AU2015205821A1 - Albumin variants - Google Patents

Abstract

The present invention relates to variants of a parent albumin having altered plasma half-life compared with the parent albumin. The present invention also relates to fusion polypeptides and conjugates comprising said variant albumin.

Description

ALBUMIN VARIANTS The present application is a divisional application of Australian Application No. 2010311332, which is incorporated in its entirety herein by reference. 5 Reference to a Sequence Listing This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference. 0 Background of the Invention Field of the Invention The present invention relates to variants of albumin or fragments thereof or fusion polypeptides comprising variant albumin or fragments thereof having a change in half-life compared to the albumin, fragment thereof or fusion polypeptide comprising albumin or a fragment thereof. 5 Any discussion of the prior art throughout the specification should in no way be considered as an admission that such prior art is widely known or forms part of common general knowledge in the field. Description of the Related Art 0 Albumin is a protein naturally found in the blood plasma of mammals where it is the most abundant protein. It has important roles in maintaining the desired osmotic pressure of the blood and also in transport of various substances in the blood stream. Albumins have been characterized from many species including human, pig, mouse, rat, rabbit and goat and they share a high degree of sequence and structural homology. 25 Albumin binds in vivo to its receptor, the neonatal Fc receptor (FcRn) "Brambell" and this interaction is known to be important for the plasma half-life of albumin. FcRn is a membrane bound protein, expressed in many cell and tissue types. FcRn has been found to salvage albumin from intracellular degradation (Roopenian D. C. and Akilesh, S. (2007), Nat. Rev. Immunol7, 715-725.). FcRn is a bifunctional molecule that contributes to maintaining a high level of IgGs and albumin in 30 serum in mammals such as human beings. Whilst the FcRn-immunoglobulin (IgG) interaction has been characterized in the prior art, the FcRn-albumin interaction is less well characterized. The major FcRn binding site is localized within DIII (381-585). Andersen et al(2010). Clinical Biochemistry 43,367-372. Data indicates that IgG and albumin bind non-cooperatively to distinct sites on FcRn (Andersen et al. (2006), Eur. J. 35 Immunol 36, 3044-3051; Chaudhury et al. (2006), Biochemistry 45, 4983-4990.). 1 It is known that mouse FcRn binds IgG from mice and humans whereas human FcRn appears to be more discriminating (Ober et aL (2001) Int. Immunol13, 1551-1559). Andersen et al (2010). Journal of Biological Chemistry 285(7):4826-36, describes the affinity of human and mouse FcRn for each mouse and human albumin (all possible combinations). No binding of albumin from 5 either species was observed at physiological pH to either receptor. At acidic pH, a 100-fold 1a difference in bin ding affinity was observed, in all cases, binding of albumin and IgG from either species to both receptors were additive. Human serum albunin (HSA) has been well characterized as a polypeptide of 585 amino acids the sequence of which can be found in Peters T- Jr (1996) Adl about Albumin: Biochemistry; Genetics and Medicat Applicaions pp10, Academic Press, Inc,, Orlando (ISBN 0-1 2521 10-3) It has a characteristic binding to its receptor FcRn, where it binds at pH 6.0 but not at pH 7. The plasma half-ife of HSA has been found to be approximately 19 days A natural variant having lower plasma half-life has been identified (Peach. R, J, and Brennan, S. 0(1991) Biochim Biophys AcaO097:49-54) having the substitution 0494N. This substitution generated an N glycosylation site in this variant, which is not present in the wild-type albumin. It is not known whether the glycosylation or the amino acid change is responsible for the change in plasma half life. Albumin has a long plasma half-ife and because of this property it has been suggested for use ir drug delivery. Albumir has been conjugated to pharmaceutically beneficial compounds (WO 2000/69902A), and it was found that the conjugate - maintained the long plasma half-ife of albumin. The resulting plasma half-life of the conjugate was general considerably longer than the plasma half-ife of the beneficial therapeutic compound alone. Further, albumin has been fused to therapeutically beneficial peptides (WO 200109271 A and WO 2003/59934 A) with the typical result that the fusion has the activity of the therapeutically beneficial peptide and a considerably longer plasma half-life than the plasma half-life of the therapeuticaly beneficial peptides alone Otagiri et a? (2009), Biol, Pharm. Bull. 32(4), 527-534, discloses that 77 albumin variant are know, of these 25 are found in domain IL. A natural variant lacking the last 1'75 amino acids at the carboxy termini has been shown to have reduced half-life (Andersen ei at (2010), Clinical Biochemistry 43. 367-372). lwao et a9(2007) studied the halff--ife of naturally accuring human albumin variants using a mouse model, and found that K541E and K560E had reduced half-life, E501K and E570K had increased half-life and Ka573E had almost no effect on half-life (Iwao et a. (2007) BB A. Proteins and Proteomics 1774, 1582-1590) Galliano et al (1993) Biochim. Biophys.Acta 1225 27-32 discloses a natural variant E505K, Minchiotti et al.(1990) discloses a natural variant K536E, Minchiotti et at (1987) Biochim Biophys. Acta 916, 411 -418 discloses a natural variant K574N. Takahashi et a (1987) Proc. Natt Acad. Sci. USA 84, 44134417, disposes a natural variant D5500 Carlson f a (1992) Proc.Nat.AcadSci USA 89, 8225- 8229disoses a natural variant 0550A. Albumin has the ability to bind a number of ligands and these become associated (associates) with albumin, This property has been utilized to extend the plasma half-life of drugs 2 having the ability to noncovalently bind to albumin. This can also be achieved by binding a pharmaceutical beneficial compound, which has little or no albumin binding properties, to a moiety having albumin binding properties. See review article and reference therein, Kratz (2008), Journal of Controled Release 132. 17138. Albumin is used in preparations of pharmaceutically beneficial compoundsin which such a preparation maybe for example, but not limited to. a nano particle or micro particle of albumin, In these examples the delivery of a pharmaceuticaly beneficial compound or mixture of compounds may benefit from alteration in the albumins affinity to its receptor where the beneficial compound has been shown to associate with albumin for the means of delivery. It is not clear what determines the plasma half-life of the formed associates (for example but not limitited to Levemir@ Kurtzhals P ef al Biochem. J. 1995 312,725-731) conjugats or fusion polypeptides but it appears to be a result of the combination of the albumin and the selected pharmaceutically beneficial compound/polypeptide. it would be desirable to be able to control the plasma halflife of given albumin conjugates associates or albumin fusion polypeptides so that a longer or shorter plasma halflife can be achieved than given by the components of the association, conjugation or fusion, in order to be able to design a particular drug according to the particulars of the indication intended to be treated. Albumin is known to accumulate and be catabolised in tumours, it has also been shown to accumulate in inflamed joints of rheumatoid arthritis sufferers, See review artide and reference therein Kratz (2008), Joumal of Controlled Release 132, 171183, It is envisaced that HSA vagrants with increased affinity for FcRn would be advantageous for the delivery of pharmaceutically beneficial compounds. It may even be desirable to have variants of albumin that have little or no binding to FcRn in order to provide shorter half-lives or controlled serum pharmacokinetics as described by Kenanova et at (2009) J. NucIMac 50 (Supplement 2):1582) Summary of the Invention The present invention provides variants of a parent albumin with improved properties compared to its parent. in particular the invention provides variants of a parent albumin having altered plasma haiflife compare to its parent The present invention relates to isolated variants of alburnin or fragments thereof, or fusion polypeptides comparing variant albumin or fragments thereof, of a parent albumin, comprising an liberation at one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503 504, 505, 506, 510, 535, 536, 537-538, 5401 541. 542, 550, 573, 574, 575, 577, 578, 579, 580, 581, 582 and 584 of the mature polypeptide of SEQ ID 3 NO: 2, wherein the variant is not the variant consisting of SEQ ID NO: 2 with the substitution D494N, E501K, K541E, D550GA, K573E or K574N. The alteration at one or more position may independently be selected among substitutions, insertions and deletions where substitution are preferred. The present invention also relates to isolated polynucleotides encoding the variants nucleic acid constructs, vectors, and host cells comprising the polynucleotides and methods of producing the vanants The present invention also relates to conjugates or associates comprising the variant albumin or fragment thereof according to the invention and a beneficial therapeutic moiety or to a fusion polypeptide comprising a variant albumin or fragment thereof of the invention and a fusion partner polypeptide. The invention further relates to compositions comprising the variant albumir fragment thereof, fusion polypeptide comprising variant albumin or fragment thereof or conjugates comprising the variant albumin or fragment thereof, according to the invention or associates comprising the variant albumin or fragment thereof, according to the invention. The compositions are preferably pharmaceutical compositions. The invention further relates to a pharmaceutical composition comprising a variant albumin, fragment thereof, fusion polypeptide comprising variant albumin or fragment thereof or conjugates comprising the variant albumin or fragment thereof, or associates comprising the variant alibumin or fragment thereof, wherein said variant albumin, fragment thereof, fusion polypeptide comprising variant albumin or fragment thereof or conjugates comprising the variant albumin or fragment or associates of variant albumin or fragment thereof has altered plasma half-life compared to the corresponding plasma half-life of the HSA or fragment thereof, fusion polypeptide comprising HSA or fragment thereof or conjugates or associates of HSA or, fragment thereof, comprising HSA or fragment thereof, Brief Description of the Figures Figure 1 shows a restriction map of the expression plasmid pDB4082, Figure 2 shows a restriction map of the expression plasmid pDB2305 Figure 3 showsa restriction map of the expression plasmid pDB4005 Figure 4 shows SPR sensorgrams 10 pM albumin injected over shFcRn HSA (JTA) fatty acid free HSA obtained from Sigma-Aldrich (A3782) HSA (Novozymes) Commercial Recombinant human serum albumin (RECOMBUMIN). Figure 5 shows ELISA binding of shFoRn-GST to human serum albumin (HSA) variants (100- .045 gg/ml Binding of WT, D494N, D494Q and D494A pH 6.0 and pH 74, Binding of WT 4 D494N. D494N/T496A and T496A at pH 6,0 and pH 7A Binding of WT, E495Q and E495A at pH 6.0 and pH 74. Figure 6 shows representative sensorgrams of binding of 0.2 pM of HSA variants to immobilized shFcRrn (-4600 RU) WT, D494N, D494Q D494A, D494N1T496A and T49A, Figure 7 shows representative sensorgrams of binding of 1 pM of HSA varants to immobilized shFcRn ( 1400 RU). WT, D494N D4940, D494A D494N/T496A and T496A. Figure 8 shows relative binding of the HSA variants compared to WT based on two independent SPR experiments as shown (A) Figure 6 and (B) Figure 7. Figure 9 shows EUSA: (A) binding of shFcRn to albumins from human, donkey, bovine, sheep, goat and rabbit at pH 60, (B) binding of shFcRn to albumin from guinea pig, hamster, rat and chicken at pH 6.0 (C) binding of shFoRn to albumin from human donkey, bovine, sheep, goat and rabbit at pH 7.4. (D) binding of shFcRn to albumin from guinea pig, hamster, rat and chicken at pH 4 (E) relative binding of the different albumins. Relative binding of human albumin to shFoRn is defined as 1.0. The ELISA values represent the mean of duplicates. Figure 10 shows SPR: Binding of shFtRn-GST to albumin from several species at pH 6.0 and pH 7 Representative sensorgrams showing binding of 5,0 .M of alburin from different species, (A) human, (B) donkey, (C) bovine, (D) goat, (E) sheep, (F) rabbit, (G) dog, (H) guinea pig, (I) hamster (J) rat. (K) mouse and (L) chicken, The albumin variants were injected over immobilized GST-tagged shFcRn (-2100 RU), Injections were performed at 25&C at a rate of 40 iuI/mi n. Figure 11 shows SPR sensorgrams of selected HSA mutants compared with wild-type HSA, 20 pM of (A) WT and P499A (B) WT and K500A (C) WT and K536A, (D) WT and P537A and (E) WT and K538A and (F) WT and K%'37A were injected over immobilized shFcRn at pH 6.0 (-1500 RU) Figure 12 shows SPR sensorgrams of HSA mutants compared with WT HSA 10 pM of (A) WT and K573A (B) WT and K5730, (C.) WT and K573F, (D) WT and K573G and (E) WT and K573L and (F)WT and K573M, (G) WT and K573O, (H) WT and K573R and (i) WT and K573T and (J) WT and K573V injected over immobilized shFcRn at pH 5.5 and pH7,. Injections were performed at 25<-0 at a flow rate of 80 plImin, Figure 13 shows SPR sensorgramEs of HSA mutants compared with wild-type HSA, 10 pM of (A) WT and K573D (B) WT and K573E, (C) WT and K573H, (D) WT and K(5731 and (E) WT and K573N and (F) WT and K573P, (G) WT and KS73S and WT and K573* and (i) WT and K573W and (J) WT and K573Y injected over immobilized shFcRn at pH 5.5 and pH74., Injiections were performed at 25"O at a flow rate of 80 p1min, Figure 14 shows SPR sensorgrams of HSA mutants compared with wilkdtype HSA. 20 pM of (A) WT and E492G+K38H+K541N+&E642D (B) WT and E492T+N503K+K541A, (C) WT and E492P+N503K+K541G+E542P, (D) WT and E492H+E501P+N503H+E505D +T506S+T540S+K 541 E and (E) WT and A490D+E492T+V493L+E501P+N503D+A504E +E505K-T506F+K541D and (F) WT and E492G+V493'+K538H+K541N+E542D injected over immobilized shFcRn at pH 6,0, Injections were performed at 25C" at a flow rate of 80 plmin, Figure 15 shows SPR sensorgrams of HSA mutants compared with wild-type HSA Twenty pM of (A) WI, (B) H4400, (C) H464Q and (D) H6350 injected over wnmobiied shFcRn at pH 60. injections were performed at 25*C at a flow rate of 80 plmin, Figure 16 shows SPR sensorgrams of HSA mutant K500E compared with wild-type HSA. Ten pM of HSA mutant K500E injected over immobilized shFcRn at pH 575. injections were performed at 25" at a flow rate of 30 pl/mm. Figure 17 shows a restriction map of the expression plasmid pDB3017 Figure 18 shows a restriction map of the expression piasnid pDB3021 Figure 19 shows a restriction map of the expression plasmid pDB3056 Figure 20 shows a restriction map of the expression plasmid pDB3166 Figure 21 shows a restriction map of the expression plasmid pDS4172 Figure 22 shows a restriction map of the expression plasmid pDB 4 267 Figure 23 shows a restriction map of the expression plasmid pDB 4 2 85 Figure 24 shows a GP-HPLC chromatogram of WT HSA and mutant K573P HRP conjugates for shFcRn analysis. Injections of 25pL were made onto a TSK G3000SWXL column (Tosob Bioscience) as described in materials and methods, Figure 25 shows SDS PAGE separation followed by both visual (A) and ultraviolet (B) detection of the Fluorescein conjugated albumin. HSAuFSM (Lane 1), K573PxF5M (Lane 2) and rHA standard (Lane 3). Figure 26 shows shFcRn binding properties of HSA variants, 10pM of WT rHA and E492T(A), WT rHA and D494N/E4950/T496A(B) WT rHA and N5030(C) WT rHA and N503K(D) W T rHA and E492T/N50D(El WT HA and E495Q/T496A(F). WT rHA and K58H(G) WT rHA and E492D(H) injected over immobilized shFcRn at pH5.5 Figure 27 shows shFcRn binding properties of HSA variants 10pM of WT rHA and K541A(l) and WT rHA and K541N(J) were injected over immobilsed shFcRn at pH5SL6 Figure 28 shows competitive binding of K573A and K573P measured by injecting shhcRn (100 nM) alone opre-incubated with different amounts of HSA K573A and KS73P over immobilized HSA (-2500 RU) at pHG.O 63 Figure 29 shows competitive binding of HSA-FLAG variants measured by injecting shFcRn (100 nM) alone or together with different amounts of HSA-FLAG variants over immobilized HSA (-2500 RU) at pH6,0. Figure 30 shows competitive binding of HSAI1 Ra variants measured by injecting shFcRn (100 nM) alone or together with different amounts of HSAL1Ra variants over immobilzed HSA (-2500 RU) at pH6O0 Figure 31 shows competitive binding of scFv4used HSA variants measured by injecting shFcRn (100 nM) alone or together with different amounts of (A) scFv-HSA-FLAG variants or (B) HSA-scFv-FLAG variants over immobilized HSA (-2500 RU) at pH60. Figure 32 shows binding of HSA, single, double and triple mutant variants to shFcRn, Samples of 10 pM of each HSA variant were injected over immobilized shFcRnat pH 5.5 or pH 7A4 Detailed Description of the Invention The present invention relates to isolated variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof. of a parent albumin, comprising an alteration at one or more (several) positions corresponding to positions 417, 440, 4641 490, 492, 493 494 495, 496t 499, 50 , 503 504. 