AU2015258298B2 - AAD-1 event DAS-40278-9, related transgenic corn lines, and event-specific identification thereof - Google Patents

Abstract

Abstract This invention relates in part to plant breeding and herbicide tolerant plants. This invention includes a novel aad- 1 transformation event in corn plants comprising a polynucleotide sequence, as described herein, inserted into a specific site within the genome of a corn cell. In some embodiments, said event / polynucleotide sequence can be "stacked" with other traits, including, for example, other herbicide tolerance gene(s) and/or insect-inhibitory proteins. Additionally, the subject invention provides assays for detecting the presence of the subject event in a sample (of corn grain, for example). The assays can be based on the DNA sequence of the recombinant construct, inserted into the corn genome, and on the genomic sequences flanking the insertion site. Kits and conditions useful in conducting the assays are always provided.

Description

ΙΟο (Ν> Οο (Ν Ρ/00/011 Regulation 3.2

Australia

Patents Act 1990 00 σ^ (Ν 00 ΙΟ (Ν ΙΟ Ο (Ν

COMPLETE SPECIFICATION STANDARD PATENT

Invention Title: AAD-1 event DAS-40278-9, related transgenic corn lines, and event-specific identification thereof

The following statement is a full description of this invention, including the best method of performing it known to us: 1001286871 Ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 30 1001182596 ΙΑ

AAD-1 EVENT DAS-40278-9. RELATED TRANSGENIC CORN LINES. AND EVENT-SPECIFIC

IDENTIFICATION THEREOF

CROSS REFERENCE TO REACTED APPLICATIONS

This application is a divisional of Australian patent application 2010284284, the entire disclosure of which is incorporated herein by reference.

BACKGROUND OF THE INVENTION

Reference to any prior art in the specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in Australia or any other jurisdiction.

The aad-1 gene (originally from Sphingobium herbicidovorans) encodes the aryloxyalkanoate dioxygenase (AAD-1) protein. The trait confers tolerance to 2,4-dichlorophenoxyacetic acid and aryloxyphenoxypropionate (commonly referred to as "fop" herbicides such as quizalofop) herbicides and may be used as a selectable marker during plant transformation and in breeding nurseries. The aad-1 gene, itself, for herbicide tolerance in plants was first disclosed in WO 2005/107437 (see also US 2009-0093366).

The expression of heterologous or foreign genes in plants is influenced by where the foreign gene is inserted in the chromosome. This could be due to chromatin structure (e.g., heterochromatin) or the proximity of transcriptional regulation elements (e.g., enhancers) close to the integration site (Weising et at, Ann. Rev. Genet 22:421-477,1988), for example. The same gene in the same type of transgenic plant (or other organism) can exhibit a wide variation in expression level amongst different events. There may also be differences in spatial or temporal patterns of expression. For example, differences in the relative expression of a transgene in various plant tissues may not correspond to the patterns expected from transcriptional regulatory elements present in the introduced gene construct.

Thus, large numbers of events are often created and screened in order to identify an event that expresses an introduced gene of interest to a satisfactory level for a given purpose. For commercial purposes, it is conunon to produce hundreds to thousands of different events and to screen those events for a single event that has desired transgene expression levels and patterns. An event that has desired levels and/or patterns of transgene expression is useful for introgressing the transgene into other genetic backgrounds by sexual outcrossing using conventional breeding methods. Progeny of such crosses maintain the transgene expression characteristics of the original transformant. This strategy is used to ensure reliable gene expression in a number of varieties that are well adapted to local growing conditions. U.S. Patent Apps. 20020120964 A1 and 20040009504 A1 relate to cotton event PV-GHGT07(1445) and compositions and methods for the detection thereof. WO 02/100163 relates to ΙΟ ο (Ν > Ο ο (Ν 00 σ^ (Ν 00 ΙΟ (Ν ΙΟ Ο (Ν 25 cotton event ΜΟΝΙ5985 and compositions and methods for the detection thereof WO 2004/011601 relates to com event MON863 plants and compositions and methods for the detection thereof. WO 2004/072235 relates to cotton event MON 88913 and compositions and methods for the detection thereof. WO 2006/098952 relates to com event 3272. WO 2007/142840 relates to com event M1R162. U.S. Patent No. 7,179,965 relates to cotton having a crylF event and a crylAc event. AAD-1 com having the specific event disclosed herein has not previously been disclosed.

BRIEF SUMMARY OF THE INVENTION

The present invention is related to the AAD-1 com event designated DAS-40278-9 having seed deposited with American Type Culture Collection (ATCC) with Accession No. PTA-10244, and progeny derived thereof Other aspects of the invention comprise the progeny plants, seeds and grain or regenerable parts of the plants and seeds and progeny of com event DAS-40278-9, as well as food or feed products made from any thereof The invention also includes plant parts of com event DAS-40278-9 that include, but are not limited to, pollen, ovule, flowers, shoots, roots, and leaves, and nuclei of vegetative cells, pollen cells, and egg cells. The invention further relates to com plants having tolerance to phenoxy auxinic and/or aryloxyalkanoate herbicides, novel genetic compositions of com event DAS-40278-9, and aspects of agronomic performance of com plants comprising com event DAS-40278-9.

This invention relates in part to plant breeding and herbicide tolerant plants. This invention includes a novel aad-1 transformation event in com plants comprising a polynucleotide sequence, as described herein, inserted into a specific site within the genome of a com cell.

In some embodiments, said event / polynucleotide sequence can be “stacked” with other traits, including, for example, other herbicide tolerance gene(s) and/or insect-inhibitory proteins. However, the subject invention includes plants having the single event, as described herein.

The additional traits may be stacked into the plant genome via plant breeding, retransformation of the transgenic plant containing com event DAS-40278-9, or addition of new traits through targeted integration via homologous recombination. Ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 30

Other embodiments include the excision of polynucleotide sequences which comprise com event DAS-40278-9, including for example, the pat gene expression cassette. Upon excision of a polynucleotide sequence, the modified event may be re-targeted at a specific chromosomal site wherein additional polynucleotide sequences are stacked with com event DAS-40278-9.

In one embodiment, the present invention encompasses a com chromosomal target site located on chromosome 2 at approximately 20 cM between SSR markers IJM(21265 (see SEQ ID NO;30 and SEQ ID N0;3i) and MMCOlll (see SEQ ID NO;32 and SEQ ID NO;33) at approximately 20 cM on the 2008 D.AS com linakge map, wherein the target site comprises a heterologous nucleic acid, in another embodiment, the present invention encompasses a corn ehromosomai target site comprising a location defined in or by SEQ ID NO:29 and the residues thereof as described herein, as v/ouid be recognized by one skilled in the art.

In one embodiment, the preserd inventiori encompasses a method of making a transgenie com plant comprising inserting a heterologous nueleie acid at a position on chromosoirie 2 at approximately 20 cM between SSR markers UK4C1265 (see SEQ ID NO:30 and SEQ ID NO;3I) and MMC0111 (see SEQ ID NO:32 and SEQ ID NO;33) at approximately 20 cM on the 2008 DAS corn linakge map. In still another embodiment, the inserted heterologons nncleic acid is flanked 5' by all or part of the 5' flanking sequence as defined herein with refernce to SEQ ID NO;29, and flanked 3' by all or part of the 5’ flanking sequence as defined herein wdth refernce to SEQ ID NO:29.

Additionally, the subject invention provides assays for detecting the presence of the subject event in a sample (of com grain, for example). The assays can be based on the DNA sequence of the recombinant constmet, inserted into the com genome, and on the genomic sequences flanking the insertion site. Kits and conditions useful in conducting the assays are also provided.

Thus, the subject invention relates in part to the cloning and analysis of the DNA sequences of a whole AAD-1 insert, and the border regions thereof (in transgenic com lines). These sequences are unique. Based on these insert and border sequences, event-specific primers were generated. PCR analysis demonstrated that these events can be identified by analysis of the PCR amplicons generated with these event-specific primer sets. Thus, these and other related procedures can be used to uniquely identify com lines comprising the event of the subject invention. ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ιη Ο (Ν 25 BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows a plasmid map of pDAS1740.

Figure 2 shows components of the insert for DAS-40278-9 (pDAS1740).

Figure 3 shows a restriction map and components of the insert for DAS-40278-9 (pDAS1740).

Figure 4 shows amplicons, primers, and a cloning strategy for the DNA insert and borders for DAS-40278-9.

Figure 5 illustrates primer locations with respect to the insert and borders for DAS-40278-9. Figure 6 illustrates the junction regions and insertion for DAS-40278-9.

Figure 7 is a breeding diagram referenced in Example 7. BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID NOs:l-28 are primers as described herein. SEQ ID NO:29 provides insert and flanking sequences for the subject event DAS-40278-9. SEQ ID NOs:30-33 are primers for flanking markers as described in Example 4. DETAILED DESCRIPTION OF THE INVENTION This invention relates in part to plant breeding and herbicide tolerant plants. This invention includes novel transformation events of com plants (maize) comprising a subject aad-1 polynucleotide sequences, as described herein, inserted into specific site within the genome of a com cell. In some embodiments, said polynucleotide sequence can be “stacked” with other traits (such as other herbicide tolerance gene(s) and/or gene(s) that encode insect-inhibitory proteins, for example. In some embodiments said polynucleotide sequences can be excised and subsequently re-targeted with additional polynucleotide sequences. However, the subject invention includes plants having a single event, as described herein.

Additionally, the subject invention provides assays for detecting the presence of the subject event in a sample. Aspects of the subject invention include methods of designing and/or producing any diagnostic nucleic acid molecules exemplified or suggested herein, particularly those based wholly or partially on the subject flanking sequences. Ο (Ν > Ο 2; ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 30 ΙΟ

More specifically, the subj ect invention relates in part to transgenic com event DAS-40278-9 (also known as pDAS 1740-278), plant lines comprising these events, and the cloning and analysis of the DNA sequences of this insert, and/or the border regions thereof. Plant lines of the subject invention can be detected using sequences disclosed and suggested herein.

In some embodiments, this invention relates to herbicide-tolerant com lines, and the identification thereof The subject invention relates in part to detecting the presence of the subject event in order to determine whether progeny of a sexual cross contain the event of interest. In addition, a method for detecting the event is included and is helpful, for example, for complying with regulations requiring the pre-market approval and labeling of foods derived from recombinant crop plants, for example. It is possible to detect the presence of the subject event by any well-known nucleic acid detection method such as polymerase chain reaction (PCR) or DNA hybridization using nucleic acid probes. An event-specific PCR assay is discussed, for example, by Windels et al. (Med. Fac. Landbouww, Univ. Gent 64/5b:459462, 1999). This related to the identification of glyphosate tolerant soybean event 40-3-2 by PCR using a primer set spanning the junction between the insert and flanking DNA. More specifically, one primer included sequence from the insert and a second primer included sequence from flanking DNA.

Com was modified by the insertion of the aad-\ gene from Sphingobium herbicidovorans which encodes the aryloxyalkanoate dioxygenase (AAD-1) protein. The trait confers tolerance to 2,4-dichlorophenoxyacetic acid and arylox)q)henoxypropionate (commonly referred to as “fop” herbicides such as quizalofop) herbicides and may be used as a selectable marker during plant transformation and in breeding nurseries. Transformation of com with a DNA fragment from the plasmid pDAS1740 was carried forward, through breeding, to produce event DAS-40278-9.

Genomic DNA samples extracted from twenty individual com plants derived from five generations and four plants per generation of event DAS-40278-9 were selected for molecular characterization of the AAD-1 com event DAS-40278-9. AAD-1 protein expression was tested using an AAD-1 specific rapid test strip kit. Only plants that tested positive for AAD-1 protein expression were selected for subsequent molecular characterization. Southern hybridization confirmed that the aad-l gene is present in com plants that tested positive for AAD-1 protein expression, and the aad-\ gene was inserted as a single intact copy in these plants when hybridized with an aad-\ gene probe. ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25

Molecular characterization of the inserted DNA in AAD-1 com event DAS-40278-9 is also described herein. The event was produced via Whiskers transformation with the Fsp I fragment of plasmid pDAS1740. Southern blot analysis was used to establish the integration pattern of the inserted DNA fragment and determine insert/copy number of the aad-1 gene in event DAS-40278-9. Data were generated to demonstrate the integration and integrity of the aad-l transgene inserted into the com genome. Characterization of the integration of noncoding regions (designed to regulate the coding regions), such as promoters and terminators, the matrix attachment regions RB7 Mar v3 and RB7 Mar v4, as well as stability of the transgene insert across generations, were evaluated. The stability of the inserted DNA was demonstrated across five distinct generations of plants. Furthermore, absence of transformation plasmid backbone sequence including the Ampicillin resistance gene (Ap'^) region was demonstrated by probes covering nearly the whole backbone region flanking the restriction sites (Fsp I) of plasmid pDAS 1740. A detailed physical map of the insertion was drawn based on these Southern blot analyses of event DAS-40278-9.

Levels of AAD-1 protein were determined in com tissues. In addition, compositional analysis was performed on com forage and grain to investigate the equivalency between the isogenic non-transformed com line and the transgenic com line DAS-40278-9 (unsprayed, sprayed with 2,4-D, sprayed with quizalofop, and sprayed with 2,4-D and quizalofop). Agronomic characteristics of the isogenic non-transformed com line were also compared to the DAS-40278-9 com.

Field expression, nutrient composition, and agronomic trials of a non-transgenic control and a hybrid com line containing Aryloxyalkanoate Dioxygenase-1 (AAD-1) were conducted in the same year at six sites located in Iowa, Illinois (2 sites), Indiana, Nebraska and Ontario, Canada. Expression levels are summarized herein for the AAD-1 protein in leaf, pollen, root, forage, whole plant, and grain, the results of agronomic determinations, and compositional analysis of forage and grain samples from the control and DAS-40278-9 AAD-1 com.

The soluble, extractable AAD-1 protein was measured using a quantitative enzyme-linked immunosorbent assay (ELISA) method in com leaf, pollen, root, forage, whole plant, and grain. Good average expression values were observed in root and pollen tissue, as discussed in more detail herein. Expression values were similar for all the sprayed treatments as well as for the plots sprayed and unsprayed with 2,4-D and quizalofop herbicides. ο (N > Ο ο (Ν 00 σ^ (Ν 00 ιη (Ν ιη ο (Ν 25 30 in

Compositional analyses, including proximates, minerals, amino acids, fatty acids, vitamins, anti-nutrients, and secondary metabolites were conducted to investigate the equivalency of DAS-40278-9 AAD-1 com (with or without herbicide treatments) to the control. Results for DAS-40278-9 AAD-1 composition samples were all as good as, or better than (biologically and agronomically), based on control lines and/or conventional com, analysis of agronomic data collected from control and DAS-40278-9 AAD-1 com plots.

As alluded to above in the Background section, the introduction and integration of a transgene into a plant genome involves some random events (hence the name “event” for a given insertion that is expressed). That is, with many transformation techniques such as Agrobacterium transformation, the “gene gun,” and WHISKERS, it is unpredictable where in the genome a transgene will become inserted. Thus, identifying the flanking plant genomic DNA on both sides of the insert can be important for identifying a plant that has a given insertion event. For example, PCR primers can be designed that generate a PCR amplicon across the junction region of the insert and the host genome. This PCR amplicon can be used to identify a unique or distinct type of insertion event.

As “events” are originally random events, as part of this disclosure at least 2500 seeds of a com line comprising the event have been deposited and made available to the public without restriction (but subj ect to patent rights), with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA, 20110. The deposit has been designated as ATCC Deposit No. PTA-10244 (Yellow Dent maize hybrid seed (Zea Mays L.):DAS-40278-9; Deposited on behalf ofDow AgroSciencesLLC; Dateofreceiptofseeds/strain(s)bythe ATTC: July 10,2009; viability confirmed August 17,2009). This deposit was made and will be maintained in accordance with and under the terms of the Budapest Treaty with respect to seed deposits for the purposes of patent procedure. The deposit will be maintained without restriction at the ATCC depository, which is a public depository, for a period of 30 years, or five years after the most recent request, or for the effective life of the patent, whichever is longer, and will be replaced if it becomes nonviable during that period.

The deposited seeds are part of the subject invention. Clearly, com plants can be grown from these seeds, and such plants are part of the subject invention. The subject invention also relates to DNA sequences contained in these com plants that are useful for detecting these plants and progeny irj Ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν (Ν 0 25 30 1001182596 8 thereof. Detection methods and kits of the subject invention can be directed to identifying any one, two, or even all three of these events, depending on the ultimate purpose of the test.

Definitions and examples are provided herein to help describe the present invention and to guide those of ordinary skill in the art to practice the invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. The nomenclature for DNA bases as set forth at 37 CFR §1.822 is used.

As used herein, except where the context requires otherwise the term ‘comprise’ and variations of the term, such as ‘comprising’, ‘comprises’ and ‘comprised’, are not intended to exclude other additives, components, integers or steps.

As used herein, the term “progeny” denotes the offspring of any generation of a parent plat which comprises AAD-I com evend DAS-40278-9. A transgenic “event” is produced by transformation of plant cells with heterologous DNA, i.e., a nucleic acid construct that includes a transgene of interest, regeneration of a population of plants resulting from the insertion of the transgene into the genome of the plant, and selection of a particular plant characterized by insertion into a particular genome location. The term “event” refers to the original transformant and progeny of the transformant that include the heterologous DNA. The term “event” also refers to progeny produced by a sexual outcross between the transformant and another variety that includes the genomic/transgene DNA. Even after repeated back-crossing to a recurrent parent, the inserted transgene DNA and flanking genomic DNA (genomic/transgene DNA) from the transformed parent is present in the progeny of the cross at the same chromosomal location. The term “event” also refers to DNA from the original transformant and progeny thereof comprising the inserted DNA and flanking genomic sequence immediately adjacent to the inserted DNA that would be expected to be transferred to a progeny that receives inserted DNA including the transgene of interest as the result of a sexual cross of one parental line that includes the inserted DNA (e.g., the original transformant and progeny resulting from selling) and a parental line that does not contain the inserted DNA. A “junction sequence” spans the point at which DNA inserted into the genome is linked to DNA from the corn native genome flanking the insertion point, the identification or detection of one or the other junction sequences in a plant's genetic material being sufficient to be diagnostic for the event. Included are the DNA sequences that span the insertions in herein-described corn events and similar lengths of flanking DNA. Specific examples of such diagnostic sequences are provided herein; however, other sequences that overlap the junctions of the insertions and the genomie sequenee, are also diagnostie and eould be used aeeording to the subjeet invention. ο (N > Ο Ο (Ν οο σ^ (Ν ΟΟ (Ν ΙΟ Ο (Ν

The subjeet invention relates to the identifieation of sueh flanking, junetion, and insert sequenees. Related PCR primers and amplieons are ineluded in the invention. Aeeording to the subjeet invention, PCR analysis methods using amplieons that span aeross inserted DNA and its borders ean be used to deteet or identify eommereialized transgenie eom varieties or lines derived from the subjeet proprietary transgenie eom lines.

The entire sequenees of eaeh of these inserts, together with portions of the respeetive flanking sequenees, are provided herein as SEQ ID NO:29. The eoordinates of the insert and flanking sequenees for this event with respeet to SEQ ID NO:29 (8557 basepairs total) are printed below. This is diseussed in more detail in Example 3.8, for example. 5’ Flanking Insert 3’Flanking residue #s (SEQ:29): 1-1873 1874-6689 6690-8557 length (bp): 1873 bp 4816 bp 1868 bp

This insertion event, and further components thereof, are further illustrated in Figures 1 and 2. These sequences (particularly the flanking sequences) are unique. Based on these insert and border sequences, event-specific primers were generated. PCR analysis demonstrated that these com lines can be identified in different com genotypes by analysis of the PCR amplieons generated with these event-specific primer sets. Thus, these and other related procedures can be used to uniquely identify these com lines. The sequences identified herein are unique. For example, 20 BLAST searches aginst GENBANK databases did not reveal any significant homology between the cloned border sequences and sequences in the database.

Detection techniques of the subject invention are especially useful in conjunction with plant breeding, to determine which progeny plants comprise a given event, after a parent plant comprising an event of interest is crossed with another plant line in an effort to impart one or more additional 25 traits of interest in the progeny. These PCR analysis methods benefit com breeding programs as well as quality control, especially for commercialized transgenic comseeds. PCR detection kits for 10 ο (N > Ο Ο (Ν οο σ^ (Ν (X) ΙΟ (Ν ΙΟ Ο (Ν 25 these transgenie eom lines ean also now be made and used. This ean also benefit product registration and product stewardship.

Furthermore, flanking com/genomic sequences can be used to specifically identify the genomic location of each insert. This information can be used to make molecular marker systems specific to each event. These can be used for accelerated breeding strategies and to establish linkage data.

Still further, the flanking sequence information can be used to study and characterize transgene integration processes, genomic integration site characteristics, event sorting, stability of transgenes and their flanking sequences, and gene expression (especially related to gene silencing, transgene methylation patterns, position effects, and potential expression-related elements such as MARS [matrix attachment regions], and the like).

In light of all the subject disclosure, it should be clear that the subject invention includes seeds available under ATCC Deposit No. PTA-10244. The subject invention also includes a herbicide-resistant com plant grown from a seed deposited with the ATCC under accession number PTA-10244. The subject invention further includes parts of said plant, such as leaves, tissue samples, seeds produced by said plant, pollen, and the like.

Still further, the subj ect invention includes descendant and/or progeny plants of plants grown from the deposited seed, preferably a herbicide-resistant com plant wherein said plant has a genome comprising a detectable wild-t)q)e genomic DNA/insert DNA junction sequence as described herein. As used herein, the term “com” means maize {Zea mays) and includes all varieties thereof that can be bred with com.

This invention further includes processes of making crosses using a plant of the subject invention as at least one parent. For example, the subject invention includes an Fi hybrid plant having as one or both parents any of the plants exemplified herein. Also within the subject invention is seed produced by such Fi hybrids of the subject invention. This invention includes a method for producing an Fi hybrid seed by crossing an exemplified plant with a different (e.g. in-bred parent) plant and harvesting the resultant hybrid seed. The subject invention includes an exemplified plant that is either a female parent or a male parent. Characteristics of the resulting plants may be improved by careful consideration of the parent plants. 11 ο (N > Ο :¾ ο (Ν (X) σ^ (Ν 00 (Ν ίη Ο (Ν 25 30 A herbicide-tolerant com plant can be bred by first sexually crossing a first parental com plant consisting of a com plant grown from seed of any one of the lines referred to herein, and a second parental com plant, thereby producing a plurality of first progeny plants; and then selecting a first progeny plant that is resistant to a herbicide (or that possesses at least one of the events of the subject invention); and selfing the first progeny plant, thereby producing a plurality of second progeny plants; and then selecting from the second progeny plants a plant that is resistant to a herbicide (or that possesses at least one of the events of the subject invention). These steps can further include the back-crossing of the first progeny plant or the second progeny plant to the second parental com plant or a third parental com plant. A com crop comprising com seeds of the subject invention, or progeny thereof, can then be planted.

It is also to be understood that two different transgenic plants can also be mated to produce offspring that contain two independently segregating added, exogenous genes. Selfing of appropriate progeny can produce plants that are homozygous for both added, exogenous genes. Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is vegetative propagation. Other breeding methods commonly used for different traits and crops are known in the art. Backcross breeding has been used to transfer genes for a simply inherited, highly heritable trait into a desirable homozygous cultivar or inbred line, which is the recurrent parent. The source of the trait to be transferred is called the donor parent. The resulting plant is expected to have the attributes of the recurrent parent (e.g., cultivar) and the desirable trait transferred from the donor parent. After the initial cross, individuals possessing the phenotype of the donor parent are selected and repeatedly crossed (backcrossed) to the recurrent parent. The resulting parent is expected to have the attributes of the recurrent parent (e.g., cultivar) and the desirable trait transferred from the donor parent.

The DNA molecules of the present invention can be used as molecular markers in a marker assisted breeding (MAB) method. DNA molecules of the present invention can be used in methods (such as, AFLP markers, RFLP markers, RAPD markers, SNPs, and SSRs) that identify genetically linked agronomically useful traits, as is known in the art. The herbicide-resistance trait can be tracked in the progeny of a cross with a com plant of the subject invention (or progeny thereof and any other com cultivar or variety) using the MAB methods. The DNA molecules are markers for this trait, and MAB methods that are well known in the art can be used to track the hebicide-12 ο (N > Ο Ο (Ν 00 c^ (Ν 00 (Ν ο (Ν 25 30 resistance trait(s) in com plants where at least one com line of the subject invention, or progeny thereof, was a parent or ancestor. The methods of the present invention can be used to identify any com variety having the subject event.

Methods of the subject invention include a method of producing a herbicide-tolerant com plant wherein said method comprises breeding with a plant of the subject invention. More specifically, said methods can comprise crossing two plants of the subject invention, or one plant of the subject invention and any other plant. Preferred methods further comprise selecting progeny of said cross by analyzing said progeny for an event detectable according to the subject invention. For example, the subject invention can be used to track the subject event through breeding cycles with plants comprising other desirable traits, such as agronomic traits such as those tested herein in various Examples. Plants comprising the subject event and the desired trait can be detected, identified, selected, and quickly used in further rounds of breeding, for example. The subject event / trait can also be combined through breeding, and tracked according to the subject invention, with an insect resistant trait(s) and/or with further herbicide tolerance traits. One preferred embodiment of the latter is a plant comprising the subject event combined with a gene encoding resistance to the herbicide dicamba.

Thus, the subject invention can be combined with, for example, traits encoding glyphosate resistance (e.g., resistant plant or bacterial EPSPS, GOX, GAT), glufosinate resistance {e.g., Pat, bar), acetolactate S50ithase (ALS)-inhibiting herbicide resistance {e.g., imidazolinones [such as imazethapyr], sulfonylureas, triazolopyrimidine sulfonanilide, pyrmidinylthiobenzoates, and other chemistries [Csrl, SurA, et al. ]), bromoxynil resistance {e.g., Bxn), resistance to inhibitors of HPPD (4-hydroxlphenyl-p50Uvate-dioxygenase) enzyme, resistance to inhibitors of phytoene desaturase (PDS), resistance to photosystem 11 inhibiting herbicides {e.g.,psbA), resistance to photosystem 1 inhibiting herbicides, resistance to protoporphyrinogen oxidase IX (PPO)-inhibiting herbicides {e.g., PPO-1), resistance to phenylurea herbicides {e.g., CYP76B1), dicamba-degrading enzymes {see, e.g., US 20030135879), and others could be stacked alone or in multiple combinations to provide the ability to effectively control or prevent weed shifts and/or resistance to any herbicide of the aforementioned classes.

