AU2019101637A4

AU2019101637A4 - Streptovaricin derivative, and preparation method and use thereof

Info

Publication number: AU2019101637A4
Application number: AU2019101637A
Authority: AU
Inventors: Xu Chen; Zixin Deng; Yuanzhen Liu; Yuhui SUN
Original assignee: Wuhan University WHU
Current assignee: Wuhan University WHU
Priority date: 2019-12-18
Filing date: 2019-12-18
Publication date: 2020-02-06
Anticipated expiration: 2027-12-18

Abstract

The present invention discloses a streptovaricin derivative, and a preparation method and use thereof, and relates to the field of streptovaricin preparation. In the present invention, the novel streptovaricin derivatives 1-4 are obtained by conducting single inactivation or deletion of P450 genes (stvP4 and stvP5) of a post-modification system in the streptovaricin biosynthetic gene cluster of the strain respectively by using Streptomyces spectabilis CCTCC M2017417 as a starting strain, and then separating and purifying the crude extracts of fermentation products of the two mutant strains to obtain the novel streptovaricin derivatives 1-4. The novel streptovaricin derivatives of the present invention have good antibacterial effects, may provide a new solution to the problem of antibiotic resistance, and provides a basis for structural modification of streptovaricin antibiotics. H H N -~8 N ~N LOAc 00 0, H I0 HO, COOMe O H OH -OH 28-dehydroxylated Streptovaricin F(1) 6-methoxy-8-hydroxy-24-carboxymethyI -tnrotoStrentovaricineI1(2) ~- 0 HO -- 0 HO OAc HO, K 0I n OAc HO, 0 H 2 0ODH 24 ~OH 6H ~OH OH 24-decarboxylated methyl Streptovaricin G(3) 24-decarboxylated methyl Streptovaricin C(4) a b C CCTCC M2017417 (p (wild-type) ..HindiII V'pst NdeI/4-58 a b971 b CCTCCM2017(P417'0 (wild-type) \HnII 'sV Nd Ill~X Streptovaricin D protoStreptovaricine I AStvP4 __ l CCTCC M2017417 10 15 20 25 30 lime (min) 100 0 OH H 738.31012 [M+HJ' 100 69.26(MH0H]O 0 H N 69.28[MH0+l NH 0 N 2 0o OH OH 0sH 10I OH~ H o..437M+] 10H 0 . OH .45[ H ~~5_ OHHH50 73431250(0.-OH 6 700 80 . 0 700 800 M/Z 100~ ~ ~ ~ ~~~~FG 05HH7245 0 HH76387MH 61-62-12 -20 -100 -50 C4 )4 N - C4 C4 C4J .0 9.5 9.'0 8.5 8.0 7.05 7.0U 605 600 5.5 5.0 4.'5 4.'0 3.'5 3.0 2.'5 2.0 1.5 1.0O 0.'5 0'0 -0.5 -1.0 ft (pm1 FIG 6a -170W -4W0 1.10 2.0 170 19 10 fQ t 10 140 130 1..0 JO lo0 90 40 70 00 51 40 50 2'0 10 U FIG 6b fil-b2A CSY gI 0 FI 6c , 10 -90 :0 6.0 7.5 7.060.0 6.0 5.5 5.0 4.5 4.0 30 3.0 15 2.0 1.5 1.0 0.5 0.0 f2 (ppm) FIG 6d 6111-b'1 -20 -40 -100 -120 -140 * - 160 -10 -200 7.5 71'0 6.5 6.'0 5!5 5!0 4'5 4,'0 3.' 3.0 2.'5 2.0 1: t o 05 0.0 f2 (p FIG 6e -550 -450 -400 -200 0 9.5 1.1 .5 B..1 7. 75 a 05 b00 51 5 0 4. 5 4.0 31 1 0 2. 2.0 15 1.0 .5 0.0 1, -1a il (50M) FIG 7a 02 y -00 -700 -500 -400 -300 20 2 0 05 0! 0 10 10 0U 140 135 1"0 0i 0 9u w 75 00 40 02 0 0 0 FIG 7b 61-62B COSY 8.0~~~~ ~ ~ I. 7. .I. . . . 530252U15100 . f2 (p. FI 7c '7 . /1 1 U1-0~-0 -30 -9D -110 -140 FIG 7d * -50 -100 -120 -140 -200 7.5 7.0 6.5 6,0 5.5 5.0 4.5 4.0 3,5 3.0 215 2.0 1.5 1.0 0.5 0.0 f2 (ppm) FIG 7e r,1-52A-H 44 S & 3-4 S 250 '>Y -~V-240 -21 -220 I 4 210 4 -200 -170 -10 -20 -0 710 y P~l y y 10 C4 - Ili --20 .0 10. 5 10. 0 90'5 9.0 0.'5 0. 70' 7.0 0. 6.0 5.' 5.'0 4.0' 4.'0 3.5 3.'0 2.5 2.'0 L.5 1.0 0.5 0.'0 -0. -1.,0 fl (p.) FIG 8a 51-520-C C4 d d' ' i C 10 1- T -- - - -- I -Y~W100 -1650 -1500 -13500 -1200 -1150 ,5000 -750 -600 -500 -200 20 210 200 190 180 170 160 150 140 130 120 110 100 90 00 7'0 5 50 4'0 30 20 10 0 fl (pp.) FIG 8b 0l/i12 Its 1I 10 9 9 7 4 4 I 0 FIG 8c 51-52A SOC * -10 4 -20 -30 -40 -70 - -0 _100 110 t -120 -1 30 -140 -1 50 -10 0.'5 0.0O 7.5 7.'0 6.5 6.'0 5.5 5.0 4.5 40 32 35' 252'0 1.5 1.0 0.5a 0.'0 -05 f2 19004 FIG 8d 1(0/113 -40 1w 140, FIG 8e 1111=10''Id - -100 -70 -40 j -0 1 -20 100 0 40000700115 0 411 4 0 . 10111 21.9O 85 80 7. . A 55 5. : :0 35 30 25 20 1.5 11 0.0 0:5 0 00 -10 01 00,7 FIG 9a -1200 -1100 -100 -700 -00 * 500 * 400 I-2 -00 20 210 200 190 100Q 170 1I0 150 140 130 120 110 100 90 80 70 00 50 40 3O 2'0 0 U FIG 9b -~-0 -- 4 F9c -40 Al" 70 All, -0 AlAO -140 -150 1. 10 ", AAA 55 5A0 4,5 4 3, 5 0 3l 5 z0 o S 1 0 0. 0,0 -o, FIG 9d 1-720 -30 -90 -110 -- 130 -10 - -170 7 7 170 15 0,0 1. 5,0 4,15 4 0 3.17 3,0 2.17 2,0 1,5 LO 0. 5 130 f2 (pp.) FIG 9e

Description

STREPTOVARICIN DERIVATIVE, AND PREPARATION METHOD AND USE THEREOF

TECHNICAL FIELD

The present invention relates to the field of streptovaricin preparation, and in particular to a novel streptovaricin derivative, and a preparation method and use thereof.