50506 510 535, 536 537, 53, 540 541 542 550, 573, 574, 575 5, 578, 579, 580. 581, 582 and 584 of the mature polypeptide of SEQ ID NO; 2. wherein the variant is not the variant consisting of SEQ ID NO: 2 4th the substitution D494N, E501K, K541E, D550GA, K573E or K574N-. The alteration at one or more position may independently be selected among substitutions, insertions and deletions where substitution are preferred. Definitions Variant: The term "variant" means aolypeptide derived from a parent albumin by one or more alteration(s), i.e. a substitutilon insertion, and/or deletion, at one or more (several) positions. A substitution means a replacement of an amino acid occupying a position with a different amino acid; a deletion means removal of an amino acid occupying a position; and an insertion means adding I or more, preferably 1-3 amino acds immediately adjacent to an amino acid occupying a * position. Mutant: The term "mutant"means a polynucleotide encoding a variant. Wild-Type Albumin; The term "wild4ype' (WT) albumin means albumin having the same amino acid sequence as naturally found in an animal or in a human being, Parent or Parent albumin The term "parent" or "parent albumin' means an albumin to which an alteration is made by the hand of man to produce the albumin variants of the present .7 invention. The parent may be a naturally occurring (wild-type) polypeptide or an allele thereof, or even a variant thereof, FcRn and shFcRn: The term "FcRn" means the human neonatal Fe receptor (FcRn), shFcRn is a soluble recombinant form of FcRn, smFcRn: The term "smFcRn" is a soluble recombinant form cf the mouse neonatal Fe Receptor. Isolated variant The term "isolated variant" means a vacant that is modified by the hand of man and separated completely or partially from at least one component with which it naturally occurs. In one aspect, the variant is at Ieast 1% pure, et.gat least 5% pure at least 10% pure, at least 20% pure, at least 40% pure, at least 60% pure, at least 80% pure, and at least 90% pure, as determined by SDS-PAGE or GPHPLC Substantially pure variant: The term "substantially pure variant" means a preparation that contains at most 10%, at most 8% at most 6%, at most 5% at most 4% at most 3%, at most 2%, at most 1%, and at most 0.5% by weight of other polypeptide material with which it is natively or recombinantly associated, Preferably, the variant is at least 92% pure, e g at least 94% pure, at least 95% pure, at least 96% pure, at least 97% pure, at least 98% pure, at least 99% at least 995% pure, and 100% pure by weight of the total polypeptide material present in the preparation. The variants of the present invention are preferably in a substantially pure form, This can be accomplished, for example, by preparing the variant by well known recombinant methods and by purification methods Mature polypeptide: The term "mature polypeptide" means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation. phosphordation, etc. in one aspect, the mature polypeptide is arnino acids I to 585 of SEQ ID NO: 2, with the inclusion of any post-translational modifications. Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide that encodes a mature albumin polypeptide In one aspect, the mature polypeptide coding sequence is nucleotides I to 1758 of SEQ ID NO: 1 Sequence Identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter 'sequence identity". For purposes of the present invention, the degreof sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, MoJ, Biol 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice t at. 2000- Trends Genet. 16: 276-277), preferably version 30.0 or later, The optional parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) 8 substitution matrx The output of Needle labelled longest identity" obtainedd using the -nobrief option) is used as the percent identity and is calculated as follows: (Identical Residues x 100)/(Length of Alignment - Total Number of Gaps in Alignment) For purposes of the present invention, the degree of sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, spra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite Rice et at, 2000, supra); preferably version3,00 or later. The optional parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled longest identity" (obtained using the -obrief option) is used as the percent identity and is calculated as follows: (Identical Deoxyribonucleotides x I 00)(Length of Alignment - Total Number of Gaps in Alignment) Fragment The term fragment" means a polypeptide having one or more (several) amino acids deleted from the amino and/or carboxyl terminus of an albumin arnd/or an internal region of albumin that has retained the ability to bind to FcRn, Fragments may consist of one uninterrupted sequence derived from HSA or it may comprise two or more sequences derived from HSA. The fragments according to the invention have a size of more than approximately 20 amino acid residues preferably more than 30 amino acid residues, more preferred more than 40 amino acid residues, more preferred more than 50 amino acid residues, more preferred more than 75 amino acid residues, more preferred more than 100 amino acid residues, more preferred more than 200 amino acid residues, more preferred more than 300 amino acid residues even more preferred more than 400 amino acid rmesidues and most preferred more than 500 amino acid residues, Ailelic variant: The term "ailelic variant" means any of two or more alternative forms of a gene occupying the same chromosomal locus, Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptde) or may encode polypeptides having altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene. Coding sequence The term "coding sequence" means polynucleotidehich directly specifies the amino acid sequence of its translated polypeptide product, The boundaries of the coding sequence are generally dzeemiined by an open reading frame which usually begins with the ATG start codon or alternative start codons such as GTG and TTG and ends with a stop codon such as TA, TAG, and TGA The coding sequence may be a DNA. cDNA. synthetic, or recombinant polynuclcotide. eDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obttained from a eukaryotic cell. cDNA lacks 9 intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA that is processed Through a series of steps; including splicing before appearing as mature spliced mRNA. Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic. The term nucleic acid construct is synonymous with the term expression cassette when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present invention. Control sequences: The term "control sequences' means all components necessary for the expression of a polynucleotide encoding a variant of the present invention. Each control sequence may be native or foreign to the polynucleotide encoding the variant or native or foreign to each other. Such control sequences include, but are not imited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator At a minimum the control sequences include a promoterand transcriptional and traniaiona stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences within the coding region of the polynucleotide encoding a variant. Operably linked: The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynuleotide such that the control sequence directs the expression of the coding sequence. Expression: The term "expression" includes any step involved in the production of the variant including, but not limited to, transcription, post-transcriptional modification, translation. post translationalmodifcation, and secretion. Expression vector: The term "expression vector' means a linear or circular DNA molecule that comprises a polynucleodde encoding a variant and is operably linked to additional nucleotides that provide for its expression. Host cell: The term "host cell* means any cell type that is susceptible to transformation, transfection, transduction, and the like with a nucle acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. Plasma half-life: Plasma half-life is ideally determined in vivo in suitable indvduais; However, since it is time consuming and expensive and there inevitable are ethical concems connected with doing experiments in animals or man it is desirable to use an in vftro assay f-or determining whether plasma half-life is extended or reduced, It is known that the binding of albumin '10 to its receptor FcRn is important for plasma half-ife and the correlation between receptor binding and plasma haif-ife is that a higher affinity of albumin to its receptor leads to longer plasma half-life, Thus for the present invention a higher affinity of albumin to FoRn is considered indicative of an increased plasma half-life and a lower affinity of albumin to its receptor is considered indicative of a reduced plasma half-life in this application and claims the binding of albumin to its receptor FcRn is described using the term affinity and the expressions stronger" or "weaker". Thus, it should be understood that a molecule having a higher affinity to FcRn than HSA is considered to bind stronger to FcRn than HSA and a molecule having a lower affinity to FcRn than HSA Is considered to bind weaker to FcRn than HSA. The terms "longer plasma half-life" or "shorter plasma half-life and similar expressions are understood to be in relationship to the corresponding parent albumin molecule. Thus, a longer plasma half-life with respect to a variant albumin of the invention means that the variant has longer plasma half-life than the corresponding albumin having the same sequences except for the ateration(s) in positions corresponding to 417 440 44, 490, 492, 493, 494 495, 496 499, 500" 501 503, 504 05 506 510, 535, 536, 53 7 53 40, 541, 542, 550 573 574, 575, 577 578 579, 580, 581, 582 and 584 in SEQ ID NO: 2. Conventions for Designation of Variants For purposes of the present invention, the mature polypeptide disclosed in SEQ ID NO:2 is used to determine the corresponding amino acid residue in another albumin. The amino acid sequence of another albumin is aligned with the mature polypeptide disclosed in SEQ ID NO: 2, and based on the alignment, the amino acid position number corresponding to any amino acid residue in the mature polypeptide disclosed in SEQ ID NO: 2 is determined using the Needleman Wunsch algorithm (Needleman and Wunsch, 1970, J Moi Biol 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS The European Molecular Biology Open Software Suite, Rice et aL 2000 ends Genet 16: 276-277), preferably version 3,0.0 or later, Identification of the corresponding amino acid residue in another albumin can be confirmed by an alignment of multiple polypeptide sequences using "ClustalW (Larkin at at, 2007, Bioinfonnaics 23: 2947-2948), When the other polypeptide (or protein) has diverged fnm the mature polypeptide of SEQ ID NO: 2 such that traditional sequence-based comparison fails to detect their relationship (Lindahi and Elofsson 2000, J Mot Blot 295: 613-615), other pairwise sequence comparison algorithms can be used, Greater sensitivity n sequence-based searching can be attained using search programs that utilize probabilistic representations of polypeptide families (profiles) to search 11 databases. For example, the PSkIBLAST program generates profiles through an iterative database search process and is capable of detecting remote homologs (Atschul et at, 1997, Nucleic Acids Res, 25; 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has one or more representatives in the protein structure databases, Programs such as GenTHREADER (Jones. 