AU2020101886A4 - Application of miR-541 in preparation of drug against hypoxia-induced neuron injuries, and drug against hypoxia-induced neuron injuries - Google Patents

Abstract

The present invention belongs to the field of biomedical technology and discloses an application of miR-541 in preparation of a drug against hypoxia-induced neuron injuries, and a drug against hypoxia-induced neuron injuries, wherein a nucleotide sequence of the miR 541 is as shown in SEQ ID NO.1. The application and the drug of the present invention can reduce neuron apoptosis caused by hypoxia. 1/2 ) 1500. C.) * L 1000 E u 500 0 fControl microRNA-541 FIG. 1 _ 150 0 0 0 (D C) S50 Control Hypoxia Hypoxia + microRNA-541 FIG. 2

Description

1/2

) 1500. C.)

* L 1000 E

u 500

fControl microRNA-541

FIG. 1

_ 150 0

00 (D C)

S50

Control Hypoxia Hypoxia +

microRNA-541

FIG. 2

APPLICATION OF MIR-541 IN PREPARATION OF DRUG AGAINST

HYPOXIA-INDUCED NEURON INJURIES, AND DRUG AGAINST HYPOXIA-INDUCED NEURON INJURIES

Technical Field

[0001] The present invention relates to the field of biomedical technology, in particular to

the application of miR-541 in preparation of a drug against hypoxia-induced neuron injuries,

and a drug against hypoxia-induced neuron injuries.

Background

[0002] The description of the background of the present invention belongs to the

technology related to the present invention. It is only used to illustrate and facilitate the

understanding of the content of the present invention and should not be construed as the prior

art existing on the first filing date of the present invention based on the applicant's explicit

belief or presumption.

[0003] Hypoxia refers to a pathological process that causes abnormal changes in the

metabolism, function, and morphology of a tissue due to insufficient oxygen supply or

impaired oxygen utilization in the tissue. Hypoxia is a very common pathological process in

various clinical diseases, and hypoxia in vital organs such as the brain and heart is also an

important cause of death. The nervous system is particularly sensitive to hypoxia, and a short

period of hypoxia caused by cerebral infarction, trauma and the like can cause irreversible

damage to neurons, resulting in a very high rate of disability and fatality.

[0004] MicroRNA (miRNA) is a class of non-coding single-stranded RNA molecules

with a length of about 22 nucleotides encoded by endogenous genes. They participate in the regulation of post-transcriptional gene expression in the body and regulate the processes of various life activities. MicroRNA-541 (miR-541) is one of the less studied molecules in microRNAs because of its late discovery. Studies have found that miR-541 can inhibit the proliferation and invasion of squamous cell lung cancer by directly targeting HMGA2. The down-regulation of miR-541 in human liver cancer tissues is related to the clinicopathological phenotype, recurrence and survival of liver cancer. Further studies have shown that miR-541 can inhibit the growth, metastasis and autophagy of liver cancer cells both in vivo and in vitro, which may contribute to its effects of regulating the progress of liver cancer. So far, there has been no research report on the correlation between microRNA

541 and hypoxic injuries, especially hypoxia-induced neuron injuries.

Summary

[0005] The purpose of the present invention is to provide an application of miR-541 in

preparation of a drug against hypoxia-induced neuron injuries, and a drug against hypoxia

induced neuron injuries. The drug of the present invention can reduce neuron apoptosis

caused by hypoxia.

[0006] The purpose of the present invention is achieved through the following technical

solutions:

[0007] In a first aspect, the present invention provides an application of miR-541 in

preparation of a drug against hypoxia-induced neuron injuries. The miR-541 has a nucleotide

sequence as shown in SEQ ID NO.1.

[0008] In a second aspect, the present invention provides a drug against hypoxia-induced

neuron injuries, wherein the drug comprises miR-541, and a nucleotide sequence of the miR

541 is as shown in SEQ ID NO.1.

[0009] Further, the drug comprises a pharmaceutically acceptable carrier for the miR

541.

[0010] Further, the carrier is cholesterol, a virus, a nanoparticle or a liposome.

