AU2020104096A4 - Molecular marker for major genetic locus resistant to bacterial leaf streak of rice and application of molecular marker - Google Patents
Molecular marker for major genetic locus resistant to bacterial leaf streak of rice and application of molecular marker Download PDFInfo
- Publication number
- AU2020104096A4 AU2020104096A4 AU2020104096A AU2020104096A AU2020104096A4 AU 2020104096 A4 AU2020104096 A4 AU 2020104096A4 AU 2020104096 A AU2020104096 A AU 2020104096A AU 2020104096 A AU2020104096 A AU 2020104096A AU 2020104096 A4 AU2020104096 A4 AU 2020104096A4
- Authority
- AU
- Australia
- Prior art keywords
- rice
- resistant
- molecular marker
- bacterial leaf
- leaf streak
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a molecular marker for a major genetic locus
resistant to rice bacterial leaf streak and an application of the molecular marker.
The molecular marker for the major genetic locus resistant to rice bacterial leaf
streak is located on Chromosome 10 of the rice; an amplified labeled primer is
RM258; and an amplified length of the labeled primer is 369 bp. In the present
invention, international rice BJ1 and high-quality rice Youzhan 8 in Guangxi
serving as parents are hybridized and self-fertilized to obtain a segregation
population F2; and the segregation population F2 is subjected to resistance
identification and genetic analysis. The result indicates that, the resistance is
controlled by 1 recessive major gene; a molecular marker RM258 in close linkage
is obtained; and the marker is located at about 48.8 cm of the Chromosome 10. The
major genetic locus resistant to bacterial leaf streak in the variety is first located on
the Chromosome 10 by an SSR marker. According to such a new discovery,
identification of the bacterial leaf streak resistant rice can be further expanded or
aided.
Drawings of Description
M1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
FIG. 1
140
120
100
80
60
40
20
0
Immune HR R MR MS S HS
Resistance level
FIG. 2
1
Description
Drawings of Description
M1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
FIG. 1
140
120
100
Immune HR R MR MS S HS Resistance level
FIG. 2
Description
Technical Field
The present invention relates to the field of molecular biology, and particularly relates to a molecular marker for a major genetic locus resistant to rice bacterial leaf streak.
Background
Bacterial leaf streak (called BLS for short) is caused by pathogenic bacteria Xanthomonas oryze pv.Oryzicola (Xoc), and is an important rice disease. Yield loss of the rice caused by the disease may be up to 32% during outbreak. Up to now, there is no ideal agent for controlling bacterial diseases such as the rice bacterial leaf streak. Compared with agent control, application of disease-resistant varieties facilitates high and stable yields of crops in successive years, may save lots of manpower and material resources and decrease farm investment, does not pollute the environment, and is in line with the direction of agricultural sustainable development. Genetic analysis indicates that, resistance of the rice to the rice bacterial leaf streak includes two resistance types, i.e., qualitative resistance and quantitative resistance which are respectively controlled by major genes and quantitative trait locus (QTL). At present, there are few application researches on molecular markers for major genes resistant to the rice bacterial leaf streak. Rice materials are enriched in rice bacterial leaf streak resistant resources, but most of the resistant resources mainly originate in tropical zones and are all ancient local varieties having poor agronomic traits. Therefore, improvement depending on the conventional breeding method only is long in period and low in resource utilization efficiency. In addition, the resistant resources are insufficiently
Description
developed, which is one of the reasons that cause slow breeding progress of rice bacterial leaf streak resistance. In the rice bacterial leaf streak resistant resources, qualitative resistance for major gene control is an important resistance type. Most of the researches on the major gene resistant to the rice bacterial leaf streak are focused on resistant resource screening and genetic analysis of resistance, while there are few researches on molecular genetic mechanisms of resistance genes, particularly molecular basis study associated with gene localization is superficial. Therefore, by enhancing discovery and utilization of the rice bacterial leaf streak resistant major gene and developing a molecular marker that can be used for assistant breeding, the utilization efficiency of the important resource can be greatly increased.
