AU2020100469A4 - Molecular marker primer for identifying sphyraena pinguis and sphyraena putnamae and application thereof - Google Patents
Molecular marker primer for identifying sphyraena pinguis and sphyraena putnamae and application thereof Download PDFInfo
- Publication number
- AU2020100469A4 AU2020100469A4 AU2020100469A AU2020100469A AU2020100469A4 AU 2020100469 A4 AU2020100469 A4 AU 2020100469A4 AU 2020100469 A AU2020100469 A AU 2020100469A AU 2020100469 A AU2020100469 A AU 2020100469A AU 2020100469 A4 AU2020100469 A4 AU 2020100469A4
- Authority
- AU
- Australia
- Prior art keywords
- sphyraena
- pinguis
- primer
- putnamae
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
An objective of the present invention is to provide a molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae and application thereof, which can help solve the problem of mixed species of sphyraena fishes. The molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae includes a primer F and a primer R, and the primer sequences are as follows: the primer F: TCAACCAACCACAAAGACATT; and the primer R: ATTATTAGGGGGATGAGTCAGTT. The molecular marker primer is applied to the idenfication of Sphyraena pinguis and Sphyraena putnamae. Results of the molecular marker sequences show that the two fishes have a difference of 35 bases, which are represented by 25 transformations and 10 transversions. The results are stable and the reproducibility is high. A method of the present invention is simple to operate, easy to grasp and high in accuracy.
Description
MOLECULAR MARKER PRIMER FOR IDENTIFYING
SPHYRAENA PINGUIS AND SPHYRAENA PUTNAMAE AND
APPLICATION THEREOF
TECHNICAL FIELD
The present invention belongs to the field of molecular biotechnology, and particularly relates to a molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae and application thereof
BACKGROUD
Sphyraena pinguis and Sphyraena putnamae belong to Sphyraena, Sphyraenidae, Perciformes. They are widely distributed in the Indian Ocean and the Pacific Ocean and are most common in the South China Sea. The two fishes are delicate and delicious, and have high edible value. They are important marine fishes fished in the southern provinces of China. The external features are: fusiform shape, pointed and long head; black brown upper portion of the side of the body; grey white lower portion; large mouth, maxillary edge composed of anterior premaxillary bone; strong teeth, canine-like, deeply implanted in the bone recess; less or degraded gill raker; cycloid scale covering the body; developed and straight lateral line; pectoral fin at a mid-side position; and fork-shaped caudal fin. Both fishes are near-shore economic fishes with delicious meat and high edible value.
A current method for distinguishing Sphyraena pinguis and Sphyraena putnamae juveniles has not been officially reported. Therefore, how to search for reliable molecular markers of Sphyraena pinguis and Sphyraena putnamae and identify Sphyraena pinguis and Sphyraena putnamae juveniles from mixed species has become an urgent problem to be solved.
SUMMARY
In view of the foregoing problems, an objective of the present invention is to provide a molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae and application thereof, which can help solve the problem of mixed species of sphyraena fishes.
The technical solution of the present invention is as follows:
a molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae , including a primer F and a primer R, where a sequence of the primer F is shown in SEQ ID NO: 1, and a sequence of the primer R is shown in SEQ ID NO: 2; and the specific sequences are as follows:
2020100469 27 Mar 2020 primer F: TCAACCAACCACAAAGACATT; and primer R: ATTATTAGGGGGATGAGTCAGTT.
Application of the molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae is provided, where the molecular marker primer is used for identifying Sphyraena pinguis and Sphyraena putnamae.
An identification method includes the following steps:
1) selecting Sphyraena pinguis and Sphyraena putnamae to form sample populations, and extracting DNAs of the two sample populations respectively;
2) : respectively using the DNAs extracted in step 1) as templates to amplify the primer F and the primer R through a PCR reaction system;
3) : purifying and sequencing amplified products obtained in step 2) to obtain sequences of molecular markers of Sphyraena pinguis and Sphyraena putnamae respectively; and
4) : comparing sequencing results to identify the species.
