AU2019100990A4

AU2019100990A4 - Recombinant shuttle plasmid containing porcine epidemic diarrhea virus s gene, recombinant adenovirus, and application thereof

Info

Publication number: AU2019100990A4
Application number: AU2019100990A
Authority: AU
Inventors: Xinsheng Liu
Original assignee: Lanzhou Veterinary Research Institute of CAAS
Current assignee: Lanzhou Veterinary Research Institute of CAAS
Priority date: 2019-09-02
Filing date: 2019-09-02
Publication date: 2019-10-10
Anticipated expiration: 2027-09-02

Abstract

The present invention provides a recombinant shuttle plasmid containing porcine epidemic diarrhea virus (PEDV) S gene, a recombinant adenovirus, and an application thereof, and relates to the technical field of genetic engineering vaccine. The recombinant adenovirus constructed by the present invention has a high titer, reaching up to 1x1011 PFU/mL, which can provide important support for clinically effective prevention and control of PEDV.

Description

RECOMBINANT SHUTTLE PLASMID CONTAINING PORCINE EPIDEMIC DIARRHEA VIRUS S GENE, RECOMBINANT ADENOVIRUS, AND APPLICATION THEREOF

TECHNICAL FIELD

The present invention relates to the technical field of genetic engineering vaccine, and in particular to a recombinant shuttle plasmid containing porcine epidemic diarrhea virus (PEDV) S gene, a recombinant adenovirus, and an application thereof.

BACKGROUND

Porcine epidemic diarrhea (PED), caused by porcine epidemic diarrhea virus (PEDV), is an acute and highly contagious porcine intestinal infectious disease mainly presenting with diarrhea, vomiting, dehydration, and high lethality of suckling piglets. In recent years, PED becomes more and more prevalent, new variants are emerging, and commercial vaccines show poor immune effects, thereby influencing the health development of the pig industry seriously.

SUMMARY

The objective of the present invention is to provide a recombinant shuttle plasmid containing porcine epidemic diarrhea virus (PEDV) S gene, a recombinant adenovirus, and an application thereof, which can provide important support for clinically effective prevention and control of PEDV.

In order to achieve the foregoing invention objective, the present invention provides the following technical solutions:

The present invention provides a recombinant shuttle plasmid containing porcine epidemic diarrhea virus (PEDV) S gene, where the nucleotide sequence of the PEDV S gene is depicted in SEQ ID NO. 1.

Preferably, the recombinant shuttle plasmid uses an adenovirus shuttle vector pDC316-mCMV-EGFP as an original plasmid.

Preferably, the PEDV S gene is inserted between Not I and Afl II restriction sites at pDC316-mCMV-EGFP.

The present invention further provides a recombinant adenovirus containing the recombinant shuttle plasmid of the foregoing solution.

The present invention further provides an application of the recombinant adenovirus of the foregoing solution in the preparation of vaccine for PEDV.

Beneficial Effects of the Present Invention: The present invention provides a recombinant shuttle plasmid containing porcine epidemic diarrhea virus (PEDV) S gene, a recombinant adenovirus, and an application thereof. The recombinant adenovirus constructed by the present invention has a high titer, reaching up to lx 10¹¹ PFU/mL, which can provide important support

2019100990 02 Sep 2019 for clinically effective prevention and control of PEDV.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows observation results of the cell state of the adenovirus in Embodiment 3, where FIGS. 1-1 to 1-12 present dilution factors of 10'¹ to IO'¹², respectively;

FIG. 2 shows a target protein band observed by an enhanced chemiluminescent (ECL) system in Embodiment 4;

FIG. 3 shows a Western blot result of a PEDV S protein expressed by a recombinant adenovirus rAd-PEDV-S of Embodiment 5.

