.5 ml centrifuge tube for later
use (plasma can be stored at 2-8 °C for 7 days and at -20 °C for several months), and
operating according to the instructions of bovine IFN-y detection kit (purchased from
Prionics Company). The values of OD450nmof samples stimulated by PPD-B, PPD-A and
PBS are recorded as OD450nm(PPD-B), OD450nm(PPD-A) and OD450nm(PBS), respectively. When
OD450nm(PPD-B) - OD450nm(PPD-A)> 0.1, and OD450nm(PPD-B)- OD450nm(PBS)> 0.1 , the bovine
tuberculosis is determined to be positive. When OD450nm(PPD-B)- OD450nm(PPD-A) < 0.1,
or OD450nm(PPD-B) - OD450nm (PBS) < 0.1, the bovine tuberculosis is determined to be
negative.
3. Detection and screening of tuberculosis positive cattle and tuberculosis negative cattle
using the methods in the above steps 1-2
Table 2 Grouping of clinical samples
Detection method Tuberculosis Tuberculosis positive cattle negative cattle TST +
IGRA +
4. Sample collection and preparation
ml of bovine venous blood was collected aseptically and injected into heparin lithium
anticoagulant blood collection tube. Separation of anticoagulation from peripheral blood
lymphocytes is carried out according to the instruction manual, including the following
specific steps.
Adding 20 ml diluent and 20 ml fresh anticoagulant into 50 ml sterile centrifuge tube in
turn.
Taking another 50 ml sterile centrifuge tube, adding 10 ml lymphocyte separation
solution, and slowly adding the diluted blood sample in step 1 above the liquid level of
the cell separation solution.
Centrifuging at 400 g in a table centrifuge at room temperature for 20 min.
After centrifugation, the centrifuge tube is divided into four layers from top to bottom.
The first layer is plasma layer, the second layer is annular milky white lymphocyte layer,
the third layer is separation liquid layer, and the fourth layer is red blood cell layer.
Carefully sucking milky white lymphocytes into a 15 ml sterile centrifuge tube with a 5
ml syringe, and then adding 10 ml cleaning solution and mixing it upside down, 250 xg.
Finally, centrifuging it for 10 min at room temperature.
Discarding supernatant from centrifuge tube, adding 1 ml erythrocyte lysate, blowing
gently and mixing evenly to let it lyse at room temperature for 5 min.
Adding 10 ml OpTmizerTM T-Cell Expansion SFM to the centrifuge tube to stop the
lysis. And then, with 250 xg, centrifuging it at room temperature for 10 min, and
discarding the supernatant.
Repeat step 6 and add 1 ml of culture medium to the centrifuge tube to suspend the cells.
1 cell suspension is taken for cell counting, and the cell density is adjusted to 5x106
cell/ml.
The cells are spread on a 12-well cell culture plate according to 1 ml per well, and each
sample is spread in two wells.
100 pl of purified bovine tuberculin (PPD-B) and 100 pl of PBS are aseptically added to
each well, and then incubated inC02 incubator at 37 °C for 6 h. Total RNA of cells is
extracted by Trizol reagent.
Measurement of concentration. The concentration of RNA samples is measured by
Nanodrop 2,000 ultraviolet spectrophotometer.
Example 2 Screening of biomarkers
1. Sample pre-treatment
Randomly screening 6 cattle with positive tuberculosis and 3 cattle with negative
tuberculosis as determined in Example 1, which were collected and treated as in Example
1.
2. Construction of sequencing library and sequencing of transcriptome
A cDNA library of 9 sequencing samples was constructed (the library structure is shown
in fig. 1), and Hiseq 2500 platform was arranged for transcriptome sequencing after the
library quality inspection was qualified. The brief steps are as follows:
(1) The mRNA was extracted from the total RNA (the extraction method refers to the
instructions of Dynabeads mRNA extraction kit).
(2) The mRNA fragment was interrupted, and the first strand of cDNA was reverse
transcribed by using its own primer.
(3) Synthesizing double-stranded cDNA.
(4) End repair of double-stranded cDNA and addition of A to 3' end.
(5) Connection of the sequencing connector and PCR amplification after purifying and
recovering the connection product.
(6) PCR products were separated by 2% agarose gel electrophoresis, and the target band
was selected by gel cutting, and the gel recovery product was the final library.
(7) The library was tested for quality control by fluorescence quantitative PCR, and then
the library was sequenced by computer.