[0011] Further, the drug is formed by ligating the miR-541 and the carrier.

[0012] Further, the drug is an injection preparation, an oral preparation, a spray

preparation, an ointment preparation or a patch.

[0013] The present invention has the following beneficial effects:

[0014] miR-541 can inhibit the decline of neuro mitochondrial membrane potential

caused by hypoxia, reduce the activity of lactate dehydrogenase (LDH) in the culture

supernatant of hypoxic neurons, and reduce neuron apoptosis caused by hypoxia.

Brief Description of Figures

[0015] FIG. 1 shows the effect of the miR-541 adenovirus vector on the expression level

of miR-541 in neurons in an embodiment of the present invention (*P<0.05, compared with

the hypoxia group).

[0016] FIG. 2 shows the effect of the miR-541 adenovirus vector on the mitochondria of

hypoxic neurons in an embodiment of the present invention (*P<0.05, compared with the

hypoxia group).

[0017] FIG. 3 shows the effect of the miR-541 adenovirus vector on the LDH activity of

hypoxic neuron culture in an embodiment of the present invention (*P<0.05, compared with

the hypoxia group).

[0018] FIG. 4 shows the effect of the miR-541 adenovirus vector on the apoptosis rate of

hypoxic neurons in an embodiment of the present invention (*P<0.05, compared with the

hypoxia group).

Detailed Description

[0019] The application will be further introduced below in conjunction with

embodiments.

[0020] In order to more clearly describe the technical solutions in the embodiments of the

present invention or in the prior art, in the following description, different "one embodiment"

or "embodiment" does not necessarily refer to the same embodiment. Different embodiments

can be replaced or combined with one another. For those of ordinary skill in the art, other

implementations can be obtained based on these embodiments without creative work.

[0021] The present invention provides an application of miR-541 in preparation of a drug

against hypoxia-induced neuron injuries, wherein a nucleotide sequence of the miR-541 is as

shown in SEQ ID NO.1.

[0022] miR-541 sequence: UCAGGUCUAAGACACGGGUGGU (SEQ ID NO.1),

which is from homo sapiens.

[0023] The present invention provides a drug against hypoxia-induced neuron injuries,

wherein the drug comprises miR-541, and a nucleotide sequence of the miR-541 is as shown

in SEQ ID NO.1.

[0024] In some embodiments of the present invention, the drug comprises a

pharmaceutically acceptable carrier for the miR-541.

[0025] In other embodiments of the present invention, the carrier is cholesterol, a virus, a

nanoparticle or a liposome.

[0026] In other embodiments of the present invention, the drug is formed by ligating the

miR-541 and the carrier.

[0027] In some other embodiments of the present invention, the drug is an injection

preparation, an oral preparation, a spray preparation, an ointment preparation or a patch.

[0028] Unless otherwise specified in the methods in the following examples, the

biochemical reagents used are all commercially available reagents, and all methods are

conventional methods.

[0029] Example 1 Adenovirus packaging of miR-541

[0030] I. Preparation of miR-541 adenovirus vector

[0031] Firstly, the precursor gene sequence of miR-541 was searched through Pubmed, a

total of 84 amino acids, and the sense and antisense strand DNA sequences (the parts of SEQ

ID NO. 2 and SEQ ID NO. 3 shown in lowercase letters) of the pre-miR-541 expression

vector were designed accordingly, and restriction sites EcoRI and BamHI and their protective

bases (the parts shown in uppercase letters) were manually added. The DNA sequence was

synthesized by chemical synthesis.

[0032] The specific operations are as follows:

[0033] 1. The following single-stranded DNA oligo (Shanghai Genechem Co., Ltd.) is

synthesized by chemical synthesis:

'to 3'

CCGGAATTCacgtcagggaaaggattctgctgtcggtcccactccaaagttcacagaatgggtggtgggcacagaatctgga

ctctgcttgtgCGCGGATCC (SEQ ID NO.2)

CGCGGATCCcacaagcagagtccagattctgtgcccaccacccattctgtgaactttggagtgggaccgacagcagaatccttt

ccctgacgtGAATTCCGG (SEQ ID NO.3)

[0034] 2. The synthesized DNA dry powder is dissolved in an annealing buffer, kept in a

water bath at 90°C for 15 min, and then allowed to naturally cool to room temperature to

produce double strands.