Summary In view of the above content, it is necessary to enhance discovery and utilization of a rice bacterial leaf streak resistant major gene and develop a molecular marker that can be used for assistant breeding, thereby greatly increasing utilization efficiency of such an important resource. To achieve the above purpose, technical solutions of the present invention are as follows: A molecular marker for a major genetic locus resistant to rice bacterial leaf streak is located on Chromosome 10 of the rice; an amplified labeled primer is RM258; a left primer sequence is CTCCCTGGCCTTTAAAGCTGTCG; a right primer sequence is GACGAACAGCAGCAGAAGAGAAGC; and an amplified length of the labeled primer is 369 bp. The present invention further provides an application of the above molecular marker in breeding rice varieties resistant to rice bacterial leaf streak or screening bacterial leaf streak resistant rice varieties for resistance genes. A screening process of the molecular marker includes the following steps:
Description
(1) positioning population construction: performing reciprocal hybridization on international rice 'BJ1' serving as a donor and high-quality rice 'Youzhan 8' in Guangxi serving as a receptor; harvesting F1 seeds; sowing the F1 seeds; performing selfing on F 1 plants to obtain F 2; and planting to obtain a positioning segregation population near-isogenic line F 2 ; (2) resistance identification: respectively planting the parents and the F1 and F 2 populations; inoculating dominant pathogenic III strains Liantang 13 in Guangxi at a tillering stage of rice; performing condition investigation within 20 days after inoculation; measuring lengths of 10 streaks of each single plant; and determining a resistance level of the single plant to the rice bacterial leaf streak according to the mean; (3) construction of DNA in resistant and susceptible pools: extracting total DNA of leaves of single plant of rice with extreme resistance and susceptibility in the F 2 generation by a CTAB method; dividing the DNA into two groups according to the resistance and susceptibility; mixing the total DNA of each single plant; and constructing resistant and susceptible DNA pools; (4) SSR molecular marker: performing polymorphism detection on the parents, i.e., the international rice 'BJ1' and the high-quality rice 'Youzhan 8' in Guangxi; screening to obtain polymorphic SSR primers having a polymorphism performance rate of 23%; taking the DNA in the resistant and susceptible gene pools as a PCR template; performing further polymorphism detection on the screened SSR primers; and discovering that the SSR marker RM258 from Chromosome 10 has polymorphism among the resistant and susceptible gene pools; (5) genetic analysis: 251 single plants of the segregation population F2 comprise 66 disease-resistant plants and 185 susceptible plants; through Chi-square test, resistant (R) and susceptible (S) segregation is in accordance with a theoretical monogenic inheritance segregation ratio of 1:3, which indicates that a
Description
rice bacterial leaf streak resistant gene carried on the international rice 'BJ1' is a recessive major gene, is located on the Chromosome 10, and is in close linkage with the SSR marker RM258. In the step (4), a 20 pL reaction system is adopted in the PCR reaction; and the reaction system includes 2.0 pL of lOx PCR Buffer (includingMgCl 2), 2.0 pL of 2.5 mmol-L-1 dNTPs, 11.9 pL of ddH 20,2.0 pL of 10 pmol-L-1 primer, 2.0 pL of template DNA and 0.1 pL of 5U-pL-1 Taq DNA polymerase. PCR reaction procedures are as follows: pre-degeneration is performed at °C for 5 min; degeneration is performed at 95°C for 30 s; annealing is performed at 52°C for 30 s; extension is performed at 72°C for 30 s; 35 cycles are conducted; extension is performed at 72°C for 5 min; and the product is preserved at 4°C. The PCR product is separated by 8% of non-denatured acrylamide gel electrophoresis, observed after fast silver staining, and analyzed by map reading. The present invention has beneficial effects as follows: 1. The international rice resistant resource BJ1 and the rice bacterial leaf streak-susceptible high-quality rice Youzhan 8 in Guangxi serving as the parents are hybridized and self-fertilized to obtain the segregation population F2 ; and the segregation population F2 is subjected to resistance identification and genetic analysis. The result indicates that, the resistance is controlled by 1 recessive major gene; the molecular marker RM258 in close linkage with the bacterial leaf streak resistant gene is obtained; and the marker is located at about 48.8 cm of the Chromosome 10. In the present invention, the major genetic locus resistant to bacterial leaf streak is first located on the Chromosome 10 in the rice bacterial leaf streak resistant international rice BJ1 and its derived varieties (lines). According to such a new discovery, identification of the bacterial leaf streak resistant rice can be further expanded or aided. 2. The major genetic locus located by the molecular marker in the present invention is clear in location (located at about 48.8 cm of the Chromosome 10) and
Description
rapid in identification. The bacterial leaf streak resistance of the rice plants can be predicted by detecting the molecular marker in linkage with the genetic locus, and is used for genotyping in the rice bacterial leaf streak resistant international rice BJ1 and its derived varieties (lines), so as to judge whether the variety or the line has the bacterial leaf streak resistance, further rapidly screen disease-resistant varieties or lines for rice breeding and greatly increase selection efficiency of the bacterial leaf streak resistant rice, thereby obtaining the bacterial leaf streak resistant rice variety containing the resistance gene. 3. The aided identification of the bacterial leaf streak resistant rice is goal-oriented, and cost is effectively saved. By detecting the major genetic locus resistant to the bacterial leaf streak, single plants with high bacterial leaf streak resistance can be identified at the seedling stage, and other plants are eliminated. Therefore, the production cost is saved, and the selection efficiency of rice materials resistant to bacterial leaf streak is greatly increased, thereby greatly shortening the breeding cycle of the rice varieties.