3. High-throughput sequencing data processing and screening of differentially expressed
genes
The raw image data obtained by sequencing is converted into sequence data by base
calling, which is called raw data or raw reads. The original sequencing data will contain
linker information, low-quality bases and undetected bases. This information which will
interfere with the subsequent information analysis; therefore, it should be removed by
setting certain filtering standards. The final obtained data is valid data, called clean data
or clean reads. The data filtering standards are as follows.
(1) Deleting reads with linker sequence.
(2) Removing the paired reads, when the content of N contained in the single-ended
sequencing read exceeds 3% of the length ratio of the read.
(3) When the number of low-quality (less than 3) bases contained in the single-ended
sequencing read exceeds 50% of the length ratio of the read, the paired reads should be
removed.
In order to be comparable between samples and between genes, it is necessary to
standardize the reads obtained from samples. Here, FPKM (fragments per kilobase per
million) is introduced to measure the relative expression of the same gene in different
samples. FPKM calculation formula is
FPKM = fragments mapped fragments (millions)x transcript length (kb) Wherein, fragments denote the number of fragments mapped to a certain mRNA (number
of two terminal sequencing reads), mapped fragments denote the total number of
fragments mapped to the reference genome (number of mapped reads), and transcript
length denotes the length of mRNA.
Screening differentially expressed genes (DEGs) as the following screening criteria.
Choosing the ratio FC (fold change) of the reference gene expression FPKM greater than
1.5 or less than 0.67 and the p value after FDR (false discovery rate) correction less than
0.05 as the screening threshold. If the above conditions are met, they are considered as
the specific differential expression genes of the two control groups and the screened
differentially expressed mRNAs are represented by heat map (fig. 2).
The results showed that 1802 differentially expressed genes were identified in peripheral
blood lymphocyte samples. According to the multiple and function of the identified
differential genes, six differential genes were screened and identified by fluorescence
quantitative PCR (Table 3). According to the detection results of RNA-Seq and
fluorescence quantitative PCR, the screening results were consistent, and the correlation
analysis showed that R2 = 0.9122, which was reliable. It is preferred to regard the marker
with the largest difference multiple, namely LT-a, as the best biomarker for diagnosis of
bovine tuberculosis.
I1
Table 3 Validation of relative expression of selected DEGs by qRT-PCR
Gene Fold-changes in RNA-Seq Fold-changes in qPCR bTB NC bTB /NC CD69 1.656 1.225 LT-a 3.456 4.516 LRP1 1.049 1.725 IL17 -2.079 -2.884 THBS1 2.498 2.515 AMT 0.967 1.251 Example 3 Verification of biomarker LT-a in the present invention
Detection of differential expression of LT-a gene in peripheral blood lymphocytes of
tuberculosis cattles and healthy cattles by fluorescence quantitative PCR. Specifically, 17
tuberculosis cattles and 17 healthy cattles were randomly screened by the method of step
1-3 in Example 1, and the total RNA samples of peripheral blood lymphocytes of each
cattle were prepared according to the method of step 4 in Example 1. Using QuantiTect
Reverse Transcription Kit to synthesize cDNA as follows.
1. Genomic DNA was removed, and the following system was prepared and reacted at 42
°C for 2 min.
gDNA Wipeout Buffer 7x 2 tl Template RNA up to 1 g RNase-free water To 14 pl Total reaction volume 14 pl 3.The first strand cDNA was synthesized by the following system: reaction at 42C for
min and reaction at 95C for 3 min.
Reverse-transcription master mix Ipl Quantiscript RT Buffer 5x 4 pl
RT Primer Mix 1gI Template RNA (mixture of step 1) 14 pl Total reaction volume 20 pl With the cDNA obtained above as template, quantitative PCR was performed by
QuantiNova SYBR Green PCR Master Mix (Qiagen), and the reaction system was as
follows:
2x QuantiNova SYBR Green PCR Master Mix 10 1 Forward Primer 0.7 1 Reverse Primer 0.7 1 cDNA 1 1 RNase-free water 7.6 [1 Total reaction volume 20 [1 The reaction procedure was as follows: 95 °C pre-denaturation for 2 min; 95 °C 5 s, 60
°C 10 s for 40 cycles; the instrument default setting was used to collect the dissolution
curve. ACTB internal reference gene was used as internal reference, and the relative
expression of differentially expressed genes was calculated by 2-Act method. The
average value of three independent repeated tests was taken for each sample. The formula
of2 of 2-aactmethod -(Asample - Acontrol) is 2- c= 2-(^*^°"0 A~tethdis-AACt=
Results: compared with tuberculosis negative cattle, the expression of LT-a mRNA in
peripheral blood lymphocytes of tuberculosis positive cattle increased significantly (P<0
.001) (fig. 3).