1999J 1 M&L Biot 287: 79715; McGuffin and Jones, 2003. Bioinformnacs 19; 874881) utilize information from a variety of sources (PSLBLAST, secondary structure prediction structural alignment profiles, and solvation ootentis) as inputs to a neural network that predicts the structural fold for a query sequence. Similarly, the method of Gough et a, 2000, J Moi Blot 313: 903<919, can be used to align a sequence of unknown structure within the superfamily models present in the SCOP database. These alignments can in turn be used to generate homology models for the polypeptide. and such models can be assessed for accuracy using a variety of tools developed for that purpose. For proteins of known structure, several tools and resources are available for retrieving and generating structural alignments. For example the SCOP superfamilies of proteins have been structurally aigned, and those alignments are accessible and downloadable, Two or more protein structures can be aligned using a variety of algorithms such as the distance alignment matrix (Holn and Sander, 1998, Proteins 33: 88-96) or combinatorial extension (Shindyalov and Boume, 1998, Protein Engineering 11: 739~747), and implementations of these algorithms can additionally be utilized to query structure databases with a structure of interest in order to discover possible structural homologs (eg, Hoim and Park, 2000, Biofnormatics 16:566-567) In describing the albumin variants of the present invention, the nomenclature described below is adapted for ease of reference. The accepted IUPAC single letter or three letter amino acid abbreviation is employed. Substitutions For an amino acid substitution, the following nomenclature is used Original amino acid, position substituted amino acid. Accordingly, for example the subsriution of threorne with alanine at position 226 is designated as "Thr226Ala" or T226A", Multiple mutations are separated by addition marks (""), e.g Gly205Arg + Ser4 1Phe" or "G205R + S41 IF", representing substitutions at positions 205 and 411 of glycine (G) with arginine (R) and shrine (S) with phenyalanine (F), respectively. The Figures also use (Tl e g "E492TIN5O3D this should be viewed as interchangeable with (") Deletions. For an amino acid deletion, the following nomenclature is used: Original amino acid, position* Accordingly, the deletion of glycine at position 195 is designated as "G195*" or "G195*, Multiple deletions are separated by addition marks ("+I. eg CGy195* + Ser411* or "G195* + S411** 12 Insertions, For an amino adid insertion the following nomenclature is used Original amino acid, position, original amino acid, inserted amino acid Accordingly the insertion of lysine after glycine at position 195 is designated "Glyl95GiyLys" or G1 95GK, An insertion of multiple amino acids is designated [Original amino acid, position, original amino acid, inserted amino acid #1, inserted amino acid #2; etcj. For example, the insertion of lysine and alanine after glycine at position 195 is indicated as 1GlyltS5lyLysAla' or "G1 95GKA'. In such cases the inserted amino acid residues) are numbered by the addition of lower case letters to the position number of the amino acid residue preceding the inserted amino acid residue(sYIn the above example, the sequence would thus be Parent: Variant 195 195 193 195b G G K A Multiple alterations. Variants comprising multiple alterations are separated by addition marks (+"), e g. -Arg1 70Tyr+Glyl95Giu" or "RI70k+G195E" representing a substitution of tyrosine and glutamic acid for arginine and glycine at positions 170 and 195, respectively. Different substitutions. Where different substitutions can be introduced at a position, the different substitutions are separated by a comma, e-g , "Arg1 7OTyr,Glu" represents a substitution of arginine with tyrosine or glutamic acid at position 170. Thus, 'Tyr167Gy;Ala + Arg170lyAia" designates the following variants: "Tyr167Gly+Arg170Gly", "Tyr 167Gly+Arg170Ala "Tyr167Ala+Arg70GIf and "Tyri 67A'a+Arg170Na" Parent albumin Albumins are proteins and constitute the most abundant protein in plasma in mammals and albumins from a long number of mammals have been characterized by biochemical methods and/or by sequence information Several albumins e g- human serum albumin (HSA), have also been characterized crystaliographically and the structure determined. HSA is a preferred albumin according to the invention and is a protein consisting of 585 amino acid residuecs and has a molecular weight of 67 kDa, In its natural form it is not glycosylated The amino acid sequence of HSA is shown in SEQ1 iNO: 2. The skilled person will appreciate that natural alleles may exist having essentially the same properties as HSA but having one or more amino acid changes compared to SEQ iD NO: 2, and the inventors also contemplate the use of such natural alleles as parent albumin according to the invention, 13 Aibumins have generally a long pisma half-ife of approximately 20 days or longer, eag. HSA has a plasma halff-lfe of 19 days, It is known that the long plasma half-life of HSA is mediated via interaction with its receptor FcRn, however, an understanding or knowledge of the exact mechanism behind the long haf-life of HSA is not essential for the present invention According to the invention the term "albumin" means a protein having the same, or very similar three dimensional structure as HSA and having a long plasma half-life. As examples of albumin proteins according to the invention can be mentond human serum albumin, primate serum albumin, (such as chimpanzee serum albumin, gorilla serum albumin), rodent serum albumin (such as hamster serum albumin, guinea pig serum albumin, mouse albumin and rat serum albumin), bovine serum albumin, equine serum albumin, donkey serum albumin, rabbit serum albumin, goat serum albumin, sheep serum albumin, dog serum albumin, chicken serum alnumin and pig serum albumin. HSA as disclosed in SEQ ID NO: 2 or any naturally occurring allele thereof is the preferred alburin according to the invention. The parent albumin, a fragment thereof, or albumin part of a fusion polypeptide comprising albumin or a fragment thereof according to the invention has generally a sequence identity to the sequence of HSA shown in SEQ ID NO: 2 of at least 60%, preferably at least 70%, preferably at least 80%. preferably at least 85% preferably at least 86%. preferably at least 87%, preferably at least 88%, preferably at least 89%, preferably at least 90%. preferably at least 91%, preferably at least 92%, preferably at least 93%, preferably at least 94%, preferably at least 95% more preferred at least 96%, more preferred at least 97%, more preferred at least 98% and most preferred at least 99%' The parent preferably comprises or consists of the amino acid sequence of SEQ ID NO; 2, In another aspect the parent comprises or consists of the mature polypeptide of SEQ ID NO: 2 In another embodiment, the parent is an allelic variant of the mature polypeptide of SEQ ID NO: 2. In a second aspect the parent is encoded by a polynucleotide that hybridizes under very low stringency conditions, low stringency conditions, medium stringency conditio-ns, medium-high stringency conditions, high stringency conditions, or very high stringency conditions with (i) the mature polypepde codisequence of SEQ ID NO:1 lhe maure polypeptide coding sequence of SEQ ID NO: or (iii) the full-length complementary strand of (i) or (ii) (J Sambrook, E,. Fritsch, and T Maniatis, 1989, Molecular Cionirng A Laboratory Manual, 2d edition. Cold Spring Harbor, New York), The polynucleotide of SEQ ID NO: I or a subsequence thereof, as well as the amino acid sequence of SEQ ID NO: 2 or a fragment thereof, may be used to design nucleic acid probes to identify and clone DNA encoding a parent from strains of different genera or species according to 14 methods we0 known in the art, In particular, such probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southem blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but should be at least 14, e.g, at least 25, at least 35, or at least 70 nucleotides in length. Preferablythe nucleic acid probe is at least 100 nucleotides in length, eg., at least 200 nucleoides at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides. at least 600 nucleotides, at least 700 nucleotides, at least 800 nuleotides, or at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labelled for detecting the corresponding gene (for example, with 3 2 P, -H, "S, biotin, or avidin). Such probes are encompassed by the present invention. A genomic DNA or cDNA library prepared from such other organisms may be screened for DNA that hybridizes with the probes described above and encodes a parent. Genomic or other DNA from such other organisms may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier maIeal In order to identify a clone or DNA that is homologous with SEQ D NO: I or a subsequence thereof, the carrier material is used in a Southern blot. For purposes of the present invention, hybridization indicates that the polynucleotide hybridizes to a labeled nucleotide probe corresponding to the polynudeotide shown in SEQ ID NO: 1, its complementary strand, or a subsequence thereof, under low to very high stringency conditions. Molecules to which the probe hybridizes can be detected using, for example, X-ray film or any other detection means known in the art. In one aspect, the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 1. In another aspect, the nucleic acid probe is nucleotides I to 1785 of SEQ ID NO: 1. In another aspect, the nucleic acid probe is a polynucleotide that encodes the polypeptide of SEQ ID NO: 2 or a fragment thereof, In another aspect, the nucleic acid probe is SEQ ID NO: 1, For long probes of at least 100 nuceotides in length, very low to very high stringency conditions are defined as prehybridization and hybridization at 42:'0 in 5X SSPE, 0.3% SDS, 200 microgramshmIisheared and denatured salmon sperm DNA, and either 25% formamide for very low and iow stringencies, 35% formamide for medium and medium-high stringencies, or 50% formamide for high and very high stringencies, following standard Southem blotting procedures for 12 to 24 hours optimally. The carrier material is finally washed three times each for 15 minutes using 2X SS0, 0,2% SDS at 45C (very low stringency), 50" Tow stringency), 55"0 (medium stringency) 60"t (mediun-high stringency) 65*0 (high stringency), or70C (very high stringency) For short probes that are about 15 nucleotides to about 70 nucleotides in length, stringency conditions are defined as prehybridization and hybridization at about 5'r to about 10NC below the calculated T, using the calculation according to Bolton and McCarthy (1962, Proc. Nat Acad Sci USA 48: 1390) in 0.9 M NaC, 0,09 M Tris-HC pH 76 6 mM EDTA, 0.5% NP-40, IX Denhardt's solution 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate 0.1 mMATP, and 0.2 mg of yeast RNA per mi following standard Southern blotting procedures for 12 to 24 hours optimally, The carrier material is finally washed once in 6X SCC pius 0.1% SDS for 15 minutes and twice each for 15 minutes using 6X SSC at S*C to 1lWC below the calculated T,. In a third aspect, the parent is encoded by a pol ynucleotide with a sequence identity to the mature polypeptide coding sequence of SEQ iD NO: 1 of at least 60% eg., at least 66%, at least 70% at least 75%, at least 80%, at least 85%, at least 90%, at least 5%, at least 96%, at least 97 1t east 98%, at least 99% or 100%, which encodes a polypeptide which is able to function as an albumin. In an embodiment, the parent is encoded by a polynucleotide comprising or consisting of SEQ ID NO: 1. Preparation of Variants In a further aspect the invention relates to a method for preparing a variant albumin fragment thereof, or fusion polypeptide comprising variant alburnin or a fragment thereof comprising the steps of: a. Identifying one or more amino acid residue positions being important for the binding of albumin to FoRn, in an albumin or a fragment thereof or the albumin part of a fusion polypeptide comprising albumin or a fragment thereof; b. Providing a nucleic acid encoding said albumin, the fragment thereof or the albumin part of a fusion polypeptide comprising albumin or the fragment thereof; c, Modiying the nucleic acid provided in b, so that the one or more (severa)amino acid residue located at the positions identified in a, are deleted or substituted or inserted with a different amino acid: d, Expressing the modified nucleic acid in a suitable host cell; and e Recvering the variant albumin, the fragment thereof or the fusion polypeptide comprising variant albumin or the fragment thereof. The identification of one or more amino acid residue positions being important for the binding of albumin to FcRn., in alibumn, fragment thereof or the albumin part of a fusion polypeptide can be done in several ways including, but not limited to, random mutagenesis followed by analysis of the generated mutants and comparison with the non-mutated parent molecule and identification 16 based on structural considerations optionally followed by generation of variants having the identified alterations and comparison with the non-mutated patent molecule, A preferred method for identification of one or more amino acid residue positions to be changed to in order to prepare a variant HSA having an altered binding to FcRn compared with natural HSA, comprises the following steps: i) Identifying a non-human albumin having a different binding property to FcRn; i) Identifying the amino acid residues of the human serum albumin interacting with FoRn; iii) Comparing the primary and/or the tertiary structure of the identified non-human albumin and human serum albumin with respect to the amino acid residues identified in step ii) and identifyingg the amino acid residues that differ between said non-human albumin and human serum albumin as being responsible for the observed binding difference;and iv) Optionaily preparing variants of HSA at the positions identified in step iii) and confirming that the prepared variants have altered binding to FcRn compared with HSA, Step i) above may be done using the SPR assay described below, However, the skilled person will appreciate that other methods may be used to identify non-human albumins having different binding properties to FoRn than HSA, and that the method is not dependent on how the non- human albumin, having different binding properties to FcRn, has been identified, In one preferred embodiment the identified non-human albumin has a stronger binding to FcRn than HSA. Examples of non-human albumins having stronger binding to FcRn than HSA include donkey serum albumin, rabbit serum albumin, dog serum albumin, hamster serum albumin, guinea pig serum albumin, mouse serum albumin and rat serum albumin, Step li) may be accomplished by considering the structure of FcRn, HSA and the binding complex cf these two In the absence of an available structure of the binding complex it is possible to use a model where the HSA structure is docked into the structure of the FcRn structure and thereby identify amino acid residues of HSA interacting with FcRn. 1n another preferred embodiment the identified non-human albumin has a weaker binding to FcRn than HSA. Examples of nor-human alburins having weaker binding to FcRn than HSA include bovine serum albumin, goat serum albumin, shcep serurn albumin and chicken serum albumin Step ii) may be accomplished by considering the structure of FcRn, HSA and the binding complex of these two in absence of an available structure of the binding complex it is possible to use a modelhere the HSA structure is docked into the structure of the FoRn structure and thereby identify residues of HSA interacting with FcRn, 17 In this invention and claims, an amino acid residues of HSA interacting with FcRn is considered any amino acid residues of HSA being located less than 1A from an amino acid in the FcRn or any amino acid residue that is involved in a hydrogen bond, a salt bridge or a polar or nonpolar interaction with an amino acid residue that is located less than b0A from an amino acid in the FcRn. Preferably the amino acid in HSA residues are located less than I0A from amino acids in the FcRn more preferred less than 6A from amino acids in the FcRn and most preferred less than 3A from ammo acids in the FcRn. Step iii) and iv) can be done using techniques well known to the skilled person. The present invention also relates to methods for obtaining a variant albumin or fragments thereof. or fusion polypeptides comprising the variant albumin or fragments thereof, or associates of variant albumin or agment thereof comprising (a) introducing into a parent albumin or fragments thereof, ar fusion polypeptides comprising the parent albumin or fragments thereof an alteration at one or more (several) positions corresponding to positions 417, 440, 464, 490. 492. 493. 