Regarding additional herbicides, some additional preferred ATS (also known as AHAS) inhibitors include the triazolopyrimidine sulfonanilides (such as cloransulam-methyl, diclosulam. 13 ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 30 florasulam, flumetsulam, metosulam, and penoxsulam), pyrimidinylthiobenzoates (such as bisp5oibac and pyrithiobac), and flucarbazone. Some preferred HPPD inhibitors include mesotrione, isoxaflutole, and sulcotrione. Some preferred PPO inhibitors include flumiclorac, flumioxazin, flufenp)^·, pyraflufen, fluthiacet, butafenacil, carfentrazone, sulfentrazone, and the diphenylethers (such as acifluorfen, fomesafen, lactofen, and oxyfluorfen).

Additionally, AAD-1 alone or stacked with one or more additional HTC traits can be stacked with one or more additional input {e.g., insect resistance, fungal resistance, or stress tolerance, et al.) or output (e.g., increased yield, improved oil profile, improved fiber quality, et al.) traits. Thus, the subject invention can be used to provide a complete agronomic package of improved crop quality with the ability to flexibly and cost effectively control any number of agronomic pests.

Methods to integrate a polynucleotide sequence within a specific chromosomal site of a plant cell via homologous recombination have been described within the art. For instance, site specific integration as described in US Patent Application Publication No. 2009/0111188 Al describes the use of recombinases or integrases to mediate the introduction of a donor polynucleotide sequence into a chromosomal target. In addition. International Patent Application No. WO 2008/021207 describes zinc finger mediated-homologous recombination to integrate one or more donor polynucleotide sequences within specific locations of the genome. The use of recombinases such as FLP/FRT as described in US Patent No. 6720475 or CRE/LOX as described in US Patent No. 5658772 can be utilized to integrate a pol5mucleotide sequence into a specific chromosomal site. Finally the use of meganucleases for targeting donor polynucleotides into a specific chromosomal location was described in Puchta et al., PNAS USA 93 (1996) pp. 5055-5060.

Other various methods for site specific integration within plant cells are generally known and applicable (Kumar et al., Trands in Plant Sci. 6(4) (2001) pp. 155-159). Furthermore, site-specific recombination systems which have been identified in several prokaryotic and lower eukaryotic organisms may be applied to use in plants. Examples of such systems include, but are not limited too: the R/RS recombinase system from the pSRl plasmid of the yeast Zygosaccharomyces rouxii (Araki et al. (1985) J. Mol. Biol. 182: 191-203), and the Gin/gix system of phage Mu (Maeser and Kahlmann (1991) Mol. Gen. Genet. 230: 170-176).

In some embodiments of the present invention, it can be desirable to integrate or stack a new transgene(s) in proximity to an existing transgenic event. The transgenic event can be considered a ο (Ν > Ο ο (Ν 00 σ^ (Ν 00 ΙΟ (Ν ΙΟ Ο (Ν 25 ΙΟ 14 preferred genomic locus which was selected based on unique characteristics such as single insertion site, normal Mendelian segregation and stable expression, and a superior combination of efficacy, including herbicide tolerance and agronomic performance in and across multiple environmental locations. The newly integrated transgenes should maintain the transgene expression characteristics of the existing transformants. Moreover, the development of assays for the detection and confirmation of the newly integrated event would be overcome as the genomic flanking sequences and chromosomal location of the newly integrated event are already identified. Finally, the integration of a new transgene into a specific chromosomal location which is linked to an existing transgene would expedite the introgression of the transgenes into other genetic backgrounds by sexual out-crossing using conventional breeding methods.

In some embodiments of the present invention, it can be desirable to excise polynucleotide sequences from a transgenic event. For instance transgene excision as described in Provisional US Patent Application No. 61/297,628 describes the use of zinc finger nucleases to remove a polynucleotide sequence, consisting of a gene expression cassette, from a chromosomally integrated transgenic event. The polynucleotide sequence which is removed can be a selectable marker. Upon excision and removal of a polynucleotide sequence the modified transgenic event can be retargeted by the insertion of a polynucleotide sequence. The excision of a polynucleotide sequence and subsequent retargeting of the modified transgenic event provides advantages such as re-use of a selectable marker or the ability to overcome unintended changes to the plant transcriptome which results from the expression of specific genes.

The subject invention discloses herein a specific site on chromosome 2 in the corn genome that is excellent for insertion of heterologous nucleic acids. Also disclosed is a 5' molecular marker, a 3' molecular marker, a 5’ flanking sequence, and a 3’ ilanking sequence useful in identifying the location of a targeting site on chromosome 2. Thus, the subject invention provides methods to introduce heterologous nucleic acids of interest into this pre-estabiished target site or in the vicinity of ibis target site. The subject invention also encomptisses a com seed and/or a com plant comprismg any heterologous nucleotide sequence inserted at the disclosed target site or in the general viciniU of such site. One option to accomplish such targeted integration is to excise and/or substitute a different insert in place of the/?a/ expression cassette exemplified herein, in this general regard, targeted in Ο (N > Ο 2; ο (Ν 00 σ^ (Ν 00 (Ν in ο (Ν 25 30 15 homologous recombination, for example and v/ithont limitation, can be used according to the subject invention.

As used herein gene, event or trait '‘stacking” is combining desired traits into one transgenic line. Plant breeders stack transgenic traits by making crosses between parents that each, have a desired trait and then idertii.iying offspriiig that have botli of these desired traits. Another way to stack genes is by transferring two or more genes into the cell nucleus of a plant at the same time daring transformation. Another way to stack genes is by re-transforming a transgenic plant with, another gene of interest. For example, gene stacking can be used to combine two or more different traits, including for example, twO or more different insect traits, insect resistance iraii(s) and disease resistance irait(s), two or more herbicide resistance traits, and'or insect resistance trait(s) and herbicide resistant traii(s). The use of a selectable marker in addition to a gene of interest can also be considered gene stacking. “Homologous recombination” refers to a reacdoi:.i betweei:.i ai:.iy pair of nucleotide sequences hasdng corresponding sites containing a similar m.Lcleotide sequence through which the two nucleotide sequences can inieraci (recombine) to form a new, recombinant DNA sequence, d’he sites of similar nucleotide sequence are each referred to herein as a “homology sequence.” Generally, the frequency of homologous recombination increases as the length of the homology sequence increases. Thus, while homologous recOmbination can occur between twO nucleotide sequences that are less than identical, the recombination frequency (or efficiency) declines as the divergence between the two sequences increases. Recombination may be accomplished using one homology sequence on each of the donor and target, irtolecules, thereby generating a “singie-crossover” recombmation product. Alternati vely, iw'O homology sequences may be placed on each of the target and donor nucleotide sequences. Recombination between twO homology sequences on the donor wdth twO homology sequences on the target generates a “double-crossover” recombination product, if the homology sequences on the donor molecule flank a sequence that is to be manipulated (e.g., a sequence of interest), the double-crossover recombination v/ith the target moiecnle will result in a recombination product wherein the sequence of interest replaces a DNA seqnence that was originally betw'een the homology sequences ort the target molecule. The exchange of DNA sequence between the target and donor through a doubie-cros.sover recombination event is termed “sequence replacement.” Ο (N > Ο ο (Ν οο σ^ (Ν ΟΟ (Ν Η Ο (Ν 25 16

The subject AAD-1 enz5one enables transgenic expression resulting in tolerance to combinations of herbicides that would control nearly all broadleaf and grass weeds. AAD-1 can serve as an excellent herbicide tolerant crop (HTC) trait to stack with other HTC traits {e.g., glyphosate resistance, glufosinate resistance, imidazolinone resistance, bromox50iil resistance, et all), and insect resistance traits {CryIF, CrylAb, Cry 34/45, et al.) for example. Additionally, AAD-1 can serve as a selectable marker to aid in selection of primary transformants of plants genetically engineered with a second gene or group of genes. HTC traits of the subject invention can be used in novel combinations with other HTC traits (including but not limited to glyphosate tolerance). These combinations of traits give rise to novel methods of controlling weed (and like) species, due to the newly acquired resistance or inherent tolerance to herbicides {e.g., glyphosate). Thus, in addition to the HTC traits, novel methods for controlling weeds using herbicides, for which herbicide tolerance was created by said enzyme in transgenic crops, are within the scope of the invention.

Additionally, glyphosate tolerant crops grown worldwide are prevalent. Many times in rotation with other glyphosate tolerant crops, control of glyphosate-resistant volunteers may be difficult in rotational crops. Thus, the use of the subject transgenic traits, stacked or transformed individually into crops, provides a tool for controlling other HTC volunteer crops. A preferred plant, or a seed, of the subject invention comprises in its genome the insert sequences, as identified herein, together with at least 20-500 or more contiguous flanking nucleotides on both sides of the insert, as identified herein. Unless indicated otherwise, reference to flanking sequences refers to those identified with respect to SEQ ID NO :29 (see the Table above). Again, SEQ ID NO:29 includes the heterologous DNA inserted in the original transformant and illustrative flanking genomic sequences immediately adjacent to the inserted DNA. All or part of these flanking sequences could be expected to be transferred to progeny that receives the inserted DNA as a result of a sexual cross of a parental line that includes the event.

The subject invention includes tissue cultures of regenerable cells of a plant of the subject invention. Also included is a plant regenerated from such tissue culture, particularly where said plant is capable of expressing all the morphological and physiological properties of an exemplified variety. Preferred plants of the subject invention have all the physiological and morphological ο (N > Ο Ο (Ν (X) σ^ (Ν (X) ΙΟ (Ν ιη Η Ο (Ν 25 30 17 characteristics of a plant grown from the deposited seed. This invention further comprises progeny of such seed and seed possessing the quality traits of interest.

Manipulations (such as mutation, further transfection, and further breeding) of plants or seeds, or parts thereof, may lead to the creation of what may be termed “essentially derived” varieties. The International Union for the Protection of New Varieties of Plants (UPOV) has provided the following guideline for determining if a variety has been essentially derived from a protected variety: [A] variety shall be deemed to be essentially derived from another variety (“the initial variety”) when (i) it is predominantly derived from the initial variety, or from a variety that is itself predominantly derived from the initial variety, while retaining the expression of the essential characteristics that result from the genotype or combination of genotypes of the initial variety; (ii) it is clearly distinguishable from the initial variety; and (iii) except for the differences which result from the act of derivation, it conforms to the initial variety in the expression of the essential characteristics that result from the genotype or combination of genotypes of the initial variety. UPOV, Sixth Meeting with International Organizations, Geneva, Oct. 30, 1992; document prepared by the Office of the Union.

As used herein, a “line” is a group of plants that display little or no genetic variation between individuals for at least one trait. Such lines may be created by several generations of self-pollination and selection, or vegetative propagation from a single parent using tissue or cell culture techniques.

As used herein, the terms “cultivar” and “variety” are synonymous and refer to a line which is used for commercial production. “Stability” or “stable” means that with respect to the given component, the component is maintained from generation to generation and, preferably, at least three generations at substantially the same level, e.g., preferably ±15%, more preferably ±10%, most preferably ±5%. The stability may be affected by temperature, location, stress and the time of planting. Comparison of subsequent generations under field conditions should produce the component in a similar manner. “Commercial Utility” is defined as having good plant vigor and high fertility, such that the crop can be produced by farmers using conventional farming equipment, and the oil with the ο (Ν > Ο ο (Ν οο σ^ (Ν ΟΟ (Ν »ο Ο (Ν 25 30 ΙΟ 18 described components can be extracted from the seed using conventional crushing and extraction equipment. To be commercially useful, the yield, as measured by seed weight, oil content, and total oil produced per acre, is within 15% of the average yield of an otherwise comparable commercial canola variety without the premium value traits grown in the same region. “Agronomically elite” means that a line has desirable agronomic characteristics such as yield, maturity, disease resistance, and the like, in addition to the insect resistance due to the subject event(s). Agronomic traits, taken individually or in any combination, as set forth in Examples, below, in a plant comprising an event of the subject invention, are within the scope of the subject invention. Any and all of these agronomic characteristics and data points can be used to identify such plants, either as a point or at either end or both ends of a range of chracteristics used to define such plants.

As one skilled in the art will recognize in light of this disclosure, preferred embodiments of detection kits, for example, can include probes and/or primers directed to and/or comprising “junction sequences” or “transition sequences” (where the com genomic flanking sequence meets the insert sequence). For example, this includes a polynucleotide probes, primers, and/or amplicons designed to identify one or both junction sequences (where the insert meets the flanking sequence), as indicated in Table 1. One common design is to have one primer that hybridizes in the flanking region, and one primer that hybridizes in the insert. Such primers are often each about at least ~15 residues in length. With this arrangement, the primers can be used to generate/amplify a detectable amplicon that indicates the presence of an event of the subject invention. These primers can be used to generate an amplicon that spans (and includes) a junction sequence as indicated above.

The primer(s) "touching down" in the flanking sequence is typically not designed to hybridize beyond about 200 bases or beyond the junction. Thus, t)q)ical flanking primers would be designed to comprise at least 15 residues of either strand within 200 bases into the flanking sequences from the beginning of the insert. That is, primers comprising sequence of an appropriate size in residues ~1674-1873 and/or -6690-6890 of SEQ ID NO:29 are within the scope of the subject invention. Insert primers can likewise be designed anywhere on the insert, but residues -1874-2074 and -6489-6689, can be used, for example, non-exclusively for such primer design.

One skilled in the art will also recognize that primers and probes can be designed to hybridize, under a range of standard hybridization and/or PCR conditions, to a segment of SEQ ID Ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ιη Ο (Ν 25 30 19 ΝΟ:29 (or the complement), and complements thereof, wherein the primer or probe is not perfectly complementary to the exemplified sequence. That is, some degree of mismatch can be tolerated. For an approximately 20 nucleotide primer, for example, typically one or two or so nucleotides do not need to bind with the opposite strand if the mismatched base is internal or on the end of the primer that is opposite the amplicon. Various appropriate hybridization conditions are provided below. Synthetic nucleotide analogs, such as inosine, can also be used in probes. Peptide nucleic acid (PNA) probes, as well as DNA and RNA probes, can also be used. What is important is that such probes and primers are diagnostic for (able to uniquely identify and distinguish) the presence of an event of the subject invention.

It should be noted that errors in PCR amplification can occur which might result in minor sequencing errors, for example. That is, unless otherwise indicated, the sequences listed herein were determined by generating long amplicons from com genomic DNAs, and then cloning and sequencing the amplicons. It is not unusual to find slight differences and minor discrepancies in sequences generated and determined in this manner, given the many rounds of amplification that are necessary to generate enough amplicon for sequencing from genomic DNAs. One skilled in the art should recognize and be put on notice than any adjustments needed due to these types of common sequencing errors or discrepancies are within the scope of the subject invention.

It should also be noted that it is not uncommon for some genomic sequence to be deleted, for example, when a sequence is inserted during the creation of an event. Thus, some differences can also appear between the subj ect flanking sequences and genomic sequences listed in GENBANK, for example.

Some of these difference(s) are discussed below in the Examples section. Adjustments to probes and primers can be made accordingly.

The components of each of the “inserts” are illustrated in Figures 1 and 2 and are discussed in more detail below in the Examples. The DNA pol5mucleotide sequences of these components, or fragments thereof, can be used as DNA primers or probes in the methods of the present invention.

In some embodiments of the invention, compositions and methods are provided for detecting the presence of the transgene/genomic insertion region, in plants and seeds and the like, from a com plant. DNA sequences are provided that comprise the subject transgene/genomic insertion region junction sequence provided herein (between residues 1873-1874 and 6689-6690 of SEQ ID NO:29), ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 20 segments thereof, and eomplements of the exemplified sequenees and any segments thereof The insertion region junetion sequenee spans the junetion between heterologous DNA inserted into the genome and the DNA from the eom eell flanking the insertion site. Sueh sequenees ean be diagnostie for the given event.

Based on these insert and border sequenees, event-speeifie primers ean be generated. PCR analysis demonstrated that eom lines of the subjeet invention ean be identified in different eom genotypes by analysis of the PCR amplieons generated with these event-speeifie primer sets. These and other related procedures can be used to uniquely identify these com lines. Thus, PCR amplieons derived from such primer pairs are unique and can be used to identify these com lines.

In some embodiments, DNA sequences that comprise a contiguous fragment of the novel transgene/genomic insertion region are an aspect of this invention. Included are DNA sequences that comprise a sufficient length of polynucleotides of transgene insert sequence and a sufficient length of polynucleotides of com genomic sequence from one or more of the three aforementioned com plants and/or sequences that are useful as primer sequences for the production of an amplicon product diagnostic for one or more of these com plants.

Related embodiments pertain to DNA sequences that comprise at least 2, 3,4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more contiguous nucleotides of a transgene portion of a DNA sequence identified herein (such as SEQ ID NO:29 and segments thereof), or complements thereof, and a similar length of flanking com DNA sequence from these sequences, or complements thereof Such sequences are useful as DNA primers in DNA amplification methods. The amplieons produced using these primers are diagnostic for any of the com events referred to herein. Therefore, the invention also includes the amplieons produced by such DNA primers and homologous primers.

This invention also includes methods of detecting the presence of DNA, in a sample, that corresponds to the com event referred to herein. Such methods can comprise: (a) contacting the sample comprising DNA with a primer set that, when used in a nucleic acid amplification reaction with DNA from at least one of these com events, produces an amplicon that is diagnostic for said event(s); (b) performing a nucleic acid amplification reaction, thereby producing the amplicon; and (c) detecting the amplicon. ο (N > Ο Ο (Ν οο σ^ (Ν (X) ΙΟ (Ν ΙΟ Ο (Ν 25 30 21

Further detection methods of the subject invention include a method of detecting the presence of a DNA, in a sample, corresponding to at least one of said events, wherein said method comprises: (a) contacting the sample comprising DNA with a probe that hybridizes under stringent hybridization conditions with DNA from at least one of said com events and which does not hybridize under the stringent hybridization conditions with a control com plant (non-event-of-interest DNA); (b) subjecting the sample and probe to stringent hybridization conditions; and (c) detecting hybridization of the probe to the DNA.

In still further embodiments, the subject invention includes methods of producing a com plant comprising the aad-1 event of the subject invention, wherein said method comprises the steps of: (a) sexually crossing a first parental com line (comprising an expression cassettes of the present invention, which confers said herbicideresistance trait to plants of said line) and a second parental com line (that lacks this herbicide tolerance trait) thereby producing a plurality of progeny plants; and (b) selecting a progeny plant by the use of molecular markers. Such methods may optionally comprise the further step of back-crossing the progeny plant to the second parental com line to producing a tme-breeding com plant that comprises said insect tolerance trait.

According to another aspect of the invention, methods of determining the zygosity of progeny of a cross with any one (or more) of said three events are provided. Said methods can comprise contacting a sample, comprising com DNA, with a primer set of the subject invention. Said primers, when used in a nucleic-acid amplification reaction with genomic DNA from at least one of said com events, produces a first amplicon that is diagnostic for at least one of said com events. Such methods further comprise performing a nucleic acid amplification reaction, thereby producing the first amplicon; detecting the first amplicon; and contacting the sample comprising com DNA with said primer set (said primer set, when used in a nucleic-acid amplification reaction with genomic DNA from com plants, produces a second amplicon comprising the native com genomic DNA homologous to the com genomic region; and performing a nucleic acid amplification reaction, thereby producing the second amplicon. The methods further comprise detecting the second amplicon, and comparing the first and second amplicons in a sample, wherein the presence of both amplicons indicates that the sample is heterozygous for the transgene insertion. DNA detection kits can be developed using the compositions disclosed herein and methods well known in the art of DNA detection. The kits are useful for identification of the subject com

Ο (N > Ο ;z; ο (N

00 σ^ (N 00 (N r-H O (N 25 30 22 event DNA in a sample and can be applied to methods for breeding com plants containing this DNA. The kits contain DNA sequences homologous or complementary to the amplicons, for example, disclosed herein, or to DNA sequences homologous or complementary to DNA contained in the transgene genetic elements of the subject events. These DNA sequences can be used in DNA amplification reactions or as probes in a DNA hybridization method. The kits may also contain the reagents and materials necessary for the performance of the detection method. A “probe” is an isolated nucleic acid molecule to which is attached a conventional detectable label or reporter molecule (such as a radioactive isotope, ligand, chemiluminescent agent, or enzyme). Such a probe is complementary to a strand of a target nucleic acid, in the case of the present invention, to a strand of genomic DNA from one of said com events, whether from a com plant or from a sample that includes DNA from the event. Probes according to the present invention include not only deoxyribonucleic or ribonucleic acids but also polyamides and other probe materials that bind specifically to a target DNA sequence and can be used to detect the presence of that target DNA sequence. “Primers” are isolated/s5mthesized nucleic acids that are annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, then extended along the target DNA strand by a polymerase, e.g., a DNA polymerase. Primer pairs of the present invention refer to their use for amplification of a target nucleic acid sequence, e.g., by the pol5mierase chain reaction (PCR) or other conventional nucleic-acid amplification methods.

Probes and primers are generally 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,23,24,25,26,27,28,29, 30,31, 32, 33,34, 35, 36,37, 38,39,40,41,42,43,44,45,46,47,48, 49, 50,51, 52, 53,54, 55, 56, 57,58, 59, 60,61, 62, 63,64, 65,66, 67,68, 69,70, 71,72, 73,74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,100,101, 102,103,104,105,106,107,108,109,110, 111, 112,113,114,115,116,117,118,119,120,121, 122,123,124,125,126,127,128,129,130,131,132,133,134,135,136,137,138,139,140,141, 142,143,144,145,146,147,148,149,150,151,152,153,154,155,156,157, 158,159,160,161, 162,163,164,165,166,167,168,169,170,171,172,173,174,175,176,177, 178,179,180,181, 182,183,184,185,186,187,188,189,190,191,192,193,194,195,196,197,198,199,200,201, 202,203,204,205,206,207,208,209,210,211,212,213,214,215,216,217,218,219,220,221, ΙΟ ο (Ν > Ο :¾ ο (Ν οο σ^ (Ν ΟΟ ΙΟ (Ν ΙΟ Ο (Ν 25 30 23 222,223,224,225,226,227,228,229,230,231,232,233,234,235,236,237, 238,239,240,241, 242,243,244,245,246,247,248,249,250,251,252,253,254,255,256,257,258,259,260,261, 262,263,264,265,266,267,268,269,270,271,272,273,274,275,276,277,278,279,280,281, 282,283,284,285,286,287,288,289,290,291,292,293,294,295,296,297, 298,299,300,301, 302,303,304,305,306,307,308,309,310,311,312,313,314,315,316,317, 318,319,320,321, 322,323,324,325,326,327,328,329,330,331,332,333,334,335,336,337, 338,339,340,341, 342,343,344,345,346,347,348,349,350,351,352,353,354,355,356,357, 358,359,360,361, 362,363,364,365,366,367,368,369,370,371,372,373,374,375,376,377, 378,379,380,381, 382,383,384,385,386,387,388,389,390,391,392,393,394,395,396,397, 398,399,400,401, 402,403,404,405,406,407,408,409,410,411,412,413,414,415,416,417,418,419,420,421, 422,423,424,425,426,427,428,429,430,431,432,433,434,435,436,437,438,439,440,441, 442,443,444,445,446,447,448,449,450,451,452,453,454,455,456,457,458,459,460,461, 462,463,464,465,466,467,468,469,470,471,472,473,474,475,476,477,478,479,480,481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, or 500 polynucleotides or more in length. Such probes and primers hybridize specifically to a target sequence under high stringency hybridization conditions. Preferably, probes and primers according to the present invention have complete sequence similarity with the target sequence, although probes differing from the target sequence and that retain the ability to hybridize to target sequences may be designed by conventional methods.

Methods for preparing and using probes and primers are described, for example, in Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989. PCR-primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose.

Primers and probes based on the flanking DN A and insert sequences disclosed herein can be used to confirm (and, if necessary, to correct) the disclosed sequences by conventional methods, e.g., by re-cloning and sequencing such sequences.

The nucleic acid probes and primers of the present invention hybridize under stringent conditions to a target DNA sequence. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA from a transgenic event in a sample. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid Ο (N > Ο Ο (Ν 00 σ^ (Ν 00 ιη (Ν ιη ο (Ν 25 30 in 24 molecules under certain circumstances. As used herein, two nucleic acid molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid structure. A nucleic acid molecule is said to be the “complement” of another nucleic acid molecule if they exhibit complete complementarity. As used herein, molecules are said to exhibit “complete complementarity” when every nucleotide of one of the molecules is complementary to a nucleotide of the other. Two molecules are said to be “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional “low-stringency” conditions. Similarly, the molecules are said to be “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional “high-stringency” conditions. Conventional stringency conditions are described by Sambrook et al., 1989. Departures from complete complementarity are therefore permissible, as long as such departures do not completely preclude the capacity of the molecules to form a double-stranded structure. In order for a nucleic acid molecule to serve as a primer or probe it need only be sufficiently complementary in sequence to be able to form a stable double-stranded structure under the particular solvent and salt concentrations employed.

As used herein, a substantially homologous sequence is a nucleic acid sequence that will specifically hybridize to the complement of the nucleic acid sequence to which it is being compared under high stringency conditions. The term “stringent conditions” is functionally defined with regard to the hybridization of a nucleic-acid probe to a target nucleic acid {i.e., to a particular nucleic-acid sequence of interest) by the specific hybridization procedure discussed in Sambrook et a/., 1989, at 9.52-9.55. See also, Sambrook eta/., 1989 at 9.47-9.52 and 9.56-9.58. Accordingly, the nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of DNA fragments.

Depending on the application envisioned, one can use varying conditions of hybridization to achieve varying degrees of selectivity of probe towards target sequence. For applications requiring high selectivity, one will t)q)ically employ relatively stringent conditions to form the hybrids, e.g., one will select relatively low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50° C to about 70° C. Stringent conditions, for example, could involve washing the hybridization filter at least twice with high-stringency wash Ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 25 buffer (0.2Χ SSC, 0.1% SDS, 65° C). Appropriate stringency conditions which promote DNA hybridization, for example, 6.OX sodium chloride/sodium citrate (SSC) at about 45° C, followed by a wash of 2.OX SSC at 50° C are known to those skilled in the art, 6.3.1-6.3.6. For example, the salt concentration in the wash step can be selected from a low stringency of about 2.OX SSC at 50° C to a high stringency of about 0.2X SSC at 50° C. In addition, the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22° C, to high stringency conditions at about 65° C. Both temperature and salt may be varied, or either the temperature or the salt concentration may be held constant while the other variable is changed. Such selective conditions tolerate little, if any, mismatch between the probe and the template or target strand. Detection of DNA sequences via hybridization is well-known to those of skill in the art, and the teachings of U.S. Patent Nos. 4,965,188 and 5,176,995 are exemplary of the methods of hybridization analyses.