DETAILED DESCRIPTION

The present invention provides a recombinant shuttle plasmid pDC316-S-EGFP containing porcine epidemic diarrhea virus (PEDV) S gene, where the nucleotide sequence of the PEDV S gene is depicted in SEQ ID NO. 1, with a full length of 4164 bp. There is no particular limitation on the source of the PEDV S gene in the present invention, which is preferably synthesized by Wuhan Gene Create Biological Engineering Co., Ltd. or amplified by RT-PCR; the nucleotide sequence of a forward primer (PEDV-20400-F) of the RT-PCR is depicted in SEQ ID NO. 2, more particularly, GCAACACTATGCATGCCAAT; the nucleotide sequence of a reverse primer

(PEDV-25103-R) of the RT-PCR is depicted in SEQ ID NO. 3, more particularly, CCTGCCAATAAGTGTGCAACA; the amplification system of the RT-PCR is shown in Table 1; the amplification procedure of the RT-PCR is as follows: at 98°C for 1 min, at 95°C for 30 s, at 60°C for 40 s, at 68°C for 1 min, followed by 34 cycles; at 68°C for 1 min; storage at 4°C.
Table 1 The amplification system of RT-PCR
System component	Volume
lOxGXL Buffer	10 pL
2.5mM dNTP	4 pL
PEDV-20400-F (lOuM)	2 pL
PEDV-25103-R (lOuM)	2 pL
GXL high-fidelity polymerase	2 pL
DEPC-treated water	27 pL
cDNA template	3 pL

In the present invention, the recombinant shuttle plasmid preferably uses the adenovirus shuttle vector pDC316-mCMV-EGFP as an original plasmid; the PEDV S gene is preferably inserted between Not I and Afl II restriction sites at pDC316-mCMV-EGFP.

2019100990 02 Sep 2019

In the present invention, the ligation system of the constructed recombinant shuttle plasmid is 8 pL, preferably including 2 pL of PEDV S gene, 4 pL of sterile distilled water, 1 pL of T4 DNA ligase, and 1 pL of ligation buffer; the ligation procedure of construction of the recombinant shuttle plasmid is preferably reaction at 16°C for 30 min.

The present invention further provides rAd-PEDV-S, a recombinant adenovirus containing the recombinant shuttle plasmid of the foregoing solution.

In the present invention, the construction system of the recombinant adenovirus preferably includes: 500 pL of DMEM (serum-free), 1.5 pg of pDC316-S-EGFP plasmid, 6 pg of pBHGloxDeltaEl,3, liposome mixture, and 293A cells; the construction procedure of the recombinant adenovirus is preferably: culture at 37°C in 5% CO2 until the appearance of massive plaques in cells; the duration of the culture is preferably 8-12 days, and more preferably 10 days.

The technical solutions of the present invention will be described in detail below in conjunction with the embodiments, but should not be construed as limiting the scope of the invention.

Embodiment 1 Construction of recombinant shuttle plasmid

1. Porcine epidemic diarrhea virus (PEDV) S gene and adenovirus shuttle vector pDC316-mCMV-EGFP were double digested with Not I and Afl II, respectively, target gene and vector fragments were recovered, 2 pL each of the foregoing recovery product was pipetted into a new tube, 4 pL of sterile distilled water was added and mixed well, 1 pL of T4 DNA ligase was added and mixed gently with 1 pL of ligation buffer, followed by reaction at 16°C for 30 min.

2. Competent Escherichia coli DH5a was transformed, monoclonal colonies were screened, and plasmids were extracted. A correct recombinant shuttle plasmid was identified and named pDC316-S-EGFP.

1) DH5a competent cells were thawed on ice; ligation product was added and mixed gently in an ice bath for 30 min;

2) after heat shock at 42°C for 45 s, a centrifuge tube was transferred onto ice rapidly and kept in ice bath;

3) 450 pL of sterile SOC medium was added, mixed well, and placed in a shaker at 37°C, followed by shaking culture for 45 min at 200 rpm/min to recover thalli; and

4) 100 pL of bacterial liquid was spread on an ampicillin-containing LB culture plate and inversely cultured for 12 h in an incubator at 37°C.