BACKGROUND

Since the 1960s, antibiotic resistance has gradually become a serious threat to public health, causing many human infections that are difficult to treat and even death. In particular, methicillin-resistant Staphylococcus aureus (MRSA) is now considered to be a superbacteria” that causes major diseases and death in human, and due to its high toxicity and wide distribution (such as in community and hospital environments), it can cause huge economic losses. Therefore, there is an urgent need to develop a new drug to combat these pathogens. Natural products have proven to be important resources for the discovery of anti-MRSA antibiotics (such as vancomycin and daptomycin); and on the other hand, engineered biosynthesis can complement this traditional time-consuming and labor-intensive drug discovery process, and novel unnatural” natural products can be obtained by direct genetic modification of their biosynthetic pathways in producing strains or by combinatorial biosynthesis in heterologous hosts. These strategies represent attractive approaches of creating molecular diversity in drugs.

Both streptovaricin and rifamycin belong to the early discovered ansamycin antibiotics. They have broad antibacterial activities against Gram-positive and Gram-negative bacteria, especially against Mycobacterium tuberculosis. Structrually, streptovaricin mainly differs from other ansamycin antibiotics in the different oxidation degrees of ansa Bridge, for examples, hydroxylation at positions C-20 and C-28, oxidation at the position Me-24 and dehydrogenation at the position C-21. In particular, C-6 and C-ll are linked by a methylenedioxybridge (MDB) to form a characteristic naphthodioxin structure. Based on the reported general biosynthetic pathways of ansamycins, the biosynthesis of streptovaricin is completed under the catalysis of a type I modular polyketide synthase (PSS). Its biosynthetic pathway begins with a special starting unit, 3-amino-5-hydroxy benzoic acid (AHBA), then goes through a plurality of polyketide chain extension steps, and finally the extended chains are cyclized by an amide synthase and released from the PKS, and further subjected to post-PKS modifications to form mature streptovaricin antibiotics.

According to reports, the bacteriostatic effects are different among streptovaricin monomer compounds, and for the biosynthesis of streptovaricin, it is currently confirmed

2019101637 18 Dec 2019 only by the use of isotopic feeding and marking and the like experiments that the aromatic chromophore on its structure originates from AHBA, and the methyl group at the position C-3, carboxymethyl group at the position C-24 and methylene group in the MDB structural unit all come from methionine. However, up to now, the streptovaricin biosynthetic gene cluster has not been reported, and the subsequent modification reactions including hydroxylation, methylation, acetylation and redox are still unclear; and on the other hand, creating streptovaricin derivatives having new activity based on chemical synthesis or semisynthesis, combined biosynthetic modification or metabolic engineering have not been reported.

SUMMARY

An objective of the present invention is to provide a novel streptovaricin derivative modified based on the structure of streptovaricins, and a preparation method thereof, and the use of them in the preparation of antibacterial agents.

The streptovaricin-producing bacterium is Streptomyces spectabilis sp. isolated from the soil in the campus of Wuhan University, and has been deposited in China Center for Type CultureCollection, Wuhan University with the accession number of CCTCC NO: M2017417 on July 7, 2017. According to the present invention, 2 single-gene-knockout mutant strains are obtained by manipulating P450 genes stvP4 and stvP5 in a Streptomyces spectabilis CCTCC M2017417 streptovaricin post-biosynthesis modification system. 4 streptovaricin derivatives that are incompletely modified are isolated from the fermentation broth of the 2 mutant strains.

The objective of the present invention is achieved by the following technical solutions.

In a first aspect, the present invention relates to a streptovaricin derivative having a structural formula shown in any one of formulas 1-4:

2019101637 18 Dec 2019

28-dehydroxylated Streptovaricin F (1)

6-methoxy-8-hydroxy-24-carboxymethyl

-protoStreptovaricine I (2)

24-decarboxylated methyl Streptovaricin G (3) 24-decarboxylated methyl Streptovaricin C (4)

In a second aspect, the present invention relates to a method for preparing the aforementioned streptovaricin derivative, including the following steps:

A. obtaining a streptovaricin biosynthesis gene cluster via cloning by using an original streptovaricin-producing strain Streptomyces spectabilis CCTCC M2017417 as a starting strain (with the accession number of CCTCC NO: M2017417), where the gene cluster includes 5 P450 genes involved in the post-biosynthesis modification process of streptovaricin, and the 5 P450 genes consist of stvPl, stvP2, stvP3, stvP4 and stvP5 genes and are respectively located on the bases at locations 13481-14773, 15800-17005, 18765-19958, 83977-85221 and 87228-88481 of SEQ ID NO: 1;

B. carrying out selective single gene inactivation on the stvP4 or stvP5 gene in the P450 genes of the post-biosynthesis modification system of streptovaricin to obtain a stvP4 gene inactivation mutant strain AstvP4 or a stvP5 gene inactivation mutant strain AstvP5; and

C. fermenting the mutant strain AstvP4, extracting its fermentation product, and separating and purifying to obtain the streptovaricin derivative shown in the above formulas 1 and 2;

or alternately fermenting the mutant strain AstvP5, extracting its fermentation product, and separating and purifying to obtain the streptovaricin derivative shown in the above

2019101637 18 Dec 2019 formulas 3 and 4.

Preferably, in the step B, the selective inactivation is in-frame knockout, where a 1990 bp fragment is amplified upstream of the stvP4 gene, as a stvP4 in-frame knockout homologous left arm stvP4-L by using a chromosome DNA of a wild-type streptovaricin-producing Streptomyces spectabilis CCTCC M2017417 (with the accession number of CCTCC NO: M2017417) as a template and by using stvP4-L-F and stvP4-L-R of which the nucleotide sequences are shown in SEQ ID NO: 2-3 as primers; and a 1989 bp fragment is amplified downstream of the stvP4 gene, as a stvP4 in-frame knockout homologous right arm stvP4-R by using stvP4-R-F and stvP4-R-R of which the nucleotide sequences are shown in SEQ ID NO: 4-5 as primers.

a 2098 bp fragment is amplified upstream of the stvP5 gene by using a chromosome DNA of a wild-type streptovaricin-producing Streptomyces spectabilis CCTCC M2017417 (with the accession number of CCTCC NO: M2017417) as a template and using stvP5-L-F and stvP5-L-R of which the nucleotide sequences are shown in SEQ ID NO: 6-7 as primers, and then used as a stvP5 in-frame knockout homologous left arm stvP5-L; and a 1928 bp fragment is amplified downstream of the stvP5 gene by using stvP5-R-F and stvP5-R-R of which the nucleotide sequences are shown in SEQ ID NO: 8-9 as primers, and then used as a stvP5 in-frame knockout homologous right arm stvP5-R.

Preferably, in the step C, the extracting of the fermentation product of the mutant strain AstvP4 or AstvP5 specifically is: the fermentation broth is extracted with an equal volume of ethyl acetate for 3 times, and an ethyl acetate phase is collected; the ethyl acetate phase is concentrated to dryness by a rotary evaporator, and then is dissolved again with 0.05 times of methanol, so that the solute contains the streptovaricin derivative.