494, 495, 496, 499, 500, 501, 503, 504, 505, 506, 510, 535, 536, 537536 540,541, 542, 550, 573 574, 575 577, 57 579, 580. 581 62 and 584 of The mature polypeptide of SEQ 1D N': 2; and (b) recovering the variant albumin or fragments thereof, or fusion polypeptides comprising the variant albumin or fragments thereof. The variants can be prepared by those skilled persons using any mutagenesis procedure known in the art, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis shuffing etc Site-directed mutagenesis is a technique in which one or more (several) mutations are created at one or more defined sites in a polynucleotide encoding the parent Site-directed mutagenesis can be accomplished in vitro by POR invoMng the use of oligonucleotide primers containing the desired mutation. Site-directed mutagenesis can also be performed in vitro by cassette mutagenesis involving the cleavage by a restriction enzyme at a site in the plasmid comprising a polynucleotide encoding the parent and subsequent ligation ot an oligonucleotide containing the mutation in the polynucleotide. Usually the restriction enzyme that digests at the plasmid and the oligonucleotide is the same, permitting ligation of the plasmid and insert to one another. See g Scherer and Davis, 1979, Proc: Natf Acad, Sc. USA 76 4949 4955; and Barton et aL, 1990 Nucleic Acids Res; 18: 7349-4966 Site-directed mutagenesis can also be accomplished in vivo by methods known in the art See e g U.S Patent Application Publication No. 2004/0171154; .Storici et at 2001, Natue Biotechnot 19: 773-776; Kren et at, 1998, Nat Med, 4 285-290; and Calissano and Macimo 1996, FungaG envt, Newsett 43:1516 18 Any site-directed mutagenesis procedure can be used in the present invention. There are many commercial kits available that can be used to prepar i variants, Synthetic gene construction entails n vitro synthesis of a designed polynucleotide molecule to encode a polypeptide of interest, Gene synthesis can be performed utilizing a number of techniques, such as the multiplex microchip-based technology described by Tian af al, (2004, Nature 432: 10504054) and similar technologies wherein olgionucleoides are synthesized and assembled upon photo-programable microfluidic chips. Single or multiple amino acid substitutions deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; BowI and Sauer, 1989, Proc Natt Acad Sci USA 86 2152-2156; WO 95/17413; orWO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g.. Lowman et a. 1991, 30ochmisty30 10832 10837; U.S Patent No. 5.223.409; WO 92/06204) and regiordrected mutagenesis (Derbyshire at at, 1986, Gena 46: 145; Nr e a , 1988, DWA 7: 127). Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect actity of cloned, mutagenized poypeptides expressed by host cells (Ness et at, 1999, Natwe Biotechnology 17: 893-8%). Mutagenzed DNA molecules that encode active polypeptides can be recovered from the host celis and rapidly sequenced using standard methods in the art hese methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide. Semi-synthetic gene construction is accomplished by combining aspects of synthetic gene con struction, and/or site-directed mutagenesis, and/or random mutagenesis, and/or shuffling Semi synthetic constuction is typified by a process utilizing polynucleotide fragments that are synthesized in combination with POR techniques, Defined regions of genes may thus be synthesized de nov, while other regions may be amplified using sie-specific mutagenic primers, while Yet other regions may be subjected to error-prone PCR or non-error prone PCR amplification. Poivnucleotide sub sequences may then be shuffled, Variants The present invention also provides variant ailbumins or fragments thereof, or fusion polypeptides comprising the variant albumin or fragments thereof of a parent albumin, comprising an alteration at one or more (several) positions corresponding to posions 417, 440 464, 490 492, 493, 494, 495, 496,499, 500, 501, 503, 504, 505, 506, 510, 535, 536, 537,538. 540 541, 542, 550, 573, 574 575, 577, 578, 579, 580, 581, 582 and 584 in SEQ ID NO: 2, wherein each 19 alteration is independently a substitution, insertion or deletion with the provision that the and the variant is not SEQ 10 NO: 2 having the substitution D494N, ESQ1K, K541E, 0550GA, K573E or K574N The variant albumin, a fragment thereof, or albumin part of a fusion polypeptide comprising variant albumin or a fragment thereof according to the invention has generally a sequence identity the sequence of HSA shown in SEQ ID NO: 2 of at least 60% preferably at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 90 %, more preferred at least 95%, more preferred at least 96%, more preferred at least 97%, more preferred at least 98% and most preferred at least 99%. in one aspect, the number uf alterations in the variants of the present invention is 1-20, e'g, 1-10 and i-,5 such as 1, 2 4,5 6 7 8, 9 or 10 alterations, The variant alburnin, a fragment thereof or fusion polypeptide comprising the variant albumin or fragment thereof has altered plasma half-life compared with the corresponding parent albumin, fragment thereof, or fusion polypeptide comprising the variant albumin or fragment thereof In a particular preferred embodiment the parent albumin is HSA and the variant albumin, a fragment thereof or fusion polypeptide comprising the variant albumin or fragment thereof has altered plasma half-life compared with the HSA, the corresponding fragment or fusion polypeptide comprising HSA or fragment thereof, The correlation between binding of albumin to its receptor and plasma half-life has been realized by the present inventors based on the natural occurring allele of HSA D494N. The inventors have analyzed this allele and found that it has a lower affinity to its receptor FcRn, Further it has been disclosed that a transgenic mouse having the natural mouse FcRn replaced with human FcRn has a higher serum albumin level than normal mouse' see {J Exp Med. (2003) 197(3):315-22) The inventors have discovered that human FoRn has a higher affinity to mouse serum albumin than mouse FcRn has to mouse serum albumin and, therefore, the observed increase in serum albumin in the transgenic mice corresponds with a higher affinity between serum albumin and its receptor, confirming the correlation between albumin binding to FcRn and plasma half-life In addition, variants of albumin that have little or no binding to FoRn have been shown to have reduced half-lfe in a mouse mode, Kenanova et al (2009) Ji Nucl Med; 50 (Supplement 2):1582)% One way to determine whether the affinity of a variant albumin to FcRn is higher or lower than the parent albumin is to use the Surface Plasmon Resonance assay (SPR) as described below. The skilled person will understand that other methods might be useful to determine whether the affinity of a variant albumin to FcRn is higher or lower than the affinity of the parent albumin to 20 FoRn. e.g., determination and comparison of the binding constants KD. Thus, according to the invention variant albumins having a KD that is lower than the KD for natural HSA is considered to have a higher plasma haiflife than HSA and variant albumins having a KD that is higher than the KD for natural HSA is considered to have a lower plasma haf -life than HSA. The variants of albumin or fragments thereof or Fusion polypeptides comprising albumin or fragments thereof comprise one or more alterations, such as substitutions deletions or insertions at one or more (several) positions corresponding to the positions in HSA selected from the group consisting of 417, 440, 464, 490, 492, 493, 494 495, 496, 499,500, 501 503, 504, 505, 06, 510, 535, 536, 537, 538, 540, 541, 542, 550, 573, 574, 575. 577 578. 579.580, 581,532 and 584 The substitution may be any substitution where the amino acid in the natural albumin sequence is substituted with a different amino acid selected among the remaining 19 natural occurring amino acids In one aspect, a variant comprises an alteration at one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503, 504, 505, 506, 510 535 536, 537, 538. 540, 541, 542, 50.573, 574, 575 577, 578, 579, 580, 581 582 and 584 in SEQ ID NO: 2. in another aspect a variant comprises an alteration at two positions corresponding to any of 417, 440, 464, 490, 492, 493 494, 495, 496t 499, 500 50, 503 504.505 506, 510, 535, 536, 537, 538. 540, 541 542, 550, 573, 574, 575, 577 58, 579 580,531,582 and 584 in SEQ ID NO: 2. In another aspect a variant comprises an alteration at three positions corresponding to ary of positions 417, 440 464, 490, 492, 493,494, 495, 496, 499, 500 501 503, 504, 505, 506, 510,535 536, 537, 538 540, 541, 542: 550, 573, 574, 575, 577 578, 579, 580, 581, 582 and 584 in SEQ ID NO: 2. in another aspect, a variant comprises an alteration at each position corresponding to positions 417, 440, 464 490, 492, 493, 494, 495, 496, 499, 500. 501, 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541, 542, 550, 573, 574, 575, 577, 578, 579, 580. 581, 52 and 584 in SEQ ID NO: 2. In another aspect, the variant comprises the substitution 0417A,H of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution H440Q of the mature polypeptide of SEQ ID NO: 2 In another aspect, the variant comprises the substitution H464Q of the mature poypeptide of SEQ ID NO 2.I in another aspect; the variant comprises the substitution A490D of the mature polypeptide of SEQ ID NO: 2. in another aspect, the variant comprises the substitution E492G, TRH of the mature polypeptide of SEQ ID NO: 2, In another aspect, the variant comprises the substitution V493rL of the mature polypeptide of SEQ ID NO: 2, in another aspect the variant comprises the substitution D494NQ.AE,P of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution E495QA of the mature polypeptide of SEQ ID NO: 2, In another aspect, the variant comprises the substitution T496A of the mature 21 polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution P499A of the mature polypeptide of SEQ 1D NO: 2. In another aspect, the variant comprises the substitution K500E,G,D,AS,.PH,FNWNT.MV ,QL.I,R of the mature polypeptide of SEQ ID NO: 2 In another aspect, the variant comprises the substitution E501APQ of the mature polypeptide of SEQ ID NO: 2, In another aspect, the variant comprises the substitution N503KDH f the mature polypeptide of SEQ ID NO: 2, in another aspect, the variant comprises the substitution A504E of the mature poiypeptide of SEQ ID NO:2, In another the variant p the subsutin E505K, D of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution T506F S of the mature polypeptide of SEQ ID NO: 2. In another aspect, the vacant comprises the substitution H510Q of the mature polypeptide of SEQ D NO: 2. In another aspect, the variant comprises the substitution H535Q of the mature polypeptide of SEQ ID NO: 2 In another aspect, the variant comprises the substitution K536A of the mature polypeptide of SEQ ID NO: 2. In another aspect the vacant comprises the substitution P537A of the mature polyeptide of SEQ ID NO: 2. In another aspecthe variant comprises the substitution K538AH of the mature polypeptide of SEQ D NO 2 In another aspect the variant comprises the substitution T540S of the mature poiypeptide of SEQ ID NO; 2, in another aspect the variant comprises tne substitution K541ADGN.E of the mature polypeptide of SEQ ID NO 2 In another aspect, the variant comprises the substitution E542PD, of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution D550N of the mature polypeptide of SEQ ID NO 2. in another aspect, the variant comprises the substitut i K573YWPHVFTNS G MCAEQRLD of the mature polypeptide of SEQ ID NO: 2, In another aspect, the variant comprises the substitution K574N of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution Q580K of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution L575F of the mature polypeptide of SEQ ID NO 2, In another aspect; the variant comprises the substitution A577TE of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution A578RS of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution S579CT of the mature polypeptide of SEQ ID NO: 2. in another aspect the variant comprises the substiun Q580K of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution A581D of the mature polypeptide of SEQ ID NO: 2, In another aspect the variant comprises the substitution A5682T of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution G584A of the mature polypeptide of SEQ ID NO: 2 In one aspect, the variant comprises an alteration at a position corresponding to position 417, n another aspect, the amino acid at a position corresponding to position 417 is substituted 22 with Ala, Arg Asn Asp, Cys. GIn, Gib, Gly. His, Ile, Leu Lys, Met, Phe. Pro, Ser. Thr. Trp Tyror Val, preferably with Ala or His, In another aspect, the variant comprises the substitution 0417A, H of the mature polypeptide of SEQ ID NO: 2, In another aspect the variant comrises an alteration at a position corresponding to position 440, In another aspect, the amino acid at a position corresponding to position 440 is substituted with Ala.Arg, Asn, Asp, Cys, Gin, Glu. Gy, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp. Tyr, or VaL preferably with Ala. in another aspect the variant comprises the substitution H440Q of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises an alteration at a position corresponding to position 464. In another aspect, the amino acid at a position corresponding to position 464 is substituted wih Ala, Arg, Asn, Asp, Cys. GIn, Glu Giy, His, le, Leu, Lys Met, Phe, Pro, Ser Thr, Tip. Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the substitution H464Q of the mature polypeptide of SEQ ID NO- 2. In another aspect, the variant comprises an alteration at a position corresponding to position 490 In another aspect. the amino acid at a position corresponding to position 490 is substituted with Ala, Arg, Asn, Asp Cys, Gin, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, in another aspect, the variant comprises the substitution A490G of the mature polypeptide of SEQ ID NO: 2, In another aspect, the variant comprises an alteration at a position corresponding to position 492. In another aspect, the amino acid at a position corresponding to position 492 is substituted with Ala, Arg, Asn, Asp, Cys. Gin, Glu. Gy, His, lie, Leu. Lys, Met, Phe, Pro, Ser, Thr, Trp. Tyr, or Val, preferably with Giy In another aspect, the variant comprises the substitution E492G of the mature polypeptide of SEQ 1 NO: 2, in another aspect the variant comprises an alteration at a position corresponding to position 493 In another aspect. the amino acid at a position corresponding to position 493 is substituted with Ala, Arg, Asn, Asp, Cys, Gin. Gu, Giy, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Va. preferably with Pro, In another aspect, the variant comprises the substitution V493P of the mature polypeptide of SEQ ID NO: 2, In another aspect, the variant composes an alteration at a position corresponding to position 494, In another aspect the amino acid at a position corresponding to position 494 is substituted with Ala, Arg. Asn, Asp. Cys. Gin, Glu, Gy, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val preferably with Asn, Gin or Ala. In another aspect, the variant comprises the substitution D494NQ, A of the mature polypeptide of SEQ ID NO: 2. Another aspect, the variant comprises an liberation at a position corresponding to position 495, In another aspect, the amino acid at a position corresponding to position 495 is substituted 23 with Ala Arg; Asn Asp, Cys. Gin, Gb, Gly. His, Ile, Leu Lys, Met, Phe. Pro, Ser. Thr Trp Tyror Vai, preferably wih Gln or Ala In another aspect, the variant comprises the substitution £4950 or A of the mature polypeptide of SEQ ID NO: 2. In another aspect the variant coprises an alteration at a position corresponding to position 496 In another aspect, the amino acid at a position corresponding to position 496 is substituted with Ala. Arg, Asn, Asp, Cys GIn, Glu. Gy, His, lle, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp. Tyr, or VaL preferably with Ala, In another aspect, the variant composes the substitution T496A of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises an alteration at a position corresponding to position 499. In another aspect, the amino acid at a position corresponding to position 499 is substituted wih Ala, Arg, Asn, Asp, Cys. GIn, Glu, Gy, His,, Ie, Leu Lys, Met, Phe, Pro, Scr Thr Tp Tyr. or Val, preferably with Ala. In another aspect, the variant comprises the substitution P499A of the rnature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises an alteration at a position corresponding to position 500. In another aspect the amino acid at a position corresponding to position 500 is substituted with Ala, Arg, Asn, Ap, Cys, GIn, Gu ly, Hislie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala, In another aspect, the variant comprises the substitution K50EG,,ASCPHFANTMVQLJR of the mature polypeptide of SEQ 10 NO: 2, in another aspect, the variant comprises an alteration at a position corresponding to position 501 In another aspect, the amino acid at a position corresponding to position 501 is substituted with Ala, Arg Asn, Asp, Cys, Gin, Glu, Gy. His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala or Gin to reduce affinity and Pro to increase affinity, In another aspect, the variant comprises the substitution E501A, 0, P of the mature polypeptide of SEQ ID NO: 2. in another aspect the variant comprises an alteration at a position corresponding to position 503 In another aspect, the amino acid at a position corresponng to position 503 is substituted with Ala, Arg. Asn, Asp, Cys, Gin, Glu, Gly, His, 4e, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Va. preferably with Asp or Lys or His, In another aspect, the vacant comprises the substitution N503D. K, H of the mature polypeptide of SEQ ID NO: 2. ln another aspect the variant comprises an alteration at a position corresponding to position 504, In another aspect, the amino acid at a position corresponding to position 504 is substituted with Ala, Arg. Asn, Asp, Cys. GInGlu, Gy, His, lie, Leu, Lys, Met, Phe, Pro, Ser Thr, Trp, Tyr, or VaL In another aspect, the variant comprises the substitution A504 of the mature polypeptide of SEQ ID NO: 2 Another aspect, the variant comprises an alteration at a position corresponding to position 505 In another aspect, the amino acid at a position corresponding to position 505 is substituted 24 with Ala Arg Asn. Asp, Cys, Gin, Gb, Gly. His, Ile, Leu. Lys, Met, Phe. Pro, Ser. Thr Trp Tyror Val In another aspect; the variant comprises the substitution E505D of the mature polypeptide of SEQ ID NO: 2. In another aspect the variant coprrises an alteration at a position corresponding to position 506, In another aspect, the amino acid at a position corresponding to position 506 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu. Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Vat In another aspect, the variant comprises the substitution T506SP of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises an alteration at a position corresponding to position 510, in another aspect, the amino acid at a position corresponding to position 510 is substituted with Ala, Arg, An, Asp, Cys. GIn, Glu, Gy, His, le, Leu. Lys, Met, Phe, Pro, Ser, Thr. Trp. Tyr, or Val, preferably with Gn in another aspect, the variant comprises the substitution H510Q of the nature polypeptide of SEQ ID NO: 2. In another aspect; the variant comprises an alteration at a position corresponding to position 535. In another aspectthe amino acid at a position corresponding to position 535 is substituted with Ala, Arg, Asn, Ap s, GIn, Gu, Gly, His, le, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Vat preferably with Gin. in another aspect, the variant comprises the substitution H535Q of the mature polypeptide of SEQ ID NO: 2, In another aspect, the variant comprises an alteration at a position corresponding to position 536. In another aspect, the amino acid at a position corresponding to position 536 is substituted with Ala, Arg, Asn, Asp, Cys. Gin, Giu. Gy, His, lie, Leu, Lys, Met, Phe, Pro, Ser Thr, Trp, Tyr, or Val, preferably with Ala, In another aspect, the variant comprises the substitution K536A of the mature polypeptide of SEQ D NO: 2, in another aspect the variant comprises an alteration at a position corresponding to position 537 In another aspect, the amino acid at a position corresponding to position 537 is substituted with Ala, Arg. Asn, Asp, Cys, Gin, Glu, Giy, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Vat preferably with Ala. In another aspect, the variant comprises the substituion PS37A of the mature polypeptide of SEQ ID NO: 2, In another aspect, the variant comprisesa alteration at a position corresponding to position 538 In another aspect the amino acid at a position corresponding to position 538 is substituted with Ala, Arg Asn, Asp, Cys. Gin, GIu, Gy, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val preferably with Ala In another aspect, the variant comprises the substitution K538H, A of the mature polypeptide of SEQ ID NO: 2. Another aspect, the variant comprises an liberation at a position corresponding to position 540. In another aspect, the amino acid at a position corresponding to position 540 is substituted 25 with AlaArg Asn. Asp, Cys, Gin, Gb, Gly. His, ile, Leu Lys, Met. Phe Pro, Ser. Thr, Trp Tyror Vat in another aspect, the variant comprises the substitution T540S of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comrnises an alteration at a position corresponding to position 541. in another aspect, the amino acid at a position corresponding to position 541 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu. Gly, His, le, Leuo Lys, Met, Phe, Pro, Ser, Thr, Trp Tyr, or Vat preferably with Gly, Asp or Ala, in another aspect, the variant comprises the substitution K541 G, D A, N of the mature polypeptide of SEQ ID NO: 2, In another aspect, the variant comprises an alteration at a position corresponding to position 542. in another aspect, the amino acid at a position corresponding to position 542 is substituted wih Ala, Arg, Asn., Asp, Cys, Gin, CGily, His, le, Leu. Lys, Met, Phe, Pro, Ser Thr. Trp. Tyr, or Vai, preferably with Asp or Pro, in another aspect, the variant comprises the substitution E542D, P of the mature polypeptide of SEQ ID NO: 2, in another aspect, the variant comprises an alteration at a position corresponding to position 550, in another aspect, the amino acid at a position corresponding to position 550 is substituted with AlaArg Asn, Asp, Cys, GIn, Giu, Gly, His, le, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. preferably with Asn to reduce affinity, preferably with Giu to increase affinity, n another aspect, the variant comprises an alteration at a position corresponding to position 573 in another aspect, the amino acid at a position corresponding to position 573 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Gu, Gly, His, lie, Leu. Lys, Met, Phe, Pro, Ser Thr, Trp. Tyr, or VaI, preferably witi Tyr, Trp, Pro His. Phe, Va, lie, Thr, Asn, Ser Gly, Met. Cys. Ala, Gi, Gin, Arg; Leu, Asp. In another aspect, the variant cormrises the substitution K573Y.W P,H F ,ViTNS,GM.CAEQRL, D of the mature polypeptide of SEQ D NO: 2 in another aspect the variant comprises an alteration at a position corresponding to position 574, In another aspect, the amino acid at a position corresponding to position 574 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Gu, Gy, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Vat preferably with Asn. In another aspect, the variant comprises the substitution K574N of the mature polypeptide of SEQ itD NO: 2. in another aspect the variant comprisesa alteration at a position corresponding to position 575. In another aspect the amino acid at a position corresponding to position 575 is substituted with Ala, Arg Asn, Asp, Cys. Gin, Glu, Gly, His, lie, Leo, Lys, Met, Phe, Pro, Ser Thr, Trp, Tyr, or Vai preferably with Phe. In another aspect, the variant comprises the substitution L575F of the mature polypeptide of SEQ ID NO: 2 Another aspect, the variant comprises an alteration at a position corresponding to position 577. in another aspect, the amino acid at a position corresponding to position 577 is substituted 26 with Ala, Arg; Asn. Asp, Cys. Gin, Giu, Gly. His, Ile, Leu. Lys, Met, Phe Pro, Ser. Thr. Trp, Tyror Vai, preferably with Thr or Iu. In another aspect, the variant comprises the substitution A577TE of the mature polypeptide of SEQ ID NO: 2. In another aspect the variant coprises an alteration at a position corresponding to position 578. in another aspect, the amino acid at a posi1;on corresponding to position 578 is substituted with Ala. Arg, Asn, Asp, Cys, Gin, Guk Giy, His, lle, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp Tyr, or VaL preferably with Arg or Ser, In another aspect, the variant compises the substitution A678RS of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises an alteration at a position corresponding to position 579, in another aspect, the amino acid at a position corresponding to position 579 is substituted with Ala, Arg, Asn. Asp, Cys, Gin, Glu, Giy. His, Ile, Leu. Lys, Met, Phe, Pro, Ser Thr. Trp Tyr, or Val, preferably with Cys or Thr. In another aspect. the variant comprises the substitution S579CT of the mature polypeptide of SEQ ID NO: 2, In another aspect, the variant comprises an alteration at a position corresponding to position 580, in another aspect, the amino acid at a position corresponding to position 580 is substituted with Ala, Arg, Asn, Ap ys Gin, Glyu Gi, His, ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. preferably with Lys. In another aspect, the variant comprises the substitution Q580K of the mature polypeptide of SEQ ID NO: 2, in another aspect, the variant comprises an alteration at a position corresponding to position 581 in another aspect, the amino acid at a position corresponding to position 581 is substituted with Ala, Arg, Asn, Asp, Cys. Gin, Glu. Gty, His, ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp, in another aspect, the variant comprises the substitution A58I D of the mature polypeptide of SEQ iD NO: 2, in another aspect, the variant comprises an alteration at a position corresponding to position 582. in another aspect, the amino acid at a position corresponding to position 582 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gy, His, lle, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Vai. preferably with Thr In another aspect, the variant comprises the substitution A582T of the mature polypeptide of SEQ ID NO: 2. in another aspect the variant comprises anlteration at a position corresponding to position 584. In another a the amino acid at a posi corresponding to position 584 is s with Ala, Arg. Asn, Asp, Cys. Gin, Glu, Gy, His, lie, Leu, Lys, Met, Phe, Pro, Ser Thr, Trp, Tyr, or Va. preferably with Ala. In another aspect, the variant comprises the substitution G584A of the mature polypeptide of SEQ ID NO 2 in another aspect, the variant comprises an alteration at positions corresponding to positions 494 and 496 in SEQ ID NO: 2, such as those described above 27 In another aspect the variant comprises alterations at positions corresponding to positions 492 and 493 in SEQ ID NO: 2, such as those described above, In another aspect, the variant comprss alterations at positions corresponding to positions 494 and 417 in SEQ ID NO: 2, such as those described above, In another aspect, the variant comprises alterations at positions corresponding to positions 492 and 503 in SEQ ID NO' 2, such as those described above. In another aspect, the variant composes alterations at positions corresponding to positions 492 and 573 in SEQ ID NO: 2, such as those described above. In another aspect the variant comprises alterations at positions corresponding to positions 492, 503, and 573 in SEQ ID NO: 2. such as those described above. in one embodiment the variant albumin or fragments thereof, or fusion polypeptides comprising the variant albumin or fragments thereof according to the invention contains one substitution at a position conesponding to a position in HSA selected from the group consisting of 417, 440, 464, 490, 492, 493, 494, 495. 496, 499, 500, 501, 503. 504, 505, 506, 510, 535 536, 537, 538, 540, 541, 542.550, 573, 574, 575, 577, 578 579, 580, 581, 582 and 584 in SEQ ID NO: 2 provided that the variant albumin is not the variant consisting of SEQ ID NO: 2 with the substitution D494N, E0IK, K541E, D550GA, K573E or K574N, The variant albumin, fragment thereof or fusion polypeptides comprising variant albumin or a fragment thereof according to the invention may comprise additional substitutions, insertions or deletions at one or more (several) positions corresponding to other positions in HSA. In another embodiment the variant albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof according to the invention contains two, three, four, five , six, seven, eight, nine, ten, eleven, twelve , thirteen, fourteen fifteen, sixteen, seventeen, eighteen, nineteen twenty or even more substitutions at positions corresponding to positions 1I HSA selected from the group consisting of 417, 440 464. 490 492, 493 494. 495, 496 499, 500, 501, 503, 504. 505,506, 510, 535, 536, 537 538, 540, 541, 542, 550, 573. 574, 57~5, 577, 578, 579, 5801 581. 582 and 584 of SEQ ID NO: 2, The variant albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof according to the invention may comprise additional substitutions, insertions or deletions at positions corresponding to other positions in HSA. In a further embodiment the variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or a fragment thereof accordirgto the invention have a plasma half-life that is longer than the plasma haif-fife of the parent albumin fragment thereof or fusion polypeptide comprising the parent albumin or a fragment thereof,. Examples according to this embodiment include variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin 28 or a fragment thereof comprising a substitution in the position corresponding to 492 503, 542, 550, 573, 574, 580. 