[0035] 3. Ligation

[0036] The RNAi adenovirus vector GV119 (Shanghai Genechem Co., Ltd.) linearized

with double enzyme digestion (EcoRI and BamHI) is ligated with the above-mentioned DNA

fragments by T4 DNA ligase, and the ligated product is subjected to transformation

experiments. The ligation reaction system is as follows, the ligation is conducted at 16°C

overnight, and the ligated product (ligation liquor) is subjected to transformation

experiments. The reagents used are shown in Table 1.

Table 1 Reagent Volume (pl) Linearized vector DNA, 100 ng/l 1 DNA oligo, 100 ng/l 1 10*T4 phage DNA ligase buffer 2 T4 phage DNA ligase 1

ddH20 15

[0037] 4. Transformation

[0038] Preparation of competent cells:

[0039] The following solutions are prepared:

[0040] 1) 0.1 M CaCl2 solution, sterilized by filtering with a 0.45 m filter;

[0041] 2) 250 mM KC12 solution;

[0042] 3) 2 M MgCl2 solution, autoclaved;

[0043] 4) SOB: 1 ml of 250 mM KC12 solution is added to 100 ml of LB, adjusted to pH

7.0 with 5 M NaOH, autoclaved, and 0.5 ml of 2 M MgCl2 solution is added thereto just

before use.

[0044] Preparation of fresh DH5a Escherichiacoli competent cells with calcium chloride

[0045] 1) A single colony is picked from a fresh plate cultured at 37°C for 16 hours,

transferred to a 1 L flask containing 100 ml of SOB medium, and incubated with vigorous

shaking at 37°C for 3 hours (rotary shaker, 300 rpm).

[0046] 2) Under aseptic conditions, the bacteria are transferred to a sterile 50 ml

polypropylene tube pre-cooled with ice, which is then placed on ice for 10 min to cool the

culture to 0°C.

[0047] 3) The culture is centrifuged at 4°C at 4000 rpm for 10 min to recover the cells.

[0048] 4) The culture is poured out and the tube is turned upside down for1 min to drain

the last trace of culture medium.

[0049] 5) Each precipitate is re-suspended in 10 ml of 0.1 mol/L CaCl2 pre-cooled with

ice and placed in an ice bath.

[0050] 6) The culture is centrifuged at 4°C at 4000 rpm for 10 min to recover the cells.

[0051] 7) The culture is poured out and the tube is turned upside down for 1 min to drain

the final residual trace culture.

[0052] 8) For every 50 ml of the initial culture, each cell precipitate is re-suspended with

2 ml of 0.1 mol/L CaCl2precooled with ice.

[0053] 9) The cells are divided into small parts and put at -70°C.

[0054] Transformation process:

[0055] The following solutions are prepared:

[0056] 1) 250 mM KC12 solution.

[0057] 2) 2 m MgCl2 solution, autoclaved.

[0058] 3) SOB medium: 1 mL of 250 mM KC12 solution is added to 100 ml of LB,

adjusted to a PH value of 7.0 with 5 M NaOH, and autoclaved; and 0.5 ml of 2 M MgCl2

solution is added thereto just before use.

[0059] 4) SOB agar medium: 0.49396 g of MgSO4.7H20is dissolved in 100 ml of SOB

medium, 1.5 g of agar powder is added thereto, and the solution is autoclaved, and cooled

down to a temperature lower than 60°C; Amp is added to reach a final concentration of 100

[tg/ml; the medium is well mixed and plated, wherein generally 30-50 ml of medium is

needed for a plate with a diameter of 90 mm.

[0060] 5) 1 M glucose solution, sterilized by filtering through a filter;

[0061] 6) SOC medium: 2 ml of 1 M glucose solution added to 100 ml of SOB medium.