Preferably, in the step C, the purifying after the extracting of the fermentation product of the mutant strain AstvP4 or AstvP5 specifically is: dissolving the extracted fermentation product in methanol, filtering through an organic-system filter membrane, taking the solution, injecting the sample, and preparing each target product by HPLC, with the chromatographic conditions being that: a phase A of water; a phase B of acetonitrile; a flow rate of 3 mL/min, a elution procedure of 35-65% B for 0-20 min; 65-95% B for 20-28 min; 95% B for 28-30 min; and the peak time of the target compound is at 12-24 min, and the chromatographic column is a ZORBAX Eclipse XDB-C18 reverse phase column (5 pm, 9.4 x 250 mm) from Agilent.

In a third aspect, the present invention relates to an engineering strain for producing the aforementioned novel streptovaricin derivatives 1 and 2, which is a Streptomyces spectabilis

2019101637 18 Dec 2019

CCTCC M2017417 (with the accession number of CCTCC NO: M2017417) that is inactivated or lacks the stvP4 gene.

In a fourth aspect, the present invention relates to an engineering strain for producing the aforementioned novel streptovaricin derivatives 3 and 4, which is a Streptomyces spectabilis CCTCC M2017417 (with the accession number of CCTCC NO: M2017417) that is inactivated or lacks the stvP5 gene.

In a fifth aspect, the present invention relates to a use of the novel streptovaricin derivative 1-4 in preparation of an antibacterial agent.

Preferably, the bacterium is a drug-resistant bacterium, Methicillin-resistant Staphylococcus aureus (MRSA).

The present invention has the beneficial effects that: the present invention separates 4 new streptovaricin derivatives from the mutant strain of Streptomyces spectabilis CCTCC M2017417 (with the accession number of CCTCC NO: M2017417), enriching the structural diversity of streptovaricin derivatives; and the streptovaricin-producing bacterium which is inactivated or lacks the stvP4 or stvP5 gene can produce a large amount of these compounds with new structures (generally with a fermentation yield of about 5-20 mg/L). The novel streptovaricin derivative of the invention has a good antibacterial effect, provides a new solution to the problem of antibiotic resistance, and provides a basis for structural modification of streptovaricin antibiotics.

BRIEF DESCRIPTION OF THE DRAWING

FIG. 1 is a chemical structure diagram of novel streptovaricin derivatives 1-4.

FIG. 2 is a diagram showing a pWHU2801 plasmid map, a knockout model of a mutant strain AstvP4, and validation results of Southern blot molecular hybridization, where a is the pWHU2801 plasmid map and the knockout model of the mutant strain AstvP4; and b is the validation results of Southern blot molecular hybridization.

FIG. 3 is a diagram showing a pWHU2802 plasmid map, a knockout model of a mutant strain AstvP5, and validation results of Southern blot molecular hybridization, where a is the pWHU2802 plasmid map and the knockout model of the mutant strain AstvP5; and b is the validation results of Southern blot molecular hybridization.

FIG. 4 is a diagram showing the HPLC-UV 432 nm detection results of fermentation products of respective mutant strains.

FIG. 5 is a diagram showing LC-ESI-HRMS structural identification results of compounds 1-4.

FIGs. 6a-6e are diagrams showing NMR structural identification results of compound 1,

2019101637 18 Dec 2019 a is ‘H-NMR; b is ¹³C-NMR; c is ‘H-‘H COSY; d is HSQC; and e is HMBC.

FIGs. 7a-7e are diagrams showing NMR structural identification results of compound 2, a is ‘H-NMR; b is ¹³C-NMR; c is ‘H-‘H COSY; d is HSQC; and e is HMBC.

FIGs. 8a-8e are diagrams showing NMR structural identification results of compound 3, a is ‘H-NMR; b is ¹³C-NMR; c is ‘H-‘H COSY; d is HSQC; and e is HMBC.

FIGs. 9a-9e are diagrams showing NMR structural identification results of compound 4, a is ‘H-NMR; b is ¹³C-NMR; c is ‘H-‘H COSY; d is HSQC; and e is HMBC.

DETAILED DESCRIPTION

In the invention patent application STREPTOVARICIN BIOSYNTHESIS GENE CLUSTER AND USE THEREOF filed by the applicant on the same day, a gene cluster responsible for biosynthesis of streptovaricin is disclosed. The whole gene cluster is a nucleotide sequence including 41 genes shown at positions 1-95304 in SEQ ID NO: 1, and the gene responsible for streptovaricin post-biosynthesis modification contains 5 P450 genes of sequentially stvPl, stvP2, stvP3, stvP4 and stvP5. These five genes are located on bases at positions 13481-14773, 15800-17005, 18765-19958, 83977-85221 and 87228-88481 of SEQ ID NO: 1, respectively.

In the present invention, P450 genes (stvP4 and stvP5) in the streptovaricin post-biosynthesis modification system of Streptomyces spectabilis CCTCC M2017417 (with the accession number of CCTCC NO: M2017417) are manipulated, so as to obtain a series of incompletely modified streptovaricin derivatives. These novel streptovaricin derivatives include: 2 8-dehydroxylated streptovaricin F (1),

6-methoxy-8-hydroxy-24-carboxymethyl-protostreptovaricine I (2), 24-decarboxylated methyl streptovaricin G (3) and 24-decarboxylated methyl streptovaricin C (4), and the structural formula of them are shown in FIG. 1.

I. Experimental Materials

1. The strains, plasmids and primers are shown in Tables 1-3.

Table 1 strains mainly used in examples

Strains Main characteristics Sources or references

Eschereichia coli

ET12567/pUZ8002 recF dam dem Cml^R Slr^R TeP KnP Commercialized product

Streptomyces spectabilis

2019101637 18 Dec 2019

CCTCC M2017417 Wild-type strain of streptovaricin-producing

Isolated from a soil

CCTCC M2017417	bacterium	sample in the campus
		of Wuhan University
AstvP4	Mutant strain with in-frame deletion of the gene	Constructed in this
	stvP4	study
AstvP5	mutant strain with in-frame deletion of the gene	Constructed in this

stvP5 study

Indicator bacterium for biological activity detection of Staphylococcus aureus

ATCC 29213	Standard strain of Staphylococcus aureus	ATCC
ATCC 25904	Standard strain of Staphylococcus aureus	ATCC
ATCC 43300	Standard strain of MRSA	ATCC
USA300 LAC	Clinically isolated strain of MRSA	Cited Reference 1
USA400 MW2	Clinically isolated strain of MRSA	Cited Reference 1
ATCC 25922	Standard strain of Escherichia coli	ATCC
ATCC 19606	Standard strain of Acinetobacter baumannii	ATCC

Note: Streptomyces spectabilis CCTCC M2017417 was deposited in China Center for

Type CultureCollection on July 7, 2017 with the accession number of CCTCC NO:

M2017417 (at the address: Wuhan University, Wuhan, China), under an alive status.

Table 2 Main Plasmids used in Examples

Plasmid	Sources or
Resistance marker	references	Use
pEASY	bla	Commercialized product	Subcloning vector
pYH7	bla, tsr, aac(3)IV	Cited Reference 2	Streptomyce-Escherichia coli shuttle plasmid
pWHU2801	bla, tsr, aac(3)IV	Constructed in this study	In-frame knockout plasmid of stvP4
pWHU2801	bla, tsr, aac(3)IV	Constructed in this	In-frame knockout plasmid of stvP5

2019101637 18 Dec 2019 study

Cited References:

1. Wardenburg JB, Schneewind O. 2008. Vaccine protection against Staphylococcus aureus pneumonia. Journal of Experimental Medicine 205:287-294.