Description of Drawings Fig. 1 is a polymorphic electrophoretogram of an amplification product of a labeled primer RM258; Notes: 1 is Marker; 2 is a (disease-resistant) banding pattern of a parent BJ1; 3 is a (susceptible) banding pattern of a parent Youzhan 8; 15 is a susceptible banding pattern; 6, 7, 8, 9, 11, 12, 14 and 16 are disease-resistant banding patterns; and 4, 5, 10 and 13 are hybrid banding patterns. Fig. 2 is a distribution diagram of plants at each resistance level in a population F 2 of rice varieties BJ1 and Youzhan 8.
Detailed Description
Description
Except for mutually exclusive features and/or steps, all features disclosed in the description or steps in all disclosed methods or processes may be combined in any manner. Unless specifically stated, any feature disclosed in the description (including any appended claim and abstract) can be replaced by other equivalent features or alternative features with similar purposes, i.e., unless specifically stated, each of the features is only an example in a series of equivalent or similar features. Embodiment 1: Specific screening steps are as follows: (1) Positioning population construction: reciprocal hybridization was performed on a variety 'BJ1' serving as a donor and 'Youzhan 8' serving as a receptor; F 1 seeds were harvested; the F 1 hybrid seeds were sowed; and selfing was performed on the hybrid seeds so as to harvest F 2 seeds. (2) Resistance identification: The parents and the F1 and F2 populations were respectively planted; 10 parent plants and 10 F1 plants were respectively planted; 251 F 2 plants were planted; dominant pathogenic III strains Liantang 13 in Guangxi were inoculated to the plants at a tillering stage of rice; 2 pins were inserted into rubber glue at a distance of about 8 mm; pinheads were exposed by about 5 mm cm and sterilized for later use; the tested strains Liantang 13 were cultured on an NA medium plate for 48 h and washed down with sterile water and then prepared into 3 x10c fu/mL suspension (used when prepared); sterile sponge that had a size equivalent to a space in the culture dish and had a thickness of about 2 cm was placed in the culture dish; a bacterium solution was poured in the culture dish, and thus the sponge sufficiently sucked the bacterium solution; the inoculated parts of rice leaves were flatly placed on the sponge dish; the rice leaves were needled by the pins with rubber glue (notice: two sides of midrib of the rice leaves were needled); the sponge was squeezed by the rubber glue with the leaves until the bacterium
Description
solution was squeezed out; the bacterium solution was supplied for the sponge at variable intervals during inoculation; each strain was inoculated to 2 newly growing fully unfolding leaves; condition investigation was performed within 20 days after inoculation; lengths of 10 streaks of each single plant were measured; and a resistance level of the single plant to the rice bacterial leaf streak was determined according to the mean value, wherein the classification standard was as shown in Table 1, and the streak length of 1.0 cm served as a resistance-susceptibilityboundary. Table 1 Resistance level classification of rice bacterial leaf streak and corresponding symptom descriptions Resistance Symptom manifestations
Immune (I) Without symptom or with browning reaction
High resistance (HR) Streak length of less than 0.1 cm
Resistance (R) Streak length of 0.1-0.5 cm
Medium resistance (MR) Streak length of 0.6-1.0 cm
Medium susceptibility (MS) Streak length of 1.1-1.5 cm
Susceptibility (S) Streak length of 1.6-2.5 cm
High susceptibility (HS) Streak length of more than 2.5 cm
(3) Construction of DNA in resistant and susceptible pools: 15 F 2 plants with extreme resistance and 15 F2 plants with extreme susceptibility were selected (an extreme resistance streak length of less than 0.5 cm, and an extreme susceptibility streak length of more than 2.5 cm); total DNA of the single plant of rice was extracted by a CTAB method; the DNA was divided into two groups according to the resistance and susceptibility; the total DNA of each single plant was mixed; and resistant and susceptible DNA pools were constructed. (4) SSR molecular marker:
Description
280 pairs of simple sequence repeat markers SSR distributed on 12 chromosomes of rice were selected; polymorphism detection was performed on the parents, i.e., the 'BJ1' and the 'Youzhan 8'; screening was performed to obtain 65 pairs of polymorphic SSR primers having a polymorphism performance rate of 23%; the DNA in the resistant and susceptible gene pools was taken as a PCR template; further polymorphism detection was performed on the screened 65 pairs of SSR primers; and it was discovered that, the SSR marker RM258 from Chromosome 10 had polymorphism among the resistant and susceptible gene pools. A 20 pL reaction system was adopted in the PCR reaction; and the reaction system included 2.0 pL of lOx PCR Buffer (includingMgCl 2), 2.0 pL of 2.5 mmol-L- 1 dNTPs, 11.9 pL of ddH 20, 2.0 pL of 10 pmol-L-' primer, 2.0 pL of template DNA and 0.1 pL of 5U-pL-' Taq DNA polymerase. PCR reaction procedures were as follows: pre-degeneration was performed at °C for 5 min; degeneration was performed at 95°C for 30 s; annealing was performed at 52°C for 30 s; extension was performed at 72°C for 30 s; 35 cycles were conducted; extension was performed at 72°C for 5 min; and the product was preserved at 4°C. The PCR product was separated by 8% of non-denatured acrylamide gel electrophoresis, observed after fast silver staining, and analyzed by map reading. Silver staining procedure (gentle oscillation was required in each step): Fixing: 10% of ethanol + 0.5% of glacial acetic acid for 10 min; Penetrating: 0.2% of silver nitrate for 10 min; Rinsing: double distilled water was used for rinsing twice at a frequency of 10 s each time; 10% of sodium thiosulfate for 30 s; Developing: 1.5% of sodium hydroxide + 1% of formaldehyde; Cleaning: running water was used for washing after a band was visible; The results were shown in Fig. 1.
Description
(5) Genetic analysis/validation: The resistance of all F1 plants subjected to reciprocal hybridization to the bacterial leaf streak is susceptible and highly susceptible, and no disease-resistant plant was discovered, which indicated that resistance of the 'BJ1' was recessive and was controlled by karyogene; 251 single plants of the segregation population F 2 included 12 immune plants, highly resistant plant, 20 resistant plants, 34 medium resistant plants, 29 medium susceptible plants, 39 susceptible plants and 117 highly susceptible plants. Fig. 2 indicated that, different resistant plants in the F 2 were in discontinuous non-normal distribution and had qualitative character distribution features. The 251 single plants of the segregation population F 2 included 66 disease-resistant plants and 185 susceptible plants. Through Chi-square test, resistant (R) and susceptible (S) segregation was in accordance with a theoretical monogenic inheritance segregation ratio of 1:3 (x2 =0.19<x2 0.05=3.84), which indicated that a rice
bacterial leaf streak resistant gene carried on the 'BJ1' was a recessive major gene, was located on the Chromosome 10, and was in close linkage with the SSR marker RM258. Therefore, it can also be indicated that, the molecular marker provided in the present invention can accurately screen out the major gene resistant to the bacterial leaf streak, thereby greatly increasing the breeding efficiency. Table 2 Resistant reactions of the parents and filial generation to bacterial leaf streak Material Number Material grades of each resistance type
of strains Immune High Resistance Medium Susceptibility High
I resistance R resistance S susceptibility
BJ1 10 2 8 0 0 0 0
Youzhan 8 10 0 0 0 0 0 10
F1 10 0 0 0 0 1 9
Description
The above describes preferred feasible embodiments in the present invention in detail. However, the embodiments are not used for limiting the patent application scope of the present invention. Equivalent variations or modifications or changes made under the technical spirit of the present invention shall belong to the patent scope covered by the present invention.