In a particularly preferred embodiment, a nucleic acid of the present invention will specifically hybridize to one or more of the primers (or amplicons or other sequences) exemplified or suggested herein, including complements and fragments thereof, under high stringency conditions. In one aspect of the present invention, a marker nucleic acid molecule of the present invention has the nucleic acid sequence set forth in SEQ ID NOS:3-I4, or complements and/or fragments thereof.

In another aspect of the present invention, a marker nucleic acid molecule of the present invention shares between 80% and 100% or 90% and 100% sequence identity with such nucleic acid sequences. In a further aspect of the present invention, a marker nucleic acid molecule of the present invention shares between 95% and 100% sequence identity with such sequence. Such sequences may be used as markers in plant breeding methods to identify the progeny of genetic crosses. The hybridization of the probe to the target DNA molecule can be detected by any number of methods known to those skilled in the art, these can include, but are not limited to, fluorescent tags, radioactive tags, antibody based tags, and chemiluminescent tags.

Regarding the amplification of a target nucleic acid sequence (e.g., by PCR) using a particular amplification primer pair, “stringent conditions” are conditions that permit the primer panto hybridize only to the target nucleic-acid sequence to which a primer having the corresponding iT) ο (N> Ο Ο (Ν 00 Os (Ν 00 (Ν Ο (Ν 25 30 26 wild-t5φe sequence (or its complement) would bind and preferably to produce a unique amplification product, the amplicon. The term “specific for (a target sequence)” indicates that a probe or primer hybridizes under stringent hybridization conditions only to the target sequence in a sample comprising the target sequence. As used herein, “amplified DNA” or “amplicon” refers to the product of nucleic-acid amplification of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether the com plant resulting from a sexual cross contains transgenic event genomic DNA from the com plant of the present invention, DNA extracted from a com plant tissue sample may be subjected to nucleic acid amplification method using a primer pair that includes a primer derived from flanking sequence in the genome of the plant adjacent to the insertion site of inserted heterologous DNA, and a second primer derived from the inserted heterologous DNA to produce an amplicon that is diagnostic for the presence of the event DNA. The amplicon is of a length and has a sequence that is also diagnostic for the event. The amplicon may range in length from the combined length of the primer pairs plus one nucleotide base pair, and/or the combined length of the primer pairs plus about 2, 3,4,5, 6,7, 8,9,10,11,12,13,14,15,16,17,18,19,20,21, 22,23,24,25,26, 27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50, 51,52,53, 54,55,56, 57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79, 80, 81, 82,83, 84,85, 86,87, 88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105, 106,107,108,109,110, 111, 112,113,114,115,116,117,118,119,120,121,122,123,124,125, 126,127,128,129,130,131,132,133,134,135,136,137,138,139,140,141,142,143,144,145, 146,147,148,149,150,151,152,153,154,155,156,157,158,159,160,161,162,163,164,165, 166,167,168,169,170,171,172,173,174,175,176,177,178,179,180,181,182,183,184,185, 186,187,188,189,190,191,192,193,194,195,196,197,198,199,200,201,202,203,204,205, 206,207,208,209,210,211,212,213,214,215,216,217,218,219,220,221,222,223,224,225, 226,227,228,229,230,231,232,233,234,235,236,237,238,239,240,241,242,243,244,245, 246,247,248,249,250,251,252,253,254,255,256,257,258,259,260,261,262,263,264,265, 266,267,268,269,270,271,272,273,274,275,276,277,278,279,280,281,282,283,284,285, 286,287,288,289,290,291,292,293,294,295,296,297,298,299,300,301, 302,303,304,305, 306,307,308,309,310,311,312,313,314,315,316,317,318,319,320,321, 322,323,324, 325, Ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ιη Η Ο (Ν 25 30 27 326,327,328,329,330,331,332,333,334,335,336,337,338,339,340,341, 342,343, 344, 345, 346,347,348,349,350,351,352,353,354,355,356,357,358,359,360,361, 362,363,364,365, 366,367,368,369,370,371,372,373,374,375,376,377,378,379,380,381, 382,383,384,385, 386, 387, 388, 389, 390, 391, 392, 393,394,395,396,397,398,399,400,401,402,403,404,405, 406,407,408,409,410,411,412,413,414,415,416,417,418,419,420,421, 422,423,424,425, 426,427,428,429,430,431,432,433,434,435,436,437,438,439,440,441, 442,443,444,445, 446,447,448,449,450,451,452,453,454,455,456,457,458,459,460,461, 462,463,464,465, 466,467,468,469,470,471,472,473,474,475,476,477,478,479,480,481, 482,483,484,485, 486,487,488,489,490,491,492,493,494,495,496,497,498,499, or 500,750,1000,1250,1500, 1750, 2000, or more nucleotide base pairs (plus or minus any of the increments listed above). Alternatively, a primer pair can be derived from flanking sequence on both sides of the inserted DNA so as to produce an amplicon that includes the entire insert nucleotide sequence. A member of a primer pair derived from the plant genomic sequence may be located a distance from the inserted DNA sequence. This distance can range from one nucleotide base pair up to about twenty thousand nucleotide base pairs. The use of the term “amplicon” specifically excludes primer dimers that may be formed in the DNA thermal amplification reaction.

Nucleic-acid amplification can be accomplished by any of the various nucleic-acid amplification methods known in the art, including the pol5onerase chain reaction (PCR). A variety of amplification methods are known in the art and are described, inter alia, in U.S. Patent No. 4,683,195 and U.S. Patent No. 4,683,202. PCR amplification methods have been developed to amplify up to 22 kb of genomic DNA. These methods as well as other methods known in the art of DNA amplification may be used in the practice of the present invention. The sequence of the heterologous transgene DNA insert or flanking genomic sequence from a subject com event can be verified (and corrected if necessary) by amplifying such sequences from the event using primers derived from the sequences provided herein followed by standard DNA sequencing of the PCR amplicon or of the cloned DNA.

The amplicon produced by these methods may be detected by a plurality of techniques. Agarose gel electrophoresis and staining with ethidium bromide is a common well known method of detecting DNA amplicons. Another such method is Genetic Bit Analysis where an DNA oligonucleotide is designed which overlaps both the adjacent flanking genomic DNA sequence and ο (N > Ο Ο (Ν 00 σ^ (Ν 00 ΙΟ (Ν Ο (Ν 25 30 28 the inserted DNA sequence. The oligonucleotide is immobilized in wells of a microwell plate. Following PCR of the region of interest (using one primer in the inserted sequence and one in the adjacent flanking genomic sequence), a single-stranded PCR product can be hybridized to the immobilized oligonucleotide and serve as a template for a single base extension reaction using a DNA pol5onerase and labelled ddNTPs specific for the expected next base. Readout may be fluorescent or ELISA-based. A signal indicates presence of the insert/flanking sequence due to successful amplification, hybridization, and single base extension.

Another method is the Pyrosequencing technique as described by Winge (Innov. Pharma. Tech. 00:18-24, 2000). In this method an oligonucleotide is designed that overlaps the adjacent genomic DNA and insert DNA junction. The oligonucleotide is hybridized to single-stranded PCR product from the region of interest (one primer in the inserted sequence and one in the flanking genomic sequence) and incubated in the presence of a DNA polymerase, ATP, sulfiirylase, luciferase, ap50'ase, adenosine 5' phosphosulfate and luciferin. DNTPs are added individually and the incorporation results in a light signal that is measured. A light signal indicates the presence of the transgene insert/flanking sequence due to successful amplification, hybridization, and single or multi-base extension.

Fluorescence Polarization is another method that can be used to detect an amplicon of the present invention. Following this method, an oligonucleotide is designed which overlaps the genomic flanking and inserted DNA junction. The oligonucleotide is hybridized to single-stranded PCR product from the region of interest (one primer in the inserted DNA and one in the flanking genomic DNA sequence) and incubated in the presence of a DNA polymerase and a fluorescent-labeled ddNTP. Single base extension results in incorporation of the ddNTP. Incorporation can be measured as a change in polarization using a fluorometer. A change in polarization indicates the presence of the transgene insert/flanking sequence due to successful amplification, hybridization, and single base extension.

TAQMAN (PE Applied Biosystems, Foster City, Calif) is a method of detecting and quantifying the presence of a DNA sequence. Briefly, a FRET oligonucleotide probe is designed that overlaps the genomic flanking and insert DNA junction. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. During specific amplification, Taq DNA 29 ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν pol5niierase cleans and releases the fluorescent moiety away from the quenching moiety on the FRET probe. A fluorescent signal indicates the presence of the flanking/transgene insert sequence due to successful amplification and hybridization.

Molecular Beacons have been described for use in sequence detection. Briefly, a FRET oligonucleotide probe is designed that overlaps the flanking genomic and insert DNA junction. The unique structure of the FRET probe results in it containing secondary structure that keeps the fluorescent and quenching moieties in close proximity. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Following successful PCR amplification, hybridization of the FRET probe to the target sequence results in the removal of the probe secondary structure and spatial separation of the fluorescent and quenching moieties. A fluorescent signal results. A fluorescent signal indicates the presence of the flanking genomic/transgene insert sequence due to successful amplification and hybridization.

Having disclosed a location in the com genome that is excellent for an insertion, the subject invention also comprises a com seed and/or a com plant comprising at least one non-aadl insert in the general vicinity of this genomic location. One option is to substitute a different insert in place of the aad-1 insert exemplified herein. In these generally regards, targeted homologous recombination, for example, can be used according to the subject invention. This type of technology is the subject of, for example, WO 03/080809 A2 and the corresponding published U.S. application (US 20030232410). Thus, the subject invention includes plants and plant cells comprising a heterologous insert (in place of or with multi-copies of aad-1), flanked by all or a recognizable part of the flanking sequences identified herein (e.g. residues 1-1873 and 6690-8557 of SEQIDNO:29).

All patents, patent applications, provisional applications, and publications referred to or cited 25 herein are incorporated by reference in their entirety to the extent they are not inconsistent with the explicit teachings of this specification. 30

The following examples are included to illustrate procedures for practicing the invention and to demonstrate certain preferred embodiments of the invention. These examples should not be constmed as limiting. It should be appreciated by those of skill in the art that the techniques 30 ΙΟ ο (Ν > Ο ;ζ; ο (Ν 00 σ^ (Ν 00 ΙΟ (Ν ΙΟ Ο (Ν disclosed in the following examples represent specific approaches used to illustrate preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in these specific embodiments while still obtaining like or similar results without departing from the spirit and scope of the invention. Unless otherwise indicated, all percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted. The following abbreviations are used unless otherwise indicated.

AAD-1 bp °C DNA DIG EDTA kb hg μΤ mL M OLP PCR PTU SDS SOP SSC TBE V aryloxyalkanoate dioxygenase-1 base pair degrees Celcius deoxyribonucleic acid digoxigenin ethylenediaminetetraacetic acid kilobase micro gram microliter milliliter molar mass overlapping probe polymerase chain reaction plant transcription unit sodium dodecyl sulfate standard operating procedure a buffer solution containing a mixture of sodium chloride and sodium citrate, pH 7.0 a buffer solution containing a mixture of Tris base, boric acid and EDTA, pH 8.3 volts

30 EXAMPLES

Example 1. Transformation and Selection of the AADl Event pDAS 1740-278

The AADl event, pDAS 1740-278, was produced by WHISBCER - mediated transformation of maize line Hi-II. The transformation method used is described in US Patent Application # 20090093366. An FspI fragment of plasmid pDAS 1740, also referred to as 35 pDAB3812, (Figure 1) was transformed into the maize line. This plasmid construct contains the plant expression cassette containing the RB7 MARv3 :: Zea mays Ubiquitin 1 promoter v2 // AADl v3 // Zea mays PER5 3’UTR :: RB 7 MARv4 plant transcription unit (PTU). 31 in Ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 30

Numerous events were produced. Those events that survived and produced healthy, haloxyfop-resistant callus tissue were assigned unique identification codes representing putative transformation events, and continually transferred to fresh selection medium. Plants were regenerated from tissue derived from each unique event and transferred to the greenhouse.

Leaf samples were taken for molecular analysis to verify the presence of the AAD-1 transgene by Southern Blot, DNA border confirmation, and genomic marker assisted confirmation. Positive TO plants were pollinated with inbred lines to obtain T1 seed. T1 plants of Event pDAS1470-278-9 (DAS-40278-9) was selected, self-pollinated and characterized for five generations. Meanwhile, the T1 plants were backcrossed and introgressed into elite germplasm (XHH13) through marker-assisted selection for several generations. This event was generated from an independent transformed isolate. The event was selected based on its unique characteristics such as single insertion site, normal Mendelian segregation and stable expression, and a superior combination of efficacy, including herbicide tolerance and agronomic performance in broad genotype backgrounds and across multiple environmental locations. The following examples contain the data which were used to characterize event pDAS-1740-278-9.

Example 2. pDAS 1740-278-9 Event Characterization via Southern Blot

Southern blot analysis was used to establish the integration pattern of the inserted DNA fragment and determine insert/copy number of the aad-1 gene in event pDAS-1740-278-9 (DAS-40278-9). Data were generated to demonstrate the integration and integrity of the aad-1 transgene inserted into the com genome.

Southern blot data suggested that the pDAS1740/Ek/? I fragment insert in com event DAS-40278-9 occurred as a simple integration of a single, intact copy of the aad-1 PTU from plasmid pDAS 1740. Detailed Southern blot analysis was conducted using probes specific to gene, promoter, terminator, and other regulation elements contained in the plasmid region and descriptive restriction enzymes that have cleavage sites located within the plasmid and produce hybridizing fragments internal to the plasmid or fragments that span the junction of the plasmid with com genomic DNA (border fragments). The molecular weights indicated from the Southern hybridization for the combination of the restriction enzyme and the probe were unique 32 Ο (N > Ο ο (Ν 00 σ^ (Ν 00 ΙΟ (Ν Ο (Ν 25 30 for the event, and established its identification patterns. These analyses also showed that the plasmid fragment had been inserted into com genomic DNA without rearrangements of the aad-1 PTU. Identical hybridization fragments were observed in five distinct generations of transgenic com event DAS-40278-9 indicating stability of inheritance of the aad-1 PTU insertion across generations. Hybridization with a mixture of three backbone probes located outside of the restriction site of Fsp I on plasmid pDAS1740 did not detect any specific DNA/gene fragments, indicating the absence of the Ampicillin resistance gene and the absence of the other vector backbone regions immediately adjacent to the Fsp I restriction sites of the plasmid pDAS1740 in transgenic com event DAS-40278-9. The illustrated map of the insert in aad-1 com event DAS-40278-9 is presented in Figures 2-3.

Example 2.1 Com Leaf Sample Collection and Genomic DNA (eDNAI Isolation gDNA prepared from leaf of the individual plants of the aad-1 com event DAS-40278-9. gDNA was extracted from leaf tissue harvested from individual plants carrying aad-1 com event DAS-40278-9. Transgenic com seeds from five distinct generations of event DAS-40278-9 were used. Twenty individual com plants, derived from four plants per generation, for event DAS-40278-9 were selected. In addition, gDNA was isolated from a conventional com plant, XHH13, which contains the genetic background that is representative of the substance line, absent the aad-l gene.

Prior to isolating the gDNA, leaf punches were taken from each plant to test aad-1 protein expression using a rapid test strip kit (American Bionostica, Swedesboro, NJ) according to the manufacturer’s recommended procedure. Each leaf punch sample was given a score of+ or - for the presence or absence of aad-1, respectively. Only positive plants from the five generations of event DAS-40278-9 were subjected to further characterization.

Com leaf samples were collected from the individual plants of the event DAS-40278-9 and the conventional control XHH13. Leaf samples were quickly frozen in liquid nitrogen and stored at approximately -80°C until usage.

Individual genomic DNA was extracted from frozen com leaf tissue following the standard CTAB method. When necessary, some of the genomic DNA was further purified with Qiagen Genomic-Tip (Qiagen, Valencia, CA) following procedures recommended by the 33 ο (N > Ο Ο (Ν

00 σ^ (N 00 UD (N UD o (N manufacturer. Following extraction, the DNA was quantified spectrofluorometrically using Pico Green reagent (Invitrogen, Carlsbad, CA). The DNA was then visualized on an agarose gel to confirm values from the Pico Green analysis and to determine the DNA quality.

Example 2.2 DNA Digestion and Separation

For molecular characterization of the DNA, nine micrograms (9 qg) of genomic DNA from the com event DAS-40278-9 DNA sample and the conventional control were digested by adding approximately five to eleven units of selected restriction enzyme per qg of DNA and the corresponding reaction buffer to each DNA sample. Each sample was incubated at approximately 37 °C overnight. The restriction enzymes EcoR I, Nco I, Sac I, Fse I, and Hind III were used for the digests (New England Biolabs, Ipswich, MA). A positive hybridization control sample was prepared by combining plasmid DNA, pDAS1740 (pDAB3812), with genomic DNA from the conventional control at a ratio of approximately equivalent to 1 copy of transgene per com genome, and digested using the same procedures and restriction enzyme as the test samples. DNA from the conventional com control (XHH13) was digested using the same procedures and restriction enzymes as the test samples to serve as a negative control.

The digested DNA samples were precipitated with Quick-Precip (Edge BioSystems, Gaithersburg, MD) and resuspended in 1 x Blue Juice (Invitrogen, Carlsbad, CA) to achieve the desired volume for gel loading. The DNA samples and molecular size markers were then electrophoresed through 0.8% agarose gels with IxTBE buffer (Fisher Scientific, Pittsburgh, PA) at 55-65 volts for approximately 18-22 hours to achieve fragment separation. The gels were stained with ethidium bromide (Invitrogen, Carlsbad, CA) and the DNA was visualized under ultraviolet (UV) light. 25 Example 2.3 Southern Transfer and Membrane Treatment

Southern blot analysis was performed essentially as described by Memelink, et al. (1994) Southern, Northern, and Western Blot Analysis. Plant Mol. Biol. Manual FI: 1-23. Briefly, following electrophoretic separation and visualization of the DNA fragments, the gels were depurinated with 0.25N HCl (Fisher Scientific, Pittsburgh, PA) for approximately 15 minutes, 30 and then exposed to a denaturing solution (AccuGENE, Sigma, St. Louis, MO) for ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 34 approximately 30 minutes followed by neutralizing solution (AccuGENE, Sigma, St. Louis, MO) for at least 30 minutes. Southern transfer was performed overnight onto nylon membranes (Roche Diagnostics, Indianapolis, IN) using a wicking system with lOxSSC (Sigma, St. Louis, MO). After transfer the membranes were washed in a 2x SSC solution and the DNA was bound to the membrane by UV crosslinking. This process resulted in Southern blot membranes ready for hybridization.

Example 2.4 DNA Probe Labeling and Hybridization

The DNA fragments bound to the nylon membrane were detected using a labeled probe. Probes used for the study were generated by a PCR-based incorporation of a digoxigenin (DIG) labeled nucleotide, [DIG-1 l]-dUTP, from fragments generated by primers specific to gene elements and other regions from plasmid pDAS1740. Generation of DNA probes by PCR S5mthesis was carried out using a PCR DIG Probe Synthesis Kit (Roche Diagnostics, Indianapolis, IN) following the manufacturer’s recommended procedures. A list of probes used for the study is described in Table 1.

Table 1._Location and Length of Probes used in Southern Analysis.

Prol)c Name Genetic Element Position on pl)ASi740(bi>) Length (bp) OLPl-3 ubiquitin promoter (ZmUbil) 28-2123 2096 OLP2 aad-1 gene 2103-3022 920 OLP3A peroxidase terminator (ZmPerS) 3002-3397 396 OLP3B RB7 Mar v4 3375-4865 1491 Backbone (OLP4A) 4900-5848 949 OLP4ABC Backbone Ap"^ gene (OLP4B) 5828-6681 855 Backbone (OLP4C) 6660-7144 485 OLP5-2 RB7 Mar v3 7124-8507 1384

Labeled probes were analyzed by agarose gel electrophoresis to determine their quality and quantity. A desired amount of labeled probe was then used for hybridization to the target 35 ο (N > Ο Ο (Ν (X) σ^ (Ν 00 ΙΟ (Ν Η Ο (Ν 20 25 DNA on the nylon membranes for detection of the specific fragments using the procedures described for DIG Easy Hyb Solution (Roche Diagnostics, Indianapolis, IN). Briefly, nylon membrane blots with DNA fixed on were briefly washed in 2xSSC and prehybridized with 20-25 mL of prewarmed DIG Easy Hyb solution in hybridization bottles at approximately 50°C for a minimal of 30 minutes in a hybridization oven. The prehybridization solution were then decanted and replaced with 20 mL of prewarmed DIG Easy Hyb solution containing a desired amount of specific probes predenatured by boiling in water for 5 minutes. The hybridization step was then conducted at approximately 40-60°C overnight in the hybridization oven.

Example 2.5 Detection

At the end of the probe hybridization, DIG Easy Hyb solutions containing the probes were decanted into clean tubes and stored at -20°C. These probes could be reused for 2-3 times according to the manufacturer’s recommended procedure. The membrane blots were rinsed briefly and washed twice in clean plastic containers with low stringency wash buffer (2xSSC, 0.1%SDS) for approximately 5 minutes at room temperature, followed by washing twice with high stringency wash buffer (O.lxSSC, 0.1% SDS) for 15 minutes each at approximately 65°C. The membrane blots were then transferred to other clean plastic containers and briefly washed with 1 xwashing buffer from the DIG Wash and Block Buffer Set (Roche Diagnostics, Indianapolis, IN) for approximately 2 minutes, proceeded to blocking in 1 x blocking buffer for a minimum of 30 minutes, followed by incubation with anti-DIG-AP (alkaline phosphatase) antibody (1:5,000 dilution, Roche Diagnostics, Indianapolis, IN) in 1 x blocking buffer for a minimum of 30 minutes. After 2-3 washes with lx washing buffer, specific DNA probes remain bound to the membrane blots and DIG-labeled DNA standards were visualized using CDP-Star Chemiluminescent Nucleic Acid Detection System (Roche Diagnostics, Indianapolis, IN) following the manufacturer’s recommendation. Blots were exposed to chemiluminescent film (Roche Diagnostics, Indianapolis, IN) for one or more time points to detect hybridizing fragments and to visualize molecular size standards. Eihns were then developed with an All-Pro 100 Plus film developer (Konica SRX-101) and images were scanned for report. The number and sizes of detected bands were documented for each probe. DIG-labeled DNA Molecular 36

Ο (N > Ο :z; ο (N

(X) σ^ (N (X) (N H O (N 25

Weight Marker II (MWM DIG II), visible after DIG detection as described, was used to determine hybridizing fragment size on the Southern blots.

Example 2.6 Probe Stripping DNA probes were stripped off the membrane blots after the Southern hybridization data were obtained, and the membrane blots could be reused for hybridization with a different DNA probe according to the manufacturer’s recommended procedures (DIG Application Manual for Filter Hybridization, (2003). Roche Diagnostics). Briefly, after signal detection and film exposure, membrane blots were thoroughly rinsed with Milli-Q water and followed by washing twice in stripping buffer (0.2N NaOH, 0.1% SDS) for approximately 15 minutes at room temperature or at 37°C. The membrane blots were then briefly washed in 2xSSC and were ready for prehybridization and hybridization with another DNA probe. The membrane blots were exposed to a new chemiluminescent film to ensure all the DNA probes were stripped of before proceeding to the next hybridization. The re-exposed films were kept along with the previous hybridization data package in the study file for record.

Example 2.7 Southern Blot Results

Expected and observed fragment sizes with a particular digest and probe, based on the known restriction enzyme sites of the pDAS1740/F5/? I fragment, are given in Table 2. Two t5φes of fragments were identified from these digests and hybridizations: internal fragments, where known enzyme sites flank the probe region and are completely contained within the pDAS1740/F5/71 fragment and border fragments where a known enzyme site is located at one end of the probe region and a second site is expected in the com genome. Border fragment sizes vary by event because, in most cases, DNA fragment integration sites are unique for each event. The border fragments provide a means to locate a restriction enzyme site relative to the integrated DNA and to evaluate the number of DNA insertions. Based on the Southern blot analyses completed in this study, it was concluded that a single copy of an intact aad-\ PTU from plasmid pDAS1740/F5/71 inserted into the com genome of event DAS-40278-9 as detailed in the insert map (Figures 2-3). 30 Ο

(N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 37

Predicted and Observed Hybridizing Fragments in Southern Blot Analysis.

Table 2, ΠΝΛ Pro ho Roslriclion Κη/Λ 111 os |·Α|)00(0(Ι Ι'Ί'ομιιιοιιΙ Si/os (hp)' Olison 0(1 l-'ra ^111011( Si/o (»η)Γ pDAS1740 8512 8512 EcoK I XHH13 none none DAS-40278-9 >3382 (border) -12000 PDAS1740 8512 8512 Ncol XHH13 none none aad-l DAS-40278-9 >2764 (border) -4000 PDAS1740 8512 8512 Sac I XHH13 none none DAS-40278-9 >4389 (border) -16000 PDAS1740 3361 3361 FsellHindlll XHH13 none none DAS-40278-9 3361 3361 pDASI740 8512 S5I2. 3W)i)·^ \c. 1 .Mill 13 none 3M)()·^ ZmUbi 1 |),\S-4n:-N-‘J >3472 (border) 03ΠΠ. 30(1()-:^ pDAS 1740 8512 8512,-3800=^ prom. Sac 1 .Mill 13 none 3Χ(Ι(|·:= D.\S-4(i2"N-‘J >4389 (border) 3ΜΙΠΑ ........ pDAS1740 3361 3301. 04(10-= /s.l //,-(.(1111 .Mill 13 none 0400-= D.\S-4(i:-N-0 3361 3361, -6400='# ο

(N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 38 DN.V Probe Restriction Enz\mes «·' F.xpectetl Fragineiii Sizes (bp) ' Observed I'ragment Size (bp)- ZmPerS term. Nco\ pDAS1740 8512 8512, -3900* XHH13 none -3900* DAS-40278-9 >2764 (border) -4000, -3900* Sac I pDAS1740 8512 8512,-9000* XHH13 none -9000* DAS-40278-9 >1847 (border) -1900,-9000* FsellHindlll pDAS1740 3361 3361,-2100* XHH13 none -2100* DAS-40278-9 3361 3361,-2100* RB7 mar4 Nco I pDAS1740 8512 8512 XHH13 none none DAS-40278-9 >2764 (border) >3472 (border) -4000 -6300 Sac I pDAS1740 8512 8512 XHH13 none none DAS-40278-9 >1847 (border) >4389 (border) -1900 -16000 RB7 mar3 Sen I pl)AS1740 8512 8512 Mill 13 none none |)\S-4n:^8-9 >2764 (border) >3472 (border) -4000 -6300 Sac I pDAS1740 8512 .\IIIII3 none none l)\S-4(i:"N-‘t >1847 (border) >4389 (border) lllllllliilioiiiiiii -16000 backbone Ncol PDAS1740 8512 8512 XHH13 none none DAS-40278-9 none none Sac I PDAS1740 8512 8512 XHH13 none none DAS-40278-9 none none

Note: * An asterisk after the observed fragment size indicates endogenous sequence hybridization that was detected across all samples (including negative controls) # Doublets in the conventional control, BC3S1, and some BC3S2 samples 1. Expected fragment sizes are based on the plasmid map of the pDAS1740 (pDAB3812) as shown in Figure 1. Ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 30 39 2. Observed fragment sizes are considered approximately from these analyses and are based on the indicated sizes of the DIG-labeled DNA Molecular Weight Marker II fragments. Due to the incorporation of DIG molecules for visualization, the marker fragments t5φically run approximately 5-10% larger than their actual indicated molecular weight.