The sequence of the molecular marker of Sphyraena pinguis in step 3) is shown in SEQ ID NO: 3, and the sequence of the molecular marker of Sphyraena putnamae is shown in SEQ ID NO: 4;
a reagent of the PCR reaction system in step 2) includes 17.5 ul of ultra-pure water, 2.5 ul of 10 x buffer, 2 ul of dNTPs, 0.15 ul of rTaq, 1 ul of DNA template, and 1 ul of each primer; and a procedure for the amplification includes pre-denaturation at 94°C for 2-5 min, then denaturation at 94°C for 35 s, annealing at 50-53°C for 30-35 s, extension at 72°C for 35 s, proceeding of 30-38 cycles, final extension at 72°C for 3-10 min, and storage at 4°C.
Further, according to the application of the molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae, a kit including the molecular marker primer and the reagent of the PCR reaction system is applied to the identification of Sphyraena pinguis and Sphyraena putnamae , and the application also includes that the molecular markers are used for identifying Sphyraena pinguis and Sphyraena putnamae .
Beneficial effects of the present invention are as follows:
According to the present invention, the designed primers of the molecular markers are utilized to perform PCR amplification to obtain the sequences of the molecular markers. According to results, the two fishes have a difference of 35 bases, which is shown as 25 transformations and 10 transversions. The results are stable and the reproducibility is high.
The present invention provides a method favorable for identifying two different species, Sphyraena pinguis and Sphyraena putnamae, from the genomic level by using a molecular
2020100469 27 Mar 2020 marker technology, thereby effectively avoiding the problems of economic losses and destruction of the ecological environment and the like caused by difficulty in distinguishing appearances and the like, which is favorable for solving the problems of mixed marine Sphyraena fish species, and provides technical support for fishery resource conservation, rational use and biodiversity research.
The identification method of the present invention is simple to operate, has strong primer specificity and high efficiency of PCR amplification, and is easy to grasp. The identification results have high accuracy and stability.
DESCRIPTION OF THE EMBODIMENTS
The present invention is further described in detail below by way of specific embodiments. These embodiments are only intended to illustrate the present invention and are not intended to limit the protection scope of the present invention. Modifications of various equivalent forms of the present invention by those skilled in the art after the reading of the present invention are defined by the appended claims of the present application.
Unless otherwise stated, all the raw materials and reagents of the present invention are conventional raw materials and reagents on the market.
Embodiment 1
Molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae and an identification method thereof:
1) Select Sphyraena pinguis and Sphyraena putnamae acquired from Beibu Gulf sea area of China to form sample populations, and extract DNAs of the two sample populations respectively.
2) : Use the DNAs extracted in step 1) as templates to amplify the primer F and the primer R respectively through a PCR reaction system.
The composition of the PCR reaction system is:
the following are sequentially added into a 0.2 ml centrifuge tube:
ultra-pure water 17.5 ul x buffer 2.5 ul dNTPs 2 ul rTaq 0.15 ul template 1 ul primer 1 ul for each
A procedure for PCR amplification includes pre-denaturation at 94°C for 2 min, (denaturation at 94°C for 15 s, annealing at 50°C for 15 s, extension at 72°C for 15 s) x 38
2020100469 27 Mar 2020 cycles, extension at 72°C for 3 min, and storage at 4°C, where PCR products can be stored for a long term.
3): Purify and then sequence the amplified products, and compare sequencing results of the two populations to identify the species.
Embodiment 2
Molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae and an identification method thereof:
1) Select Sphyraena pinguis and Sphyraena putnamae acquired from Beibu Gulf sea area of China to form sample populations, and extract DNAs of the two sample populations respectively.
2) : Use the DNAs extracted in step 1) as templates to amplify the primer F and the primer R respectively through a PCR reaction system.