Description
Sequence Listing
<110> Institute of Microbiology of Academy of Agricultural Sciences in Guangxi
Zhuang Autonomous Region
<120> Molecular marker for major genetic locus resistant to rice bacterial leaf
streak and application of molecular marker
<160> 2 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 23 <212> DNA <213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 1
ctccctggcc tttaaagctg tcg 23
<210> 2 <211> 24 <212> DNA <213> Artificial sequence ( 2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 2
gacgaacagc ageagaagag aagc 24
Description
Sequence Listing <110> Institute of Microbiology of Academy of Agricultural Sciences in Guangxi Zhuang Autonomous Region <120> Molecular marker for major genetic locus resistant to rice bacterial leaf streak and application of molecular marker <160> 2 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 23 <212> DNA <213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 1 ctccctggcc tttaaagctg tcg 23 <210> 2 <211> 24 <212> DNA <213> Artificial sequence ( 2 Ambystoma laterale x Ambystomajeffersonianum) <400> 2 gacgaacagc ageagaagag aagc 24
Claims (4)
1. A molecular marker for a major genetic locus resistant to rice bacterial leaf streak, which is located on Chromosome 10 of the rice, wherein an amplified labeled primer is RM258; a left primer sequence is CTCCCTGGCCTTTAAAGCTGTCG; a right primer sequence is GACGAACAGCAGCAGAAGAGAAGC; and an amplified length of the labeled primer is 369 bp.
2. An application of the molecular marker of claim 1 in breeding rice varieties resistant to rice bacterial leaf streak or screening bacterial leaf streak resistant rice varieties for resistance genes.
3. The molecular marker according to claim 1, wherein a screening process of the molecular marker comprises the following steps: (1) positioning population construction: performing reciprocal hybridization on international rice 'BJ1' serving as a donor and high-quality rice 'Youzhan 8' in Guangxi serving as a receptor; harvesting F1 seeds; sowing the F1 seeds; performing selfing on F 1 plants to obtain F 2; and planting to obtain a positioning segregation population near-isogenic line F 2 ; (2) resistance identification: respectively planting the parents and the F1 and F 2 populations; inoculating dominant pathogenic III strains Liantang 13 in Guangxi at a tillering stage of rice; performing condition investigation within 20 days after inoculation; measuring lengths of 10 streaks of each single plant; and determining a resistance level of the single plant to the rice bacterial leaf streak according to the mean; (3) construction of DNA in resistant and susceptible pools: extracting total DNA of leaves of single plant of rice with extreme resistance and susceptibility in the F 2 generation by a CTAB method; dividing the DNA into two groups according to the resistance and susceptibility; mixing the total DNA of each single plant; and constructing resistant and susceptible DNA pools; (4) SSR molecular marker: performing polymorphism detection on the parents, i.e., the international rice 'BJ1' and the high-quality rice 'Youzhan 8' in
Claims
Guangxi; screening to obtain polymorphic SSR primers having a polymorphism performance rate of 23%; taking the DNA in the resistant and susceptible gene pools as a PCR template; performing further polymorphism detection on the screened SSR primers; and discovering that the SSR marker RM258 from Chromosome 10 has polymorphism among the resistant and susceptible gene pools; (5) genetic analysis: 251 single plants of the segregation population F2 comprise 66 disease-resistant plants and 185 susceptible plants; through Chi-square test, resistant (R) and susceptible (S) segregation is in accordance with a theoretical monogenic inheritance segregation ratio of 1:3, which indicates that a rice bacterial leaf streak resistant gene carried on the international rice 'BJ1' is a recessive major gene, is located on the Chromosome 10, and is in close linkage with the SSR marker RM258.