Restriction enz5ones with unique restriction site in plasmid pDAS1740, EcoK I, Nco I, Sac I, Fse 1/Hind III, were selected to characterize aad-l gene insert in event DAS-40278-9. Border fragment of > 3382 bp, >2764 bp, >4389 bp was predicted to hybridize with the aad-\ gene probe following EcoK I, Nco I, and Sac I digest respectively (Table 2). Single aad-\ hybridization band of ~ 12000 bp, -4000 bp, and -16000 bp were observed when EcoK I, Nco I, and Sac I were used respectively, indicating a single site of aad-\ gene insertion in the com genome of event DAS-40278-9. Double digestion with Fse I and Hind III was selected to release a fragment of 3361 bp which contains the aad-\ plant transcription unit (PTU, promoter/gene/terminator) (Table 2). The predicted 3361 bp fragment was observed with the aad-\ gene probe following Fse 1/Hind III digestion. Results obtained with all four enzymes/enzyme combination digestion of the DAS-40278-9 sample followed by aad-l gene probe hybridization indicated that a single copy of an intact aad-l PTU from plasmid pDAS1740 was inserted into the com genome of event DAS-40278-9.

Restriction enz5ones Nco I, Sac 1 and Fse 1/Hind III were selected to characterize the promoter (ZmUbil) region for aad-l in event DAS-40278-9. Nco 1 and Sac 1 digests are expected to generate a border region fragment of >3472 bp and >4389 bp, respectively, when hybridized to DNA probes specifically to the ZmUbil promoter region (Table 2). Two hybridization bands of -6300 bp and -3600 bp were detected with ZmUbil promoter probe following Nco 1 digestion. The -3600 bp band, however, was present across all sample lanes including the conventional controls, suggesting that the -3600 bp band is a non-specific signal band resulting from the homologous binding of the corn-derived ubiquitin promoter (ZmUbil) probe to the com endogenous ubi gene. On the contrary, the -6300 bp signal band was detected in the tested DAS-40278-9 samples but not in the conventional controls, indicating that the -6300 bp band is specific to the ZmUbil promoter probe from plasmid pDAS1740 and therefore it is the expected Nco I/ZmUbil band indicated in Table 2. Similarly, two hybridization bands of -3800 bp and -16000 bp were detected with ZmUbil promoter probe following Sac 1 Ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 30 40 digestion. The ~3800 bp band appeared in all sample lanes including conventional controls and thus is considered as non-specific hybridization of ZmUbil promoter probe to the com endogenous ubi gene. The -16000 bp hybridization band that is only present in DAS-40278-9 samples is considered the expected Sac 1/ ZmUbil band. Double digestion with Fse 1/ Hind III is expected to release the aad-\ PTU fragment of 3361 bp that hybridizes to the ZmUbil promoter probe (Table 2). This 3361 bp band and a non-specific hybridization band of -6400 bp were detected by ZmUbil promoter probe following Fse 1/ Hind III digestion. The -6400 bp band is considered non-specific binding of the ZmUbil promoter probe to the com endogenous ubi gene because this band is present in all sample lanes including the conventional controls. Additionally, another band very close to -6400 bp was observed in the conventional control, BC3S1, and some of the BC3S2 samples. This additional band very close to -6400 bp is also considered non-specific because it is present in the conventional control XHH13 sample lanes and is most likely associated with the genetic background of XHH13.

The same restriction enzymes/enzyme combination, Nco I, Sac I and Fse HHind III were selected to characterize the terminator (ZmPerS) region for aad-\ in event DAS-40278-9. Nco I digest is expected to generate a border region fragment of >2764 bp when hybridized to DNA probes specifically to the ZmPer5 terminator region (Table 2). Two hybridization bands of -4000 bp and -3900 bp were detected with ZmPer5 terminator probe following Nco I digestion.

The -3900 bp band was present across all sample lanes including the conventional controls, suggesting that the -3900 bp band is a non-specific signal band probably due to the homologous binding of the corn-derived peroxidase gene terminator (ZmPer5) probe to the com endogenous per gene. On the contrary, the -4000 bp signal band was detected in the tested DAS-40278-9 samples but not in the conventional controls, indicating that the -4000 bp band is specific to the ZmPer5 terminator probe from plasmid pDAS1740 and therefore it is the expected Nco I/ZmPer5 band indicated in Table 2. A >1847 bp border fragment is expected to hybridized to the ZmPer5 terminator probe following Sac I digestion. Two hybridization bands of -1900 bp and -9000 bp were detected with ZmPer5 terminator probe following Sac I digestion. The -9000 bp band appeared in all sample lanes including conventional controls and thus considered as non-specific hybridization of ZmPer5 terminator probe to the com endogenous per gene. The -1900 bp hybridization band that was only present in DAS-40278-9 samples is considered the Ο (N > Ο Ο (Ν οο CTs (Ν (X) ΙΟ (Ν ΙΟ Ο (Ν 25 30 41 expected Sac 1/ ZmPer5 band. Double digestion with Fse 1/ Ηίηά III is expected to release the aad-\ PTU fragment of 3361 bp that hybridizes to the ZmPer5 terminator probe (Table 2). This 3361 bp band and an additional non-specific hybridization band of ~2100 bp were detected by ZmPerS terminator probe following Fse V Ηίηά III digestion. The additional ~2100 bp band is the non-specific binding of the ZmPer5 terminator probe to the com endogenous gene since this band is present in all sample lanes including the negative controls. Results obtained with these digestions of the DAS-40278-9 sample followed by ZmUbil promoter and ZmPer5 terminator probe hybridization further confirmed that a single copy of an intact aad-\ PTU from plasmid pDAS1740 was inserted into the com genome of event DAS-40278-9.

Restriction enzymes, Nco I and Sac I, were selected to characterize the rest of the components from pDAS1740/F5/? I fragment in AAD-1 com event DAS-40278-9 (Table 2). DNA sequences of components RB7 Mar v3 and RB7 Mar v4 have over 99.7% identity, therefore DNA probes specific for RB7 Mar v3 or RB7 Mar v4 were expected to hybridize to DNA fragments containing either version of the RB7 Mar. Two border fragments of >2764 bp and >3472 bp were expected to hybridize with RB7 Mar v4 and RB7 Mar v3 probes following Nco I digestion (Table 2). Two hybridization bands of ~4000 bp and ~6300 bp were observed with either RB7 Mar v4 or RB7 Mar v3 probe after Nco I digestion in DAS-40278-9 samples. Similarly, two border fragments of >1847 bp and >4389 bp were predicted with RB7 Mar v4 and RB7 Mar v3 probes following Sac I digestion (Table 2). Hybridization bands of ~ 1900 bp and ~16000 bp were detected in DAS-40278-9 samples with RB7 Mar v4 or RB7 Mar v3 probe after Sac I digestion.

Taken together, the Southern hybridization results obtained with these element probes indicated that the DNA inserted in com event DAS-40278-9 contains an intact aad-\ PTU along with the matrix attachment regions RB7 Mar v3 and RB7 Mar v4 at the 5 ’ and 3 ’ ends of the insert, respectively.

Example 2.8 Absence of Backbone Sequences

Equal molar ratio combination of three DNA fragments (Table 1) covering nearly the entire Fsp I backbone region (4867-7143 bp in plasmid pDAS1740) of plasmid pDAS1740 were used as the backbone probe to characterize AAD-1 com event DAS-40278-9. Plasmid 42 Ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν pDAS1740/F5/71 fragment was used to generate event DAS-40278-9, therefore, no specific hybridization signal was expected with the backbone probe combination (Table 2) following any restriction enz5one digestion. It was confirmed that no specific hybridization signal was detected with backbone probe following Nco I or Sac I digestion in all DAS-40278-9 samples. Positive control lanes contained the expected hybridizing bands demonstrating that the probes were capable of hybridizing to any homologous DNA fragments if present in the samples. The data suggested that the insertion in com event DAS-40278-9 did not include any vector backbone sequence outside of the Fsp I region from plasmid pDAS1740.

Leaf samples from five distinct generations of the event DAS-40278-9 were used to conduct the Southern blot analysis for molecular characterization. The integration pattern was investigated using selected restriction enzyme digest and probe combinations to characterize the inserted gene, aad-1, as well as the non-coding regions including promoter, terminator of gene expression, and the matrix attachment regions.

Southern blot characterization of the DNA inserted into event DAS-40278-9 indicate that a single intact copy of the aad-1 PTU has been integrated into event DAS-40278-9. The molecular weights indicated by the Southern hybridization for the combination of the restriction enzyme and the probe were unique for the event, and established its identification patterns. The hybridization pattern is identical across all five generations, indicating that the insert is stable in the com genome. Hybridization with probes covering the backbone region beyond the pDAS1740/F5/71 transformation fragment from plasmid pDAS1740 confirms that no vector backbone sequences have been incorporated into the event DAS-40278-9.

Example 3. Cloning and Characterization of DNA Sequence in the Insert and the Flanking Border Regions of Com Event DAS-40278-9

25 To characterize the inserted DNA and describe the genomic insertion site, DNA sequences of the insert and the border regions of event DAS-40278-9 were determined. In total, 8557 bp of event DAS-40278-9 genomic sequence were confirmed, comprising 1873 bp of 5’ flanking border sequence, 1868 bp of 3’ flanking border sequence, and 4816 bp of DNA insert. The 4816 bp DNA insert contains an intact aad-\ expression cassette, a 259 bp partial MAR v3 30 on the 5’ terminus, and a 1096 bp partial MAR v4 on the 3’ terminus. Sequence analysis 43 ΙΟ ο (Ν > Ο 2; ο (Ν 00 σ^ (Ν 00 Ό (Ν Ό Ο (Ν

Z.\J revealed a 21 bp insertion at 5’-integration junction and a two base pair deletion from the insertion locus of the com genome. A one base pair insertion was found at 3’-integration junction between the com genome and the DAS-40278-9 insert. Also, a single base change (T to C) was found in the insert at position 5212 in the non-coding region of the 3’ UTR. None of these changes affect the open reading frame composition of the aad-\ expression cassette. PCR amplification based on the event DAS-40278-9 insert and border sequences confirmed that the border regions were of com origin and that the junction regions could be used for event-specific identification of DAS-40278-9. Analysis of the sequence spanning the junction regions indicated that no novel open reading frames (ORF>= 200 codons) resulted from the DNA insertion in event DAS-40278-9 and also no genomic open reading frames were intermpted by the DAS-40278-9 integration in the native com genome. Overall, characterization of the insert and border sequences of the AAD-1 com event DAS-40278-9 indicated that a single intact copy of the aad-l expression cassette was integrated into the native com genome.

Example 3.1. Genomic DNA Extraction and Quantification

Genomic DNA was extracted from lyophilized or freshly ground leaf tissues using a modified CTAB method. DNA samples were dissolved in lx TE (lOmM Tris pH8.0, ImM EDTA) (Fluka, Sigma, St. Louis, MO) and quantified with the Pico Green method according to manufacturer’s instmctions (Molecular Probes, Eugene, OR). For PCR analysis, DNA samples were diluted with molecular biology grade water (5 PRIME, Gaithersburg, MD) to result in a concentration of 10-100 ng/μΕ.

Example 3.2. PCR Primers

Table 3 lists the primer sequences that were used to clone the DNA insert and the 25 flanking border regions of event DAS-40278-9, with positions and descriptions marked in Figure 4. Table 4 lists the primer sequences that were used to confirm the insert and border sequences. The primer positions were marked in Figures 4 and 5, respectively. All primers were S5mthesized by Integrated DNA Technologies, Inc. (Coralville, LA). Primers were dissolved in water (5 PRIME, Gaithersburg, MD) to a concentration of 100 μΜ for the stock 30 solution and diluted with water to a concentration of 10 μΜ for the working solution. ο (N> Οο (Ν

Tables. 44

List of primer sequences used in the cloning of the insert in Com Event DAS-40278-9 and flanking border sequence (X) σ^ (Ν οο (Ν ΙΟ Ο (Ν

Primer Name Size (bp) Location (bp) Sequence Purpose 5End3812_A 26 2231-2256 (-) SeqlDNo; 1;5’- TGCACTGCAGGTCGACTCTAGAGGAT 3’ Primary PCR for 5’ border sequence 5End3812_B 23 2110-2132(-) Seq ID No; 2; 5’- GCGGTGGCCACTATTTTCAGAAG 3’ Secondary PCR for 5’ border sequence 3End3812_C 26 5535-5560 (+) Seq ID No; 3:5’- TTGTTACGGCATATATCCAATAGCGG - 3’ Primary PCR for 3 ’ border sequence 3End3812_D 26 5587-5612 (+) SeqlDNo; 4; 5’- CCGTGGCCTATTTTCAGAAGAAGTTC - 3’ Secondary PCR for 3 ’ border sequence Amp IF 23 736-758 (+) SeqlDNo; 5; 5’- ACAACCATATTGGCTTTGGCTGA - 3’ Amplification of the insert, AmpUcon 1, used with Amp IR Amp IR 28 2475-2502 (-) SeqlDNo; 6; 5’ CCTGTTGTCAAAATACTCAATTGTCCTT 3’ Amplification of the insert, Amplicon 1, used with Amp IF in Ο

(N > Ο ;z; ο (N oo σ^

(N

OO *n

(N *n o

(N 45

Amp 2F 23 1696-1718(+) Seq ID No: 7: 5’- CTCCATTCAGGAGACCTCGCTTG 3’ Amplification of the insert, Amplicon 2, used with Amp 2R Amp 2R 23 3376-3398 (-) Seq ID No: 8: 5’- GTACAGGTCGCATCCGTGTACGA - 3’ Amplification of the insert, Amplicon 2, used with Amp 2F Amp 3F 25 3254-3278 (+) Seq ID No: 9:5’ CCCCCCCTCTCTACCTTCTCTAGAT - 3’ Amplification of the insert, Amplicon 3, used with Amp 3R Amp3R 23 4931-4953 (-) Seq ID No: 10: 5’- GTCATGCCCTCAATTCTCTGACA - 3’ Amplification of the insert, AmpUcon 3, used with Amp 3F Amp 4F 23 4806-4828 (+) Seq ID No: 11: 5’ - GTCGCTTCAGCAACACCTCAGTC - 3’ Amplification of the insert, Amplicon 4, used with Amp 4R Amp 4R 23 6767-6789 (-) Seq ID No: 12: 5’ AGCTCAGATCAAAGACACACCCC - 3’ Amplification of the insert, Amplicon 4, used with Amp 4F Amp 5F 28 6300-6327 (+) Seq ID No: 13:5’ TCGTTTGACTAATTTTTCGTTGATGTAC 3’ Amplification of the insert, Amplicon 5, used with Amp 5R Amp 5R 23 7761-7783 (-) Seq ID No: 14: 5’- TCTCACTTTCGTGTCATCGGTCG 3’ Amplification of the insert, AmpUcon 5, used with Amp 5F (+): Direct sequence; (-): Complementary sequence; ο (N> Ο Ο (Ν 46

List of primer sequences used in the confirmation of com genomic DNA 00 σ^ (Ν 00 (Ν ΙΤ)ο (Ν

Table 4. Primer Name Size (bp) Location (bp) Sequence Purpose lF5End01 17 1816-1832 (+) SeqlDNo; 15; 5’-CCAGCACGAACCATTGA 3 ’ confirmation of 5' border genomic DNA, used with AI5End01 lF5End02 24 1629-1652 (+) SeqlDNo; 16; 5’ CGTGTATATAAGGTCCAGAGGGTA- 3’ confirmation of 5' border genomic DNA, used with AI5End02 AISEndOl 17 4281-4297 (-) SeqlDNo; 17; 5’-TTGGGAGAGAGGGCTGA 3’ confirmation of 5' border genomic DNA, used with lF5End01 AI5End02 20 4406-4426 (-) SeqlDNo; 18; 5’-TGGTAAGTGTGGAAGGCATC- 3’ confirmation of 5' border genomic DNA, used with lF5End02 lF3End03 20 8296-8315 (-) SeqlDNo; 19; 5’-GAGGTACAACCGGAGCGTTT- 3’ confirmation of genomic DNA, used with lF5End03 lF3End04 19 8419-8437 (-) Seq ID No; 20; 5’ -CCGACGCTTTTCTGGAGTA- 3’ confirmation of genomic DNA, used with lF5End04 lF5End03 22 378-399 (+) SeqlDNo; 21; 5’- TGTGCCACATAATCACGTAACA- 3’ confirmation of genomic DNA, used with lF3End03 lF5End04 20 267-286 (+) Seq ID No; 22; 5’ -GAGACGTATGCGAAAATTCG- 3’ confirmation of genomic DNA, used with lF3End04 AISEndOl 22 4973-4994 (+) SeqlDNo; 23: 5’- TTGCTTCAGTTCCTCTATGAGC- 3’ confirmation of 3' border genomic DNA, used with lF3End05 lF3End05 19 7060-7078 (-) Seq ID No; 24: 5’ -TCCGTGTCCACTCCTTTGT- 3’ confirmation of 3' border genomic DNA, used with ABEndO 1 IFSEndTlF 22 2033-2054 (-) Seq ID No; 25: 5’ - GCAAAGGAAAACTGCCATTCTT- 3’ 278 specific sequence amplification at 5' junction IFSEndTlR 20 1765-1784 (+) Seq ID No; 26; 5’ -TCTCTAAGCGGCCCAAACTT- 3 ’ 278 specific sequence amplification at 5' junction Com278-F 23 1884-1906 (-) Seq ID No; 27; 5’ - ATTCTGGCTTTGCTGTAAATCGT- 3’ 278 specific sequence amplification at 5' junction ΙΟ ο (Ν> Ο Ο (Ν 47 Seq ID No; 28; 5’- TTACAATCAACAGCACCGTACCTT- 278 specific sequence amplification at 5' Com278-R 24 1834-1857 (+) 3’ junction 00 σ^ (Ν 00 ΙΟ (Ν ΙΟ Ο (Ν (+): Direct sequence; (-): Complementary sequence; 5 Example 3.3. Genome Walking

The GenomeWalker™ Universal Kit (Clontech Laboratories, Inc., Mountain View, CA) was used to clone the 5’ and 3’ flanking border sequences of com event DAS-40278-9. According to the manufacturer’s instmction, about 2.5 qg of genomic DNA from AAD-1 com event DAS-40278-9 was digested overnight with AcoR V, Stu I (both provided by the kit) or Sea 10 1 (New England Biolabs, Ipswich, MA). Digested DNA was purified using the DNA Clean &

Concentrator™-25 (ZYMO Research,Orange, CA) followed by ligation to GenomeWalker™ adaptors to constmet GenomeWalker™ libraries. Each GenomeWalker™ library was used as DNA template for primary PCR amplification with the adaptor primer API, provided in the kit, and each constmct-specific primer 5End3812_A and 3End3812_C. One microliter of 1:25 15 dilution of primary PCR reaction was then used as template for secondary PCR amplification with the nested adaptor primer AP2 and each nested constmct-specific primer 5End3812_B and 3End3812_D. TaKaRa LA Taq™ HS (Takara Bio Inc., Shiga, Japan) was used in the PCR amplification. In a 50 pL PCR reaction, 1 pL of DNA template, 8 pL of 2.5 mM of dNTP mix, 0.2 pM of each primer, 2.5 units of TaKaRa LA Taq™ HS DNA Polymerase, 5 pi of 10 x LA 20 PCR Buffer II (Mg2+ plus), and 1.5 pL of 25 mM MgCb were used. Specific PCR conditions are listed in Table 5. 10 ο (Ν> Ο :¾ο (Ν 48 00 σ^ (Ν 00 ΙΟ (Ν ΙΟ Ο (Ν

Table 5. Conditions for Genome Walking of the AAD-1 Com Event DAS-40278-9 to Amplify the Flanking Border Regions Sequence Primer Set l>re- denntiire (°C7niin) Denature (“C'/sec.) Anneal (°C/sec.) 1 l·'.vleπsίιιπ (°t''iniii:sec) Dm itiiK (‘(Vsec.) Anneal CV'sec.) l-Atensiiin (°C'miii:secl 1 iiial Γ.\UΊI^i>ll (°('/niin) 5’ border 5End3812_A / API 95/3 95/30 gg.05/cycle^64 /30 68/10:00 95/30 64/30 68/10:00 72/10 8 cycles 22 cycles 5’ border (nested) 5End3812_B / AP2 95/3 95/30 gg.05/cycle^g4 /30 68/10:00 95/30 64/30 68/10:00 72/10 8 cycles 22 cycles 3’ border 3End3812_C / API 95/3 95/30 gg.0.5/cycle^g4 /30 68/10:00 95/30 64/30 68/10:00 72/10 8 cycles 22 cycles 3’border (nested) 3End3812_D / AP2 95/3 95/30 gg-0.5/cyd=_^g4 /30 68/10:00 95/30 64/30 68/10:00 72/10 8 cycles 22 cycles

Example 3.4. Conventional PCR

Standard PCR was used to clone and confirm the DNA insert and border sequence in the com event DAS-40278-9. TaKaRa LA Taq™ (Takara Bio Inc., Shiga, Japan), HotStarTaq DNA Polymerase (Qiagen, Valencia, CA), Expand High Fidelity PCR System (Roche Diagnostics, Inc., Indianapolis, IN), or the Easy-A® High-Fidelity PCR Cloning Enzyme & Master Mix (Stratagene, LaJolla, CA) was used for conventional PCR amplification according to the manufacturer’s recommended procedures. Specific PCR conditions and amplicon descriptions are listed in Table 6. Ο (N> Οο (Ν 49 00 σ^ (Ν 00 (Νο (Ν

Table 6. Conditions for Standard PCR Amplification of the Border Regions in the Com Event DAS-40278-9 Targcl Sc(|iicncc Primer Sel Pre- (leiialiirc (°(7niiii) Denature (°(7see.) Anneal (°(/see. ) K\leiisioii (°( /niin:see) Kinal l-Atension (°( /mill) 5’ border IFSEndOl / AISEndOl 95/3 95/30 60/30 68/5:00 72/10 35 cycles 5’ border lF5End02 / AI5End02 95/3 95/30 60/30 68/5:00 72/10 35 cycles Across the insert locus lF3End03 / lF5End03 95/3 95/30 60/30 68/5:00 72/10 35 cycles Across the insert locus lF3End04 / lF5End04 95/3 95/30 60/30 68/5:00 72/10 35 cycles 5’ junction (Amplicon 1) Amp IF / Amp IR 95/2 94/60 55/60 72/2:00 72/10 35 cycles Amplicon 2 Amp IF / Amp IR 95/2 94/60 55/60 72/2:00 72/10 35 cycles Amplicon 3 Amp IF / Amp IR 95/2 94/60 55/60 72/2:00 72/10 35 cycles Amplicon 4 Amp IF / Amp IR 95/2 94/60 55/60 72/2:00 72/10 35 cycles 3 ’ junction (Amplicon 5) Amp IF / Amp IR 95/2 94/60 55/60 72/2:00 72/10 35 cycles 3 ’ border lF3End05 95/30 60/30 68/5:00 72/10 ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 20 25 / AISEndOl 95/3 35 cycles 50

Example 3.5 PCR Product Detection. Purification. Sub-cloning of PCR Products, and Sequencing PCR products were inspected by electrophoresis using 1.2 % or 2 % E-gel (Invitrogen, Carlsbad, CA) according to the product instruction. Eragment size was estimated by comparison with the DNA markers. If necessary, PCR fragments were purified by excising the fragments from 1% agarose gel in lx TBE stained with ethidium bromide, using the QIAquick Gel Extraction Kit (Qiagen, Carlsbad, CA). PCR fragments were sub-cloned into the pCR®4-TOPO® using TOPO TA Cloning® Kit for Sequencing (Invitrogen, Carlsbad, CA) according to the product instruction. Specifically, two to five microliters of the TOPO® cloning reaction was transformed into the One Shot chemically competent TOP 10 cells following the manufacturer’s instruction. Cloned fragments were verified by minipreparation of the plasmid DNA (QIAprep Spin Miniprep Kit, Qiagen, Carlsbad, CA) followed by restriction digestion with EcoK I or by direct colony PCR using T3 and T7 primers, provided in the kit. Plasmid DNA or glycerol stocks of the selected colonies were then sent for sequencing.

After sub-cloning, the putative target PCR products were sequenced initially to confirm that the expected DNA fragments had been cloned. The colonies containing appropriate DNA sequences were selected for primer walking to determine the complete DNA sequences. Sequencing was performed by Cogenics (Houston, TX).

Pinal assembly of insert and border sequences was completed using Sequencher software (Version 4.8 Gene Codes Corporation, Ann Arbor, MI). Annotation of the insert and border sequences of com event DAS-40278-9 was performed using the Vector NTI (Version 10 and 11, Invitrogen, Carlsbad, CA).