[0062] Transformation steps:

[0063] 1) 200 [ of each competent cell suspension is transferred to a sterile

microcentrifuge tube using a cooled sterile pipette tip, 2 1 of ligation liquid is added to each

tube which is then rotated gently to mix the contents, and placed in ice for 30 min.

[0064] 2) The tube is placed on a tube rack placed in a circulating water bath preheated to

42°C for exactly 90 seconds. Do not shake the tube. Then, the tube is quickly transferred to

the ice bath to cool the cells for 1-2 min.

[0065] 3) 800 1 of SOC medium is added to each tube. The culture medium is heated to

37°C in a water bath, then the tube is transferred to a shaker at 37°C and incubated for 45 min

to resuscitate the bacteria, and 150 1 of transformed competent cells are transferred to Amp

resistant (100 g/ml) LB agar medium containing 20 mmol/L MgSO4.

[0066] 4) The plate is placed at room temperature until the liquid is absorbed, then the

plate is turned upside down, cultured at 37°C for 16 hours.

[0067] 5) Positive clone PCR is performed.

[0068] 5. PCR identification of positive clones.

[0069] The transformants are picked and suspended in 10 1 of LB solution, mixed well

and 1 1 is taken as template, and the colony PCR identification experiment is carried out by

using GV119 universal primer (Shanghai Genechem Co., Ltd.).

[0070] PCR identification system and PCR procedure:

[0071] See Table 2 for reagents and their usage.

Table 2

Reagent Volume (pl)

10*buffer 2

dNTPs (2.5 Mm) 0.8

Primer(+) 0.4

Primer(-) 0.4

Taq polymerase 0.2

Template 1

ddH20 15.2

[0072] PCR procedure (see Table 3):

Table 3

Temperature Time Number of cycles

940 C 30s 1

940 C 30s 600 C 30s 30

720 C 30s

720 C 6min 1

[0073] Sequencing of positive clone: The PCR positive clone is sequenced. The sequence

is as shown in the nucleotide sequence shown in SEQ ID No. 3 in the sequence listing. The

sequencing result is correct and consistent with the synthesized sequence.

[0074] II. Packaging and titer detection of siRNA adenovirus

[0075] 1. Adenovirus packaging

[0076] 1.1 HEK293 (ATCC, cat# CRL-1573) cell culture

[0077] 1) Viable cell count

[0078] The cell suspension is diluted to 200-2000 cells/ml with serum-free DMEM

medium (generally the dilution factor is 100 times), and 0.1 ml of 0.4% trypan blue solution

is added to 0.1 ml of cell suspension. The mixture is mixed gently, and after a few minutes,

cells are counted with a hemocytometer. Viable cells reject trypan blue, so cells stained blue

are dead cells.

[0079] 2) Cryopreservation of cell lines

[0080] The cells that have grown vigorously for 2 to 3 days are taken, and made into

2x10 6-2x10 7/ml with the cell culture medium. 0.5 ml of the cell suspension, 0.4 ml of FBS

and 0.1 ml of DMSO (or glycerol) are added to a 1 ml freezing tube, mixed and sealed. The

tube is placed at 4°C for 1 hour and -20°C for 2 hours, and then directly put in liquid

nitrogen, or alternatively, placed in liquid nitrogen steam overnight and then immersed in

liquid nitrogen.

[0081] 3) Cell thawing

[0082] The freezing tube is taken out from the liquid nitrogen tank. Protective glasses and

gloves should be worn. It is quickly put in a water bath at 37°C, shaken from time to time to

thaw as soon as possible. After wiped and disinfected with 70% alcohol, it is moved to the

clean bench, the cell suspension is drawn into a culture flask, 3 ml of DMEM medium

containing 10% FBS is additionally added, and the flask is placed in an incubator for culture.

The culture medium is replaced once the next day and further culturing is carried out.

[0083] 4) Cell passage

[0084] The old culture medium is discarded, 5 ml of sterile PBS solution is added, the

flask is shaken gently to wash the cell growth surface, and then the PBS solution is discarded.