Example 4 Diagnostic Value Analysis of Bovine Tuberculosis Markers
The inventor applied ROC to analyse and evaluate the diagnostic value of LT-a as a
biomarker for bovine tuberculosis diagnosis. AUC (Area under ROC curve) indicates the
area under ROC curve, which is a quantitative analysis of diagnostic value of biomarkers.
Generally, the AUC value is between 0.5 and 1.0, and a larger AUC represents a higher diagnostic value. The results showed that (fig. 4), LT-a, a biomarker of tuberculosis infected cattle and healthy cattle, had AUC=0.9982, which had high diagnostic value.
Example 5 Determination of cutoff value of LT-a detection method for bovine
tuberculosis
Cut-off value of tuberculosis positive cattle and tuberculosis negative cattle (including 17
tuberculosis positive cattle and 17 tuberculosis negative cattle) was distinguished by
receiver operating characteristic curve analysis of LT-a.
The results showed that when PPD-B was used as stimulator, the AUC of LT-a was
0.9982, and when the selectivity specificity was 100%, its detection sensitivity could
reach 97.06%. These experimental data showed that when cutoff value was set at 4.990,
LT-a had higher sensitivity and specificity in detecting bovine tuberculosis, so that it
could distinguish tuberculosis positive cattle from tuberculosis negative cattle.
Table 4 Sensitivity and specificity of biomarkers in bTB Diagnosis
Effect AUC Sensitivity 95 % CI (%) Specificity 95 %CI (%) for Cutoff value
value (%) for sensitivity (%) specificity ( 2 -AACt)
Differentiate M Bovis-infected 0.9982 100.0 88.92- 100.0 94.42 73.91 - 99.905 > 2.952
Cattle (n=34 ) from NC(n=17) 96.96 85.57- 99.89 100.0 80.49 - 100.0 > 4.990
According to the invention, a complete workflow is established for discovering and
verifying mRNA biomarkers in peripheral blood lymphocytes, and LT-a is successfully
determined as a biomarker for detecting bovine tuberculosis.
The above is only the preferred embodiment of the present invention, and it should be
pointed out that for ordinary people in the technical field, without departing from the
technical principle of the present invention, several improvements and embellishments
can be made, which should also be regarded as the protection scope of the present
invention.
Claims (10)
1. A biomarker for diagnosis of bovine tuberculosis is LT-a.
2. The application of the diagnostic biomarker or the reagent for detecting the diagnostic
biomarker according to claim 1 in preparing the bovine tuberculosis diagnostic kit.
3. The primer combination of biomarkers for diagnosis of bovine tuberculosis according
to claim 1, characterized by consisting of primer pairs of DNA sequences shown in
Primer pair 6 in Table 1.
4. The application according to claim 2, characterized in that when the relative content of
LT-a mRNA in peripheral blood lymphocytes stimulated by PPD-B is -AAct> 2 5, it is
judged that bovine tuberculosis is positive; otherwise, if 2-ACt < 5, it is judged that
bovine tuberculosis is negative.
5. The biomarker for diagnosis of bovine tuberculosis according to claim 1, characterized
in that the expression of the biomarker in peripheral blood lymphocytes of cattle
diagnosed as positive for tuberculosis is differentially regulated compared with the
expression in control samples.
6. The biomarker for diagnosis of bovine tuberculosis according to claim 5, characterized
in that the control sample is cattle without tuberculosis.
7. The application according to any one of claims 2-6, characterized in that the kit is a
fluorescence quantitative PCR kit.
8. The application according to claim 7, characterized in that the fluorescence
quantitative detection kit further contains an endogenous reference gene amplification
primer, which is bovine ACTB gene.
9. The primer combination for endogenous reference gene amplification according to
claim 1 is composed of primer pairs of DNA sequences shown as Primer pair 1 in Table
1.
10. A diagnostic kit for bovine tuberculosis is comprised of a detection reagent for
detecting the expression level of LT-a.
-1/4- 07 Jan 2021 2021100081
Fig. 1
Structure of libraries and sequencing process of transcriptome.
-2/4- 07 Jan 2021 2021100081
Fig. 2
Heat map of bTB cattle and healthy cattle transcriptional expression profiles.
-3/4- 07 Jan 2021 2021100081
Fig. 3
Validation the expression level of LT-α mRNAs as biomarker for bTB diagnosis.