2. Sun Y, He X, Liang J, Zhou X, Deng Z. 2009. Analysis of functions in plasmid pHZ1358 influencing its genetic and structural stability in Streptomyces lividans 1326. Appl Microbiol Biotechnol 82:303-310.

The construction method of corresponding strains or plasmids is described in detail in the aforementioned cited reference 2, and those skilled in the art can obtain the corresponding strains or plasmids by reproducing according to the stated construction method.

Table 3 Primers used in examples and sequences thereof

Primers Nucleotide sequence (5'-3') Enzymatic cleavage sites

P4-L-F GCGCATATGGAGCTGAATGGGACC	Ndel
P4-L-R CGCCTGCAGTGACCGGCCACCGACC	Pstl
P4-R-F GTTCTGCAGGGTGGCTGTCATGGGG	Pstl
P4-R-R GGGAAGCTTCGACGGACACGCTCAC	Hindlll

CK-P4-F CGTCCCGCAAGGGCGCGTGGACCGG

CK-P4-R CGGGCTCGTCGCCGACCACGTCACG

P5-L-F AGACATATGACTTCGTCGATGACCG	Ndel
P5-L-R CTTCTGCAGCGCCTCGTCTGAGCAC	Pstl
P5-R-F GTTCTGCAGGGTGGCTGTCATAGGT	Pstl
P5-R-R GTCAAGCTTGTCGTCGAGCAGCTCC	Hindlll

CK-P5-F ACGTCTTCAAGAGCGTCCCCAAAGG

CK-P5-R GGCGGTCTCCCCGTCGAAGCTGGTG

2. Medium (1) 2X TY liquid medium: 10 g of yeast extract, 16 g of tryptone, 5 g of sodium chloride, and 1 L of Milli-Q pure water, subjected to high temperature sterilization at 115°C for 30 min.

(2) 2X TY solid medium: 10 g of yeast extract, 16 g of tryptone, 5 g of sodium chloride,

2019101637 18 Dec 2019 g of agar powder, and 1 L of Milli-Q pure water, subjected to high temperature sterilization at 115°C for 30 min.

(3) ABB 13 solid medium: 5 g of soluble starch, 5 g of soybean peptone, 3 g of calcium carbonate, 2.1 g of 3-(N-morpholine)propanesulfonic acid, 0.01 g of thiamine hydrochloride, 0.012 g of ferrous oxide, 20 g of agar powder, 1 L of Milli-Q pure water, the pH value being adjusted to 7.0 with potassium hydroxide, and subjected to high temperature sterilization at 115°C for 30 min. Before use, a 1 M magnesium chloride solution after filtration sterilization is added into the medium according to a volume ratio of 1%.

(4) TSBY liquid medium: 30 g of soybean broth that is enzymatically hydrolyzed with a protease, 5 g of yeast extract and 105 g of sucrose are dissolved in deionized water and brought to a constant volume of 1 L, and subjected to high-temperature steam sterilization at 115°C for 30 min.

(5) SFM liquid medium: 20 g of soybean flour is weighed and dissolved in 1,000 mL of deionized water, subjected to high-temperature steam sterilization at 115°C for 30 min (boiled and then cooked for 3 h), and then filtered through 4-8 layers of gauze to remove insoluble substances. It is added with 20 g of mannitol, and is brought to the volume of 1000 mL with deionized water after the mannitol is fully dissolved, and then subjected to high-temperature steam sterilization at 115°C for 30 min again.

3. Antibiotics and concentrations thereof are shown in Table 4.

Table 4 Antibiotics and use concentration thereof

Antibiotics	English Name and Abbreviations	Resistance gene	Final use concentration (pg/mL)
Streptomyces spectabilis	Escherichia coli
Ampicillin	Ampicillin, Amp	bla	-	100
Apramycin	Apramycin, Apr	aac3(IV)	25	25
Kanamycin	Kanamycin, Kan	aac	25	25
Chloramphenicol	Chloramphenicol, Cml	cat	25	25
Nalidixic acid	Nalidixic acid, NA		-	25

II. Experimental method

1. Culture of Escherichia coli and Streptomyces spectabilis CCTCC M2017417

The culture of Escherichia coli adopts the 2X TY medium, and the culture is conducted at 220 rpm and 37°C. The culture of the wild-type CCTCC M2017417 and the mutant strain thereof adopts the SFM medium, and the culture is conducted at 220 rpm and 28°C for 7

2019101637 18 Dec 2019 days.

2. Escherichia coli-Streptomyces spectabilis intergeneric conjugal transfer

About 1 cm² of a bacterial mass of Streptomyces spectabilis CCTCC M2017417 which has been grown on the ABB 13 solid medium for 3-4 d, is taken and cultured in 15 mL of the TSBY liquid medium at 28°C and 220 rpm for 2 d until the logarithmic growth phase, and then used as a conjugal transferring receptor bacterium. Escherichia coli ET12567/pUZ8002, which has been cultured overnight at 37°C and 220 rpm and then transferred at a ratio of 1:100 (v/v) and cultured for 2.5-3 h until the logarithmic growth phase, is used as a conjugal transferring donor bacterium. The donor and receptor bacteria grown to the logarithmic phase are each centrifuged at 5000 rpm x 5 min. The supernatant is discarded, and then the bacteria are each collected and washed twice with the 2X TY liquid medium. Most of the supernatant is discarded, about 1 mL of the supernatant of the donor bacterium is retained, and about 5 mL of the supernatant of the receptor bacterium is retained. Each 100 pL of the upper young bacteria were pipetted as much as possible and then mixed, and then coated onto an ABB 13 plate containing 1% magnesium chloride, dried under blowing, inverted and cultured in a 28°C constant-temperature incubator for 12 h. Then, 1 mL of sterile water containing apramycin and nalidixic acid is taken and evenly covered on the surface of the medium, so that the final concentration of antibiotics on the plate reaches 35 pg/mL of apramycin and 30 pg/mL of nalidixic acid. After the liquid on the surface of the medium is dried under blowing, the plate is sealed, and inverted and cultured in a 28°C constant-temperature incubator. Generally, after about 6-7 days, an obvious transconjugant can be seen.

3. Fermentation of Streptomyces spectabilis CCTCC M2017417 and Extraction and Separation of Fermentation Products (1) Fermentation culture of Streptomyces spectabilis CCTCC M2017417:

About 1 cm² of a bacterium mass that has been cultured on the ABB 13 solid medium for 3-4 d is taken, inoculated into 40 mL of the TSBY liquid medium, and cultured at 28°C and 200 rpm for 3 d, and used as the seed medium. The seed culture medium is transferred to 60 mL of a fermentation medium at a ratio of 1:20, and cultured at 28°C and 200 rpm for 7 days.

(2) Extraction and Separation of Fermentation Products of Streptomyces spectabilis CCTCC M2017417:

the fermentation broth is extracted with an equal volume of ethyl acetate for 3 times, and an ethyl acetate phase is collected; the ethyl acetate phase is concentrated to dryness by a

2019101637 18 Dec 2019 rotary evaporator, and then is dissolved again with 0.05 times of methanol, so that the solute contains the streptovaricin derivative.