Embodiment 2 Packaging of recombinant adenovirus

293A cells were seeded in a plate and used for transfection when cell density was up to

2019100990 02 Sep 2019

70%-80%; 500 pL of DMEM (serum-free) was added to a 1.5 mL EP tube, and then 1.5 pg of pDC316-S-EGFP plasmid and 6 pg of pBHGloxDeltaEl,3 were added and mixed well, followed by adding to 293A cells together with liposome mixture, while the medium was shaken gently to mix well and cultured at 37°C in a 5% CO2 cell incubator. After continuous culture for 10 days, cells were collected until massive plaques were observed in cells microscopically.

Embodiment 3 Titration of recombinant adenovirus

Taking a 96-well plate, the cells obtained in Embodiment 2 were plated at 10E4 cells/well and cultured in an incubator for 24 h. A 10-fold serial dilution (11 gradients) was prepared using 10 pL of concentrated adenovirus suspension, adenovirus amplification buffer at a dilution factor of 100 pL was added, and 100 pL of complete medium was added to each well after infection for 24 h. Culture proceeded in 5% CO2 for 48 h and cell state was observed; the concentrated adenoviruses after 10-fold dilution were transfected into cells, and the cell state was observed, followed by observation and photographing under a fluorescence microscope after culture for 72 h. Virus titer was calculated. Experimental results are shown in FIG. 1, where FIGS. 1-1 to 1-12 present dilution factors of 10'¹ to IO'¹², respectively. Results showed that the constructed recombinant adenovirus had a high titer, which was up to 1 x 10¹¹ PFU/mL.

Embodiment 4 Identification of recombinant adenovirus

Recombinant adenovirus rAd-PEDV-S packaged in Embodiment 2 and no-load adenovirus Ad5-EGFP were transfected into AD-293 cells, respectively. Protein was extracted after 48 h and electrotransferred onto a PVDF membrane after separation by SDS-PAGE; mouse anti-His-Tag monoclonal antibody (1:1000 dilution) was added and incubated for 12 h at 4°C; the membrane was washed twice with TBST and incubated with HRP-conjugated goat anti-mouse IgG (1:2000 dilution) for 2 h at room temperature; the membrane was washed, and a target protein band was observed by an enhanced chemiluminescent (ECL) system (Millipore, USA). Result is shown in FIG. 2. The result showed that the recombinant adenovirus rAd-PEDV-S could express PEDV S protein well in the cell.

Embodiment 5 Western blot of recombinant adenovirus rAd-PEDV-S-expressed PEDV S protein

After recombinant adenovirus rAd-PEDV-S was transfected with 293 cells, total sample protein was collected. With recombinant adenovirus-uninfected normal cell as control, Western blot was conducted for identification. Result is shown in FIG. 3. The result showed that the recombinant adenovirus rAd-PEDV-S could express PEDV S protein well in the cell.

The foregoing descriptions are only preferred implementation manners of the present invention. It should be noted that for a person of ordinary skill in the art, several improvements and modifications may further be made without departing from the principle of the present

2019100990 02 Sep 2019 invention. These improvements and modifications should also be deemed as falling within the protection scope of the present invention.

Claims

1. A recombinant shuttle plasmid containing porcine epidemic diarrhea virus (PEDV) S gene, wherein the nucleotide sequence of the PEDV S gene is depicted in SEQ ID NO. 1.

2. The recombinant shuttle plasmid according to claim 1, wherein the recombinant shuttle plasmid uses an adenovirus shuttle vector pDC316-mCMV-EGFP as an original plasmid.

3. The recombinant shuttle plasmid according to claim 2, wherein the PEDV S gene is inserted between Not I and Afl II restriction sites at pDC316-mCMV-EGFP.

4. A recombinant adenovirus comprising the recombinant shuttle plasmid according to any one of claims 1 to 3.

5. An application of the recombinant adenovirus according to claim 4 in the preparation of vaccine for PEDV