1 ml of 0.25% trypsin digestion liquid is added to digest for 1-2 min until the cells are

completely digested. 5 ml of DMEM medium containing 10% FBS and 100 U/ml double

antibodies is added, pipetted several times with a graduated pipette to wash the cells on the

flask wall. After mixing, the cells are transferred into a new culture flask according to 1:5 or

1:6 for further culture. After about 3 days, when the cell growth surface is full of cells, re

passaging is conducted.

[0085] 1.2 Preparation of DNA solution

[0086] The adenovirus shuttle plasmid (the siRNA adenovirus vector prepared above)

and the auxiliary packaging plasmid (pBHG lox AE1,3 Cre (Microbix. Canada)) are

amplified with E. coli strain DH5a, and the method is as follows:

[0087] 1) 200 pl of DH5a is transferred to a sterile microcentrifuge tube using a cooled

aseptic pipette tip, 2 pl of adenovirus shuttle plasmid or auxiliary packaging plasmid is added

to each tube which is then rotated gently to mix the contents, and placed in ice for 30 min.

[0088] 2) The tube is placed on a tube rack placed in a circulating water bath preheated to

42°C for exactly 90 seconds without shaking the test tube. Then, the tube is quickly

transferred to a ice bath to cool the cells for 1-2 min.

[0089] 3) 800 1 of SOC medium is added to each tube. The culture medium is heated to

37°C in a water bath, then the tube is transferred to a shaker at 37°C and incubated for 45 min

to recover the bacteria; and 150 1 of transformed competent cells are transferred to Amp

resistant (100 g/ml) LB agar medium containing 20 mmol/L MgSO4.

[0090] 4) The plate is placed at room temperature until the liquid is absorbed, then the

plate is turned upside down, and cultured at 37°C for 16 hours.

[0091] 5) A monoclone is picked up and added to Amp-resistant (100 g/ml) LB liquid

medium, and cultured on a shaker at 37°C for 12-16 hours.

[0092] 6) Plasmid DNA is extracted from the bacterial liquor obtained in step 5 using

Qiagen's plasmid extraction kit (Cat. 12145). The plasmid DNA is dissolved in sterile TE,

and measured for concentration and purity by the ultraviolet light absorption method to

ensure that the A260/A280 of the plasmid DNA is between 1.8 and 2.0.

[0093] 1.3 Plasmid transfection

[0094] 1) 24 hours before transfection, HEK293 cells in logarithmic growth phase are

digested with 0.25% trypsin, adjusted with DMEM medium containing 10% FBS to make the

cell density become 30%-40%, re-inoculated in a T25 flask, and cultured in a 37°C and 5%

C02 incubator. In about 24 hours, the cells can be used for transfection when the cell density

reaches 50%-60%. Cell state is very important for virus packaging, so it is necessary to

ensure good cell state and fewer passages.

[0095] 2) The cell culture medium is changed to serum-free DMEM medium 2 hours

before transfection.

[0096] 3) 5 pg of the prepared DNA solution (shuttle plasmid (the above siRNA

adenovirus vector)) and 5 g of auxiliary packaging plasmid (pBHG lox AE 1,3 Cre

(Microbix. Canada)) are added into a sterile centrifuge tube and mixed with DMEM evenly,

adjusted to a total volume of 50 d, and incubated at room temperature for 5 min.

[0097] 4) The Lipofectamine 2000 reagent is gently shaken, 10 [ of the Lipofectamine

2000 reagent is taken and mixed with 50 [ of DMEM in another tube, and incubated at room

temperature for 5 min.

[0098] 5) The diluted DNA is well mixed with the diluted Lipofectamine 2000 by gentle

turning the tube upside down without shaking.

[0099] 6) After mixing, the mixture is incubated at room temperature for 20 min to form

a transfection complex of DNA with Lipofectamine 2000 dilution.

[00100] 7) The mixture of DNA and Lipofectamine 2000 is transferred to the culture

containing HEK293 cells, well mixed, and cultured in a 37°C, 5% C02 cell incubator.

[00101] 8) After culture for 6 h - 8 h, the medium containing the transfection mixture is

poured out, 2 ml of PBS liquid is added to each bottle of cells, the culture bottle is shaken

gently from side to side to wash away the remaining transfection mixture, and then poured

out.