The composition of the PCR reaction system is:
the following are sequentially added into a 0.2 ml centrifuge tube:
ultra-pure water 17.5 ul x buffer 2.5 ul dNTPs 2 ul rTaq 0.15 ul template 1 ul primer 1 ul for each
A procedure for PCR amplification includes pre-denaturation at 94°C for 4 min, (denaturation at 94°C for 35 s, annealing at 53°C for 30 s, extension at 72°C for 15 s) x 30 cycles, extension at 72°C for 10 min, and storage at 4°C, where PCR products can be stored for a long term.
3) : Purify and then sequence the amplified products, and compare sequencing results of the two populations to identify the species.
Embodiment 3
Molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae and an identification method thereof:
1) Select Sphyraena pinguis and Sphyraena putnamae acquired from Beibu Gulf sea area of China to form sample populations, and extract DNAs of the two sample populations respectively.
2) : Use the DNAs extracted in step 1) as templates to amplify the primer F and the primer R respectively through a PCR reaction system.
The composition of the PCR reaction system is:
the following are sequentially added into a 0.2 ml centrifuge tube:
2020100469 27 Mar 2020 ultra-pure water 17.5 ul x buffer 2.5 ul dNTPs 2 ul rTaq 0.15 ul template 1 ul primer 1 ul for each
A procedure for PCR amplification includes pre-denaturation at 94°C for 5min, (denaturation at 94°C for 35 s, annealing at 50°C for 35 s, extension at 72°C for 35 s) x 38 cycles, extension at 72°C for 10 min, and storage at 4°C, where PCR products can be stored for a long term.
3): Purify and then sequence the amplified products, and compare sequencing results of the two populations to identify the species.
It can be seen from 210bp sequence sequencing results of mtDNA COI genes of Sphyraena pinguis and Sphyraena putnamae obtained in Embodiment 1 that Sphyraena pinguis and Sphyraena putnamae have a difference of 35 bases, which is shown as 25 transformations and 10 transversions.
The 210bp sequence sequencing results of the mtDNA COI genes of Sphyraena pinguis and Sphyraena putnamae are as follows:
Sphyraena pinguis·. CCTTTACTTA CTATTTGGTG CCTGAGCAGG GATGGTAGGC
Sphyraenaputnamae : ***(A**C * * * C * G 1
Ruler:.........10.........20.........3040
Sphyraena pinguis'. ACCGCCCTTA GCCTACTCAT TCGTGCCGAA TTAAGCCAAC
Sphyraenaputnamae'. **a**T**A********T*****A******C*T**T****
Ruler:.........50.........60.........7080
Sphyraena pinguis'. CTGGCTCTCT CCTAGGGGAT GACCAAATCT ATAACGTCAT
Sphyraenaputnamae : *q*********t****a**C********T*****T**T**
Ruler:.........90.........100.........110120
Sphyraena pinguis'. CGTCACAGCC CACGCCTTCG TGATAATCTT CTTCATAGTC
Sphyraenaputnamae'. ***a*****A********T**A********T**T**A**A
Ruler:.........130.........140.........150160
Sphyraena pinguis'. ATGCCCATTA TGATTGGAGG CTTCGGTAAC TGACTCATCC
Ruler:.........170.........180.........190200
Sphyraena pinguis'. CCCTAATAAT
2020100469 27 Mar 2020
Sphyraenaputnamae'. **********
Ruler: .........210 (the foregoing * indicates the same base sequence site)
The sequencing results showed that the amplification results of the five Sphyraena pinguis samples were consistent, and the amplification results of the five Sphyraena putnamae samples were consistent. The results are stable and the reproducibility is high, indicating that the identification accuracy of the present invention is high, and the method is simple and easy to operate.