4. Purification and Preparation of sreptovaricin derivatives

Purification of streptovaricin derivatives from extracted product of Fermentation Broth by HPLC the extracted fermentation product is dissolved in methanol, and filtered through an organic-system filter membrane, the solution is taken, and the sample is injected, with the chromatographic conditions being that: a phase A of water; a phase B of acetonitrile; a flow rate of 3 mL/min, a elution procedure of 35-65% B for 0-20 min; 65-95% B for 20-28 min; 95% B for 28-30 min. The peak time of the target compound is at 12-24 min. The chromatographic column is a ZORBAX Eclipse XDB-C18 reverse phase column (5 pm, 9.4 x 250 mm) from Agilent.

5. LC-ESI-HRMS Detection of Streptovaricin Derivatives

The extracted fermentation product is dissolved in methanol, filtered through an organic-system filter membrane, then the solution is taken and the sample is injected, with the chromatographic conditions being that: a phase A of water; a phase B of acetonitrile; a flow rate of 1 mL/min, a elution procedure of 35-65% B for 0-20 min; 65-95% B for 20-28 min; 95% B for 28-30 min; 95-35% B for 30-33 min; and 35% B for 33-38 min. The chromatographic column is a Diamonsil C18 reverse phase column (5 pm, 4.6 x 250 mm) from Dikma. The eluted liquid is subjected to a 1:1 flow split and is introduced into an ESI-HRMS detector, where ESI adopts a positive ion mode. The optimized ion source conditions are: a spray voltage of 3.5 kv, a capillary temperature of 275°C, a sheath gas flow rate of 50 L/h, an auxiliary gas flow rate of 10 L/h, an ion source temperature of 275°C, a scanning range of m/z 300-1000, and a sample injection volume of 10 pL.

6. Determination of biological activity-minimum inhibitory concentration (MIC)

This method refers to the microdilution broth method in Methods for Dilution antibacterial Susceptibility Test for Bacteria That Grow Aerobiacally, Approved Standard-Ninth Edition, the American Clinical and Laboratory Standards Institute (CLSI).

(1) Formulation of antibacterial drug stock solution:

A quantitative value, which is 10 times of the upper limit of a commonly-used determination concentration, is used as the concentration of the antibacterial stock solution, i.e., 1280 mg/L. After the stock solution is formulated, it is filtered through a 0.22 pm microporous filter membrane for sterilization, and then sub-packaged in a small amount for later use, and the remaining stock solution is stored at -20°C.

2019101637 18 Dec 2019 (2) Inoculation of test bacteria:

Formulation of culture medium: Columbia blood plate is selected as the strain activation culture medium. MH broth is selected for an antibacterial test.

Preparation of test bacteria solution: the test bacteria are activated on the Colombian blood plate by a plate streaking method, cultured and observed at 37°C for 16-18 h until monoclonal strains growth, then several single colonies are selected and directly suspended in the MH medium to 0.5 Mcfarland standard, and then diluted with the broth at 1:100 (with a bacteria content of about 10⁶ CFU/mL) and ready for use. Turbidimetry standard: 0.5 mL of 0.048 mol/L barium chloride plus 99.5 mL of a 0.18 mol/L sulfuric acid solution are mixed evenly, and the turbidity of the mixture is adjusted with a wavelength at 530 nm to make the absorption value be 0.1, and such a turbidity is 0.5 Mcfarland standard, which is equivalent to 5 x (10⁷-l0⁸ CFU/mL).

Dilution of antibacterial drugs: the antibacterial drugs in the 2nd to 12th wells are diluted with the MH broth in a double dilution method to the following concentrations: 256 mg/L, 128 mg/L, 64 mg/L, 32 mg/L, 16 mg/L, 8 mg/L, 4 mg/L, 2 mg/L, 1 mg/L, 0.5 mg/L, and 0.25 mg/L. See Table 5 for the dilution method.

Table 5 Dilution method of antibacterial drugs

Serial number of well in each row	1	2	3	4	5	6	7	8	9	10	11	12
Steps	100	100	100	100	100	100	100	100	100	100	100	100
Step 1: adding broth (pL)	-	-	-	-	-	-	-	-	-	-	-	100
Step 2: adding a 512 mg/L

2019101637 18 Dec 2019

drug solution (HL)
Dilution: step 3												Taki ng 100
Step 4											Taki ng 100
Step 5										Takin gioo
Step 6									Takin g wo

Step 13		Discard! ng 100
Step 14: add 10⁶CFU/mL bacterial solution (HL)	100	100	100	100	100	100	100	100	100	100	100	100
Final concentrati on of drug (mg/L)	0	0.125	0.25	0.5	1	2	4	8	16	32	64	128
Final	5x10	5xl0⁶	5x10	5x10	5x10	5x10	5x10	5x10	5xl0⁶	5xlO⁶	5xlO⁶	5xl0⁶

2019101637 18 Dec 2019

concentrati on of bacterial solution (CFU/mL)

6

Inoculation of test bacteria: the diluted test bacteria solution is taken and inoculated into the 1st to the 11th wells at 100 pL/well according to a sequence from low to high concentrations of the antibacterial drugs, then the final inoculation amount of bacteria per well is about 5 x 10⁵ CFU/mL, and the final drug concentrations in individual rows are 128 mg/L, 64 mg/L, 32 mg/L, 16 mg/L, 8 mg/L, 4 mg/L, 2 mg/L, 1 mg/L, 0.5 mg/L, 0.25 mg/L, 0.125 mg/L, and 0 mg/L. After the drugs are mixed well with the bacteria solution, the wells are capped and sealed with a sealing film, and then cultured and observed at 37°C for 18-20 h. The operation steps are shown in Table 5.

(3) Result judgment:

Under a black background light source, observation of the occurrence of turbidity in the broth and the occurrence of sediment at the bottom of the well is taken as a standard to judge whether the test bacteria grow, and the MIC value is the minimum antibacterial drug concentration contained in the well in which no growth of the test bacteria occurs. In order to make the results more rapid and clear, 5 pL of 5 g/L triphenyltetrazole chloride (TTC) can be added into each well, and after incubation at 35°C for 1-3 h, the well presented as red has test bacteria grow therein.

The present invention will be described in further detail below with reference to embodiments, but implementation of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[Embodiment 1] Construction of Engineering Strain for Producing novel Streptovaricin Derivatives (1 and 2)

The engineering strain for producing a novel Streptovaricin derivative was a streptovaricin-producing bacterium which was inactivated or lacks the stvP4 gene.

(1) stvP4 in-frame knockout recombinant plasmid pWHU2801 (FIG. 2a)

1) A 1990 bp fragment was amplified upstream of the stvP4 gene by using a chromosome DNA of a wild-type streptovaricin-producing bacterium Streptomyces

2019101637 18 Dec 2019 spectabilis CCTCC M2017417 (with the accession number of CCTCC NO: M2017417) as a template and by using stvP4-L-F and stvP4-L-R as primers, and then used as a stvP4 in-frame knockout homologous left arm stvP4-L, a 1989 bp fragment was amplified downstream of the stvP4 gene by using stvP4-R-F and stvP4-R-R as primers, and then used as a stvP4 in-frame knockout homologous right arm stvP4-R.