4. The molecular marker according to claim 3, wherein in the step (4), a 20 pL reaction system is adopted in the PCR reaction; and the reaction system comprises 2.0 pL of lOx PCR Buffer (comprisingMgCl 2),2.0 pL of 2.5 mmol-L-' dNTPs, 11.9 pL of ddH 20,2.0 pL of 10 pmol-L-'primer, 2.0 pL of template DNA and 0.1 pL of 5U-pL-' Taq DNA polymerase; PCR reaction procedures are as follows: pre-degeneration is performed at °C for 5 min; degeneration is performed at 95°C for 30 s; annealing is performed at 52°C for 30 s; extension is performed at 72°C for 30 s; 35 cycles are conducted; extension is performed at 72°C for 5 min; and the product is preserved at 4°C; the PCR product is separated by 8% of non-denatured acrylamide gel electrophoresis, observed after fast silver staining, and analyzed by map reading.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2020104096A AU2020104096A4 (en) | 2020-12-15 | 2020-12-15 | Molecular marker for major genetic locus resistant to bacterial leaf streak of rice and application of molecular marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2020104096A AU2020104096A4 (en) | 2020-12-15 | 2020-12-15 | Molecular marker for major genetic locus resistant to bacterial leaf streak of rice and application of molecular marker |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| AU2020104096A4 true AU2020104096A4 (en) | 2021-02-25 |
Family
ID=74668025
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| AU2020104096A Ceased AU2020104096A4 (en) | 2020-12-15 | 2020-12-15 | Molecular marker for major genetic locus resistant to bacterial leaf streak of rice and application of molecular marker |
Country Status (1)
| Country | Link |
|---|---|
| AU (1) | AU2020104096A4 (en) |
-
2020
- 2020-12-15 AU AU2020104096A patent/AU2020104096A4/en not_active Ceased
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755482B (en) | SSR molecular marker III for identifying progeny plants of Gala apples and application thereof | |
| JP2015231359A (en) | Compositions and methods for Peronospora resistance in spinach | |
| CN107058529B (en) | Method for breeding durable resistance material of wheat stripe rust | |
| Yang et al. | Improving rice blast resistance of Feng39S through molecular marker-assisted backcrossing | |
| CN106868182B (en) | Specific primer pair and application thereof in detection of rice resistance to bacterial blight | |
| CN105794631A (en) | Building method of durum wheat-elytrigia elongatum 7E scab-resistant alien-disomic line | |
| CN105238866B (en) | One SNP site related to upland cotton Early mature apricot and its application | |
| CN108004236B (en) | Corn stalk rot disease-resistant molecular breeding method and application thereof | |
| CN105734057B (en) | With the SSR marker and its application of muskmelon downy mildew resistance main effect QTL linkage | |
| CN111073991B (en) | Rice blast resistance gene Pi67(t), codominant molecular marker closely linked with same and application | |
| CN105331689B (en) | Wheat-elytrigia elongata powdery mildew resistant translocation line breeding method and molecular marker thereof | |
| CN104762298B (en) | A kind of rice seedling resistant gene of salt qST11 and its molecule labelling method | |
| AU2020104096A4 (en) | Molecular marker for major genetic locus resistant to bacterial leaf streak of rice and application of molecular marker | |
| CN113278723B (en) | Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application | |
| CN104762299B (en) | A kind of rice seedling resistant gene of salt qST2 and its molecule labelling method | |
| CN107988423A (en) | The SNP marker of rice non-transgenic anti-herbicide gene OsALS and its application | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof | |
| CN113832249A (en) | Molecular marker for detecting specific chromosome fragment of wheat backbone germplasm 8425B and application thereof | |
| CN110195124A (en) | The molecular labeling of rice bacterial leaf streak major gene loci and its application | |
| CN101845504A (en) | Primer sequence for identifying resistance of cucumber against alternaria cucumerina and identification method thereof | |
| CN105850722A (en) | Culture method for stable and homozygous tobacco chromosome single fragment substitution line | |
| CN106350515B (en) | With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN118291673B (en) | QTL (quantitative trait locus), molecular marker, primer and application related to aging resistance of soybeans | |
| CN116574829B (en) | Molecular marker linked with rice mesocotyl elongation gene qML3 and application thereof | |
| CN113136452B (en) | Primer pair for identifying common wheat-haynaldia villosa 6VS.6AL translocation line and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FGI | Letters patent sealed or granted (innovation patent) | ||
| MK22 | Patent ceased section 143a(d), or expired - non payment of renewal fee or expiry |