[00102] 9) 5 ml of cell culture medium containing 10% serum is added to each bottle of

cells to continue culture in a 37°C, 5% C02 incubator.

[00103] 10) The cell growth status after transfection is observed every day. If the cell

culture medium turns yellow obviously, an appropriate amount of fresh complete culture

medium is additionally added as appropriate.

[00104] 1.4 Harvest of recombinant adenovirus

[00105] About 10-15 days after transfection, HEK 293 cells begin to fall, and some cells

show cytopathic effect (CPE). After most of the cells present typical CPE and 50% of the

cells are detached, the cells are collected by low-speed centrifugation and re-suspended in 2 ml of DMEM, repeatedly frozen-thawed at -70°C/37°C with shaking for 3 times, and centrifuged at 4°C and 7000 g for 5 min. The virus supernatant is collected and stored at

0 C.

[00106] 2. Amplification of adenovirus

[00107] 2.1 The first round of amplification

[00108] The HEK293 cells in good growth condition in a T25 cell culture flask is 4-fold

diluted and transferred to another T25 cell culture flask where they are cultured in DMEM

medium containing 10% FBS at 37 0C, 5% C02 (the cells are cultured under this condition in

all the following amplifications). When the cells reach 60% confluence, the old culture

medium is discarded, 2 mL of the crude extract harvested after successful recombination of

the replication-defective adenovirus is add into the culture flask. The culture flask is placed in

a cell culture incubator for 90 min, and finally 3 mL of complete culture medium is

additionally added to the culture flask to continue culture. When most of the cells present

typical CPE and 50% of the cells are detached, the cells are collected by low-speed

centrifugation and re-suspended in 2 ml of DMEM, repeatedly frozen and thawed at

°C/37C with shaking for 3 times, and centrifuged at 4 0C and 7000 g for 5 min. The virus

supernatant is collected and store at -700 C.

[00109] 2.2 The second round of amplification

[00110] All the HEK293 cells in good growth condition in a T25 cell culture flask are

transferred to a T75 cell culture flask where they are further cultured with complete culture

medium. When the cells reach 90% confluence, the old culture medium is discarded, 2 ml of

the virus liquid obtained from the first round of amplification is added to the culture flask.

The culture flask is placed in the cell culture incubator to incubate for 90 min, and finally 10

mL of complete culture medium is additionally added to the culture flask to continue culture.

When most of the cells show typical CPE and 50% of the cells are detached, the cells are

collected by low-speed centrifugation and re-suspended in 10 ml DMEM, repeatedly frozen

and thawed at -70°C/37°C with shaking for 3 times, and centrifuged at 4°C and 7000 g for 5

min. The virus supernatant is collected and stored at -70°C.

[00111] 3. Adenovirus purification

[00112] The recombinant adenovirus is purified according to the steps of Adeno-XTM

Virus Purification Kit (BD Biosciences, Clontech), and the main steps are as follows:

[00113] 1) The BD Adeno-X purification device is taken out to filter 10 ml of the crude

virus solution with a 0.45 m filter membrane, and the filtrate is stored in a collection bottle;

[00114] 2) 4 pl of 25 U/pl Benzonase is added to the virusfiltrate, well mixed, and

incubated at 37°C for 30 min;

[00115] 3) 10 ml of 1x dilution buffer is added to the collection bottle and well mixed with

the virus filtrate;

[00116] 4) 5 ml of sterilized PBS is drawn into a 20 ml syringe, the syringe is inserted into

the filter to push PBS to go through the cannula to exhaust the air in thefilter and cannula;

[00117] 5) The cannula is inserted into the virus filtrate in the collection bottle;

[00118] 6) The virus filtrate is drawn into the syringe, pushed out at a speed of 5 ml/min to

flow through the filter. Care should be taken to avoid air entering the system;

[00119] 7) The inlet of the cannula is transferred from the collection bottle to 1x Wash

Buffer;

[00120] 8) The wash buffer is drawn into the syringe through the cannula, and all the wash

buffer is pushed to flow through the filter at a speed of 5 ml/min;