2) The homologous left arm stvP4-L was directly connected to a pEASY vector to obtain a recombinant plasmid pEASY-stvP4-L, and the correct one as verified by enzyme digestion and sequencing was subjected to enzyme digestion by using restriction enzyme cutting sites Ndel and PstI that were cloned into both terminals of the homologous arm in advance, and then recovered, similarly, the homologous right arm stvP4-R was directly connected to a pEASY vector to obtain a recombinant plasmid pEASY-stvP4-R, and the correct one as verified by enzyme digestion and sequencing was subjected to enzyme digestion by using restriction enzyme cutting sites Hindlll and PstI that were cloned into both terminals of the homologous arm in advance, and then recovered.

3) Three-fragment enzyme linkage was conducted on the two recovered fragments and the vector pYH7 recovered through Ndel and Hindlll enzyme digestion, and a correct recombinant plasmid pWHU2801 was obtained after verified through enzyme digestion, which was used for in-frame knockout of the gene stvP4.

(2) construction of stvp4 in-frame knockout strain AstvP4

The stvP4 in-frame knockout recombinant plasmid pWHU2801 was transferred into Escherichia coli ET12567/pUZ8002, and screened by using apramycin, kanamycin and Chloromycetin as resistance screening markers. The screened-out correct transformant ET12567/pUZ8002+pWHU2801 as verified by plasmid extraction and enzyme digestion was used as a conjugal transferring donor bacterium, and the wild-type streptovaricin-producing bacterium CCTCC M2017417 was used as conjugal transferring receptor bacterium, to introduce the pWHU2801 into the conjugal transferring receptor bacterium according to the conjugation transfer method described above. Then, a transconjugant having apramycin resistance was screened out by using apramycin as a screening marker, and then subjected to relaxation culture (relaxation culture: monoclones were streaked and cultured on a culture plate containing 1% MgCh), the monoclones obtained by relaxation culture were subjected to replica plating on a non-resistant plate containing apramycin to screen out strains sensitive to apramycin. These strains were possible double cross-over mutant strains or wild-type strains. PCR screening and verification were carried out by using verification primers CK-stvP4-F and CK-stvP4-R and

2019101637 18 Dec 2019 using the genomic DNA of these strains as templates. The theoretical positive amplification band was 1,001 bp. The correct strain as screened and verified by PCR was a double cross-over mutant strain, i.e., the stvP4 in-frame knockout strain AstvP4, and the successful construction of the mutant strain AstvP4 was further confirmed by Southern blot molecular hybridization (FIG. 2b).

The mutant strain AstvP4 was fermented together with the wild-type CCTCC M2017417 control group, and the fermentation products of them were detected by HPLC-UV analysis. The results were shown in FIG. 4. The results showed that the mutant strain AstvP4 produced the novel streptovaricin derivatives 1 and 2, while these novel compounds could not be detected for the control group wild-type CCTCC M2017417.

[Embodiment 2] Construction of Engineering Strain for Producing novel Streptovaricin Derivatives (3 and 4)

The engineering strain for producing a novel streptovaricin derivative was a streptovaricin-producing bacterium which was inactivated or lacks the stvP5 gene.

(1) stvP5 in-frame knockout recombinant plasmid pWHU2802 (FIG. 3a)

1) A 2098 bp fragment was amplified upstream of the stvP5 gene by using a chromosome DNA of a wild-type streptovaricin-producing bacterium Streptomyces spectabilis CCTCC M2017417 (with the accession number of CCTCC M2017417) as a template and by using stvP5-L-F and stvP5-L-R as primers, and then used as a stvP5 in-frame knockout homologous left arm stvP5-L, a 1928 bp fragment was amplified downstream of the stvP5 gene by using stvP5-R-F and stvP5-R-R as primers, and then used as a stvP5 in-frame knockout homologous right arm stvP5-R.

2) The homologous left arm stvP5-L was directly connected to a pEASY vector to obtain a recombinant plasmid pEASY-stvP5-L, and the correct one as verified by enzyme digestion and sequencing was subjected to enzyme digestion by using restriction enzyme cutting sites Ndel and PstI that were cloned into both terminals of the homologous arm in advance, and then recovered, similarly, the homologous right arm stvP5-R was directly connected to a pEASY vector to obtain a recombinant plasmid pEASY-stvP5-R, and the correct one as verified by enzyme digestion and sequencing was subjected to enzyme digestion by using restriction enzyme cutting sites Hindlll and PstI that were cloned into both terminals of the homologous arm in advance, and then recovered.

3) Three-fragment enzyme linkage was conducted on the two recovered fragments and the vector pYH7 recovered through Ndel and Hindlll enzyme digestion, and a correct recombinant plasmid pWHU2802 was obtained after verified through enzyme digestion,

2019101637 18 Dec 2019 which was used for in-frame knockout of the gene stvP5 (FIG. 3a).

(2) construction of stvP5 in-frame knockout strain AstvP5

The stvP5 in-frame knockout recombinant plasmid pWHU2802 was transferred into Escherichia coli ET12567/pUZ8002, and screened by using apramycin, kanamycin and Chloromycetin as resistance screening markers. The screened-out correct transformant ET12567/pUZ8002+pWHU2802 as verified by plasmid extraction and enzyme digestion was used as a conjugal transferring donor bacterium, and the wild-type streptovaricin-producing bacterium CCTCC M2017417 was used as conjugal transferring receptor bacterium, to introduce the pWHU2802 into the conjugal transferring receptor bacterium according to the conjugation transfer method described above. Then, a transconjugant having apramycin resistance was screened out by using apramycin as a screening marker, and then subjected to relaxation culture (relaxation culture: monoclones were streaked and cultured on a culture plate containing 1% MgCh), the monoclones obtained by relaxation culture were subjected to replica plating on a non-resistant plate containing apramycin to screen out strains sensitive to apramycin. These strains were possible double cross-over mutant strains or wild-type strains. PCR screening and verification were carried out by using verification primers CK-stvP5-F and CK-stvP5-R and using the genomic DNA of these strains as templates. The theoretical positive amplification band was 1,006 bp. The correct strain as screened and verified by PCR was a double cross-over mutant strain, i.e., the stvP5 in-frame knockout strain AstvP5, and the successful construction of the mutant strain AstvP5 was further confirmed by Southern blot molecular hybridization (FIG. 3b).

The mutant strain AstvP4 was fermented together with the wild-type CCTCC M2017417 control group, and the fermentation products of them were detected by HPLC-UV analysis. The results were shown in FIG. 4. The results showed that the mutant strain AstvP5 produced the novel streptovaricin derivatives 3 and 4, while these novel compounds could not be detected for the control group wild-type CCTCC M2017417.

[Embodiment 3] HPLC-UV Analysis of Fermentation Products of Strains mL small-scale parallel fermentation and product extraction were carried out on each high-yield strain constructed above and the control group wild-type CCTCC M2017417 together, and HPLC-UV detection was carried out on the fermentation products of them. The ion peaks of the series of streptovaricin products in each mutant strain were extracted, and the results were shown in FIG. 4.