581 5682 or 584 in SEQ iD NO: 2. Preferred substitutions according to this embodiment of the invention include the substitution of the amino acid residue in the position corresponding to 492 in SEQ ID NO: 2 with a G residue, substitution of the amino acid residue in the position corresponding to 503 in SEQ ID NO: 2 with a H or a K residue, substitution of the amino acid residue in the position corresponding to 550 in SEQ ID NO; 2 with an E residue, the substitution of the amino acid residue in a position corresponding to 573 in SEQ ID NO: 2 with an Y W~ PH UTNSGMC,AEQ,P.L or a D, the substitution of the amino acid residue in a position corresponding to 574 in SEQ ID NO: 2 with an N residue, or the substitution of the amino acid residue in the position corresponding to 580 in SEQ ID NO: 2 with an K residue. Other preferred variants have a substitution in the position corresponding to 492 in SEQ ID NO;2 with a o residue and a substitution in the position corresponding to 573 in SEQID NO: 2 with anA or a P residue. Other preferred variant has a number of substitutions corresponding to position 492 in SEQ ID NO: 2 with an H residue in position 503 in SEQ ID NO: 2. Other preferred variants have a substitution in the position corresponding to 492 in SEQ ID NO: 2 with a G residue and a substitution in the position corresponding to position 503 in SEQ ID NO: 2 corresponding to a H or a K and a substitution in position 573 in SEQ ID NO: 2 with an A or a P residue, in a further embodiment the variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof according to the invention have a plasma halflife that is shorter than the plasma haf-life of the parent albumin fragment thereof or fusion polypeptide comprising the parent albumin or a fragment thereof. Examples according to this embodiment include variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or a fragment thereof comprising a substitution in the position corresponding to 417, 440, 494 495, 496, 499, 500, 501, 536, 537 '538, 541, 494+496 or 492+493 in SEQ ID NO: 2 Preferred substitutions include the substitutions corresponding to Q417A, H4400, D494E+Q417H, D494N.Q.A, E495Q,A, T496A, D494N+T496A or, P499, K500A, ES1A, E501Q, K536A, P537A, K538A, K541G, K541A K541D or D550N in SEQ ID NO: 2. in another embodiment of the invention the variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or a fragment thereof according to the invention have lost their ability to bind FcRn, in this connection variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof is considered to have lost the ability to bind PcRn if the measured resonance units for the variant in the SPR assay described below isless than 10% of the measured resonance units for the corresponding parent albumin or fragment thereof; Examples according to this embodiment include variants of albumin or fragments 29 thereof, or fusion polypeptides comprising variant albumin or fragments thereof comprising a substitution at a position corresponding to 464, 500, 510 or 535 in SEQ 10 NO: 2. Preferred substitutions include the substitutions corresponding to H4640., K500A,P,CS,A,D.G H5100 or H535Q in SEQ ID NO: 2, In addition to the one or more substitutions at one or more positions corresponding to positions 417, 464,490 492,493 494,495 496,499,500,501.503,504,505,506, 510535,536, 537, 538, 540, 541 542, 50, 573 574, 580 581, 582 and 584 in SEQ ID NO 2 the variant albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof according to the invention may contain additional substitutions, deletions or insertions in other positions of the molecules. Such additional substitutions, deletions or insertions may be useful in order to alter other properties of the molecules such as but notimited to altered glycosylation; introduction of reactive groups of the surface such a thiol groups, renioving/generating a carbamoylation site; etc. Residues that might be altered in order to provide reactive residues on the surface and which advantageously could be applied to the present invention has been disclosed in the unpublished patent application WO 20101092135 (included by reference) Particular preferred residues include the positions corresponding to positions in SEQ ID NO: 2. As examples of alterations that can be made in SEQ HD NO: 2 or in corresponding positions in other albumins in order to provide a reactive thiol group on the surface includes alterations corresponding toiflowing alterations in SEQ ID NO: 2: L585 D10, A2Q, D620 A364C, A504C, E505C, T79, £86C D129C, D5490. A581 D121D , E2 S270 A578GO L595LC, D1DC, A2AC D562D, A364AC A504AC, E505EC, T79TC, E86EC, D129D. Dr49DC, A581AC, A581AC. D121DC, E2EO S270S0,A579AO. C360*, C316> 075* 0168% C5W, 0361> 09, 0124> 0169 and 0567*. Alternatvely a cysteine residue may be added to the N or C terminal of albumin, Polynucleotides The present invention also relates to isolated polynucleotides that encode any of the variants of the present invention Nucleic Acid Constructs The present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a variant of the present invention operable linked to one or rore (several) control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences. 30 A polynucleotide may be manipulated in a variety of ways to provide for expression of a variant manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art, The control sequence may be a promoter sequence, which is recognized by a host celi for expression of the polynucleotide, The promoter sequence contains transcriptional control sequences that mediate the expression of the variant. The promoter may be any nucleic acid sequence that shows transcriptional activity in the host ceil including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. In a yeast host, useful promoters are obtained from the genes for Saccharoryces cerevisiae encase (ENO41), Saccharomyces cerevisiae protease A (PRAI), Saccharomvces cerevisiae protease B (PRB1) Saccharomyes cerevisiae translation elongation factor (TEFI) Saccharornvces cerevis'aa translation elongation factor (TEF2), Sacvharonyces ceravishae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/giyceradehyde 3hosphate dehydrogenase (ADH, ADH2IGAP), Saccharomyes cerevwssa triose phosphate isomerase (TPI) Saccharomyces cerevIs/ae metaliothionein (CUP1), and Saccharomyces cereis/ae phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romans et al, 1992, Yeast 8: 423-488, The control sequence may also be a suitable transcription terminator sequence which is recognized by a host cell to terminate transcription, The terminator sequence is operable linked to the terminus of the polynucleotide encoding the variant. Any terminator that is functionaln the host cell may be used. Preferred terminators for yeast host cells are obtained from the genes for Sacharimnyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYCI), Saccharomyces cerevistae alcohol dehydrogenase (ADH1) and Sacchamyvces cerevisiae glyceraldehyde phosphate dehydrogenase, Other useful terminators for yeast host cells are described by Romanos et al., 1992, sopra, The controlsequence may also be a suitable leader sequencea nontranslated region of an mRNA that is important for translation by the host cel The leader sequence is operable linked to the 5'4terminus of the polynucleotide encoding the variant, Any leader sequence that is functional in the host cell may be used. Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevsCae enolase (ENO.-1), Saccharomyces cerevisa 3phosphoglycerate kinase, 31 Saccharoinyces cerevisiae alpha-factor, and Saccharomyces cerevisae alcohol dehydrogenaseglyceraidehyde-3-phosphate dehydrogenase (ADH2/GAP), The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3-terminus of the variant-encoding sequence and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used. Usefubpolyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, MoL CeLlarbo 15: 5983-5990, The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a variant and directs the variant into the celFs secretary pathway, The 5'-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region that encodes the variant.Alternatively, the 5'-end of the coding sequence may contain a signal peptide coding region that is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the variant However, any signal peptide coding region that directs the expressed variant into the secretary pathway of a host cell may be used. Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisfae alpha-factor and Saccharomyces cerevisiae invertase Other useful signal peptide coding sequences are described by Romanos et a., 1992, supa Where both signal peptide and propeptide regions are present at the N-terminus of a variant, the propeptide region is positioned next to the N-terminus of the variant and the signal peptide region is positioned next to the N-terminus of the propeptide region. Methods of Production The variants of the present invention can be prepared using techniques well known to the skilled person. One convenient way is by zoning nucleic acid encoding the parent albumin or a fragment thereof or fusion polypeptide comprising albumin or a fragment thereof, modifying said nucle acid to introduce the desired substitution(s) at one or more (several) positions corresponding to positions 417, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503. 504, 505; 506 510, 535, 536, 537, 538 540, 541, 542, 550 573 574 and 580 in SEQ ID NO: 2, where the variant is not the variant consisting of SEQ iD NO:2 with the substitution D494N, E501K, K51IE, D550GA, K573E or K574N., prepang a suitable genetic construct where the modified nucleic acid 32 is placed in operative connection with suitable regulatory genetic elements, such as promoter, terminator, activation sites, ribosome binding sites etc. introducing the genetic construct into a suitable host organism. culturing the transformed host organism under conditions leading to expression of the variant and recovering the variant, All these techniques are known in the art and it is within the skills of the average practitioner to design a suitable method for preparing a particular variant according to the invention. The variant polypeptide of the invention may also be connected to a signal sequence in order to have the variant polypeptide secreted into the growth medium during culturing of the tansformed host organism, t is generally advantageous to have the variant polypeptide secreted into the growth medium in order to ease recovery and purification Techniques for preparing variant polypeptides have also been disclosed in WO 2009019314 (included by reference) and these techniques may also be applied to the present invention. Albumins have been successfully expressed as recombinant proteins in a range of hosts including fungi (including but not limited to Aspergillus (WO06066595)Klvyveromyces (Fleer 1991 Biofechnoogy 9, 968975). Pichla (Kobayashi 1998 Therapeutic Apheresis 2, 257-262) ard Saccharomyces (Sleep 1990, Bokechnology 8 42-46)), bacteria (Pandjaitab 2000, J Allen y Clin. immunot 105, 279-285)). animals (Barash 1993 Transgenic Research 2, 266"276) and plants (including but not limited to potato and tobacco (Sijmons 1990, BioAtechnology 8. 217 and Farran 2002 Transgenic Researh 11, 337-346). The variant polypeptide of the invention is preferably produced recombinantly in a suitable host cell i principle any host cell capable of producing a ptide in suitable amounts may be used and it is within the skills of the average practitioner to select a suitable host cell according to the invention A preferred host organism is yeast, preferably selected among Saccharomycacae more preferred Saccheromvces cerevisiae. The variant poiypeptides of the invention may be recovered and purified from the growth medium using a combination of known separation techniques such as firation, centrifugation, chromatography, and affinity separation techniques etc, It is within the skis of the average practitioner to purify the variants of the invention using a particular combination of such known separation steps. As an example of purification techniques that may be applied to the variants of the present invention can be mentioned the teaching of W00044772. The variant polypeptides of the invention may be used for delivering a therapeuticai ly beneficial compound to an animal or a human individual in need thereof. Such therapeutcally beneficial compounds include, but are not limited, to labels and readily detectable compounds for use in diagnostics, such as various imaging techniques; pharmaceutical active compounds such as drugs, or specifically binding moieties such as antibodies. The variants of the invention may even be connected to two or more different therapeutically beneficial compounds, e.g., an antibody and a 33 drug, which gives the combined molecule the ability to bind specifically to a desired target and thereby provide a high concentration of the connected drug at that particular target. Fusion polypeptides The variants of albumin or fragments thereof according to the invention may also be fused with a non-albumin polypeptide fusion partner. The fusion partner may in principle be any polypeptide but generally it is preferred that the fusion partner is a polypeptide having therapeutic or diagnostic properties Fusion polypeptides comprising albumin or fragments thereof are known in the art. It has been found that such fusion polypeptide comprising albumin or a fragment thereof and a fusion partner polypeptide have a longer plasma half-ife compared to the infused fusion partner polypeptide. According to the invention it is possible to alter the plasma half-life of the fusion polypeptides according to the invention compared to the corresponding fusion polypeptides of the prior art. One or more therapeutic polypeptides may be fused to the N-terminus, the C-terminus of albumin, inserted into a oop in the albumin structure or any combination thereof, It may or it may not comprise linker sequences separating the various components of the fusion polypeptide. Teachings relating to fusions of albumin or a fragment thereof are known in the art and the skilled person will appreciate that such teachings can also be applied to the present invention. WO 2001/79271 A and WO 2003/59934 A also contain examples of therapeutic polypeptides that may be fused to albumin or fragments thereof, and these examples apply also to the present invention. Conjugates The variants of albunin or fragments thereof according to the invention may be conjugated to a second molecule using techniques known within the art Said second molecule may comprise a diagnostic moiety and in this embodiment the conjugate may be useful as a diagnostic tool such as in imaging; or the second molecule may be a therapeutic compound and in this embodiment the conjugate may be used for therapeutic purposes where the conjugate will have the therapeutic properties of the therapeutic compound as well as the long plasma half-fe of the alburnin. Conjugates of albumin and a therapeutic molecule are known in the art and it has been verified that such coniugates have long plasma half-life compared with the non-conjugated, free therapeutic molecule as such. The conjugates may conveniently be linked via a free thio group present on the surface of HSA (amino acid residue 34 of mature HSA) using wellnown chemistry In one particular preferred aspect the variant albumin or fragment thereof is conjugated to a beneficial therapeutic compound and the conjugate is used for treatment of a condition in a patient in need thereof, which condition is responsive to the particular selected therapeutic compound. Techniues for conjugating such a therapeuticay compound to the variant albumin or fragment 34 thereof are known in the art, WO 20091019314 discloses examples of techniques suitable for conjugating