2020100469 27 Mar 2020
Sequence table <110> South China Sea Fisheries Research Institute, CAFS <120> Molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae and application thereof <141> 2019-04-18 <160>4 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 21 <212>DNA <213> Artificial sequence <400> 1 tcaaccaacc acaaagacat 121 <210>2 <211> 23 <212>DNA <213> Artificial sequence <400> 2 attattaggg ggatgagtca gtt 23 <210> 3 <211> 210 <212>DNA <213> Artificial sequence <400> 3 cctttactta ctatttggtg cctgagcagg gatggtaggc accgccctta gcctactcat 60 tcgtgccgaa ttaagccaac ctggctctct cctaggggat gaccaaatct ataacgtcat 120 cgtcacagcc cacgccttcg tgataatctt cttcatagtc atgcccatta tgattggagg 180 cttcggtaac tgactcatcc ccctaataat 210 <210>4
2020100469 27 Mar 2020 <211> 210 <212>DNA <213> Artificial sequence <400> 4 cctctaccta ctatttggcg cctgggctgg gatggtaggt acagctctaa gcctacttat 60 tcgagccgaa cttagtcaac cgggctctct cttaggagac gaccaaattt ataatgttat 120 cgtaacagca cacgcctttg taataatctt ttttatggta atacccatta tgattggggg 180 ctttgggaac tgacttattc ccctaataat 210
Claims (5)
1. A molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae, comprising a primer F and a primer R, wherein a sequence of the primer F is shown in SEQ ID NO: 1, and a sequence of the primer R is shown in SEQ ID NO: 2.
2) : respectively using the DNAs extracted in step 1) as templates to amplify the primers according to claim 1 through a PCR reaction system;
2. Application of the molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae according to claim 1, wherein the molecular marker primer is used for identifying Sphyraena pinguis and Sphyraena putnamae., preferably, wherein an identification method comprises the following steps:
selecting Sphyraena pinguis and Sphyraena putnamae to form sample populations, and extracting DNAs of the two sample populations respectively;
3. The application of the molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae according to claim 2, wherein the sequence of the molecular marker of Sphyraena pinguis in step 3) is shown in SEQ ID NO: 3, and the sequence of the molecular marker of Sphyraena putnamae is shown in SEQ ID NO: 4, preferably, wherein the molecular markers are used for identifying Sphyraena pinguis and Sphyraena putnamae.
3) : purifying and sequencing amplified products obtained in step 2) to obtain sequences of molecular markers of Sphyraena pinguis and Sphyraena putnamae respectively; and
4. The application of the molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae according to claim 2, wherein a reagent of the PCR reaction system in step 2) comprises 17.5 ul of ultra-pure water, 2.5 ul of 10 x buffer, 2 ul of dNTPs, 0.15 ul of rTaq, 1 ul of DNA template, and 1 ul of each primer., preferably, wherein a procedure for the amplification in step 2) comprises pre-denaturation at 94°C for 2-5 min, then denaturation at 94°C for 35 s, annealing at 50-53°C for 30-35 s, extension at 72°C for 35 s, proceeding of 30-38 cycles, final extension at 72°C for 3-10 min, and storage at 4°C.
4) : comparing sequencing results to identify the species.