The mutant strain AstvP4 accumulated streptovaricin D as expected with a yield that was

2019101637 18 Dec 2019 about 100 times higher than that of the wild-type CCTCC M2017417, and meanwhile the mutant strain AstvP4 accumulated two obvious streptovaricin biosynthetic intermediates or by-pass metabolites (1 and 2); the mutant strain AstvP5 was still able to produce the protostreptovaricin I, and meanwhile accumulated two obvious biosynthetic intermediates or by-pass metabolites (3 and 4) (FIG. 4).

[Embodiment 4] Preparation and Biological Activity Determination of novel Streptovaricins (Compounds 1-4) (1) Mass fermentation and crude product extraction of mutant strains

The mutant strain AstvP4 or AstvP5 was subjected to mass fermentation and crude product extraction according to the following method:

a seed fermentation medium that had been cultured in a 50 mL x 4 TSBY medium at 28°C for 2 d, was transferred to a 250 mL x 8 SFM high-yield medium at a ratio of 1:10 (v/v) and fermented in the medium at 28°C for 7 d. The fermentation broth after fermentation was extracted with equal volume of ethyl acetate for 3 times, and the ethyl acetate phase was retained. The ethyl acetate phase was separated and then concentrated to dryness by a rotary evaporator, and then re-dissolved to 10 mL with chromatographic-grade methanol to obtain a concentrated fermentation extract solution.

Each target product was prepared from the concentrated fermentation solution by HPLC, and these products were subjected to LC-ESI-HRMS and *H, ¹³C, 'H-'H COSY, HSQC and HMBC nuclear magnetic resonance analysis detection (FIGs. 5-9). Upon structural identification, all of the structures of the aforementioned component products were consistent with those in FIG. 1. The LC-ESI-HRMS of them was shown in FIG. 5, and the *H, ¹³C NMR detection spectrum data were shown in Table 6.

Table 6 *H and ¹³C NMR spectrum data (600M, D2O, ppm) of compounds 1-4

Position	1	2	3	4
5h, mult (J in Hz)	5c, type	5h, mult (J in Hz)	5c, type	5h, mult (J in Hz)	5c, type	5h, mult (J in Hz)	5c, type
1	/	154.9, C	/	185.2, C	/	154.9, C	/	153.9, C
2	/	121.2, C	/	139.2, C	/	121.6, C	/	121.9, C
3	/	136.CU,	/	137.7, C	/	136.2*,	/	135.4, C
		C				C

2019101637 18 Dec 2019

3-CH3	1.93, s	11.9, ch₃	1.86, s	12.3, ch₃	2.16, s	10.8, ch₃	2.00, s	12.3, ch₃
4	/	136.2*,	/	184.0, C	/	136.3*,	/	136.3, C
		C				C
5	/	101.6, C	/	110.2, C	/	101.3, C	/	101.0, C
6	/	159.8, C	/	161.7, C	/	159.7, C	/	160.1, C
6a	5.96, d	89.6,	3.81, s	61.8,	5.96, d	89.6,	5.96, d	89.5,
	(4-8);	ch₂		ch₃	(4-8);	ch₂	(4-7);	ch₂
	5.25, d				5.24, d		5.21, d
	(4.8)				(4.8)		(4.7)
7	/	105.6s	/	116.8s	/	106.1s	/	106.0s
7-CH3	1.94, s	6.0, CH₃	2.27, s	8.0, CH₃	1.93, s	6.0, CH₃	1.92, s	6.0, CH₃
8	/	188.3, C	/	169.5, C	/	188.3, C	/	188.3, C
9	/	112.9, C	/	128.2*,	/	113.0, C	/	113.0, C
				C
10	/	125.9, C	/	126.7*,	/	125.9, C	/	125.1, C
				C
11	/	169.2, C	/	197.1, C	/	169.8, C	/	170.0, C
12	/	128.0, C	/	137.8, C	/	130.2*,	/	130.2*,
						C		c
I2-CH3	2.05, s	11.6,	1.96, s	10.8,	2.29, s	12.3,	2.30, s	12.5,
		ch₃		ch₃		ch₃		ch₃
13	/	168.9, C	/	/	/	169.2, C	/	169.1, C
14	2.25, s	19.5,	/	/	2.30, s	19.7,	2.29, s	19.7,
		ch₃				ch₃		ch₃
15	/	171.7, C	/	170.8, C	/	170.2, C	/	170.9, C
16	/	132.6, C	/	131.1,C	/	130.4*,	/	130.3*,

2019101637 18 Dec 2019

16-CH3	2.00, s	11.0,	2.03, s	11.2,	2.00, s	11.8,	2.11,s	11.7,
		ch₃		ch₃		ch₃		ch₃
17	7.73, dt	130.4,	7.27, d	132.0,	7.77, d	132.9,	7.54,	131.9,
	(11.7,	CH	(10.5)	CH	(12.1)	CH	br.d	CH
	1-2)						(10.3)
18	6.49, t	125.1,	6.43, t	122.8,	6.48, t	123.5,	6.49, t	123.3,
	(11-7)	CH	(11-2)	CH	(12.1)	CH	(10.3)	CH
19	5.71, d	138.5,	5.65, t	143.5,	5.89, d	143.0,	5.63, t	142.4*,
	(11-7)	CH	(10.5)	CH	(12.1)	CH	(10.3)	CH
20	/	75.6, C	3.03, m	38.4,	/	76.9, C	3.16, m	37.7,
				CH				CH
2O-CH3	1.45, s	26.6,	0.89, d	17.2,	1.48, s	23.1,	1.10, d	18.4,
		ch₃	(6.7)	ch₃		ch₃	(6.6)	ch₃
21	4.24, d	87.0,	3.39, m	81.7,	3.42, m	82.1,	3.37, m	82.1,
	(8.2)	CH		CH		CH		CH
22	2.41, m	28.4,	1.94, m	34.9,	1.74, m	37.2,	1.77, m	36.5,
		CH		CH		CH		CH
22-CH3	1.26, d	16.0,	1.20, d	19.3,	0.84, d	17.4,	1.08, d	18.7,
	(6.9)	ch₃	(6.7)	ch₃	(6.6)	ch₃	(6.6)	ch₃
23	3.80, m	71.6,	4.14, m	74.5,	3.66, m	80.1,	3.57, m	80.2,
		CH		CH		CH		CH
24	2.82, m	55.1,	2.90, dd	52.1,	1.90, m	32.7,	1.28, m	29.3,
		CH	(10.5,	CH		CH		CH
			2.2)
24-CH3/C	/	170.7, C	3.64, s	50.6,	1.00, d	9.7, CH₃	0.87, d	9.2, CH₃
OO-/CO				ch₃	(6.8)		(6.6)

2019101637 18 Dec 2019

och₃				172.6, C
25	3.82, m	75.4,	3.89, dd	70.1,	3.94, m	70.7,	3.96, m	70.3,
		CH	(10.5,	CH		CH		CH
			2.2)
26	1.68, m	39.5,	1.29, m	42.5,	2.35, m	35.9,	1.94, m	36.2,
		CH		CH		CH		CH
26-CH₃	1.05, d	10.1,	0.48, d	9.8, CH₃	0.76, d	8.7, CH₃	0.87, d	8.7, CH₃
	(6.7)	ch₃	(6.9)		(6.7)		(6.9)
27	3.59, m	74.0,	3.95, m	72.1,	3.49, m	73.6,	3.54, m	75.4,
		CH		CH		CH		CH
28	2.55, m	37.1,	2.48, m	38.7,	/	77.2, C	/	76.5, C
		CH		CH
28-CH₃	0.70, d	14.1,	0.97, d	17.7,	1.13, s	21.9,	1.18, s	23.9,
	(6.7)	ch₃	(6.6)	ch₃		ch₃		ch₃
29	5.26, m	150.3,	6.17, d	145.4,	5.65, br.	152.3,	5.68, br.	142.4*,
		CH	(8.4)	CH	s	CH	s	CH

(2) Determination of biological activity

The standard strains of Staphylococcus aureus ATCC29213 and ATCC25904, the standard strain of MRSA ATCC43300, and the clinically isolated strains of MRSAUSA300 LAC and USA400 MW2 were selected as test objects, and a minimum inhibitory concentration (MIC) test was carried out on the novel streptovaricins (compounds 1-4) by using vancomycin as a positive control. The test results were shown in table 7.