[00121] 9) The filter is taken down;

[00122] 10) Eluting adenovirus using a 5ml BD Luer-Lok syringe: 3 ml of 1x Elution

Buffer is drawn into the syringe; the syringe is connected to the notch of the filter, 1 ml of

Elution Buffer is pushed to flow through the filter into a 5 ml sterile centrifuge tube; the filter

is incubated at room temperature for 5 min, and the remaining elution buffer is pushed to

flow through the filter to collect the remaining adenovirus;

[00123] 11) The purified adenovirus is sub-packaged and stored at -70°C.

[00124] 4. Adenovirus titering

[00125] 4.1 Adenovirus titering -endpoint dilution method

[00126] 1) 24 hours before the experiment, 100 pl of HEK293 cell suspension containing

about 1x10 3 cells is added to each well of the 96-well plate;

[00127] 2) 10 sterile Ep tubes are prepared, 990 1 of complete culture medium is added to

the first Ep tube, and 900 1 of complete culture medium is added to each of the remaining 9

tubes.

[00128] 3) Dilution of the virus liquid to be tested: 10 pl of the adenovirus stock solution

is measured and added to the 990 pl Ep tube to make a 1:100 dilution (10-2); then with this as

a starting point, 100 pl of the diluted solution is measured and added to a 900 pl Ep tube to

make a 1:10 dilution (10-') until 10-13 is reached.

[00129] 4) The 96-well plate is taken out from the cell incubator to confirm under the

microscope that the cells in each well are growing well. The old culture medium is drawn out and discarded, and then the virus liquids sequentially diluted at 1013 to 106 are added to the

96-well plate, each dilution occupies one row; and for each row, to each of wells 1-10, 90 [

of virus liquid is added, and for each of wells 11-12, 90 1 of virus-free complete culture

medium is added to act as a control.

[00130] 5) The 96-well plate is place in a 37°C, 5%CO2cell incubator to continue culture.

[00131] 6) The cytopathic phenomenon is observed after 10 days, the CPE wells are

counted to analyze the positive rate of each row, and the virus titer is calculated (Spearman

Karber Method):

[00132] 4.2 Calculation method of virus titer

[00133] Virus titer = 10(x+0.8)(PFU/ml), x = the sum of the positive rates of CPE under

successive dilutions of 101 to 10-13.

[00134] The titer obtained in the end was 1x10° PFU/ml.

[00135] *Conditions applicable to the formula:

[00136] a. The negative control has no CPE and growth inhibition;

[00137] b. The wells with the minimum dilution concentration of virus liquid all have

CPE.

[00138] Example 2 Transfection of hippocampal neurons of newborn SD rats by miR-541

adenovirus and detection of its interference efficiency

[00139] 1) Newborn SD (Sprague Dawley) rats (within 3 days of birth) purchased from

Beijing Vital River Laboratory Animal Technology Co., Ltd. (website:

https://www.vitalriver.com/) were used. After the newborn SD rats were anesthetized, the hippocampus was immediately taken out, and the primary hippocampal neurons of the newborn rats were obtained by trypsin (sigma) digestion.

[00140] 2) Adenovirus was added to the cell culture medium at a concentration of 100

PFUs/cell

[00141] 3) After 48 hours, the cells were observed under the microscope, collected, and

detected for the changes of miR-541 expression in the cells by RT-PCR.

[00142] As shown in FIG. 2, the expression level of miR-541 in the neurons transfected

with miR-541 adenovirus was significantly higher than that of the control group. It shows

that the constructed miR-541 adenovirus can effectively increase the expression level of miR

541 in the transfected cells.