-4/4- 07 Jan 2021 2021100081
Fig. 4
ROC analysis of bTB diagnosis biomarker LT-α.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2021100081A AU2021100081A4 (en) | 2021-01-07 | 2021-01-07 | Biomarker for diagnosis of bovine tuberculosis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2021100081A AU2021100081A4 (en) | 2021-01-07 | 2021-01-07 | Biomarker for diagnosis of bovine tuberculosis and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| AU2021100081A4 true AU2021100081A4 (en) | 2021-04-01 |
Family
ID=75267728
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| AU2021100081A Active AU2021100081A4 (en) | 2021-01-07 | 2021-01-07 | Biomarker for diagnosis of bovine tuberculosis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| AU (1) | AU2021100081A4 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022238515A1 (en) * | 2021-05-11 | 2022-11-17 | University College Dublin, | Rna markers for tuberculosis and methods of detecting thereof |
-
2021
- 2021-01-07 AU AU2021100081A patent/AU2021100081A4/en active Active
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022238515A1 (en) * | 2021-05-11 | 2022-11-17 | University College Dublin, | Rna markers for tuberculosis and methods of detecting thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Asfaw et al. | Distribution and superinfection of bovine leukemia virus genotypes in Japan | |
| CN112322764B (en) | Detection kit and detection method for brucella | |
| WO2006022459A1 (en) | Primer and probe for detection of sars coronavirus, kit comprising the primer and/or the probe, and detection method thereof | |
| Zhang et al. | The nasal viromes of cattle on arrival at western Canadian feedlots and their relationship to development of bovine respiratory disease | |
| Rabalski et al. | Severe acute respiratory syndrome coronavirus 2 in farmed mink (Neovison vison), Poland | |
| Carroll et al. | Deep sequencing of RNA from blood and oral swab samples reveals the presence of nucleic acid from a number of pathogens in patients with acute Ebola virus disease and is consistent with bacterial translocation across the gut | |
| EP4025345A1 (en) | Systems, methods, and compositions for the rapid early-detection of host rna biomarkers of infection and early identification of covid-19 coronavirus infection in humans | |
| WO2022179494A1 (en) | Salmonella typhi detection kit, preparation method therefor and application thereof | |
| Marfell et al. | Global gene expression profiling of monocyte-derived macrophages from red deer (Cervus elaphus) genotypically resistant or susceptible to Mycobacterium avium subspecies paratuberculosis infection | |
| AU2021100081A4 (en) | Biomarker for diagnosis of bovine tuberculosis and application thereof | |
| WO2023279042A2 (en) | Compositions and methods for detection of severe acute respiratory syndrome coronavirus 2 variants | |
| CN110093432B (en) | sRNA marker for distinguishing mycobacterium tuberculosis from BCG vaccine and application thereof | |
| Fang et al. | Potential diagnostic value of the peripheral blood mononuclear cell transcriptome from cattle with bovine tuberculosis | |
| CN113186312A (en) | Molecular marker for distinguishing Brucella A19 vaccine strain and wild strain | |
| KR100617951B1 (en) | Primer Set for Diagnosis of Infection of TGEV PRCV and PEDV and Method of Diagnosis using The Primer Set | |
| KR102267326B1 (en) | Method and kit for detecting coronavirus | |
| CN110195096A (en) | It is a kind of for detecting the sample processing method of bloodstream infection pathogenic bacteria | |
| KR102019950B1 (en) | Novel primer set for detecting rotavirus and kit to distinguish wild rotavirus and vaccine rotavirus using the same | |
| KR101617142B1 (en) | Nucleic acid test based avian influenza virus detection kit with improved detection accuracy | |
| Wasniewski et al. | Investigations on SARS-CoV-2 and other coronaviruses in mink farms in France at the end of the first year of COVID-19 pandemic | |
| CN101423874A (en) | Foot-and-mouth disease virus multiple RT-PCR detection kit, preparation method thereof and application | |
| Khair et al. | Expression of Toll-like receptors 3, 7, 9 and cytokines in feline infectious peritonitis virus-infected CRFK cells and feline peripheral monocytes | |
| CN111304342A (en) | PCR kit for identifying Brucella strain S2 vaccine strain and wild strains of other species and use method thereof | |
| CN115074461B (en) | Triple PCR detection method for canine influenza virus, canine coronavirus and canine reovirus | |
| CN116042918B (en) | Five virus joint inspection compositions, kit, method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FGI | Letters patent sealed or granted (innovation patent) | ||
| PC | Assignment registered |
Owner name: QINGDAO INNOVATIVE DIAGNOSTICS BIOTECH CO., LTD. Free format text: FORMER OWNER(S): POULTRY INSTITUTE, SHANDONG ACADEMY OF AGRICULTURAL SCIENCES |