Table 7 MIC value test results of the microdilution broth method

Test Compound (pg/mL)	Test Strain
ATCC29213	ATCC25904	ATCC43300	USA300 LAC	USA400 MW2
1	> 128	> 128	> 128	> 128	> 128

2	32	16	16	16	16
3	4	8	2	8	8
4	32	32	16	32	32
Vancomycin	1	1	1	1	1

The compounds 2, 3 and 4 shown in the table have relatively strong inhibitory activities on each of the standard strain of Staphylococcus aureus ATCC29213, the standard strain of MRSA ATCC 43300, and the clinically isolated strains of MRSA USA300 LAC and USA 400 MW2, with a minimum inhibitory concentration (MIC) value of them being as low as 2 pg/mL. At the same time, the present invention tested the biological activity of Streptovaricin C to the Escherichia coli standard strain ATCC 25922 and the Acinetobacter baumannii ATCC 19606, and the results showed that the MICs of them were 8 pg/mL and 16 pg/mL respectively.

The above embodiments are preferred embodiments of the present invention. However, the implementation of the present invention are not limited by the above embodiments. Any other change, modification, substitution, combination, and simplification made without departing from the spiritual essence and principle of the present invention should be an equivalent replacement manner, and all are included in a claimed scope of the present invention.

Claims

1. A streptovaricin derivative having a structural formula shown in any one of formulas 1-4:

28-dehydroxylated streptovaricin F (1)

6-methoxy-8-hydroxy-24-carboxymethyl

-protostreptovaricine I (2)

24-decarboxylated methyl streptovaricin G (3)

24-decarboxylated methyl streptovaricin C (4)

2. A method for preparing the streptovaricin derivatives 1-4 according to claim 1, comprising the following steps:

A. obtaining a streptovaricin biosynthesis gene cluster via cloning by using an original streptovaricin-producing strain Streptomyces spectabilis CCTCC M2017417 as a starting strain (with the accession number of CCTCC NO: M2017417), wherein the gene cluster comprises 5 P450 genes (stvPl, stvP2, stvP3, stvP4 and stvP5) involved in the post-biosynthesis modification of streptovaricin, which are respectively located on the bases at locations 13481-14773, 15800-17005, 18765-19958, 83977-85221 and 87228-88481 of SEQ ID NO: 1;

B. carrying out selective inactivation respectively on the P450 genes responsible for the post-biosynthesis modification of streptovaricin, i.e., the stvP4 and stvP5, to respectively obtain a stvP4 gene inactivation mutant strain AstvP4 and a stvP5 gene inactivation mutant strain AstvP5, wherein for the selective inactivation of stvP4, it is characterized by in-frame knockout, and that is, a 1990 bp fragment is amplified upstream of the stvP4 gene by using a chromosome DNA of a wild-type streptovaricin-producing bacterium Streptomyces spectabilis CCTCC M2017417 (with the accession number of CCTCC NO: M2017417) as a template and using stvP4-L-F and

2019101637 18 Dec 2019 stvP4-L-R of which the nucleotide sequences are shown in SEQ ID NO: 2-3 as primers, and then used as a stvP4 in-frame knockout homologous-cross-over left arm stvP4-L, and a 1989 bp fragment is amplified downstream of the stvP4 gene by using stvP4-R-F and stvP4-R-R of which the nucleotide sequences are shown in SEQ ID NO: 4-5 as primers, and then used as a stvP4 in-frame knockout homologous-cross-over right arm stvP4-R; for the selective inactivation of stvP5, it is characterized by in-frame knockout, and that is, a 2098 bp fragment is amplified upstream of the stvP5 gene by using a chromosome DNA of a wild-type streptovaricin-producing bacterium Streptomyces spectabilis CCTCC M2017417 (with the accession number of CCTCC NO: M2017417) as a template and using stvP5-L-F and stvP5-L-R of which the nucleotide sequences are shown in SEQ ID NO: 6-7 as primers, and then used as a stvP5 in-frame knockout homologous-cross-over left arm stvP5-L, and a 1928 bp fragment is amplified downstream of the stvP5 gene by using stvP5-R-F and stvP5-R-R of which the nucleotide sequences are shown in SEQ ID NO: 8-9 as primers, and then used as a stvP5 in-frame knockout homologous-cross-over right arm stvP5-R;

C. for a method of extracting the fermentation product of the mutant strain AstvP4 or AstvP5, it is characterized in that the fermentation broth of the mutant strain AstvP4 or AstvP5 is extracted with equal volume of ethyl acetate for 3 times, the ethyl acetate phase is collected and concentrated to dryness by a rotary evaporator, and then is re-dissolved by 0.05 volume of methanol, so that the solutes of the mutant strains AstvP4 and AstvP5 respectively contain streptovaricin derivatives 1-2 or 3-4; and

D. for a method of purifying the extracted fermentation product of the mutant strain AstvP4 or AstvP5, it is characterized in that the extracted fermentation product is dissolved in methanol, filtered by an organic-system filter membrane, and the filtrate is purified by high-performance liquid chromatography, the chromatographic conditions are: a phase A of water; a phase B of acetonitrile; a flow rate of 3 mL/min, a elution procedure of 35-65% B for 0-20 min; 65-95% B for 20-28 min; and 95% B for 28-30 min, the peak times of the streptovaricin derivatives 1-4 are at 12-24 min, and the chromatographic column is a ZORBAX Eclipse XDB-C18 reverse phase column (5 pm, 9.4 x 250 mm) from Agilent, as such the streptovaricin derivatives of formulas 1-4 according to claim 1 are prepared.

3. An engineered strain for producing streptovaricin derivatives 1 and 2 according to claim 1, which is a Streptomyces spectabilis CCTCC M2017417 (with the accession number of CCTCC NO: M2017417) in which a stvP4 gene is inactivated, and an engineering strain for producing streptovaricin derivatives 3 and 4 according to claim 1, which is a Streptomyces spectabilis CCTCC M2017417 (with the accession number of CCTCC NO: M2017417) in which a stvP5 gene is inactivated.

2019101637 18 Dec 2019

4. A use of the streptovaricin derivatives 1-4 according to claim 1 in preparation of an antibacterial agent.

5. The use according to claim 4, wherein the bacterium is a drug-resistant bacterium.