a therapeutically compound to a polypeptide which techniques can also be appiied to the present invention, Further WO 2009/019314 discloses examples of compounds and moieties that may be conjugated to substituted transferring and these examples may also be applied to the present invention, The teaching of WO 2009/019314 is included herein by reference HSA contains in its natural form one free thiol group that conveniently may be used for conjugation.As a particular embodiment within this aspect the variant albumin or fragment thereof may comprise further modifications provided to generate additional free thio groups on the surface This has the benefit that the payload of the variant allbumin or fragment thereof is increased so that more than one molecule of the therapeutic compound can be conjugated to each rnolecule of variant albumin or fragment thereof or two or more different therapeut ic compounds may be conjugated to each molecule of variant albumin or fragment thereof, e ga compound having targeting properties such as an antibody specific for example a tumour; and a cytotoxic drug conjugated to the variant albumin or fragment thereof thereby creating a highly specific drug against a tumour, Teaching of particular residues that may be modified to provide for further free thiol groups on the surface can be found in copending patent application WO 2010 092135, which is incorporated by reference, Associates The variants of albumin or fragments thereof may further be used in form of "associates". In this connection the term "associate is intended to mean a compound comprising a variant of albumin or a fragment thereof and another compound bound or associated to the variant albumin or fragment thereof by non-covalent binding, As an example of such an associate can be mentioned an associate consisting variant albumin and a lipid associated to albumin by a hydrophobic interaction Such associates are known in the art and they may be prepared using welnown techniques.As an example of a preferred associate according to the invention can be mentioned an associate comfprising variant albumin and paclitaxel. Other uses The variant albumin or fragments thereof or fusion polypeptides comprising variant albumin or fragments thereof according to the invention have the benefit that their plasma half-life is altered compared to the parent albumin or fragments thereof or fusion polypeptides comprising parent albumin or fragments thereof. This has the advantage that the plasma half-life of conjugates comprising variant albumin or a fragment thereof or fusion polypeptide comprising variant alburin or a fragment thereof, or an associate comprising variant albumin or a fragment thereof according to the invention can be selected in accordance with the particular therapeutic purpose. 35 For example for a conjugate, associate or fusion polypeptide used for imaging purposes in animals or human beings, where the imaging moiety has an very short halflife and a conjugate or a fusion polypeptide comprising HSA has a plasma half-life that is far longer than needed for the imaging purposes it would be advantageous to use a variant albumin or fragment thereof of the invention having a shorter plasma haff-life than the parent albumir or fragment thereof, to provide conjugates of fusion polypeptides having a plasma halfflife that is sufficiently long for the imaging purpose but sufficiently short to be cleared form the body of the particular parent on which it is applied, In another example for a conjugate, an associate or fusion polypeptide comprising a therapeutic compound effective to treat or alleviate a particular condition in a patient in need for such a treatment it would be advantageous to use the variant albumin or fragment thereof having a longer plasma half-life than the parent albumin or fragment thereof, to provide associates or conjugates or fusion polypeptides having longer plasma half-lives which would have the benefit that the administration of the associate or conjugate or fusion polypeptide of the invention would be needed less frequently or reduced dose with less side affects compared to the situation where the parent albumin or associates thereof or fragment thereof was used, In a further aspect the invention relates to compositions comprising the variant albumin, associates thereof or fragment thereof, variant albumin fragment or associates thereof or fusion polypeptide comprising variant albumin or fragment thereof according to the invention. The compositions are preferably pharmaceutical compositions. The com position may be prepared using techniques known in the area such as disclosed in recognized handbooks within the pharmaceutical field. in a particular embodiment the compositions comprise a variant albumin or a fragment thereof according to the invention and a compound comprising a pharmaceutically beneficial moiety and an albumin binding domain (ABD), According to the invention ABD means a site, moiety or domain capable of binding to circulating albumin in vivo and thereby conferring transport in the circulation of the ABD and any compound or moiety bound to said ABD. ABD s are known in the art and have been shown to bind very tight to albumin so a compound comprising an ABC bound to albumin will to a certain extent behave as a single molecule The inventors have realized by using the variant albumin or fragment thereof according to the invention together with a compound comprising a pharmaceutically beneficial moiety and an ABD makes it possible to alter the plasma half-life of the compound comprising a pharmaceutically beneficial moiety and an ABD compared to the situation where said compound were injected as such in a patient having need thereof or administered in a formulation composing natural albumin or a fragment thereof, 36 The variant albumin or fragments thereof, conjugates comprising variant albumin or a fragment thereof or fusion polypeptide comprising variant albumin or a fragment thereof, or an associate comprising variant albumin or a fragment thereof according to the invention may also be incorporated into nano- or microparticles using techniques well known within the art. A preferred method for preparing nano- or microparticles that may be applied to the variant albumins or fragments thereof according to the invention is disclosed in WO 2004/071536 which is incorporated herein by reference; Compositions The present invention is also directed to the use of a variant of albumin or a fragment thereof or fusion polvpeptides comprising variant albumin or fragments thereof or a conjugate comprising a variant of albumin or a fagment thereof; or an associate comprising a variant of albumin or a fragment thereof for the manufacture of a pharmaceutical composition, where in the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, or a conjugate comprising a variant of albumin or a fragment thereof, or an associate comprising a variant of albumin or a fragment thef has an altered plasma halflife compared with HSA or the corresponding fragment thereof or fusion polypeptide comprising HSA or fragment thereof or corugate comprising HSA. In this connection the corresponding fragment of HSA is intended to mean a fragment of HSA that aligns with and has same number of amino acids as the fragment of the variant albumin with which it is cmpared. Similarly the corresponding fusion polypeptide comprising HSA or conjugate comprising HSA is intended to mean molecules having same size and amino acid sequence as the fusion polypeptide of conjugate comprising variant albumin, with which it is compared. Preferably the vacant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof has a plasma half life that is higher than the plasma half-life of HSA or the corresponding fragment thereof or fusion polypeptide comprising HSA or fragment thereof. Alternatively, this may be expressed as the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof has a KID to FoRn that is lower that the corresponding KD for HSA or the corresponding fragment thereof or fusion polypeptide comprising HSA or fragment thereof. Preferably, is KD for the vacant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereoffragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof less than 0.9X KD for HSA, more 37 preferred less than 0,5X KD for HSA, more preferred less than CJX KD for HSA, even more preferred less than 0.05X KD for HSA, even more preferred less than 0.02X KD for HSA and most preferred less than 0,01X KD for HSA. The variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof is preferably the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof; fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof according to the invention. The present invention is further described by the following examples that should not be construed as limiting the scope of the invention Examples Materials and Methods ELISA: Wells were coated with wildtype HSA or variants diluted in phosphate buffered saline (PBS) to stated concentrations, incubated overnight at 4 C and then blocked with 4% skimmed milk (Acurnedia) for 1 hour at room temperature, The wells were then washed four times with PBS/0.005% TWEEN@ 20 (PBS/T) pH 6,0 before glutathione-S-transferase (GST -fused ()shFcRn (05 pg/mI) as described in FFS J. 2008 Aug;275(1a)409710. pre-ircubated with an horseradish peroxidase (HRP)-conjugated polyclonal anti-GST from goat (1:5000 GE Healthcare) diluted in 4% skimmed milk PBS/0.005% TNEEN@ 20 (PBS/T) pH 60 was added to each well and incubated for 1 5 h at room temperature followed by washing four times with PBS/IT pH 6.0. One hundred p1 of the substrate tetramethylbenzdine (TMB) (Caibiochem) was added to each well and incubated for 45 min before 100 pi of 0 25 M HeI was added. The absorbance was measured at 450 nrm using a Sunrise TECAN spectrophotometer (T ECAN, Maennedorf, Switzerland). The same ELISA was repeated with PBS/T pH 7.4. Surface Plasmon Resonance (SPR): SPR experiments were carried out using a Biacore 3000 instrument (GE Healthcare), Flow cells of OMS sensor chips were coupled with shFcRn-GST (~1400-500RU) using amine coupling chemistry as described in the protocol provided by the manufacturer. The coupling was performed by injecting 10pg/ml of the protein in 10mM sodium acetate pH 5.0 (GE heaithcare). Phosphate buffer (67mM phosphate buffer, 0,15M NaCl, 0,005% TWEEN@ 20) at pH 6,0) was used as running buffer and dilution buffer. Regeneration of the surfaces were achieved using injections of HS-EP buffer (0.01M HEPES, 0.15M NaCl, 3mM EDTA, 0.005% surfactant P20) at pH 7.4 (Biacore AB), For binding to immobilized shFcRn-GST, 1,0-0,5 pM of each HSA variant was injected over the 38 surface at constant flow rate (40 pl/mi) at 25 C, In all experiments, data was zero adjusted and the reference cell subtracted. Data evaluation was performed using BlAevaluation 4.1 software (BlAcore AB), The same SPR assay was repeated with HBS-EP buffer pH 7,4. For the purposes of this patent unless otherwise stated HSA, WT HSA, rHA refer to Recombinant human serum albumin commercially avadable under the registered tradename RECOMBUMiN (available from Novozymes Biopharma UK Ltd, Nottingham UK) was used for the examples, Serum albumin from other species: The albumins werecombinant wheres stated, produced using sequences provided from publicly available databases. Or purchased from commercial supplers, FoRn Expression and purification of soluble Human (shFcRn) and Mouse (smFcRn) FcRn: Methods for the generation of shFcRn and smRFcRn expression plasmids, expression and purification of each heterodimer can be found in Berntzen et at (2005) J, immune, Methods 298:93104)MAlternatively shFcRn FcRn heterodimer was produced by GeneArt AG (Gemany). Sequences for the two sub units of the heterodimer can be found in SEQ ID NO: 3 and SEQ ID NO: 4, The soluble receptor was expressed in HEK293 cells and purified from culture supernatant using NiHiTrap chromatography columns. Example 1. Preparation of variants Preparation of specific HSA mutein expression plasm ids Methods for the expression of HSA mutant variants and HSA fusion variants were produced using several techniques. Standard molecular biology techniques were employed throughout such as described in Sambrook J, and 0 W, Russel, 2001. Molecular Cloning; a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Method 1. Amino acid substitutions in HSA detailed in Tabiel Synthetic DNA No/Sai fragments (859 bp) were generated by gene assembly (GeneArt AG, Germany) containing point mutations within the HSA-encoding gene (SEQ ID NO: 1) to introduce the desired amino acid substitution in the translated protein Table 2 details the codons used to introduce the amino acid substitutions into the HSA-encoding gene, The nucleotide sequence of the synthetic fragment encoding unchanged amino acids (i.e. wild type) was identical to That in pDB 2 24 3 (described in WO 00/44772). The synthetic nucleotide fragments were ligated into Ncol/Sacl-digested pDB2243 to produce plasmids pDB3876 --- pDB3886 (Table I). For the production of expression plasmids, pDB3876 --- pDB3886 (see Table 1) were each digested with 39 Nod and Pvol, the DNA fragments were separated through a 0.7% (w/v) TAE gel, and 2992bp fragments (Woi cassettes' including PRBI promoter DNA encoding the fusion leader (FL) sequence (disclosed in WO 2010/092135), nucleotide sequence encoding HSA and ADHI terminator; see Figure 1) were purified from the agarose gel using a Qiagen Gel Extraction Kit f'ollowi ng the manufacture's instruction s dNot cassettes' were gated into a Not/Shrimp Alkalne Phosphatase (Roche) treated "disintegration" plasmid pSAC35, disclosed in EP-A-286 424 and described by Sleep, D, ef at (1991) Si/Technology 9, 183 - 187. Ligation mixtures were used to transform chemically-competent E. co/i DHa. Expression plasmids pD3887 pDR3897, pSAC35-derivatives containing the 'NotI cassettes"were identified using standard techniques. Disintegration plasmids pDB3887 pDB3897 and p082244 (For the expression of wild type HSA, described in WO 00/44772) (Table 1) were used to transform S, cerevslae BXP10-ci (as previously described W0/2001/079480 as described below. Table 1: Plasmid, amino acid substitution introduced into HSA Plasmid Construct pDB3876 HSA D494N PD5357 HSA 54A gO063878 HSA E4950 pDB3879 ISA E495A pDB3880 HSA 0494Q pDB3881 -1SA D494 T496A p0B388 2 HISA T496A pDB$535 MS A4920 pDB3884 HSA E492G V493P pDB3s886 TISAE492H pDB3887 iISA 04941 p55J555 ISAX 0454A pDB3889 HSA E495Q p0B3890 HSA E495A pDB38 9 1 ISA 04940 pDB31892 HSA D494N, T496A pDB3893 HSA T494A pDB3895 1SA E492G V493P p01 $~n SA 69 pD 6 3897 HSA E492P 40 n/a = Not applicable. pDB3876-pDB3886 are subdoning plasmids, Table 2, Codons used to introduce amino acid substitutions into HSA Amino acid Codon GGT G1u GAA Asp OAT a GTT Ala GCT ArQ AGA Asr AAT Met AG lie ATT Thr ACT T- TGG Tyr TAT Leu TTG Phe TTT ------------------ T C T Gin CAA Hts CAT Stop TAA Method 2 reduction oi HSA variants D494N+E495Q+T496A and E495Q+T496A A PCk-based method, using a QuickChange Lightening Kit (Statagene, was employed to itoduce point mutations into HSA, Oligonuciectide pairs xAP094 (SEQ ID NO: 5)/xAP09 (SEQ D NO: 6) and xAP096 (SEQ ID NO: 7)/xAP097 (SEQ ID NO: 8) were used to generate two HSA variants (D494N+E495Q+T496A and E495Q+T496A, respectively), Plasmid