Homology searching was done using the BLAST program against the GenBank database. Open reading frame (ORE) analysis using Vector NTI (Version 11, Invitrogen) was performed to identify ORPs (>= 200 codons) in the full insert and flanking border sequences. ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 51

Example 3.6. 5’ End Border Sequence A DNA fragment was amplified from each com event DAS-40278-9 GenomeWalker™ library using the specific nested primer set for 5’ end of the transgene. An approximately 800 bp PCR product was observed from both the event DAS-40278-9 EcoK V and Stu I GenomeWalker™ libraries. The Sea I GenomeWalker™ library generated a product around 2 kb. The fragments were cloned into pCR®4-T0P0® and six colonies from each library were randomly picked for end sequencing to confirm the insert contained the expected sequences. Complete sequencing by primer walking of the inserts revealed that the fragments amplified from com event DAS-40278-9 Stu I, EcoK V, and Sea I GenomeWalker™ libraries were 793, 822, and 2132 bp, respectively. The DNA fragments generated from the Stu I and EcoK V GenomeWalker™ libraries were a 100% match to the DNA fragment generated from Sea I GenomeWalker™ library, suggesting that these DNA fragments were amplified from the 5’ region of the transgene insert. BLAST search of the resultant 1873 bp com genomic sequence indicated a high similarity to the sequence of a com BAC clone. Moreover, sequence analysis of the insertion junction indicated that 917 bp of the MAR v3 at its 5’ end region was tmneated compared to the plasmid pDAS1740/Fs7? I fragment, leaving a 259 bp partial MAR v3 at the 5’ region of the aad-\ expression cassette.

Example 3.7. 3’ End Border Sequence A DNA fragment with size of approximately 3 kb was amplified from com event DAS-40278-9 Stu I GenomeWalker™ library using the specific nested primer set for the 3’ end of the transgene. The DNA fragment was cloned into pCR®4-TOPO® and ten colonies were randomly picked for end sequencing to confirm the insertion of the expected sequences. Three clones with the expected inserts were completely sequenced, generating a 2997 bp DNA fragment. Sequence analysis of this DNA fragment revealed a partial MAR v4 element (missing 70 bp of its 5’ region) and 1867 bp com genomic sequence. BLAST search showed the 1867 bp genomic DNA sequence was a 100% match to sequence in the same com BAC clone as was identified with the 5’ border sequence. Ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν irj Ο (Ν ζυ 25 30 52

Example 3.8. DNA Insert and Junction Sequence

The DNA insert and the junction regions were cloned from com event DAS-40278-9 using PCR based methods as previously described. Five pairs of primers were designed based on the 5’ and 3’ flanking border sequences and the expected transgene sequence. In total, five overlapping DNA fragments (Amplicon 1 of 1767 bp, Amplicon 2 of 1703 bp, Amplicon 3 of 1700 bp, Amplicon 4 of 1984 bp, and Amplicon 5 of 1484 bp) were cloned and sequenced (Figure 4). The whole insert and flanking border sequences were assembled based on overlapping sequence among the five fragments. The final sequence confirms the presence of 4816 bp of the DNA insert derived from pDAS1740/F5/? I, 1873 bp of the 5’ flanking border sequence, and 1868 bp of 3’ flanking border sequence. The 4816 bp DNA insert contains an intact aad-l expression cassette, a 259 bp partial MAR v3 on the 5’ terminus, and a 1096 bp partial MAR v4 on the 3’ terminus (Seq ID No: 29).

At least two clones for each primer pair were used for primer walking in order to obtain the complete sequence information on the DNA insert and its border sequences. Sequence analysis indicated a 21 bp insertion at 5’-integration junction between com genome DNA and the integrated partial MAR v3 from the pDAS 1 lAOIFsp I. BLAST search and Vector NTI analysis results indicated that the 21 bp insert DNA did not demonstrate homology to any plant species DNA or the pDAS1740 plasmid DNA. A single base pair insertion was found at the 3’-integration junction between com genome DNA and the partial MAR v4 from the pDAS1740/F5/? I. DNA integration also resulted in a two base pair deletion at the insertion locus of the com genome (Figure 6). In addition, one nucleotide difference (T to C) at the position of 5212 bp was observed in the non-translated 3’ UTR region of the DNA insert (Seq ID No: 29). However, none of these changes seem to be critical to aad-\ expression or create any new ORFs (>= 200 codons) across the junctions in the insert of DAS-40278-9.

Example 3.9. Confirmation of Com Genomic Sequences

To confirm the insertion site of event DAS-40278-9 transgene in the com genome, PCR amplification was carried out with different pairs of primers (Figure 4). Genomic DNA from event DAS-40278-9 and other transgenic or non-transgenic com lines was used as a template. Two aad-\ specific primers, AI5End01 and AI5End02, and two primers designed according to ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 30 53 the 5’ end border sequence, lF5End01 and lF5End02, were used to amplify DNA fragments spanning the aad-l gene to 5’ end border sequence. Similarly, to amplify a DNA fragment spanning the aad-\ to 3’ end border sequence, lF3End05 primer derived from the 3’ end border sequence and aad-\ specific ADEndOl primer were used. DNA fragments with expected sizes were amplified only from the genomic DNA of AAD-1 com event DAS-40278-9, with each primer pair consisting of one primer located on the flanking border of AAD-1 com event DAS-40278-9 and one aad-l specific primer. The control DNA samples did not yield PCR products with the same primer pairs indicating that the cloned 5 ’ and 3 ’ end border sequences are indeed the upstream and downstream sequence of the inserted aad-\ gene constmct, respectively. It is noted that a faint band with size of about 8 kb was observed in all the com samples including AAD-1 com event DAS-40278-9, AAD-1 com event DAS-40474 and non transgenic com line XHH13 when the primer pair of lF5End01 and AI5End01 were used for PCR amplification. An observed faint band (on a prepared gel) could be a result of nonspecific amplification in com genome with this pair of primers.

To further confirm the DNA insertion in the com genome, two primers located at the 5’ end border sequence, lF5End03 and lF5End04, and two primers located at the 3’ end border sequence, lF3End03 and lF3End04, were used to amplify DNA fragments spanning the insertion locus. PCR amplification with either the primer pair of lF5End03/lF3End03 or the primer pair of lF5End04/lF3End04 resulted in a fragment with expected size of approximately 8 kb from the genomic DNA of AAD-1 com event DAS-40278-9. In contrast, no PCR products resulted from the genomic DNA of AAD-1 com event DAS-40474-7 or the non-transgenic com line XHH13. Given that AAD-1 com event DAS-40278-9 and event DAS-40474-7 were generated by transformation of Hill, followed by backcrossing the original transgenic events with the com line XHH13, the majority of genome in each of these two events is theoretically from the com line XHH13. It is very likely that only the flanking border sequences close to the aad-\ transgene are carried over from the original genomic DNA and preserved during the AAD-1 event introgression process, while other regions of genome sequences might have been replaced by the genome sequences of XHH13. Therefore, it is not surprising that no fragments were amplified from the genomic DNA of AAD-1 com event DAS-40474-7 and XHH13 with either the primer pair of lF5End03/lF3End03 or the primer pair of lF5End04/lF3End04. 54 ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν

Approximately 3.1 and 3.3 kb fragments were amplified with the primer pair of lF5End03/ lF3End03 and lF5End04/lF3End04 respectively in the genomic DNA of the com lines Hill and B73 but not in the com line A188. The results indicate that the border sequences originated from the genome of the com line B73.

Additional cloning of com genomic DNA from B73/HiII was performed to ensure validity of the flanking border sequences. The PCR amplified fragments were sequenced in order to prove the insert DNA region integrated into the specific location of B73/HiII genomic DNA. Primers were designed based on the sequence obtained. Primer set Amp lE/Amp 5R was used to amplify a 2212 bp fragment spanning the 5’ to 3’ junctions from native B73/HiII genome without insert DNA. Sequence analysis revealed that there was a two base pair deletion from the native B73 genome in the transgene insertion locus. Analysis of the DNA sequences from the cloned native B73 genomic fragment identified one ORF (>= 200 codons) located downstream of the 3’- integration junction region. Additionally, there are no other ORFs across the original locus where the AAD-1 com event DAS-40278-9 integrated. BLAST search also confirmed that both 5’ end and 3’ end border sequences from the event DAS40278-9 are located side by side on the same com BAG clone.

Given the uniqueness of the 5’-integration junction of the AAD-1 com event DAS-40278-9, two pairs of specific PCR primers, lF5EndTlF/lF5EndTlR and Com278-F/Com278-R, were designed to amplify this insert-to-plant genome junction. As predicted, the desired DNA fragment was only generated in the genomic DNA of the AAD-1 com event DAS-40278-9 but not any other transgenic or non-transgenic com lines. Therefore, those two primer pairs can be used as AAD-1 com event DAS-40278-9 event-specific identifiers.

Example 4. Genomic Characterization via Flanking SSR Markers of DAS-40278-9 25 To characterize and describe the genomic insertion site, marker sequences located in proximity to the insert were determined. A panel of polymorphic SSR markers were used to identify and map the transgene location. Event pDAS 1740-278 is located on chromosome 2 at approximately 20 cM between SSR markers UMC1265 and MMCOl 11 at approximately 20 cM on the 2008 DAS com linkage map. Table 6 summarizes the primer information for these two 30 makers found to be in close proximity to transgene pDAS1740-278. Ο (N> Ο Ο (Ν 55 οο σ^ (Ν ΟΟ (Ν Η Ο (Ν

Table 6. Primer names, dye labels, locus positions, forward and reverse primer sequences, and significant notes for flanking makers associated with event pDAS1740-278. Primer Name Lab^ Chr Bin Pwward Primer Reverse Primer Notes umc1265 NED 2 20 2.02 Seq lb No: 30: 5’ ~ GCCTAGTCGCC TACCCTACCAAT-3’ Seq ID No: 31: 5’--TGTGTTCTTGATT GGGTGAGACAT- 3’ Left flanking marker mmcOm FAM 2 20 2.03 Seq ID No: 32: 5’ - TACTGGGG ATTAGAGCAGAAG -3’ Seq ID No: 33: 5’-AATCTATGT GTGAACAGCAGC -3’ Right flanking marker

Example 4.1. gPNA Isolation gDNA was extracted from leaf punches using the DNEasy 96 Plant Test Kit (Qiagen, Valencia, California). Modifications were made to the protocol to accommodate for automation. Isolated gDNA was quantified using the PicoGreen® dye from Molecular Probes, Inc. (Eugene, OR). The concentration of gDNA was diluted to 5 ng/μΐ for all samples using sterile deionized water.

Example 4.2. Screening of gDNA with Markers

The diluted gDNA was genotyped with a subset of simple sequence repeats (SSR) markers. SSR markers were synthesized by Applied Biosystems (Foster City, California) with forward primers labeled with either 6-FAM, HEXA^IC, or NED (blue, green and yellow, 15 respectively) fluorescent tags. The markers were divided into groups or panels based upon their fluorescent tag and amplicon size to facilitate post-PCR multiplexing and analysis. PCR was carried out in 384-well assay plates with each reaction containing 5 ng of genomic DNA, 1.25X PCR buffer (Qiagen, Valencia, California), 0.20 μΜ of each forward and reverse primer, 1.25 mM MgCb, 0.015 mM of each dNTP, and 0.3 units of HotStart Taq DNA 20 polymerase (Qiagen, Valencia, California). Amplification was performed in a GeneAmp PCR System 9700 with a 384-dual head module (Applied Biosystems, Foster City, California). The amplification program was as follows: (1) initial activation of Taq at 95°C for 12 minutes; (2) 30 sec at 94°C; (3) 30 sec at 55°C; (4) 30 sec at 72°C; (5) repeat steps 2-4 for 40 cycles; and (6) 30 min final extension at 72°C. The PCR products for each SSR marker panel were multiplexed 56 ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν together by adding 2 μ1 of each PCR product from the same plant to sterile deionized water for a total volume of 60 μ1. Of the multiplexed PCR products, 0.5 ul were stamped into 384-well loading plates containing 5 μ1 of loading buffer comprised of a 1:100 ratio of GeneScan 500 base pair LIZ size standard and ABI HiDi Formamide (Applied Biosystems, Foster City, California). The samples were then loaded onto an ABI Prism 3730x1 DNA Analyzer (Applied Biosystems, Foster City, California) for capillary electrophoresis using the manufacturer’s recommendations with a total mn time of 36 minutes. Marker data was collected by the ABI Prism 3730x1 Automated Sequencer Data Collection software Version 4.0 and extracted via GeneMapper 4.0 software (Applied Biosystems) for allele characterization and fragment size labeling.

Example 4.3 SSR Marker Results

The primer data for the flanking markers which were identified in the closest proximity to the transgene are listed in Table 6. The two closest associated markers, UMC1265 and MMCOl 11, are located approximately 20 cM away from the transgene insert on chromosome 2.

Example 5. Characterization of aad-\ Protein in Event DAS-40278-9

The biochemical properties of the recombinant aad-\ protein derived from the transgenic maize event DAS-40278-9 were characterized. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE, stained with Coomassie blue and glycoprotein detection methods), western blot, immunodiagnostic test strip assays, matrix assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and protein sequencing analysis by tandem MS were used to characterize the biochemical properties of the protein.

Example 5.1. Immunodiagnostic Strip Assay 25 The presence of the aad -1 protein in the leaf tissue of DAS-40278-9 was confirmed using commereially prepared immunodiagnostic test strips from American Bionostica. The strips were able to discriminate between transgenie and nontransgenie plants by testing emde leaf extracts (data not shown). The non-transgenie extracts (XHH13) did not contain detectable amounts of immunoreactive protein. This result was also eonfirmed by western blot analysis. 57 ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 30 Το test for the expression of the aad-\ protein, an immunodiagnostic strip analysis was performed. Four leaf punehes were collected from each plant for XHH13 (control plant) and event DAS-40278-9 by pinching the tissue between the snap-cap lids of individually labeled 1.5-mL microfuge tubes. Upon receipt in the lab, 0.5 mL of aad-\ extraction buffer (American Bionostica, Swedesboro, NJ) was added to each tube, and the tissue was homogenized using a disposable pestle followed by shaking the sample for ~10 seconds. After homogenization, the test strip was placed in the tube and allowed to develop for ~ 5 minutes. The presence or absence of the aad-\ protein in the plant extract was confirmed based on the appearance (or lack of appearance) of a test line on the immunodiagnostic strip. Once the expression of the aad-l protein was confirmed for the transgenic event, the maize stalk tissue was harvested and lyophilized and stored at approximately -80°C until use

Example 5.2. Purification of the aad-1 Protein from Com

Immuno-purified, maize-derived aad-\ protein (molecular weight: ~33 kDa) or cmde aqueous extracts from com stalk tissue were prepared. All leaf and stalk tissues were harvested and transported to the laboratory as follows: The leaves were cut from the plant with scissors and placed in cloth bags and stored at approximately -20 °C for future use. Separately, the stalks were cut off just above the soil line, placed in cloth bags and immediately frozen at approximately -80 °C for ~6 hours. The stalks were then placed in a lyophilizer for 5 days to remove water. Once the tissues were completely dried they were ground to a fine powder with dry ice and stored at approximately -80 °C until needed.

The maize-derived aad-\ protein was extracted from lyophilized stalk tissue in a phosphate- based buffer (see Table 7 for buffer components) by weighing out ~30 grams of lyophilized tissue into a chilled 1000 mL glass blender and adding 500 mL of extraction buffer. The tissue was blended on high for 60 seconds and the soluble proteins were harvested by centrifuging the sample for 20 minutes at 30,000 xg. The pellet was re-extracted as described, and the supernatants were combined and filtered through a 0.45 μ filter. The filtered supernatants were loaded at approximately +4 °C onto an aaii-aad -1 immunoaffinity column that was conjugated with a monoclonal antibody prepared by Strategic Biosolution Inc. (MAh 473F1 85.1; Protein A purified; Lot #: 609.03C-2-4; 6.5 mg/mL (-35.2 mg total)) 58 Ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 15 (Windham, ME); Conjugated to CNBr-activated Sepharose 4B (GE Healthcare, Piscataway, NJ). The non-bound proteins were collected and the column was washed extensively with prechilled 20 mM ammonium bicarbonate buffer, pH 8.0. The bound proteins were eluted with 3.5 M NaSCN, (Sigma, St. Louis, MO), 50 mM Tris (Sigma, St. Louis, MO) pH 8.0 buffer. Seven 5-mL-fractions were collected and fraction numbers 2^7 were dialyzed overnight at approximately +4°C against 10 mM Tris, pH 8.0 buffer. The fractions were examined by SDS-PAGE and western blot and the remaining samples were stored at approximately +4°C until used for subsequent analyses.

Table 7. The commercially available reference substances used in this study are listed in the following table:

UcIVrence Subsliiiicc Soybean Trypsin Inhibitor Prodiici Na«ie A component of the GelCode Glycoprotein Staining Kit Lot .Number lA 110577 \ssay Glycosylation Pierce Cat #; 1856274 Horseradish Peroxidase A component of the GelCode Glycoprotein Staining Kit JG124509 Glycosylation Pierce Cat#; 1856273 Bovine Serum Albumin Fraction V (BSA) Pre-Diluted BSA Protein Assay Standard Set FH71884A Glycosylation, SDS-PAGE and Western Blot Pierce Cat #; 23208 Prestained Molecular Weight Markers Novex Sharp Prestained Protein Markers 469212 & 419493 Western Blot Invitrogen Cat #; LC5800, Molecular Weight Markers of 260, 160, 110, 80, 60, 50, 40, 30,20, 15, 10 and 3.5 kDa Molecular Weight Markers Invitrogen Markl2 Protein Marker Mix 39983 & 399895 SDS-PAGE Invitrogen Cat #; LC5677, Molecular Weight Markers of 200, 116.3,97.4, 66.3, 55.4.36.5.31.0. 21.5, 14.4, 6.0, 3.5 and 2.5 kDa

The protein that bound to the immunoaffinity column was examined by SDSPAGE and the results showed that the eluted fractions contained the aad-\ protein at an approximate molecular weight of 33 kDa. In addition, a western blot was also performed and was positive for the aad-\ protein. The maize-derived aad-\ protein was isolated from ~30 g of lyophilized stalk material. 59 ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 30

Example 5.3. SDS-PAGE and Western Blot

Eyophilized tissue from event DAS-40278-9 and XHH13 stalk (~100 mg) were weighed out in 2-mL microfuge tubes and extracted with ~1 mL of PBST (Sigma, St. Louis, MO) containing 10% plant protease inhibitor cocktail (Sigma, St. Louis, MO). The extraction was facilitated by adding 4 small ball bearings and Geno-Grinding the sample for 1 minute. After grinding, the samples were centrifuged for 5 minutes at 20,000xg and the supernatants were mixed 4:1 with 5x Laemmli sample buffer (2% SDS, 50 mM Tris pH 6.8, 0.2 mg/mL bromophenol blue, 50% (w/w) glycerol containing 10% freshly added 2-mercaptoethanol) and heated for 5 minutes at ~100°C. After a brief centrifugation, 45 μΕ of the supernatant was loaded directly onto a BioRad Criterion SDS-PAGE gel (Bio-Rad, Hercules, CA) fitted in a Criterion Cell gel module. A positive reference standard of microbe-derived aad-1 was resuspended at 1 mg/mL in PBST pH 7.4 and further diluted with PBST. The sample was then mixed with Bio-Rad Laemmli buffer with 5% 2-mercaptoethanol and processed as described earlier. The electrophoresis was conducted with Tris/glycine/SDS buffer (Bio-Rad, Hercules, CA) at voltages of 150 - 200 V until the dye front approached the end of the gel. After separation, the gel was cut in half and one half was stained with Pierce GelCode Blue protein stain and the other half was electro-blotted to a nitrocellulose membrane (Bio-Rad, Hercules, CA) with a Mini trans-blot electrophoretic transfer cell (Bio-Rad, Hercules, CA) for 60 minutes under a constant voltage of 100 volts. The transfer buffer contained 20% methanol and Tris/glycine buffer from Bio-Rad. For immunodetection, the membrane was probed with an aad-l specific polyclonal rabbit antibody (Strategic Biosolution Inc., Newark, DE, Protein A purified rabbit polyclonal antibody Lot #: DAS FI 197-15 1, L6 mg/mL). A conjugate of goat anti-rabbit IgG (H+L) and alkaline phosphatase (Pierce Chemical, Rockford, IL) was used as the secondary antibody. SigmaFosi BCIP/NBT substrate was used for development and visualization of the immunoreactive protein bands. The membrane was washed extensively with water to stop the reaction and a record of the results was captured with a digital scanner (Hewlett Packard, Palo Alto, CA)

In the P.fluorescens-^odMCQd aad-\ the major protein band, as visualized on Coomassie stained SDS-PAGE gels, was approximately 33 kDa. As expected, the corresponding maize-derived aad-\ protein (event DAS-40278-9) was identical in size to the microbe-expressed 60 Η Ο (Ν > Ο Ο (Ν οο σ^ (Ν ΟΟ (Ν Η Ο (Ν 25 30 proteins. Predictably, the plant purified fractions contained a minor amount of non-immunoreactive impurities in addition to the aad-\ protein. The co-purified proteins were likely retained on the column by weak interactions with the column matrix or leaching of the monoclonal antibody off of the column under the harsh elution conditions. Other researchers have also reported the non-specific adsorption of peptides and amino acids on cyanogen-bromide activated Sepharose 4B immunoadsorbents (Kennedy and Barnes, 1983; Holroyde et al., 1976; Podlaski and Stem, 2008).

The Pseudomonas-denYed aad-l protein showed a positive signal of the expected size by polyclonal antibody western blot analysis. This was also observed in the DAS-40278-9 transgenic maize stalk extract. In the aad-l western blot analysis, no immunoreactive proteins were observed in the control XHH13 extract and no alternate size proteins (aggregates or degradation products) were seen in the transgenic samples.

Example 5.4. Detection of Post-translational Glvcosvlation

The immunoaffmity chromatography-purified, maize-derived aad-l protein (Fraction #3) was mixed 4:1 with 5x Laemmli buffer. The microbe-derived aad-l, soybean trypsin inhibitor, bovine semm albumin and horseradish peroxidase were diluted with Milli-Q water to the approximate concentration of the plant-derived aad-l and mixed with Bio-Rad Laemmli buffer. The proteins were then heated at ~95°C for 5 minutes and centrifuged at 20000xg for 2 minutes to obtain a clarified supernatant. The resulting supernatants were applied directly to a Bio-RadCriterion Gel and electrophoresed with XT MES mnning buffer (Bio-Rad, Hercules, CA) essentially as described above except that the electrophoresis was run at 170 V for ~60 minutes. After electrophoresis, the gel was cut in half and one half was stained with GelCode Blue stain for total protein according to the manufacturers’ protocol. After the staining was complete, the gel was scanned with a Molecular Dynamics densitometer to obtain a permanent visual record of the gel. The other half of the gel was stained with a GelCode Glycoprotein Staining Kit (Pierce Chemical, Rockford, IL) according to the manufacturers’ protocol to visualize glycoproteins. The glycoproteins (with a detection limit as low as 0.625 ng per band) were visualized as magenta bands on a light pink background. After the glycoprotein staining was complete, the gel was scanned with a Hewlett Packard digital scanner to obtain a 61 Ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 30 permanent visual record of the gel. After the image of the glycosylation staining was captured, the gel was stained with GelCode Blue to verify the presence of the non-glycosylated proteins. The results showed that both the maize- and microbe-derived aad-\ proteins had no detectable covalently linked carbohydrates. This result was also confirmed by peptide mass fingerprinting.

Example 5.5. Mass Spectrometry Peptide Mass Fingerprinting and Sequencing of Maize-and Pseudomonas- Derived aad-\

Mass Spectrometry analysis of the Pseudomonas- and maize-derived aad-\ was conducted. The aad-\ protein derived from transgenic com stalk (event DAS-40278-9) was subjected to in-solution digestion by hypsin followed by MALDI-TOF MS and ESI-LC/MS.

The masses of the detected peptides were compared to those deduced based on potential protease cleavage sites in the sequence of maize-derived aad-\ protein. The theoretical cleavage was generated in silico using Protein Analysis Worksheet (PAWS) freeware from Proteometrics EEC. The aad-l protein, once denatured, is readily digested by proteases and will generate numerous peptide peaks.

In the trypsin digest of the transgenic-maize-derived aad-\ protein (event DAS-40278-9), the detected peptide fragments covered nearly the entire protein sequence lacking only one small tryptic fragment at the C-terminal end of the protein, to and one short (2 amino acids) peptide fragment. This analysis confirmed the maize-derived protein amino acid sequence matched that of the microbe-derived aad-l protein. Results of these analyses indicate that the amino acid sequence of the maize-derived aad-l protein was equivalent to the P. _/7wore5ce«5-expressed protein.

Example 5.5.1. Tryptic Peptide Fragment Sequencing

In addition to the peptide mass fingerprinting, the amino acid residues at the N- and C-termini of the maize-derived aad-l protein (immunoaffmity purified from maize event DAS-40278-9) were sequenced and compared to the sequence of the microbe-derived protein. The protein sequences were obtained, by tandem mass spectrometry, for the first 11 residues of the microbe- and maize-derived proteins (Table 8). The amino acid sequences for both proteins ο (Ν > Ο ο (Ν 00 σ^ (Ν 00 ΙΟ (Ν ΙΟ Ο (Ν ΙΟ 62 were A' HAALSPLSQ R " (SEQ ID ΝΟ:30) showing the N-terminal methionine had been removed by an aminopeptidase (Table 8). The N-terminal aad- \ protein sequence was expected to be m' AHAALSPLSQR'^. (SEQIDN0:31) These results suggest that during or after translation in maize and P. fluorescem, the N-terminal methionine is cleaved by a methionine aminopeptidase (MAP). MAPs cleave methionyl residues rapidly when the second residue on the protein is small, such as Gly, Ala, Ser, Cys, Thr, Pro, and Val (Walsh, 2006). In addition to the methionine being removed, a small portion of the N-terminal peptide of the aad-1 protein was shown to have been acetylated after the N-terminal methionine was cleaved (Table 8). This result is encountered frequently with eukaryotic (plant) expressed proteins since approximately 80-90% of the N-terminal residues are modified (Polevoda and Sherman, 2003). Also, it has been shown that proteins with serine and alanine at the N-termini are the most frequently acetylated (Polevoda and Sherman, 2002). The two cofranslational processes, cleavage of N-terminal methionine residue and N-terminal acetylation, are by far the most common modifications and occur on the vast majority (~85%) of eukaryotic proteins (Polevoda and Sherman, 2002). However, examples demonstrating biological significance associated with N-terminal acetylation are rare (Polevoda and Sherman, 2000).