[00143] Example 3 The therapeutic effect of miR-541 adenovirus prepared in Example 3

on hypoxia-induced neuron injuries

[00144] The primary culture of hippocampal neurons of newborn SD rats were divided

into three groups:

[00145] (1) Normal control (NC);

[00146] (2) Hypoxia, where the cells were incubated with1%02 (volume percentage) for

6 hours;

[00147] (3) Hypoxic cells interfered with miR-541 adenovirus, where adenovirus was

added to the cell culture medium at a concentration of 100 PFUs/cell, and the culture was

continued for 48 hours under the condition of 1%02, and the cells and their culture

supernatant were collected;

[00148] (4) The collected cells were stained with JC-1 (Solarbio, M8650), and detected for

mitochondrial membrane potential by flow cytometry. Or alternatively, the collected cells

were fixed with 70% ethanol overnight, stained with PI staining solution (leagene, DA0021),

and then detected for apoptosis by flow cytometry. The collected cell culture supernatant was

detected using LDH detection kit (Beyotime, COO16) for lactate dehydrogenase activity

[00149] (5) The specific results are as follows:

[00150] 1) The effect of miR-541 adenovirus vector on the mitochondrial membrane

potential of hypoxic hippocampal neurons was detected by flow cytometry. The results

showed that miR-541 inhibited the decrease of mitochondrial membrane potential of hypoxic

hippocampal neurons (FIG. 1). The mitochondrial membrane potential represents the

functional state of mitochondria, and mitochondria are the energy factories of neurons and

important signal pathway integrators. This result indicated that the miR-541 adenovirus

vector can effectively protect neurons damaged by hypoxia.

[00151] 2) The effect of miR-541 adenovirus vector on LDH (lactate dehydrogenase)

activity in hypoxic hippocampal neuron culture medium was detected. The results showed

that miR-541 inhibited LDH activity in hypoxic hippocampal neuron culture medium (see

FIG. 3). LDH is released into the culture medium during cell damage. The LDH in the culture

medium represents the degree of cell damage. This result indicates that the miR-541

adenovirus vector can avoid hypoxia-induce injuries of hippocampal neurons, and once again

shows that the miR-541 adenovirus vector has a protective effect on hypoxic neurons.

[00152] 3) The effect of the miR-541 adenovirus vector on the apoptosis of hypoxic

hippocampal neurons was detected by flow cytometry. The results are shown in FIG. 4: miR-

541 intervention resulted in a significant decrease in the apoptosis rate of hypoxic

hippocampal neurons. Apoptosis is the main way of hypoxic neuron death, miR-541

adenovirus vector can significantly reduce the apoptosis rate of hypoxic neurons, which

directly proves the protection of the miR-541 adenovirus vector to hypoxic neurons.

[00153] The results show that a pharmaceutical composition composed of miR-541 and a

pharmaceutically acceptable carrier has similar effects to miR-541.

[00154] It should be noted that the above embodiments can be freely combined as

required. The above descriptions are only preferred embodiments of the present invention and

are not intended to limit the present invention. For those skilled in the art, the present

invention can have various modifications and changes. Any modification, equivalent

replacement, improvement, etc., made within the spirit and principle of the present invention

shall be included in the protection scope of the present invention.

Claims (6)

CLAIMS:

1. An application of miR-541 in preparation of a drug against hypoxia-induced neuron

injuries, wherein a nucleotide sequence of the miR-541 is as shown in SEQ ID NO.1.

2. A drug against hypoxia-induced neuron injuries, wherein the drug comprises miR

541, and a nucleotide sequence of the miR-541 is as shown in SEQ ID NO.1.

3. The drug according to claim 2, wherein the drug comprises a pharmaceutically

acceptable carrier for the miR-541.

4. The drug according to claim 3, wherein the carrier is cholesterol, a virus, a

nanoparticle or a liposome.

5. The drug according to claim 3 or 4, wherein the drug is formed by ligating the miR

541 and the carrier.

6. The drug according to claim 2, wherein the drug is an injection preparation, an oral

preparation, a spray preparation, an ointment preparation or a patch.

Relative content of miR-541 in cells (%) Relative change of mitochondrial membrane potential (%)

Control Control 1/2

FIG. 2 FIG. 1

Hypoxia Hypoxia +

Lactate dehydrogenase activity Apoptosis rate (%) (mU/mL)

Control

Control 2/2

FIG. 4 FIG. 3

Hypoxia Hypoxia Hypoxia +

Hypoxia +