5. The application of the molecular marker primer for identifying Sphyraena pinguis and Sphyraena putnamae according to claim 2, wherein a kit comprising the molecular marker primer and the reagent of the PCR reaction system is applied to the identification of Sphyraena
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910314414.4 | 2019-04-18 | ||
| CN201910314414.4A CN110029173A (en) | 2019-04-18 | 2019-04-18 | A kind of molecular labeling primer and its application identifying oil Yu and the Yu that sets one's teeth on edge |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| AU2020100469A4 true AU2020100469A4 (en) | 2020-04-30 |
Family
ID=67239146
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| AU2020100469A Ceased AU2020100469A4 (en) | 2019-04-18 | 2020-03-27 | Molecular marker primer for identifying sphyraena pinguis and sphyraena putnamae and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN110029173A (en) |
| AU (1) | AU2020100469A4 (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107557483A (en) * | 2017-10-26 | 2018-01-09 | 浙江海洋大学 | A kind of discriminating China Coast Yong fish species indeterminate sp and knife Yong molecular labeling primer and method |
| CN108070663A (en) * | 2017-12-06 | 2018-05-25 | 中国水产科学研究院南海水产研究所 | Differentiate the molecular labeling primer and method of the penaeus penicillatus young and During Larvae Rearing of Penaeus Merguiensis De Man |
| CN107988387A (en) * | 2017-12-06 | 2018-05-04 | 中国水产科学研究院南海水产研究所 | A kind of molecular labeling primer and labeling method for differentiating Zhoushan sea area thornback species indeterminate sp |
-
2019
- 2019-04-18 CN CN201910314414.4A patent/CN110029173A/en active Pending
-
2020
- 2020-03-27 AU AU2020100469A patent/AU2020100469A4/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| CN110029173A (en) | 2019-07-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2020100468A4 (en) | Molecular marker primer for identifying trachitotus ovatus and trachinotus blochii and application thereof | |
| CN106834439B (en) | Molecular marker related to growth of litopenaeus vannamei and application thereof | |
| KR101775219B1 (en) | Probe for identifying sea bream species and tilapia species and identifying method using the same | |
| CN106434977A (en) | Molecular marker primer and method for identifying Shao's Sillago and Sillago sihama | |
| CN105316412A (en) | Method for identification or auxiliary identification of day age of pig at 100kg weight and special kit of method | |
| CN114438231A (en) | CRELD1 gene molecular marker related to chicken carcass traits and application | |
| CN109554486A (en) | SNP marker relevant to grass carp character and its application | |
| CN114686597A (en) | SNP molecular marker for sex identification of salangid and application thereof | |
| CN113881785A (en) | SNP (Single nucleotide polymorphism) site primer combination for multi-trait breeding of litopenaeus vannamei and application of SNP site primer combination | |
| CN107119143A (en) | A kind of catfish DNA bar code standard detection sequence and its application | |
| AU2020100469A4 (en) | Molecular marker primer for identifying sphyraena pinguis and sphyraena putnamae and application thereof | |
| CN113151430A (en) | Penaeus chinensis female specific primer and application thereof | |
| CN111073983B (en) | SNP marker related to identification of northern subspecies and Florida subspecies of largemouth bass and application thereof | |
| CN112159851A (en) | Molecular identification method of eleutheronema tetradactylum and eleutheronema tetradactylum based on COI gene sequence | |
| CN116426653A (en) | DNA (deoxyribonucleic acid) marker for identifying genetic sex of palaemon carinicauda and application thereof | |
| CN113718043B (en) | Specific molecular marker and primer for identifying genetic sex of Chaptera multiflora and method and application thereof | |
| CN115011701A (en) | SNP molecular marker with cryptocaryon irritans disease resistance-related traits for trachinotus ovatus and application of SNP molecular marker | |
| CN107841563A (en) | Differentiate the molecular specificity labeled primers and method of catfish | |
| CN103725688A (en) | Molecular markers related with antibody level of newcastle disease virus as well as identification method and application of molecular markers | |
| CN110643715B (en) | Method for rapidly identifying compound gobies and javanica fish | |
| CN113684284A (en) | Primer, kit and method for identifying fish of loach family | |
| CN109439764B (en) | Molecular marker for identifying native-like eggs and native eggs and application | |
| CN113699224A (en) | Molecular marker C2 for sex identification of Chinese prawn and application thereof | |
| Giresi et al. | A morphological key to distinguish among smoothhound sharks (genus Mustelus) in the Gulf of Mexico | |
| CN111748639A (en) | Molecular marker for identifying sex of haliotis discus hannai and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FGI | Letters patent sealed or granted (innovation patent) | ||
| MK22 | Patent ceased section 143a(d), or expired - non payment of renewal fee or expiry |