Table 8. Summary of N-terminal Sequence Data of AAD-1 Maize- and Microbe-Derived Proteins

Source

Expected N-terminal Sequence^ P.fluorescens Maize Event DAS-40278-9 M^AHAALSPLSQR^^ (SEQ ID NO:31) M^AHAALSPLSQR^^ 25

Source Relative Detected N-terminal Sequence^ Abundance 30 35 P. fluorescens A H A A L S P L S Q R^^ 100% Maize Event DAS-40278-9 A H A A L S P L S Q R^^ 31% Maize Event DAS-40278-9 N-Ac^ H A A L S P L S Q R^2 3% (SEQ ID NO:30) Maize Event DAS-40278-9 H A A L S P L S Q R^^ 50% (SEQ ID NO :32) Maize Event DAS-40278-9 A A L S P L S Q R^2 6% (SEQ ID NO:33) Maize Event DAS-40278-9 A L S P L S Q R^^ 12% ΙΟ ο (Ν > Ο Ο (Ν 00 σ^ (Ν 00 ΙΟ (Ν ΙΟ Ο (Ν 30 63 (SEQ ID ΝΟ:34) ^Expected N-terminal sequence of the first 12 amino acid residues of P.fluorescens- and maize-derived AAD-1. ^Detected N-terminal sequences of P. fluorescens- and maize-derived AAD-1. ^The tandem MS data for the N-terminal peptides revealed a mixture of AHAALSPLSQR (acetylated) and A-^ceO^/-AHAALSPLSQR (acetylated). “Ragged N-terminal ends” were also detected (peptides corresponding to amino acid sequences HAALSPLSQR, AALSPLSQR, and ALSPLSQR). The relative abundance, an estimate of relative peptide fragment quantity, was made based on the corresponding LC peak areas measured at 214 nm.

Notes:

Numbers in superscript (R’^) indicate amino acid residue numbers in the sequence.

Amino acid residue abbreviations: A: alanine H: histidine L: leucine M: methionine P: proline Q: glutamine R: T: arginine threonine S: serine

In addition to N-acetylation, there was also slight N-terminal truncation that appeared during purification of the maize-derived aad-l protein (Table 8). These “ragged-ends” resulted in the loss of amino acids Ai, and A'^ (in varying forms and amounts) irom the maize-derived protein. This tmncation is thought to have occurred during the purification of the aad-1 protein as the western blot probe of the crude leaf extracts contained a single crisp band at the same MW as the microbe-derived aad-l protein. The extraction buffer for the western blotted samples contained an excess of a protease inhibitor cocktail which contains a mixture of protease inhibitors with broad specificity for the inhibition of serine, cysteine, aspartic, and metalloproteases, and aminopeptidases.

The C-terminal sequence of the maize- and microbe-derived aad-l proteins were determined as described above and compared to the expected amino acid sequences (Table 9). The results indicated the measured sequences were identical to the expected sequences, and both the maize- and microbe-derived aad-l proteins were identical and unaltered at the C- terminus. 64 in ο (N > Ο Ο (Ν

Table 9. Summary of C-terminal Sequence Data of AAD-1 Maize- and Microbe-Derived Proteins

Source_Expected C-terminal Sequence^ 287t tVGGVRPA 287t TVGGVRPA R^^® P.fluorescens Maize Event DAS-40278-9 (X) σ^ (Ν (X) ιη (Ν ιηο (Ν

Source P.fluorescens Maize Event DAS-40278-9 (SEQ ID NO:35)

Detected C-terminal Sequence^ 287t TVGGVRPA R^^® 287t TVGGVRPA R^*^® (SEQ ID NO:35) ^Expected C-terminal sequence of the last 10 amino acid residues of P.fluorescens- and maize-derived tAAD-1. ^Detected C-terminal sequences of P.fluorescens- and maize-derived tAAD-1 . Notes: Numbers in superscript (R’^) indicate amino acid residue numbers in the sequence. TAmino acid residue abbreviations: A: alanine G: glycine P: proline R: arginine T: threonine V: valine

Example 6. Field Expression. Nutrient Composition Analysis and Agronomic Characteristics of a Hybrid Maize Line Containing Event DAS-40278-9

The purpose of this study was to determine the levels of AAD-1 protein found in com tissues. In addition, compositional analysis was performed on com forage and grain to investigate the equivalency between the isogenic non-transformed com line and the transgenic com line DAS-40278-9 (unsprayed, sprayed with 2,4-D, sprayed with quizalofop, and sprayed with 2,4-D and quizalofop). Agronomic characteristics of the isogenic non-transformed com 30 line were also compared to the DAS-40278-9 com. The Field expression, composition, and agronomic trials were conducted at six test sites located within the major corn-producing regions of the U.S and Canada. These sites represent regions of diverse agronomic practices and environmental conditions. The trials were located in Iowa, Illinois (2 sites), Indiana, Nebraska and Ontario, Canada. 35 All site mean values for the control, unsprayed AAD-1, AAD-1 + quizalofop, AAD-1 + 2,4-D and tAAD-1 + both entry samples were within literature ranges for com. A limited number 65 ΙΟ ο (Ν > Ο ο (Ν οο σ^ (Ν ΟΟ (Ν Ο (Ν of significant differences between unsprayed AAD-1, AAD-1 + quizalofop, AAD-1 + 2,4-D or AAD-1 + both com and the control were observed, but the differences were not considered to be biologically meaningful because they were small and the results were within ranges found for commercial com. Plots of the composition results do not indicate any biologically-meaningfiil treatment-related compositional differences among unsprayed AAD-1, AAD-1 + quizalofop, AAD-1 + 2,4-D or AAD-1 + both com and the control com line. In conclusion, unsprayed AAD-1, AAD-1 + quizalofop, AAD-1 + 2,4-D and AAD-1 + both com composition results confirm equivalence of AAD-1 (Event DAS 40278-9) com to conventional com lines.

Example 6.1. Com Lines Tested

Hybrid seed containing the DAS-40278-9 event and control plants which are conventional hybrid seed of the same genetic background as the test substance line, but do not contain the DAS-40278-9 event, are listed in Table 10.

Table 10.

Test Entry Description 1 Νοη-ααί/-1 Control 2 aad-\ unsprayed 3 aad-\ sprayed w/ quizalofop 4 aad-\ sprayed w/ 2,4-D 5 aad-\ sprayed w/ 2,4-D and quizalofop

The com plants described above were grown at locations within the major com growing regions of the U.S. and Canada. The six field testing facilities, Richland, lA; Carlyle, IL; Wyoming, IL; Rockville, IN; York, NE; and Branchton, Ontario, Canada (referred to as lA, ILl, 20 IL2, IN, NE and ON) represent regions of diverse agronomic practices and environmental conditions for com.

The test and control com seed was planted at a seeding rate of approximately 24 seeds per row with seed spacing within each row of approximately 10 inches (25 cm). At each site, 4 replicate plots of each treatment were established, with each plot consisting of 2-25 ft rows. 66 Ο (N > Ο 2; ο (Ν 00 σ^ (Ν 00 (Ν ΙΟ Ο (Ν

Plots were arranged in a randomized complete block (RCB) design, with a unique randomization at each site. Each com plot was bordered by 2 rows of a non-transgenic maize hybrid of similar maturity. The entire trial site was surrounded by a minimum of 12 rows (or 30 ft) of a non-transgenic maize hybrid of similar relative maturity.

Appropriate insect, weed, and disease control practices were applied to produce an agronomically acceptable crop. The monthly maximum and minimum temperatures along with rainfall and irrigation were average for the site. These ranges are typically encountered in com production.

Example 6.2. Herbicide Applications

Herbicide treatments were applied with a spray volume of approximately 20 gallons per acre (187 L/ha). These applications were designed to replicate maximum label rate commercial practices. Table 11 lists the herbicides that were used.

Table 11.

Herbicide fSN C'oncentration Weedar 64 026491-0006 39%, 3.76 lb ae" /gal, 451 g ae/1 Assure II I06I55 10.2%, 0.87 lb ai*’ /gal, 104 g ai/1 ^ ae = acid equivalent. ’’ ai = active ingredient. 2,4-D (Weedar 64) was applied as 3 broadcast over-the-top applications to Test Entries 4 20 and 5 (seasonal total of 3 lb ae/A). Individual applications were at pre-emergence and approximately V4 and V8 -V8.5 stages. Individual target application rates were 1.0 lb ae/A for Weedar 64, or 1120 g ae/ha. Actual application rates ranged from 1096 - 1231 g ae/A.

Quizalofop (Assure II) was applied as a single broadcast over-the-top application to Test Entries 3 and 5. Application timing was at approximately V6 growth stage. The target 25 application rate was 0.0825 lb ai/A for Assure II, or 92 g ai/ha. Actual application rates ranged from 90.8 - 103 g ai/ha. 67 ΙΟ ο (Ν > Ο ο (Ν

Example 6.3. Agronomic Data Collection and Results

Agronomic characteristics were recorded for all test entries within Blocks 2, 3, and 4 at each location. Table 12 lists the following characteristics that were measured. (X) σ^ (Ν (X) ΙΟ (Ν ΙΟ Ο (Ν

Table 12. Trait Evaldffitt0i;:;Tiihmg DesCtiiiliilfrf^ij^ta Early Population VI andV4 Number of plants emerged per plot. Seedling Vigor V4 Visual estimate of average vigor of emerged plants per plot Plant Vigor/Injury Approximately 1-2 weeks after applications Injury from herbicide applications. Time to Silking Approximately 50% Silking The number of accumulated heat units from the time of planting until approximately 50% of the plants have emerged silks. Time to Pollen Shed Approximately 50% Pollen shed The number of accumulated heat units from the time of planting until approximately 50% of the plants are shedding pollen Pollen Viability Approximately 50% Evaluation of pollen color and shape over time Plant Height Approximately R6 Height to the tip of the tassel Ear Height Approximately R6 Height to the base of the primary ear Stalk Lodging Approximately R6 Visual estimate of percent of plants in the plot with stalks broken below the primary ear Root Lodging Approximately R6 Visual estimate of percent of plants in the plot leaning approximately 30° or more in the first ~l/2 meter above the soil surface Final Population Approximately R6 The number of plants remaining per plot Days to Maturity Approximately R6 The number of accumulated heat units from the time of planting until approximately 50% of the plants have reached physiological maturity. Stay Green Approximately R6 Overall plant health Disease Incidence Approximately R6 Visual estimate of foliar disease incidence Insect Damage Approximately R6 Visual estimate of insect damage Note: Heat Unit = ((MAX temp + MIN temp) /2)- 50°F

An analysis of the agronomic data collected from the control, aad-\ unsprayed, aad-l + 2,4-D, aad-\ + quizalofop, and aad-\ + both entries was conducted. For the across-site analysis, no statistically significant differences were observed for early population (V1 and V4), vigor. in Η Ο (Ν > Ο :¾ ο (Ν 00 σ^ (Ν 00 ιη (Ν ιη Ο (Ν 68 final population, crop injury, time to silking, time to pollen shed, stalk lodging, root lodging, disease incidence, insect damage, days to maturity, plant height, and pollen viability (shape and color) values in the across location summary analysis (Table 13). For stay green and ear height, significant paired t-tests were observed between the control and the aad-\ + quizalofop entries, but were not accompanied by significant overall treatment effects or False Discovery Rates (FDR) adjusted p-values (Table 13).

Locations for the DAS-40278-9 aad-1 Com (Sprayed and Unsprayed) and Control

Table 13._Summary Analysis of Agronomic Characteristics Results Across

Analyte Overall Trt. Effect (Pr>F)" Control Unsprayed (P-value,'’ Adi. P)^ Sprayed Quizalofo P (P-value, Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) Early population VI (no. of plants) (0.351) 42.8 41.3 (0.303, 0.819) 41.7 (0.443, 0.819) 41.9 (0.556, 0.819) 44.1 (0.393, 0.819) Early population V4 (no. of plants) (0.768) 43.1 43.3 (0.883, 0.984) 43.7 (0.687, 0.863) 44.3 (0.423, 0.819) 44.8 (0.263, 0.819) Seedling Vigor** (0.308) 7.69 7.39 (0.197, 0.819) 7.36 (0.161, 0.819) 7.58 (0.633, 0.819) 7.78 (0.729, 0.889) Final population (number of plants) (0.873) 40.1 39.6 (0.747, 0.889) 39.7 (0.802, 0.924) 39.9 (0.943, 1.00) 41.1 (0.521, 0.819) Crop Injury - L* app.*^ NA* 0 0 0 0 0 Crop Injury - 2 app. (0.431) 0 0 (1.00, 1.00) 0 (1.00, 1.00) 0 (1.00, 1.00) 0.28 (0.130, 0.819) Crop Injury -3^**app.*= NA 0 0 0 0 0 Crop Injury -4‘**app.*= NA 0 0 0 0 0 Time to Silking (heat units)^ (0.294) 1291 1291 (0.996, 1.00) 1293 (0.781, 0.917) 1304 (0.088, 0.819) 1300 (0.224, 0.819) Time to Pollen Shed (heat units)^ (0.331) 1336 1331 (0.564, 0.819) 1342 (0.480, 0.819) 1347 (0.245, 0.819) 1347 (0.245, 0.819) Pollen Shape 0 minutes (%)® (0.872) 10.9 10.9 (0.931, 1.00) 11.3 (0.546, 0.819) 11.4 (0.439, 0.819) 11.3 (0.605, 0.819) in ο

(N > Ο ο (Ν 00

Os (Ν 00 in (Ν in ο (Ν 69

Pollen Shape 30 minutes (%) (0.486) 49.2 50.8 (0.618,0.819) 46.4 (0.409, 0.819) 48.1 (0.739, 0.889) 51.9 (0.409, 0.819) Pollen Shape 60 minutes (%) (0.724) 74.4 74.7 (0.809, 0.924) 73.6 (0.470, 0.819) 73.9 (0.629, 0.819) 75.0 (0.629, 0.819) Pollen Shape 120 minutes (%) (0.816) 82.6 82.6 (1.00, 1.00) 82.6 (1.00, 1.00) 82.6 (1.00, 1.00) 82.5 (0.337, 0.819) Analyte Overall Trt. Effect (Pr>Ff Control Unsprayed (P-value,’’ Adi. P)*' Sprayed Quizalofo P (P-value, Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) Pollen Color 30 minutes (%) (0.524) 51.9 52.5 (0.850, 0.960) 48.9 (0.306, 0.819) 50.3 (0.573, 0.819) 53.6 (0.573, 0.819) Pollen Color 60 minutes (%) (0.332) 75.3 75.9 (0.612, 0.819) 74.2 (0.315, 0.819) 74.2 (0.315, 0.819) 75.9 (0.612, 0.819) Pollen Color 120 minutes (%) NA 84.0 84.0 84.0 84.0 84.0 Stalk Lodging (%) (0.261) 5.11 5.22 (0.356, 0.819) 5.00 (0.356, 0.819) 5.00 (0.356, 0.819) 5.00 (0.356, 0.819) Root Lodging (%) (0.431) 0.44 0.17 (0.457,0.819) 0.72 (0.457, 0.819) 0.17 (0.457, 0.819) 0.11 (0.373, 0.819) Stay Green' (0.260) 4.67 4.28 (0.250,0.819) 3.92 (0.034", 0.819) 4.17 (0.144, 0.819) 4.11 (0.106, 0.819) Disease Incidence” (0.741) 6.42 6.22 (0.383,0.819) 6.17 (0.265, 0.819) 6.17 (0.265, 0.819) 6.17 (0.265, 0.819) Insect Damage^ (0.627) 7.67 7.78 (0.500, 0.819) 7.78 (0.500, 0.819) 7.72 (0.736, 0.889) 7.56 (0.500, 0.819) Days to Maturity (heat units)^ (0.487) 2411 2413 (0.558, 0.819) 2415 (0.302, 0.819) 2416 (0.185, 0.819) 2417 (0.104, 0.819) Plant Height (cm) (0.676) 294 290 (0.206,0.819) 290 (0.209, 0.819) 291 (0.350, 0.819) 291 (0.286, 0.819) Analyte Overall Trt. Effect (Pr>F)^ Control Unsprayed (P-value,’’ Adi. P)" Sprayed Quizalofo P (P-value, Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) 70 124 120 118 121 118 Ear Height (cm) (0.089) (0.089,0.819) (0.018”, 0.786) (0.214, 0.819) (0.016”, 0.786) ΙΟ ο (Ν > Ο ο (Ν 00 σ^ (Ν 00 ΙΟ (Ν ο (Ν

Overall treatment effect estimated using an F-test.

Comparison of the sprayed and unsprayed treatments to the control using a t-test. P-values adjusted using a False Discovery Rate (FDR) procedure.

Visual estimate on 1-9 scale; 9 = tall plants with large robust leaves. 0-100% scale; with 0 = no injury and 100 = dead plant.

The number of heat units that have accumulated from the time of planting. 0-100% scale; with % pollen grains with collapsed walls. 0-100% scale; with % pollen grains with intense yellow color.

Visual estimate on 1-9 scale with 1 no visible green tissue.

Visual estimate on 1-9 scale with 1 being poor disease resistance.

Visual estimate on 1-9 scale with 1 being poor insect resistance. NA = statistical analysis not performed since no variability across replicates or treatment. Statistical difference indicated by P-Value <0.05.

Example 6.4. Sample Collection

Samples for expression and composition analysis were collected as listed in Table 14. Table 14.

Block Tissue Approx. (irowlh Stage" Sample Size Samnles ner Entrv Control TestsEntries Entry 1 2-5 1 Leaf V2-4 3 leaves 3 3 (expression) Leaf V9 3 leaves 3 3 Pollen*’ R1 1 plant 3 3 Root*’ R1 1 plant 3 3 Leaf*’ R1 1 leaf 3 3 Forage R4 2 plants*^ 3 3 Whole Plant R6 2 plants*’ 3 3 Grain R6-Maturity 1 ear 3 3 Block Ti.s.suc Growth Stage" Sample Size Control Fntry 1 ΙΙΙΙΙΐίϊΕΐΙ^ 2-4 Forage R4 3 plants*’ 1 1 (composition) Grain R6-Maturity 5 ears 1 1

Approximate growth stage. Η Ο (Ν > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 20 25 71 ’’ The pollen, root, and leaf samples collected at R1 collected from the same plant.

Two plants chopped, combined and sub-sampled for expression, or 3 plants for composition.

Example 6.5. Determination of aad-l Protein in Com Samples

Samples of com were analyzed for the amount of aad-\ protein. Soluble extractable aad-1 protein is quantified using an enzyme-linked immunosorbent assay (ELISA) kit purchased from Beacon Anal5dical System, Inc. (Portland, ME).

Samples of com tissues were isolated from the test plants and prepared for expression analysis by coarse grinding, lyophilizing and fine-grinding (if necessary) with a Geno/Grinder (Certiprep, Metuchen, New Jersey). No additional preparation was required for pollen. The aad-\ protein was extracted from com tissues with a phosphate buffered saline solution containing the detergent Tween-20 (PBST) containing 0.5% Bovine Semm Albumin (BSA). For pollen, the protein was extracted with a 0.5% PBST/BSA buffer containing 1 mg/mL of sodium ascorbate and 2% protease inhibitor cocktail. The plant tissue and pollen extracts were centrifuged; the aqueous supernatant was collected, diluted with appropriate buffer if necessary, and analyzed using an aad-\ ELISA kit in a sandwich format. The kit used the following steps. An aliquot of the diluted sample and a biotinylated anti-aa<i-l monoclonal antibody are incubated in the wells of a microtiter plate coated with an immobilized anti-aa<i-l monoclonal antibody. These antibodies bind with aad-\ protein in the wells and form a "sandwich" with aad-l protein bound between soluble and the immobilized antibody. The unbound samples and conjugate are then removed from the plate by washing with PBST. An excess amount of streptavidin-enzjone (alkaline phosphatase) conjugate is added to the wells for incubation. At the end of the incubation period, the unbound reagents were removed from the plate by washing.

Subsequent addition of an enz5one substrate generated a colored product. Since the aad-l was bound in the antibody sandwich, the level of color development was related to the concentration of aad-l in the sample (i.e., lower residue concentrations result in lower color development).

The absorbance at 405 nm was measured using a Molecular Devices V-max or Spectra Max 190 plate reader. A calibration curve was generated and the aad-l concentration in unknown samples was calculated from the polynomial regression equation using Soft-MAX Pro™ ΙΟ ο (Ν > Ο ο (Ν 00 σ^ (Ν 00 ΙΟ (Ν ΙΟ Ο (Ν 72 software which was compatible with the plate reader. Samples were analyzed in duplicate wells with the average concentration of the duplicate wells being reported. A summary of the aad-\ protein concentrations (averaged across sites) in the various com matrices is shown in Table 15. aad-l average protein concentration ranged from 2.87 ng/mg dry weight in R1 stage root to 127 ng/mg in pollen. Expression results for the unsprayed and sprayed plots were similar. The aad-\ protein was not detected in any control samples, with the exception of one control root sample from the Indiana site.

Tissues

Table 15. Summary of Mean Concentration Levels of aad-l Protein Measured in the aad-l Unspraved, aad-l + Quizalofop. aad-l + 2.4-D and aad-l + Ouizalofop and 2.4-D in Maize

Com AAD-1 ng/mg Tissue Dry Weight Tissue Treatment Mean Std. Dev. Range V2-V4 Leaf AAD-1 Unsprayed 13.4 8.00 1.98-29.9 AAD-1 + Quizalofop 13.3 6.89 4.75-24.5 AAD-1 +2,4-D 14.2 7.16 4.98-26.7 AAD-1 + Quizalofop and 2,4-D 12.3 7.09 4.07-22.5 V9 Leaf AAD-1 Unsprayed 5.96 2.50 2.67-10.9 AAD-1 + Quizalofop 5.38 1.84 2.52-9.15 AAD-1 + 2,4-D 6.37 2.41 3.03-10.9 AAD-1 + Quizalofop and 2,4-D 6.52 2.38 3.11-11.1 R1 Leaf AAD-1 Unsprayed 5.57 1.66 3.47-9.34 AAD-1 + Quizalofop 5.70 1.63 2.70-7.78 AAD-1 + 2,4-D 5.99 1.90 2.40-9.42 AAD-1 + Quizalofop and 2,4-D 6.06 2.27 1.55-10.2 Pollen AAD-1 Unsprayed 127 36.2 56.3-210 AAD-1 + Quizalofop 108 29.9 52.2-146 AAD-1 + 2,4-D 113 30.2 37.5-137 AAD-1 + Quizalofop and 2,4-D 112 32.6 45.4-162 R1 Root AAD-1 Unsprayed 2.92 1.87 0.42-6.10 AAD-1 + Quizalofop 3.09 1.80 0.56-6.06 AAD-1 + 2,4-D 3.92 2.03 0.91-7.62 AAD-1 + Quizalofop and 2,4-D 2.87 1.23 1.09-5.56 R4 Lorage AAD-1 Unsprayed 6.87 2.79 2.37-12.1 AAD-1 + Quizalofop 7.16 2.84 3.05-11.6 AAD-1 + 2,4-D 7.32 2.46 2.36-10.6 15 20 ο (N> Ο Ο (Ν οο σ^ (Ν ΟΟ (Ν Η Ο (Ν 73 AAD-1 + Quizalofop and 2,4-D 6.84 2.31 2.25-10.3 Whole plant AAD-1 Unsprayed 4.53 2.55 0.78-8.88 AAD-1 + Quizalofop 4.61 2.22 0.75-8.77 AAD-1 + 2,4-D 5.16 2.53 0.83-10.2 AAD-1 + Quizalofop and 2,4-D 4.55 1.77 1.30-8.21 Grain AAD-1 Unsprayed 5.00 1.53 2.66-8.36 AAD-1 + Quizalofop 4.63 1.51 1.07-6.84 AAD-1 + 2,4-D 4.98 1.78 2.94-9.10 AAD-1 + Quizalofop and 2,4-D 4.61 1.62 1.81-7.49 ® ND = value less than the method Limit Of Detection (LOD). *’ Values in parentheses are between the method LOD and Limit Of Quantitation (LOQ)

Example 6.6. Compositional Analysis

Samples of com forage and grain were analyzed at for nutrient content with a variety of tests. The analyses performed for forage included ash, total fat, moisture, protein, carbohydrate, cmde fiber, acid detergent fiber, neutral detergent fiber, calcium and phosphoms. The analyses performed for grain included proximates (ash, total fat, moisture, protein, carbohydrate, cmde fiber, acid detergent fiber), neutral detergent fiber (NDF), minerals, amino acids, fatty acids, vitamins, secondary metabolites and anti-nutrients. The results of the nutritional analysis for com forage and grain were compared with values reported in literature ( see; Watson, 1982 (4); Watson, 1984 (5); ILSI Crop Composition Database, 2006 (6); OECD Consensus Document on Compositional Considerations for maize, 2002 (7); and Codex Alimentarius Commission 2001 (8)).

Example 6.6.1. Proximate. Fiber and Mineral Analysis of Forage

An analysis of the protein, fat, ash, moisture, carbohydrate, ADF, NDF, calcium and phosphoms in com forage samples from the control, unsprayed aad-\, aad-\ + quizalofop, aad-\ + 2,4-D and aad-\ + both entries was performed. A summary of the results across all locations is shown in Table 16. For the across-site and individual-site analysis, all proximate, fiber and mineral mean values were within literature ranges. No statistical differences were observed in the across-site analysis between the control and transgenic entries for moisture, ADF, NDF, calcium and phosphoms. For protein and ash, significant paired t-tests were observed for the unsprayed AAD-1 (protein), the aad-\ + quizalofop (protein), and aad-\ + both (ash), but were Ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 74 not accompanied by significant overall treatment effects or FDR adjusted p-values. For fat, both a significant paired t-test and adjusted p-value was observed for aad-\ + quizalofop compared with the control, but a significant overall treatment effect was not observed. For carbohydrates, a statistically significant overall treatment effect, paired t-test and FDR adjusted p-value was observed between the aad-\ + quizalofop and the control. Also for carbohydrates, a significant paired t-test for the unsprayed aad-\ entry was observed, but without a significant FDR adjusted p-value. These differences are not biologically meaningful since all across-site results for these analytes were within the reported literature ranges for com, and differences from the control were small (<23 %).

Table 16. Summary of the Proximate. Fiber and Mineral Analysis of Com Forage from All Sites.

Proximate (% dry weight) Literature Values'^ Overall Treatment Effect (Pr>F)'’ Control Unsprayed (P-value,* Adi. P)" Sprayed Quizalofop (P-value, Adi. P) Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) Protein 3.14-15.9 (0.054) 7.65 6.51 (0.016*, 0.066) 6.41 (0.010*, 0.051) 7.17 (0.285, 0.450) 7.13 (0.245, 0.402) Fat 0.296-6.7 (0.068) 2.29 2.08 (0.202, 0.357) 1.78 (0.005*, 0.028*) 2.10 (0.233, 0.391) 2.01 (0.093, 0.213) Ash 1.3-10.5 (0.072) 3.90 3.84 (0.742, 0.859) 4.03 (0.525, 0.708) 3.99 (0.673, 0.799) 4.40 (0.019*, 0.069) Moisture 53.3-87.5 (0.819) 69.5 69.2 (0.651, 0.782) 69.5 (0.988, 0.988) 69.8 (0.699, 0.820) 70.0 (0.501, 0.687) Carbohydrates 66.9-94.5 (0.026*) 86.1 87.6 (0.015*, 0.061) 87.8 (0.006*, 0.034*) 86.8 (0.262, 0.424) 86.5 (0.538, 0.708)

Fiber

Acid Detergent Fiber (ADF) 16.1-47.4 (0.968) 26.5 26.6 (0.925, 0.970) 26.8 (0.833, 0.925) 26.0 (0.677, 0.800) 26.8 (0.851. 0.937) Neutral Detergent Fiber (NDF) 20.3-63.7 (0.345) 41.6 43.6 (0.169, 0.322) 43.3 (0.242, 0.402) 41.3 (0.809, 0.911) 41.6 (0.978, 0.985)

Minerals (% dry weight) 00 σ^ (Ν 00 (Ν ο (Ν ο (N> Ο Ο (Ν 75 Calcium 0.071-0.6 (0.321) 0.212 0.203 (0.532, 0.708) 0.210 (0.930, 0.970) 0.215 (0.815, 0.911) 0.231 (0.150, 0.296) Phosphoms 0.094- 0.55 (0.163) 0.197 0.189 (0.198, 0.354) 0.202 (0.427, 0.615) 0.203 (0.288, 0.450) 0.200 (0.608, 0.762) Combined range. Overall treatment effect estimated using an F-test. Comparison of the transgenic treatments to the control using t-tests. P-values adjusted using a False Discovery Rate (FDR) procedure. Statistical difference indicated by P-Value <0.05. 20

Example 6.6.2. Proximate and Fiber Analysis of Grain A summary of the results for proximates (protein, fat, ash, moisture, cholesterol and carbohydrates) and fiber (ADF, NDF and total dietary fiber) in com grain across all locations is shown in Table 17. All results for proximates and fiber were within literature ranges, and no significant differences in the across-site analysis were observed between the control and transgenic entries for fat, ash, NDF and total dietary fiber. For moisture, a significant overall treatment effect was observed, but not accompanied by significant paired t-tests or FDR adjusted p-values. For ADF, a significant paired t-test was observed for aad-\ + both, but no significant overall treatment effect or FDR adjusted p-value was seen. For both protein and carbohydrates, significant pair-tests, adjusted p-values and overall treatment effects were found for the unsprayed aad-1, aad-1 + quizalofop, and aad-l + both. Since these differences were small (< 12%) and all values were within literature ranges, the differences are not considered biologically meaningful.

Sites.

Table 17._Summary of the Proximate and Fiber Analysis of Com Grain from All

Proximate (% dry weight) Literature Values® Overall Treatment Effect (Pr>F)*’ Control Unsprayed (P-value,' Adi. P)" Sprayed Quizalofop (P-value, Adi. P) Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) Protein 6-17.3 (0.003') 9.97 10.9 (0.002', 0.016') 11.1 (0.0004', 0.013') 10.5 (0.061, 0.161) 10.9 (0.002', 0.015') Fat 1.2-18.8 (0.369) 4.26 4.19 (0.238, 0.397) 4.16 (0.095, 0.215) 4.26 (0.955, 0.977) 4.22 (0.427, 0.615) ο (Ν> Ο 2;ο (Ν 00 σ^ (Ν 00 (Νο (Ν 76 Ash 0.62-6.28 (0.553) 1.45 1.55 (0.178, 0.330) 1.52 (0.364, 0.557) 1.45 (0.982, 0.985) 1.51 (0.397, 0.587) Moisture 6.1-40.5 (0.038*^) 25.1 25.5 (0.406, 0.594) 24.4 (0.056, 0.152) 24.5 (0.117, 0.254) 24.5 (0.114, 0.250) Cholesterol NR^ NA® <LOQ <LOQ <LOQ <LOQ <LOQ Carbohydrate 63.3-89.8 (0.005“^) 84.3 83.3 (0.002', 0.015') 83.2 (0.001', 0.013') 83.8 (0.074, 0.185) 83.4 (0.003', 0.019')

Fiber Acid Detergent Fiber (ADF) 1.82-11.3 (0.247) 4.23 3.94 (0.130, 0.269) 3.99 (0.197, 0.354) 3.89 (0.078, 0.193) 3.82 (0.035', 0.106) Neutral Detergent Fiber (NDF) 5.59-22.6 (0.442) 10.6 10.3 (0.455, 0.638) 9.89 (0.120, 0.254) 9.90 (0.121, 0.254) 10.3 (0.552, 0.708) Total Dietary Fiber 8.3-35.3 (0.579) 13.4 12.8 (0.164, 0.313) 12.9 (0.195, 0.353) 13.1 (0.487, 0.679) 12.9 (0.215, 0.370)

Combined range.

Overall treatment effect estimated using an F-test.

Comparison of the transgenic treatments to the control using t-tests. P-values adjusted using a False Discovery Rate (FDR) procedure.

Statistical difference indicated by P-Value <0.05. NR = not reported. NA= statistical analysis was not performed since a majority of the data was < LOQ.

Example 6.6..^ Mineral Analysis of Grain 10 An analysis of com grain samples for the minerals calcium, chromium, copper, iodine, iron, magnesium, manganese, molybdenum, phosphoms, potassium, selenium, sodium, and zinc was performed. A summary of the results across all locations is shown in Table 18. All results were within the reported literature ranges. For the across-site analysis, no significant differences were observed for calcium, copper, iron, and potassium. Mean results for chromium, iodine, 15 selenium and sodium were below the limit of quantitation of the method. For magnesium and phosphorus, significant paired t-tests were observed for the unsprayed aad-l and the aad-l + quizalofop entries, but were not accompanied by significant overall treatment effects or FDR adjusted p-values. For manganese and molybdenum, a significant paired t-test was observed for 77 Ο (N > Ο ο (Ν (X) σ^ (Ν οο (Ν ο (Ν the unsprayed aad-l, but a significant FDR adjusted p-value and overall treatment effect was not found. For the aad-\ + both entry, a significant paired t-test was observed for zinc, but a significant FDR adjusted p-value or overall treatment effect was not present. Additionally, these differences from the control were small (< 13%), and all values were within literature ranges, when available.

Table 18. Summary of the Mineral Analysis of Com Grain from All Sites.

Minerals (mg/lOOg dry wt.) Literature Values^ Overall Treatment Effect (Pr>F)*’ Control Unsprayed (P-value, Adi. P)" Sprayed Quizalofop (P-value, Adi. P) Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) Calcium 1.27-100 (0.493) 4.05 4.21 (0.146, 0.289) 4.12 (0.505, 0.687) 4.04 (0.944, 0.977) 4.06 (0.898, 0.957) Chromium 0.006- 0.016 NA^ <LOQ <LOQ <LOQ <LOQ <LOQ Copper 0.073- 1.85 (0.963) 0.144 0.151 (0.655, 0.782) 0.146 (0.890, 0.957) 0.141 (0.817, 0.911) 0.149 (0.749, 0.863) Iodine 7.3-81 NA <LOQ <LOQ <LOQ <LOQ <LOQ Iron 0.1-10 (0.333) 2.49 2.60 (0.086, 0.206) 2.56 (0.310, 0.482) 2.51 (0.801, 0.911) 2.59 (0.145, 0.289) Magnesium 59.4- 1000 (0.072) 122 129 (0.010^, 0.051) 128 (0.017^, 0.066) 126 (0.145, 0.289) 127 (0.070, 0.177) Manganese 0.07-5.4 (0.099) 0.525 0.551 (0.025^, 0.082) 0.524 (0.884, 0.957) 0.526 (0.942, 0.977) 0.532 (0.505, 0.687) Molybdenum NR (0.143) 261 229 (0.020^, 0.072) 236 (0.067, 0.173) 244 (0.206, 0.362) 234 (0.046, 0.132) Phosphorus 147-750 (0.102) 289 303 (0.012^, 0.057) 300 (0.035^, 0.106) 299 (0.055, 0.150) 298 (0.085, 0.206) Potassium 181-720 (0.453) 362 368 (0.330, 0.510) 359 (0.655, 0.782) 364 (0.722, 0.839) 357 (0.454, 0.638) Selenium 0.001-0.1 NA <LOQ <LOQ <LOQ <LOQ <LOQ Sodium 0-150 NA <LOQ <LOQ <LOQ <LOQ <LOQ

Combined range. ΙΟ ο (Ν > Ο ο (Ν οο σ^ (Ν ΟΟ (Ν Η Ο (Ν 25 78 Zinc 2.26 2.32 2.34 2.29 2.37 0.65-3.72 (0.166) (0.183, (0.108, (0.627, (0.027^, 0.336) 0.238) 0.768) 0.085)

Overall treatment effect estimated using an F-test.

Comparison of the transgenic treatments to the control using t-tests. P-values adjusted using a False Discovery Rate (FDR) procedure. NA= statistical analysis was not performed since a majority of the data was < LOQ. Statistical difference indicated by P-Value <0.05.

Example 6.6.4 Amino Acid Analysis of Grain

Com samples were analyzed for amino acid content in the control, unsprayed aad-l, aad-1 + quizalofop, aad-\ + 2,4-D and aad-\ + both com, and a summary of the results over all locations and by individual field site are shown in Table 19. Levels of all amino acids were within the reported literature ranges, and no significant differences in the across-site analysis were observed for arginine, lysine, and tyrosine. Significant differences were observed for several of the amino acids in the across-site analysis. In these instances, the amino acid content of the control was lower than the aad-\ transgenic lines, which may be related to the overall lower protein content in the control grain compared with the aad-\ lines. For the unsprayed aad-1 entry, significant overall treatment effects along with significant paired t-tests and FDR adjusted p-values were found for all amino acids except arginine, glycine, lysine, tryptophan and t5aOsine. For the aad-\ + quizalofop entry, significant overall treatment effects along with significant paired t-tests and FDR adjusted p-values were found for all amino acids except arginine, cysteine, glycine, lysine, tr)q)tophan and tyrosine. For the aad-l + 2,4-D entry, significant overall treatment effects along with significant paired t-tests (with significant FDR adjusted p-values) were found for all amino acids except arginine, aspartic acid, glycine, histidine, lysine, t5aOsine and valine. For the aad-l + both entry, significant overall treatment effects along with significant paired t-tests and FDR adjusted p-values were found for all amino acids except arginine, glycine, lysine, serine, tryptophan and tyrosine. Although there were many differences observed for amino acids, the differences were small (< 15%), not observed across all sites, and all mean values were within reported literature ranges. 30 Table 19.

Summary of the Amino Acid Analysis of Com Grain from All Sites. Ο (N> Οο (Ν 00 σ^ (Ν 00 (Νο (Ν 79

Amino Acids (% dry weight) Literature Values^ Overall Treatment Effect (Pr>F)'’ Control Unsprayed (P-value,‘' Adi. P)" Sprayed Quizalofop (P-value, Adi. P) Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) Alanine 0.44-1.39 (0.002·^) 0.806 0.901 (0.0005^ 0.013*^) 0.900 (0.0005^ 0.013*^) 0.863 (0.021^ 0.074) 0.894 (0.001^ 0.013*^) Arginine 0.12-0.64 (0.371) 0.486 0.499 (0.286, 0.450) 0.505 (0.139, 0.283) 0.487 (0.929, 0.970) 0.484 (0.897, 0.957) Aspartic Acid 0.34-1.21 (O.OIO·^) 0.712 0.768 (0.002^ 0.015“^) 0.764 (0.003^ 0.021*^) 0.743 (0.060, 0.160) 0.762 (0.004^ 0.027*^) Cysteine 0.08-0.51 (0.033*^) 0.213 0.225 (0.009^ 0.050*^) 0.223 (0.020^ 0.072) 0.223 (0.018^ 0.067) 0.226 (0.005^ 0.028*^) Glutamic Acid 0.97-3.54 (O.OOP^) 1.97 2.22 (0.0003^ 0.013*^) 2.21 (0.0004^ 0.013*^) 2.12 (0.017^ 0.067) 2.20 (0.001^ 0.013*^) Glycine 0.18-0.54 (0.052) 0.383 0.397 (0.018^ 0.067) 0.398 (0.013^ 0.059) 0.390 (0.217, 0.371) 0.397 (0.016^ 0.066) Histidine 0.14-0.43 (0.005“^) 0.283 0.303 (0.001^ 0.013*^) 0.302 (0.002^ 0.014·^) 0.295 (0.036, 0.109) 0.302 (0.002^ 0.014·^) Isoleucine 0.18-0.71 (0.003*^) 0.386 0.427 (0.001^ 0.014“^) 0.427 (0.001^ 0.014“^) 0.410 (0.044^ 0.127) 0.431 (0.001^ 0.013*^) Leucine 0.64-2.49 (O.OOP^) 1.35 1.54 (0.0003^ 0.013*^) 1.54 (0.0003^ 0.013*^) 1.47 (0.013^ 0.059) 1.53 (0.001^ 0.013*^) Lysine 0.05-0.56 (0.211) 0.310 0.315 (0.210, 0.367) 0.316 (0.128, 0.265) 0.309 (0.879, 0.956) 0.316 (0.102, 0.226) Methionine 0.10-0.47 (0.003*^) 0.195 0.209 (0.001^ 0.013*^) 0.209 (0.001^ 0.013*^) 0.205 (0.014^ 0.061) 0.208 (0.001^ 0.014·^) Phenylalanine 0.24-0.93 (0.002·^) 0.551 0.617 (0.001^ 0.013*^) 0.619 (0.001^ 0.013*^) 0.592 (0.023^ 0.077) 0.615 (0.001^ 0.013*^) Pro line 0.46-1.63 (0.002*^) 0.910 1.01 (0.0004^ 0.013*^) 1.01 (0.001^ 0.013*^) 0.975 (0.012^ 0.059) 0.997 (0.001^ 0.014“^) Serine 0.24-0.91 (0.009*^) 0.498 0.550 (0.002^ 0.014“^) 0.550 (0.001^ 0.014“^) 0.529 (0.042^ 0.122) 0.536 (0.015^ 0.061) ο (N> Ο :¾ο (Ν 00 σ^ (Ν 00 ιη (Ν Ο (Ν 80 Amino Acids (% dry weight) Literature Values® Overall Treatment Effect (Pr>F)*’ Control Unsprayed (P-value,* Adi. P)" Sprayed Quizalofop (P-value, Adi. P) Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) Threonine 0.22-0.67 (0.005*) 0.364 0.394 (0.001*, 0.014*) 0.394 (0.001*, 0.013*) 0.384 (0.023*, 0.077) 0.390 (0.003*, 0.020*) Tryptophan 0.03-0.22 (0.088) 0.052 0.055 (0.067, 0.173) 0.056 (0.025*, 0.082) 0.056 (0.014*, 0.060) 0.056 (0.029*, 0.092) Tyrosine 0.10-0.79 (0.390) 0.336 0.355 (0.535, 0.708) 0.375 (0.214, 0.370) 0.339 (0.907, 0.964) 0.314 (0.500, 0.687) Valine 0.21-0.86 (0.005*) 0.495 0.537 (0.002*, 0.014*) 0.538 (0.002*, 0.014*) 0.519 (0.054, 0.148) 0.538 (0.001*, 0.014*) Combined range. Overall treatment effect estimated using an F-test. Comparison of the transgenic treatments to the control using t-tests. P-values adjusted using a False Discovery Rate (FDR) procedure. Statistical difference indicated by P-Value <0.05.

Example 6.6.5.Fatty Acid Analysis of Grain 15 20

An analysis of com grain samples for fatty acids was performed. A summary of the results aeross all locations is shown in Table 20. All results for the eontrol, unsprayed aad-l, aad-l + quizalofop, aad-\ + 2,4-D and aad-l + both com grain samples analyzed for these fatty acids were within the published literature ranges. Results for eaprylic (8:0), capric (10:0), lauric (12:0), myristie (14:0), myristoleic (14:1), pentadecanoic (15:0), pentadeeenoic (15:1), heptadecanoie (17:0), heptadecenoie (17:1), gamma linolenie (18:3), eieosadienoic (20:2), eicosatrienoie (20:3), and arachidonie (20:4) were below the method Limit of Quantitation (LOQ). In the across-site analysis, no significant differences were observed for 16:0 palmitic, 16:1 pamitoleic, 18:0 stearic, 18:2 linoleic, 18:3 linolenie, and 20:0 arachidic. For 18:1 oleic and 20:1 eicosenoic, significant paired t-tests were observed for the unsprayed aad-l (18:1) and the aad-l + 2,4-D (18:1 and 20:1) entries, but were not accompanied by significant overall treatment effects or FDR adjusted p-values. For 22:0 behenic, a significant overall treatment effect and significant paired t-tests for aad-l + 2,4-D and aad-l + both were found, but significant FDR adjusted p-values were not present. Ο (N> Οο (Ν

Summary of t 81 re Fatty Acid Analysis of Com Grain from All Sites. 00 σ^ (Ν 00 (Νο (Ν

Table 20. Fatty Acids (% total fatty acids)" Literature Values’’ Overall Treatment Effect (Pr>F)" Control Unsprayed (P-value,‘^ Adi. P)' Sprayed Quizalofop (P-value, Adi. P) Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) 8:0 Caprylic 0.13-0.34 NA^ <LOQ <LOQ <LOQ <LOQ <LOQ 10:0 Capric ND NA <LOQ <LOQ <LOQ <LOQ <LOQ 12:0 Laurie ND- 0.687 NA <LOQ <LOQ <LOQ <LOQ <LOQ 14:0 Myristic ND-0.3 NA <LOQ <LOQ <LOQ <LOQ <LOQ 14:1 Myristoleic NR NA <LOQ <LOQ <LOQ <LOQ <LOQ 15:0 Pentadecanoic NR NA <LOQ <LOQ <LOQ <LOQ <LOQ 15:1 Pentadecenoic NR NA <LOQ <LOQ <LOQ <LOQ <LOQ 16:0 Palmitic 7-20.7 (0.559) 9.83 9.88 (0.618, 0.763) 9.95 (0.280, 0.445) 9.78 (0.617, 0.763) 9.90 (0.544, 0.708) 16:1 Palmitoleic ND-1.0 (0.552) 0.056 0.044 (0.804, 0.911) 0.047 (0.551, 0.708) 0.041 (0.555, 0.708) 0.079 (0.392, 0.582) 17:0 Heptadecanoic ND-0.11 NA <LOQ <LOQ <LOQ <LOQ <LOQ 17:1 Heptadecenoic ND-0.1 NA <LOQ <LOQ <LOQ <LOQ <LOQ 18:0 Stearic ND-3.4 (0.561) 2.04 1.98 (0.119, 0.254) 2.01 (0.437, 0.626) 2.00 (0.259, 0.421) 2.02 (0.598, 0.756) 18:1 Oleic 17.4-46 (0.076) 31.3 30.4 (0.013®, 0.059) 30.8 (0.178, 0.329) 30.4 (0.015®, 0.061) 30.7 (0.092, 0.213) 18:2 Linoleic 34.0-70 (0.474) 47.5 48.3 (0.189, 0.345) 48.4 (0.144, 0.289) 48.0 (0.453, 0.638) 48.5 (0.119, 0.254) 18:3 Gamma Linolenic NR NA <LOQ <LOQ <LOQ <LOQ <LOQ ΙΟο (Ν> Οο (Ν (X) σ^ (Ν 00 ΙΟ (Ν ΙΟ Ο (Ν 82 Fatty Acids (% total fatty acids)'‘ Literature Values*’ Overall Treatment Effect (Pr>F)^ Control Unsprayed (P-value,‘^ Adi. P)' Sprayed Quizalofop (P-value, Adi. P) Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) 18:3 Linolenic ND-2.25 (0.479) 1.04 1.05 (0.537, 0.708) 1.06 (0.202, 0.357) 1.04 (0.842, 0.932) 1.06 (0.266, 0.428) 20:0 Arachidic 0.1-2 (0.379) 0.400 0.386 (0.061, 0.161) 0.393 (0.341, 0.525) 0.390 (0.153, 0.297) 0.390 (0.175, 0.328) 20:1 Eicosenoic 0.17-1.92 (0.107) 0.232 0.226 (0.089, 0.210) 0.230 (0.497, 0.687) 0.223 (0.013^ 0.059) 0.227 (0.121, 0.254) 20:2 Eicosadienoic ND-0.53 NA <LOQ <LOQ <LOQ <LOQ <LOQ 20:3 Eicosatrienoic 0.275 NA <LOQ <LOQ <LOQ <LOQ <LOQ 20:4 Arachidonic 0.465 NA <LOQ <LOQ <LOQ <LOQ <LOQ 22:0 Behenic ND-0.5 (0.044^) 0.136 0.088 (0.093, 0.213) 0.076 (0.887, 0.957) 0.086 (0.011®, 0.054) 0.108 (0.023®, 0.077)

Results converted from units of % dry weight to % fatty acids.

Combined range.

Overall treatment effect estimated using an F-test.

Comparison of the transgenic treatments to the control using t-tests. P-values adjusted using a False Discovery Rate (FDR) procedure. NA= statistical analysis was not performed since a majority of the data was < LOQ. Statistical difference indicated by P-Value <0.05.

Example 6.6.6. Vitamin Analysis of Grain 10 The levels of vitamin A, Bl, B2, B5, B6, B12, C, D, E, niacin, and folic acid in com grain samples from the control, unsprayed aad-l, aad-l + quizalofop, aad-\ + 2,4-D and aad-\ + both com entries were determined. A summary of the results across all locations is shown in Table 21. Vitamins B12, D and E were not quantifiable by the analytical methods used. All mean results reported for vitamins were similar to reported literature values, when available. 15 Results for the vitamins without reported literature ranges (vitamins B5 and C) were similar to control values obtained (< 22% difference from control). For the across-site analysis, no statistical differences were observed, with the exception of vitamins B1, C and niacin. 83 Ο (Ν > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν

Significant paired t-tests for Vitamins B1 were observed between the control and unsprayed aad-1, aad-\ + quizalofop, and aad-\ + both, but were not accompanied by significant overall treatment effects or FDR adjusted p-values. For vitamin C, a significant overall treatment effect was observed along with significant paired t-tests and FDR adjusted p-values for aad-\ + quizalofop and aad-l + 2,4-D. Similarly for niacin, a significant overall treatment effect was observed along with significant paired t-tests and FDR adjusted p-values for aad-\ + quizalofop and aad-\ + both. A significant paired t-test for the aad-\ + 2,4-D was also found for niacin for the aad-\ + 2,4-D entry, but was not accompanied by a significant overall treatment effect or FDR adjusted p-value. Since the differences were not observed across sites and values were within literature ranges (when available), the differences are not considered biologically meaningful.

Table 21._Summary of Vitamin Analysis of Com Grain from All Sites.

Vitamins (mg/kg dry weight) Literature Values® Overall Treatment Effect (Pr>F)'’ Control Unsprayed (P-value, Adi. P)'* Sprayed Quizalofop (P-value, Adi. P) Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) Beta Carotene (Vitamin A) 0.19- 46.8 (0.649) 1.80 1.85 (0.372, 0.566) 1.80 (0.967, 0.983) 1.82 (0.770, 0.883) 1.87 (0.221, 0.376) Vitamin B1 (Thiamin) 1.3-40 (0.068) 3.47 3.63 (0.041^ 0.121) 3.67 (0.013^ 0.059) 3.54 (0.375, 0.567) 3.64 (0.032®, 0.100) Vitamin B2 (Riboflavin) 0.25-5.6 (0.803) 2.15 2.05 (0.443, 0.631) 2.08 (0.600, 0.756) 1.99 (0.227, 0.383) 2.07 (0.543, 0.708) Vitamin B5 (Pantothenic acid) NR^ (0.820) 5.28 5.17 (0.623, 0.766) 5.09 (0.391, 0.582) 5.29 (0.968, 0.983) 5.10 (0.424, 0.615) Vitamin B6 (Pyridoxine) 3.68- 11.3 (0.431) 6.52 6.57 (0.859, 0.938) 6.66 (0.652, 0.782) 6.66 (0.652, 0.782) 7.08 (0.088, 0.210) Vitamin B12 NR NA® <LOQ <LOQ <LOQ <LOQ <LOQ Vitamin C NR (0.018^") 22.4 21.2 (0.268, 0.429) 17.5 (0.005^ 0.028^") 18.0 (0.004^ 0.026^") 20.4 (0.068, 0.173) Vitamin D NR NA <LOQ <LOQ <LOQ <LOQ <LOQ

Combined range. ο (N > Ο Ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 20 84 Vitamin E (alpha Tocopherol) 1.5-68.7 (0.558) <LOQ <LOQ <EOQ <LOQ <LOQ Niacin (Nicotinic acid,Vit. B3) 9.3 - 70 (O.OIS^’) 26.1 24.2 (0.050, 0.140) 22.9 (0.002®, 0.017®) 23.7 (0.018®, 0.067) 22.9 (0.002®, 0.016®) Folic Acid 0.15-683 (0.881) 0.594 0.588 (0.779, 0.890) 0.574 (0.403, 0.592) 0.592 (0.931, 0.970) 0.597 (0.916, 0.970)

Overall treatment effect estimated using an F-test.

Comparison of the transgenic treatments to the control using t-tests. P-values adjusted using a False Discovery Rate (FDR) procedure.

Statistical difference indicated by P-Value <0.05. NR = not reported. NA= statistical analysis was not performed since a majority of the data was < LOQ.

Example 6.6.7. Anti-Nutrient and Secondary Metabolite Analysis of Grain

The secondary metabolite (coumaric acid, ferulic acid, furfural and inositol) and antinutrient (phytic acid, raffinose, and trypsin inhibitor) levels in com grain samples from the control, unsprayed aad-1, aad-1 + quizalofop, aad-l + 2,4-D and aad-l + both com entries were determined. A summary of the results across all locations is shown in Table 22 and 23. For the across-site analysis, all values were within literature ranges. No significant differences between the aad-l entries and the control entry results were observed in the across-site analysis for inositol and tr3φsin inhibitor. Results for furfural and raffinose were below the method’s limit of quantitation. Significant paired t-tests were observed for coumaric acid (unsprayed aad-l, aad-l + 2,4 -D and aad-l + both), and femlic acid {aad-l + quizalofop and aad-l + both). These differences were not accompanied by significant overall treatment effects or FDR adjusted p-values and were similar to the control (< 10% difference). A significant overall treatment effect, paired t-test, and FDR adjusted p-value was found for ph5dic acid (unsprayed aad-l). Since all results were within literature ranges and similar to the control (<11% difference), these differences are not considered to be biologically meaningful.

Table 22. Summary of Secondary Metabolite Analysis of Com Grain from All Sites. 25 10 15 inο (N> Ο Ο (Ν οο σ^ (Ν ΟΟ ιη (Ν ιηο (Ν 85 Secondary Metabolite (% dry weight) Literature Values^ Overall Treatment Effect (Pr>F)'’ Control Unsprayed (P-value,° Adi. P)" Sprayed Quizalofop (P-value, Adi. P) Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) Coumaric Acid 0.003- 0.058 (0.119) 0.021 0.020 (0.038®, 0.113) 0.020 (0.090, 0.211) 0.019 (0.022®, 0.074) 0.020 (0.029®, 0.091) Ferulic Acid 0.02- 0.389 (0.077) 0.208 0.199 (0.051, 0.141) 0.196 (0.010®, 0.051) 0.200 (0.080, 0.196) 0.197 (0.019®, 0.069) Furfural 0.0003- 0.0006 NA^ <LOQ <LOQ <LOQ <LOQ <LOQ Inositol 0.0089- 0.377 (0.734) 0.218 0.224 (0.548, 0.708) 0.218 (0.973, 0.984) 0.213 (0.612, 0.763) 0.211 (0.526, 0.708)

Combined range.

Overall treatment effect estimated using an F-test.

Comparison of the transgenic treatments to the control using t-tests. P-values adjusted using a False Discovery Rate (FDR) procedure.

Statistical difference indicated by P-Value <0.05. NA= statistical analysis was not performed since a majority of the data was < LOQ.

Table 23. Summary of Anti-Nutrient Analysis of Com Grain from All Sites.

Anti-Nutrient (% dry weight) Literature Values® Overall Treatment Effect (Pr>F)*’ Control Unsprayed (P-value, Adi. P)' Sprayed Quizalofop (P-value, Adi. P) Sprayed 2,4-D (P-value, Adi. P) Sprayed Both (P-value, Adi. P) Phytic Acid 0.II-I.57 (0.046®) 0.727 0.806 (0.003®, 0.020®) 0.767 (0.099, 0.224) 0.755 (0.245, 0.402) 0.761 (0.158, 0.304) Raffinose 0.02-0.32 NA*· <LOQ <LOQ <LOQ <LOQ <LOQ Trypsin Inhibitor (TIU/mg) I.09-7.I8 (0.742) 5.08 5.10 (0.954, 0.977) 4.87 (0.631, 0.770) 5.45 (0.387, 0.582) 5.18 (0.813, 0.911)

Combined range.

Overall treatment effect estimated using an F-test.

Comparison of the transgenic treatments to the control using t-tests. P-values adjusted using a False Discovery Rate (FDR) procedure.

Statistical difference indicated by P-Value <0.05. NA= statistical analysis was not performed since a majority of the data was < LOQ. ο (Ν > Ο ο (Ν (X) σ^ (Ν (X) ΙΟ (Ν ΙΟ Ο (Ν 86

Example 7 - Additional agronomic trials

Agronomic characteristics of com line 40278 compared to a near-isoline com line were evaluated across diverse environments. Treatments included 4 genetically distinct hybrids and their appropriate near-isoline control hybrids tested across a total of 21 locations.

The four test hybrids were medium to late maturity hybrids ranging from 99 to 113 day relative maturity. Experiment A tested event DAS-40278-9 in the genetic background Inbred C X BC3S1 conversion. This hybrid has a relative maturity of 109 days and was tested at 16 locations (Table 24). Experiment B tested the hybrid background Inbred E x BC3S1 conversion, a 113 day relative maturity hybrid. This hybrid was tested at 14 locations, using a slightly different set of locations than Experiment A (Table 24). Experiments C and D tested hybrid backgrounds BC2S1 conversion x Inbred D and BC2S1 conversion x Inbred F, respectively. Both of these hybrids have a 99 day relative maturity and were tested at the same 10 locations.

Table 24. Locations of agronomic trials

Location 2 A Lxpei 2B iment 2C 2D Atlantic, lA X X Fort Dodge, lA X X X X Huxley, lA X X X X Nora Springs, lA X Wyman, lA X X Lincoln, IL X Pontiac, IL X X X X Princeton, IL X X Seymour, IL X Shannon, IL X X X Viola, IL X X Bremen, IN X X X X Evansville, IN X Fowler, IN X X X X Mt. Vernon, IN X Olivia, MN X X Wayne, NE X X York, NE X X Arlington, WI X X X 87

Patteville, WI X X X Watertown, WI X X Η Ο (Ν > Ο Ο (Ν (X) σ^ (Ν (X) ΙΟ (Ν ΙΟ Ο (Ν 20 25

For each trial, a randomized complete block design was used with two replications per location and two row plots. Row length was 20 feet and each row was seeded at 34 seeds per row. Standard regional agronomic practices were used in the management of the trials.

Data were collected and analyzed for eight agronomic characteristics; plant height, ear height, stalk lodging, root lodging, final population, grain moisture, test weight, and yield. The parameters plant height and ear height provide information about the appearance of the hybrids. The agronomic characteristics of percent stalk lodging and root lodging determine the harvestability of a hybrid. Final population count measures seed quality and seasonal growing conditions that affect yield. Percent grain moisture at harvest defines the maturity of the hybrid, and yield (bushels/acre adjusted for moisture) and test weight (weight in pounds of a bushel of com adjusted to 15.5% moisture) describe the reproductive capability of the hybrid.

Analysis of variance was conducted across the field sites using a linear model. Entry and location were included in the model as fixed effects. Mixed models including location and location by entry as random effects were explored, but location by entry explained only a small portion of variance and its variance component was often not significantly different from zero. For stock and root lodging a logarithmic transformation was used to stabilize the variance, however means and ranges are reported on the original scale. Significant differences were declared at the 95% confidence level. The significance of an overall treatment effect was estimated using a t-test.

Results from these agronomic characterization trials can be found in Table 2. No statistically significant differences were found for any of the four 40278 hybrids compared to the isoline controls (at p<0.05) for the parameters of ear height, stalk lodging, root lodging, grain moisture, test weight, and yield. Final population count and plant height were statistically different in Experiments A and B, respectively, but similar differences were not seen in comparisons with the other 40278 hybrids tested. Some of the variation seen may be due to low levels of genetic variability remaining from the backcrossing of the DAS-40278-9 event into the Ο (N > Ο Ο (Ν 88 elite inbred lines. The overall range of values for the measured parameters are all within the range of values obtained for traditional com hybrids and would not lead to a conclusion of increased weediness. In summary, agronomic characterization data indicate that 40278 com is biologically equivalent to conventional com. 00 σ^

Table 25. Analysis of agronomic characteristics Experiment A Parameter (units) Treatment Mean Range P- value Min Max Plant Height (inches) AAD-1 96.31 94.00 99.00 0.6174 Control 95.41 95.00 98.00 Ear Height (inches) AAD-1 41.08 30.00 48.00 0.4538 Control 44.42 40.00 47.00 Stalk Lodging (%) AAD-1 3.64 0.00 27.70 0.2020 Control 2.49 0.00 28.57 Root Lodging (%) AAD-1 1.00 0.00 7.81 0.7658 Control 0.89 0.00 28.33 Final Population (plants/acre in lOOO’s) AAD-1 31.06 27.00 36.00 0.0230 Control 32.17 27.00 36.00 Grain Moisture (%) AAD-1 22.10 14.32 27.80 0.5132 Control 21.84 14.52 31.00 Test Weight (Ib/bushel) AAD-1 54.94 51.10 56.80 0.4123 Control 54.66 51.00 56.80 Yield (bushels/acre) AAD-1 193.50 138.85 229.38 0.9712 Control 187.05 99.87 256.72 (Ν οο (Ν Η Ο (Ν

10 Experiment B

Parameier (units) Treatment .Mean Range P-^alue .Min .Max Plant Height (inches) AAD-1 106.92 104.00 108.00 0.0178 Control 100.79 95.00 104.00 Ear Height (inches) AAD-1 51.75 49.00 50.00 0.1552 Control 45.63 38.00 50.00 Stalk Lodging (%) AAD-1 1.24 0.00 15.07 0.1513 Control 0.72 0.00 22.22 Root Lodging (%) AAD-1 0.64 0.00 6.15 0.2498 Control 0.40 0.00 9.09 Final Population (plants/acre in lOOO’s) AAD-1 31.30 26.00 37.00 0.4001 Control 30.98 25.00 35.00 Grain Moisture (%) AAD-1 23.71 14.34 28.70 0.9869 Ο (N> Οο (Ν 00 08 (Ν 00 (Ν ο (Ν 89 Control 23.72 13.39 31.10 Test Weight (Ib/bushel) AAD-1 56.96 50.90 59.50 0.2796 Control 56.67 52.00 60.10 Yield (bushels/acre) AAD-1 200.08 102.32 258.36 0.2031 Control 205.41 95.35 259.03 Ο (N> Οο (Ν 90

Table 25. (cont.) Analysis of agronomic characteristics Experiment C 00 σ^ (Ν 00 (Ν ο (Ν Parameter (units) rreatment Mean Range P-\alue Min Ma\ Plant Height (inches) AAD-1 95.92 94.00 96.00 0.1262 Control 90.92 90.00 90.00 Ear Height (inches) AAD-1 47.75 41.00 50.00 0.4630 Control 43.75 37.00 46.00 Stalk Eodging (%) AAD-1 6.74 0.00 27.47 0.4964 Control 5.46 0.00 28.12 Root Eodging (%) AAD-1 0.3512 0.00 7.58 0.8783 Control 0.3077 0.00 33.33 Einal Population (plants/acre in lOOO’s) AAD-1 32.78 29.00 36.00 0.0543 Control 31.68 24.00 35.00 Grain Moisture (%) AAD-1 19.09 13.33 25.90 0.5706 Control 19.36 13.66 26.50 Test Weight (Ib/bushel) AAD-1 54.62 42.10 58.80 0.1715 Control 55.14 52.80 58.40 Yield (bushels/acre) AAD-1 192.48 135.96 243.89 0.2218 Control 200.35 129.02 285.58

Experiment D

Parameter (units) I'reatment Mean Range P-\alue Min .Ma\ Stalk Eodging (%) AAD-1 7.29 0.00 9.26 0.4364 Control 4.17 0.00 39.06 Einal Population (plants/acre in lOOO’s) AAD-1 29.93 27.00 34.00 0.0571 Control 31.86 29.00 35.00 Grain Moisture (%) AAD-1 18.74 19.40 24.40 0.4716 Control 19.32 13.35 25.70 Test Weight (Ib/bushel) AAD-1 56.59 54.80 58.30 0.0992 Control 55.50 52.70 57.40 Yield (bushels/acre) AAD-1 203.55 196.51 240.17 0.7370 Control 199.82 118.56 264.11

Example 8 - Use of Com Event DAS-40278-9 Insertion Site for Targeted Integration 10

Consistent agronomic performance of the transgene of com event DAS-40278-9 over several generations under field conditions suggests that these identified regions around the com event DAS-40278-9 insertion site provide good genomic locations for the targeted integration of in ο (N > Ο ο (Ν 00 σ^ (Ν 00 ιη (Ν ιη ο (Ν 20 25 91 other transgenic genes of interest. Such targeted integration overcomes the problems with so-called “position effect,” and the risk of creating a mutation in the genome upon integration of the transgene into the host. Further advantages of such targeted integration include, but are not limited to, reducing the large number of transformation events that must be screened and tested before obtaining a transgenic plant that exhibits the desired level of transgene expression without also exhibiting abnormalities resulting from the inadvertent insertion of the transgene into an important locus in the host genome. Moreover, such targeted integration allows for stacking transgenes rendering the breeding of elite plant lines with both genes more efficient.

Using the disclosed teaching, a skilled person is able to target polynucleic acids of interest to the same insertion site on chromosome 2 as that in com event DAS-40278-9 or to a site in close proximity to the insertion site in com event DAS-40278-9. One such method is disclosed in International Patent Application No. W02008/021207, herein incorporated by reference in its entirety.

Briefly, up to 20 Kb of the genomic sequence flanking 5' to the insertion site and up to 20 Kb of the genomic sequence flanking 3' to the insertion site (portions of which are identified with reference to SEQ ID NO :29) are used to flank the gene or genes of interest that are intended to be inserted into a genomic location on chromosome 2 via homologous recombination. The gene or genes of interest can be placed exactly as in the com event DAS-40278-9 insertion site or can be placed anywhere within the 20 Kb regions around the com event DAS-40278-9 insertion sites to confer consistent level of transgene expression without detrimental effects on the plant. The DNA vectors containing the gene or genes of interest and flanking sequences can be delivered into plant cells via one of the several methods known to those skilled in the art, including but not limited to Agrobacterium-mQdiaiQd transformation. The insertion of the donor DNA vector into the com event DAS-40278-9 target site can be further enhanced by one of the several methods, including but not limited to the co-expression or up-regulation of recombination enhancing genes or down-regulation of endogenous recombination suppression genes. Furthermore, it is known in the art that double-stranded cleavage of specific sequences in the genome can be used to increase homologous recombination frequency, therefore insertion into the com event DAS-40278-9 insertion site and its flanking regions can be enhanced by ΙΟ ο (Ν > Ο ο (Ν (X) σ^ (Ν (X) ΙΟ (Ν ΙΟ Ο (Ν 20 25 30 92 expression of natural or designed sequenee-speeifie endonueleases for eleaving these sequenees. Thus, using the teaehing provided herein, any heterologous nueleie aeid ean be inserted on eom ehromosome 2 at a target site loeated between a 5’ moleeular marker diseussed in Example 4 and a 3' moleeular marker diseussed in Example 4, preferably within SEQ ID NO:29, and/or regions thereof as diseussed elsewhere herein.

Example 9 - Exeision of the vat Gene Expression Cassette from Com Event DAS-40278-9

The removal of a seleetable marker gene expression eassette is advantageous for targeted insertion into the genomie loei of eom event DAS-40278-9. The removal of the pat seleetable marker from eom event DAS-40278-9 allows for the re-use of the pat seleetable marker in targeted integration of polynueleie aeids into ehromosome 4 in subsequent generations of eom.

Using the disclosed teaching, a skilled person is able to excise polynueleie acids of interest from com event DAS-40278-9. One such method is disclosed in Provisional US Patent Application No. 61/297,628, herein incorporated by reference in its entirety.

Briefly, sequence-specific endonucleases such as zinc finger nucleases are designed which recognize, bind and cleave specific DNA sequences that flank a gene expression cassette.

The zinc finger nucleases are delivered into the plant cell by crossing a parent plant which contains transgenic zinc finger nuclease expression cassettes to a second parent plant which contains com event DAS-40278-9. The resulting progeny are grown to maturity and analyzed for the loss of the pat expression cassette via leaf painting with a herbicide which contains glufosinate. Progeny plants which are not resistant to the herbicide are confirmed molecularly and advanced for self-fertilization. The excision and removal of the pat expression cassette is molecularly confirmed in the progeny obtained from the self-fertilization. Using the teaching provided herein, any heterologous nucleic acid can be excised from com chromosome 2 at a target site located between a 5’ molecular marker and a 3' molecular marker as discussed in Example 4, preferably within SEQ ID NO:29 or the indicated regions thereof.

Example 10 - Resistance to brittlesnap Ο (N > Ο ο (Ν 00 σ^ (Ν 00 (Ν ο (Ν 25 30 93

Brittlesnap refers to breakage of com stalks by high winds following applications of growth regulator herbicides, usually during periods of fast growth. Mechanical '‘push'” tests, which use a bar to physically push the com to simulate damage due to high winds, Vv'ere perfonned on hybrid com containing event DAS-40278-9 and control plants not containing event DAS-40278-9. The treatments were completed at four different geographical locations and were repHcated four times (there was an exception for one trial which was only replicated three times).

The plots consisted of eight rows: four rows of each of the two hybrids, with two row'S containing event DAS-40278-9 and two row-s without the event. Each row was twenty feet in length. Corn plants w-ere growm to the V4 developnientai stage, and a commercial herbicide containing 2,4-D (Weedar 64, Nufami Inc., Burr Ridge, IL) was applied at rates of 1120 g ae/ha, 224 0 g ae/ha and 4480 g ae/ha . Seven days after application of the herbicide, a mechanical push test w'as performed. The mechanical push test tor brittlesnap consisted of pulling a 4-foot bar dow'u the two ro ws of corn, to simulate wind dan.iage. Height of the bar and speed of t.ravel were set to provide a low level of stalk breakage (10% or less) with untreated plants to e.n.sure a test severe enough to demonstrate a difference between treatments, 'fhe directionality of the brittlesnap treatment was applied against leaning com. IVvO of the trial locations experienced high winds and thunderstorms 2-3 days after application of the 2,4-D herbicide. On twx> consecutive days, a thundersiomi commenced in Huxley lA, Wind speeds of 2 to 17 m s ' with high speeds of 33 m s'^ were reported at the site of the field plot. The wind direction 'was variabie. On one day, a thunderstorm was reported in Lanesboro MN. Winds of high velocity vvere reported at the site of this field plot. In addition, both sionns produced rain. The combination of rain and wind attributed to the reported brittlesnap damage.

Assessments of the brittlesnap damage which resulted from the mechanical push test (and inclement weather) were made I13/ visually rating the percentage of injur/. Prior to the mechanical brittlesnap bar treatment, plant stand counts were made fior the hybrid com containing event DAS-40278-9 and controls. Several days after the brittlesnap bar treatment the plot stand eounts were reassessed. The pereentage of leaning and pereentage of redueed stand within the plot was determined (Table 26). The data from the trials demonstrated that hybrid eom eontaining event DAS-40278-9 has less propensity for brittlesnap as eompared to the null ΙΟο (Ν> Ο Ο (Ν 94 plants following an application of 2,4-D.

OO OS (N OO UD (N UD O (N

Table 26; DAS-40278-9 Com Brittlesnap Tolerance to V4 Application of 2,4-D Amine. The percentage of brittlesnap was calculated for hybrid corn plants containing event DAS-40278-9 Before Mechamcal Snapping Mean Yo [.meaning 7-8 Days After Application^ IVeatiKeni 278 (SLBOl-278/74XP8!iXIR) Nall (Si.B0i//4XPSnXTR) 278 (SLBOIVX-278//ΒΕ«>5ίδΧΤ) NitI} (SLB01VX/7BE9 S15XT) Weedat 64 IDOKae/t-a 0% 3S% 0% 33%o Wcedar 64 2240 g ae/lia 1% 0% 3-7 /0 Wc-eda·· 64 4480 g ae/ha 2% 5.6% ]% 46% Untreated 0% 0% 0¾) U /0 .After Mechanical Snaj M^ean'^ Yo Lemm^ 11-14 Days .41 )ping ter Application Treatment 278 (SLBOU 278//4XP§11.X;TR) NuI5 (Si.;B01//4X;P81IXTR) 278 (SI.B01VX-278.-7ΕΙ];95ί5ΧΙ·) NmB (SI.B0tVX//BE Weedar 64 1120 g ae/ha 0% 19% 1% 24% Weedar 64 2240 g ae/ha 4% 20% 7%. 27% Weedar 64 4480 g ae/lia 4·% 26% 6Y; 28%) Untreated 0% 0% OYi 0% After Mechanical Snapping Mean’ % Stand Reduction 11-14 Days After Application Treatment 278 (SLBOU 278//4XP811XTR) Nall (S:i..B0i//4XP81tXTR) 278 (SUBOIXTC-278.-7BI];9515XI·) NkH (SLBOtVX//BE 95Ϊ5ΧΤ) Weedar 64 1120g ae/lta 3% 38%) 6% 42% Weedar 64 2240 g ae/ha 9% 35% 12% 41 % Weeda·' 64 4480 g: ae/ha'' 9% 40% 16%o 40‘'Vo Untreated 0% 0% 0% 0% ^ Thunderstorm and high winds occurred 2-3 days after application in two trials ^ Treatments replicated four times in a randomized complete block design (one trial was only ο (N > Ο ο (Ν 00 σ^ (Ν 00 ΙΟ (Ν Ο (Ν 20 95 completed for three replications) ^ Means corrected for occurrences in untreated (untreated means forced to zero)

Example 11 - Protein Analysis of Grain

Grain with increased total protein content was produced from hybrid com containing event DAS-40278-9 as compared to control plants not containing the event. Two consecutive multisite field trails were conducted that included non-sprayed and herbicide-treatments with three different herbicide combinations. In 7 of the 8 statistical comparisons, the DAS-40278-9 event produced grain with significantly higher total protein content (Table 27). This data is corroborated by analyses of individual amino acids.

Example 12 - Additional Agronomic Trials

Table 27: Protein content of grain from multisite field trials 2008 Field Season Non- transgenic Near-iosline Event DAS- 40278-9 unsprayed Event DAS- 40278-9 quizalofop Event DAS- 40278-9 2,4-D Event DAS-40278-9 quizalofop and 2,4-D Mean 9.97 10.9 11.1 10.5 10.9 % increase over isoline 0 9.3 11.3 5.3 9.3 Paired t-test NA 0.002 0.0004 0.061 0.002 2008 Field Season Non- transgenic Near-iosline Event DAS- 40278-9 unsprayed Event DAS- 40278-9 quizalofop Event DAS- 40278-9 2,4-D Event DAS-40278-9 quizalofop and 2,4-D Mean 10.9 11.6 11.7 11.7 11.5 % increase over isoline 0 6.4 7.3 7.2 5.5 Paired t-test NA 0.0048 0.001 0.0012 0.0079 Ο (N > Ο Ο (Ν οο σ^ (Ν ΟΟ ΙΟ (Ν ΙΟ Ο (Ν 96

Agronomic characteristics of hybrid com containing event DAS-40278-9 compared to nearisoline com were collected from multiple field trials across diverse geographic environments for a growing season. The data were collected and analyzed for agronomic characteristics as described in Example 7. The results for hybrid com lines containing event DAS-40278-9 as compared to null plants are listed in Table 28. Additionally, agronomic characteristics for the hybrid com lines containing event DAS-40278-9 and null plants sprayed with the herbicides quizalofop (280 g ae/ha) at the V3 stage of development and 2,4-D (2,240 g ae/ha) sprayed at the V6 stage of development are described in Table 29.

Table 28: yield, percent moisture, and final population results for hybrid com containing event DAS-

Name Yield Grain Moisture (%) Final Population (plants/acre reported in lOOO’s) Hybrid Com Containing DAS-40278-9 218.1 21.59 31.69 Control Hybrid Com 217.4 21.91 30.42

Table 29: yield, percent moisture, percentage stock lodging, percentage root lodging and total population for hybrid com lines containing event DAS-40278-9 as compared to the near-isoline control.

Trial Yield Grain Moisture (%) Stock Lodge (%) Root Lodge (%) Final Population (plants/acre reported in lOOO’s) Spray Trial Hybrid Com #1 Containing DAS-40278-9 214.9 23.4 0.61 2.19 30 Control Hybrid Com #1 177.9 23.46 0.97 36.32 28.36 LSD (0.5) 13.3 1.107 0.89 10.7 1.1 Non Spray Hybrid Com #1 Containing DAS-40278-9 219.6 22.3 0.95 1.78 30.8 Control Hybrid Com #1 220.3 22.51 0.54 1.52 30.55 Ο (N> Οο (Ν 00 σ^ (Ν 00 (Νο (Ν 97 LSD (0.5) 6.9 0.358 0.98 1.65 0.7 Spray Trial Hybrid Com #2 Containing DAS-40278-9 198.6 26.76 0.38 2.08 29.29 Control Hybrid Com #2 172.3 23.76 1.5 39.16 28.86 LSD (0.5) 13.3 1.107 0.89 10.7 1.1 Non Spray Hybrid Com #2 Containing DAS-40278-9 207.8 24.34 0.22 0.59 31 Control Hybrid Com #2 206.2 24.88 0.35 0.12 30.94 LSD (0.5) 8.0 0.645 0.55 1.79 0.9

Claims (8)

1. A method of controlling weeds, said method comprising applying an aryloxy alkanoate herbicide to a field, wherein said field comprises a transgenic com plant comprising a genome, said genome comprising SEQ ID NO:29.

2. The method of claim 1, wherein said herbicide comprises 2,4-dichlorophenoxyacetic acid (2,4-D) or a aryloxyphenoxypropionate herbicide or a combination thereof.

3. The method of claim 1 or 2, wherein said herbicide is quizalofop, quizalofop and 2,4-dichlorophenoxyacetic acid (2,4-D), or phenoxy auxin.

4. The method of any one of claims 1-3, wherein said transgenic corn plant comprises AAD-1 event DAS-40278-9 as presented in seed deposited with American Type Culture Collection (ATCC) under Accession No. PTA-10244.

5. The method of any one of claims 1-4, wherein the transgenic com plant has further resistance to one or more additional herbicides.

6. The method of claim 5, wherein said one or more additional herbicides are selected from the group consisting of glyphosate, glufosinate, acetolaetate synthase (ALS)-inhibiting herbicide, imidazolinones, imazethapyr, sulfonylureas, triazolopyrimidine sulfonanilide, pyrmidinylthiobenzoates, bromoxynil, inhibitors of HPPD (4-hydroxlphenyl-pyruvate-dioxygenase) enzyme, inhibitors of phytoene desaturase (PDS), photosystem II inhibiting herbicides, resistance to photosystem I inhibiting herbicides, resistance to protoporphyrinogen oxidase IX (PPO)-inhibiting herbicides, phenylurea herbicides, and dicamba.

7. The method of any one of claims 1-6, wherein the method further comprises applying to said field comprising said transgenic com plant, one or more of the additional herbicides to which the plant has further resistance.

8. A method of controlling glyphosate-resistant weeds in an area comprising at least one transgenic com plant, wherein said transgenic com plant comprises a genome, said genome comprising SEQ ID NO:29, wherein said transgenic com plant further comprises a glyphosate tolerance trait, and said method comprises applying an aryloxyalkanoate herbicide to at least a portion of said area.