pDB3927(disclosed in WO 2010/092135) was used as template DNA and the methodology recommended by the manufacturer of the kit was followed, The resulting plasirnds were named pDB3996 and pDB3996 (contain H-SA D494N+-E4950+T496A and E495Q+T496A expression cassettes, respectively), pDB399 and pDB3996 were digested with BstElliBsri and the linearised DNA molecules were purified using standard techniques, One hundred ng of each BstEi/PsrBI digested DNA, purified using a Qiagen PCR-Purification kit following the manufacturer's instructions, was mixed individually with 1 S0ng AcS/BamH-igested pDB3936) (disclosed in WO 2010/092135) and 41 used to directly transform S. care vis/ac BXP1Odr using the Sigma Yeast Transformation kit described below Method 3. Amino acid substitutions in HSA detailed i Table 3 Piasmid p093927 (disclosed in WO 2010/092135) (containing an identical nuceotide sequence encoding HSA as in p02243) was manipulated to amino acid substitutions within the mature HSA protein. Synthetic DNA fragments were generated (GeneArt AG, Germany or DNA2.0 inc, USA) (NcoliBsu36i, AvrUSphi or SacVSphI fragments), containing point m stations within the HSA-encoding gene to introduce the desired amino acid substitutions) into the translated protein sequence. Tabe 2 details the codons used to introduce the amino acid substitutions into the HSA encoding gene, The nucleotide sequence of the synthetic fragment encoding unchanged amino acids (i.e. wild type) was identical to those in pDB392 7 . Synthetic DNA fragments were sub-coned into NcoI/su36, Awrl/Sphi-, Sad! Sph -digested pDB3927 (described in PCT 11 527204-4O) to generate pDB4006-p8D4010, pDB4083-pDa4101 and pDS4103-pDB4111 and pDB4194, pDB4200,pDB 4 202 (see Table 3), Similarly, SamH/Sal fragments containing point mutations in the nucleotide sequence encoding HSA were generated by gene assembly (DNA2.0 Inc, USA) and ligated into BamHIiSail digested pDB3964 (described in WO 2010/092135) to produce plasmids pDB3986p093989 (Table 3). The C-terminai string of amino acids from position 573-35 (KKLVAASQAALGL) (SEQ 10 NO: 9) in HSA were mutated to those in rnacaque (PKFVAASQAALA (SEQ ID NO: 10), mouse (PNLVTRCKDALA) (SEQ ID NO: 11) rabbit (PKLVESSKATLG) (SEQ ID NO: 12) and sheep (PKLVASTQAALA) (SEQ I0 NO: 13) serum albumin. The codons used to introduce each amino acid substitution are given in Table 2, Synthetic DNA fragments (SacI/Sphl) were generated (DNA2.0 Inc, USA) by gene assembly (the nucleotide sequence of the synthetic fragment encoding unchanged amino acids (i e. wild type) was identical to that in pDB3927) and were sub-cloned into Sac/Sphl-digested p093927 to produce plasmids pDB4114-4117 (Table 3). Plasmids pDB3883 (Table 1), pDB4094 and pDB4095 (Table 3) were digested with No/Sacl and 857bp fragments from each digest were purified before being ligated into NcoUSacl digested pDB4006 or pDB4110 (8,688kb) (Table 3) to produce pDB4156-pDB4161, Expression plasmids were generated in vivo (ie, via homologous recombination in S. cerevisiae: a techniquereferred to as gap repair or in vivo cloning- see Orr-Weaver & Szostak 1983. Proc. Natl, Acad Sc USA, 80:4417-4421) Modified plasmids listed in Table 3 were digested with BstElWBsrB1 and the linearised DNA molecules were purified using standard techniques. One hundred ng of each BstEIlI/Bsra digested DNA. purified using a Qiagen PCRPurification kit 42 fobowing the manufacturers instructions, was mixed indMdually with 100ng Acc65UBamHl digested pOB3936 (disclosed in WO 2010/092135) and used to directly transform S cerevisiae BXP10ciro using the Sigma Yeast Transformation kit described below. Table 3 Plasmid Amino acid substitution in HSA pDB3987 HSA H4634Q B~3988 HSA H5100 HSA H535Q pDB400C HSA K73A pDB4O07 H$A E492T/N503K/K541A pDB4b08 HSA KS41G pDB4U009 |HSA K541fJ pDB4O10D HSA DS50N pDB4083 | HSA D4094EQ41~7H pDB84 HSA Q4IA pDB4087 HSA K560A pt4S HSA KS3"A rDB4088 HSA P537A D0608 lISA K500A DBt4090 HSA E492GNv493P/K538H/KS41N/5420 pDB409 1 HSA E492P/N503K iK541 G/E542P 6084092 H1SA NS03K pDB4093 lS S3 pDB40 4 H SA E492G N 3K 84 0 98 HSAE492G/N503D pDB04U99 HSA K538H DB410 HSA K541A pDB4101 HSA K541N pDB4103 HSA E5420 pDB4105 HSA 0550E pDB106HSA E492HfE501P/N503H/ES5D5/T506s/T540S/K541 E HSA p0B4107 A490/E492TNV493LUE501IP/N503/A50 4E1E505K/TSO6F/K54 10 pDB4 1 08 HSA E501A pDB4109ISA E501Q pD 6 4 10 HSAK573P 43 pDB41 11 HSA E492/K538H1K54N IN!E42D pD 4 114 HJA K573PitL75F/G584A pDB411 HSA K573P/K574WNA577T/A578R/S579C/0580K A5810D G584A DB411 lb SA573P/A5Y7EJA578S/O580K/A582T p0417 HSAKT3/58SSTT]54 pDB415SvS HE 492G K573A 'pB4 159 H9 AE492G K573P pDB4160 HSA £4920 N503K K573P DB84194 H SA 0550£ pDB420 HSA K574N pDB4202 HSA Q580K able 4 K500 prirners arnd pasr d Or ginaI primners CODONS USED CTTGGAAGTCOGACGAAACTTACGTTOOCCA MAATTAACGCTG OTTTGGAAGTOGAOGAAACTTACGTT0CAGItGAATTCXAAGCTG xAP219' (SEQt)NO: 75 W57 G OTTTGGAAGGACGAAAOTTACGTTCCAAGAGAATTOAACGOTG xP4I ' SA E492 NO: 3 1 K)Asp3A CTTTGGAAOTO AOOGAACTTAOGTTCCA0ACGAATTOAACG 0TG xAP221 (SEQAD NO;9 AsnK AAT CTTTGGAAGTOGAOGAAAOTTAOGTTOCAACGAATTCAA0G00Gh xAP2220 (SEQ ~D NO: 18) Met ATG 0TTTGGAAGTCOACGAAACTTAOGTTCCASAATTCAAOGCTGO OTTTGGAAGTCGACGAAACTTACGTTCCAATQGAATTOAAOGCTG xAP2 (SEQ iD NO: 22) T Alt OTTTGGAAGTOGAOGAAAOTTACGTTCC0ATTGAATTCAAOGCTG CTTTGGAAGTOGA0GAATTA0GTTC CATO GAATTCAACGOTG xAP224 (SEQ D__O: 22 T TTcO xAP290TTTGGAAGTCGAOGAAACTTACGTTCCAO$GAATTCAACGOTO h T StC !S NO: 23) - I -- ---------------------------- T-------- A-- O-- O---- A---- T-- T---------- T-------- A--------------- A A---------- A A------------ T OxAP226~SCO D NO: 4) Ov ....... AA.T..A...A.T.A..TT........T......... xAW 9 7 (SEQ )55NO:E5 y"' ATT--OAA-T-A-O-AA-T-A--T--0-------T-AA----T xAPB'2$ ('SQ iS ,N26Le __ X A P- --- ---- ----- T ---------- A --- T ------ A ----- A--- A------- A------ T T------ A---------- A A----T---A A---------T-------------- Tabk! , K44 (SEQ ID NO: 27) TTTGGAAG-TGGACOA~lATTAOCGTTOOA 1-:.-G ,OTTCAACGCT xAP23 EQ D NO 28) Ser TCT CTTTCAAG TOOACGAAAOTTAOGTTOCA ' AAGXATTCAACGTC xAP231 (SEQ ID NO: 29) Gn CAA GTTTGaAAGTQACTAAAAOAAGOAOGAATTGAACCTG Odgiri prrner CDON xAP187 (SEQ ID NO: 3) Has GG xA18(EO IDNO: 31G u AA ATTT AAGTOOQAGCGACTTAGCOAACAAGTTAAGACCTCCC xAP190 (EQ DNO:..... OAXTTAAGCTTATTAGAAAOAAAGAGCAAOAAGTAAOG (SEQ xUSED ATAAGCGTAAGGCAGCTTGACTT GCAGCAACAAGTTT 'ACCCTCCTCG xAP188 (SEQ ID NO: 35) MI GM ATAAG'TAA-GOAGCTTGACTTGCAGOAACAAOTTT.JACGTOOT CG xAP189 (SEQ ID NO: 3t Asp GAT ATAA0TAAG0AGCTTGATTAG AACAAGTTT A55CT55CTCrN I xA P195 (SEQ ID~NIO'~3)~ Vhr AT ATAAGGGTAA3OGAGTPOGACTTCOOAGOAAGAAGTTT TAAOOCTOTCG xAP196 (SEQ ID NO: 43) A rp TGG ATGGTAAC AGGTTACTixTG O5AGAAAGTTTP- 'FAGCGT xAP1972 (SEQ ID~NO: 39 As AT ATAAGCOSTAAGGCAGCTTGACTTGCAGOAACAAGTTT AGGGOTCO TCG xAPI91 'SEQ iD NO: 4) tet ATG ATAAGCCTA AC GCAGCTTGACTTGCAGCAACAAGTATT:' ACCCTCCTC xAP12 (SEQ ID NO 3) he AT ATAAGGTAAGG CAGCTTGACTTGGCAGCAACAAGTTTAGAACCTCCTCTCG xAF'193 (S EQ ID7,\ NO:,ib 44) C Xs ' ATAAGCGTAAGC G AGGTTGCTT(GC3rAACAAGTTT. "'NAGGGTGT AT.MCGGAAO - CGAGOTTGAGTTCGAGGAAGA AGTTT .',,"ACCGTCTTCO xAP2O1 (SEQ iD N 4Th ACT ATA.AGGG TAAGGGAGGTTGAOTTG AGG-AAGA4AGT I , dA 'TCG( xAP2Ol (SEQiD NO: 48) Lar 'G 45 AT AAZGOQ TAAEC30AGCTTGACT TGCAGGAACAA GTT TITACCCTCCTCG xAP202 (S D NO: 49) Gin CAA ATACCTAAGGOAGCTTGAOT'TGOAGOAAOA- AGTT"T' : >5ACCqQTQCTCQ xAR203 (SEO 0NO:0 H~ i s, CA xAP203 (SEQ ID NO: 51Hs OP taa xAP205 AATCCTGCCA TGGAG,'ATiCTGC3(TTGAATG;TGCTG ATG (S'EIQ D NO: 52) Method 4. HSA K1500 arid K573 temuahn brar PCR was used to produce two permutation libraries in which the coduins encoding amino acid 500 or 573 of mature HSA were changed (mutated) to alternative non-wild type amino acids and a termination codons (K5XXSTOP). Mutagenic o gonucletides (Table 4 and Table 5), were designed to amplify HSA- encoding DNA and incorporate the desired changes. That is, for the changes at position 500, pDB4082 (Figure 1) was used as a template DNA. pDB4082 is a derivative of pDB2305 (disclosed in EP 1788084) and was produced as follows. pDB2305 (FIgure 2) was digested with N/l!Spel and the yielded 8.779kb Nsil fragirment was self-ligated to produce pDB 4 005 (Figure 3), A synthetic DNA fragment (Bsal/Sphl) was generated by gene assembly (DNA20 inc, USA) (SEQ lD NO: 1) (containing 3' region of the PRB1 promoter, modified fusion leader sequence, nuceotide sequence encoding HSA and 5' region of the modified ADHI terminator), and ligated into Hindli/Sphl-digested pDB4005 (Figure 3) to produce pDB 4 082. Note. The Hindill site in PRB1 promoter site has been removed and a Sacil site within the nucleotide sequence encoding HSA has been introduced. For the permutation library for position 500 of HISA, the nucleotide sequence encoding HSA corresponding to that between the Sall / Hindil sites (see plasmid map pDB 4 082, Figure 1) was generated using the New England Biolabs Phusion kit (Table 6) and oligonucleotid'es listed in Table 4. Table 7 describes the PCR method employed. The permutation library at amino acid position 573 in HSA was generated usng pDB3927 as template DNA and Involved am pifying the albu min-encoding DNA corresponding to that between the Ncol and Bsu36I sites using oligonucleotides detailed in Table 5. Table C:; FOR ingredients \fl lr? I o brary 20;' Buffe.r NFs'5Xi.M 2- I d N TP m ix C)M(10mM) . .......... 2 oligonucleotide 2(: igonucetde xAP216 xAP187 46 IIP husion polymerase..L 1 I Template DNA --~5ng- DB40182 DB3927 72--i- 1 (HL,,OIN\ OKI Table 7. PCR conditions 57C for 3Osec 67'C for S wi I ycl For the abumin variants based at positions 500 and 573, each PCIR-product was punfied using a Qiagen PCP-clean up kit (according to the manufactures instructions), digested with Sa/l/irhlll (position 500 library) or Ncol/Bsu36 (position 573 library), The digested DNAs were then purified using a Qiagen PRclean up kit and ligated into Sal/ HindlIl or Ncol/BsuI61 digested pDB4082 or pDB3927, respective replacing the equivalent native sequence. Ligations were transformed into E. co/l DH5a subsequent pliasmids isolated from transformants using a Qiagen miniprep kit (according to the manufacturer's instructions) and the correct constructs idcntiied by restriction analysis. This produced a collection of plasmids, pDB4204 - pDB4222 (position 500 library) pDB4173 to pD 8 4190 (position 573 library), containing albumin genes which differed only in their sequence corresponding to the codorn for the amino acid at position 500 or 573 Table 4 and 5, respectively). The specific changes in each plasmid were confirmed by sequencing. The resultants plasmids were used to generate expression plasmids and albumin fusion producing yeast by in vivo cloning as described above, That is, . cerevisiae was transformed using the Sigma Yeast Transformation kit (described below), using a mixture of a 100 ng BstEli/Bs$81ldigeste HSA variant containing plasmid and 100 ng Acc65l/BamH1i digested pDB3936. Transformation of S, cerevisiae S cerevis/ae BXP10 o as previously described WO/2001/079480) or Strain A cir4 (described in W0/2005/061718) was streaked on to YEPD plates (1% (wiv) yeast extract, 2% (wiv) Bactopeptone. 2% (w/v) glucose), 1.5% agar) and allowed to grow for 4 days at 30'C prior to transformation One g of whole plasmid (i.e, circular plasmids) or, for gap repair 100 ng BtEI/Bsr or NsiliPvu-digested HSA variant or HSA variant fusion containing plasmid and 100 ng A ccG5l!SamHI digested pDB3936 were used to transform S. erevtsiae using a Sigma Yeast Transformation kit using a modified lithium acetate method (Sigma yeast transformation kit, YEAST-1, protocol 2; Ito et at, (1983) BacterioL 153, 16: Elble, (1992) Biotechniques, 13, 18), The protocol was amended slightly by incubating the transformation at room temperature for 4 h 47 prior to heat shock. Following heat shock, the cels were briefly centrifuged before being re suspended in 20pl I M sorbitol then spread over BMMD agar plates; the composition of BMMD is described by Sleep ey a (2001) Yeast, 18, 403. Rates were incubated at 30'0 for 4 days before individual colonies were patched on to fresh BMMD plates, Yeast strain numbers are detailed in Table I Stocks were prepared for each yeast strain as follows: BMMD broth was inoculated with a heavy loop of each yeast patch and grown for 24h at 30C with orbital shaking at 200rpm. Cells were harvested by centrifugation at 1900 x g for 5 min in a Sorval RT600 centrifuge. i rmL supernatant was removed and replaced by trehalose 40% (w/v) The cells were resuspended and transferred to cyrovials (lmL) for storage at -S80. Shake flask growth of & cerevisiae BMMD (recipe 0,17% (w/v) yeast nitrogen base without amino acid and ammonium sulphate (Difco), 372rmM ammonium sulphate, 29mM citric acid. 142mM disodium hydrogen orthophosphate dehydrate pH6.5, 2% (wiv) glucose) media (10mL) was inoculated with each yeast strain and grown for 12h at 3C" with orbital shaking at 200rpm, An aliquot of each starter culture (4mL) was used to inoculate 2 x 200mL BMMD media and grown for 36h at 3'C with orbital shaking at 200rpm, Cells were harvested by filtration through 0,2pm vacuum filter membranes (Stericup, Milipore) including a GF-D prefiter (Whatman) and the supernatant retained for purification, Primary concentration Retained culture supernatant was concentrated using Tangential Flow Filtration using a Pal Filtron LV system fitted with a Omega 10KD (0.093sqm2) filter (LV CentramateTM cassette, Pall Filtron) with a transmembrane pressure of 20psi and a circulation rate of l80mnain Fermentation Fedeatch fermentations were carried out in a 10 L Sartorius Biostat C fermenter at 30t: pH was monitored and adjusted by the addition of ammonia or sulphuric acid as appropriate, The ammonia also provided the nitrogen source for the cultures, The level of dissolved oxygen was monitored and linked to the stirrer speed, to maintain the level at >20% of saturation, Inocula were grown in shake flasks in buffered minimal media (recipe) For the batch-phase the cultures was inoculated into fermenter media (approximately 50% of the fermenter volume) containing 2% (wV) sucrose. The feed stage was automatically triggered by a sharp rise in the level of dissolved oxygen, Sucrose was kept at growth-limiting concentrations by controlling the rate of feed to a set nominal growth rate. The feed consisted of fermentation media containing 50% (w/v) sucrose, all essentially as described by Collins. (Collins, S.H., (1990) Production of secreted proteins in yeast, in: TR Harris (Ed.) Pmtein production by biotechnology, Elsevier, London. pp. 61i7 GP-HPLC quantitation 48 Purified albumin variants, fusions and conjugates were analysed by GPtIPLC and quantification as follows, injections of 2.5pL were made onto a 78mm id x 300mm length TSK G30003SWXL column (Tosoh Biosciencet with a 6.0mm id x 40mm length TSK SW guard column (Tosob Bioscience> Samples were chromatographed ir 25mM sodium phosphate, 100mM sodium sulphate, 0.05% (wiv) sodium azide, pH 7O atA mL/min, Samples were quantified by UV detection at 280nm, by peak area, relative to a recombinant human albumin standard of known concentration (IOmgimL) and corrected for their relative extinction coefficients. Purification of albumin variants from shake flask Albumin variants were purified from shake flask (either culture supernatant or concentrated culture supernatant) using a single chromatographic step using an albumin affinity matrix (AlbuPurelh ProMetic BioSciences, Inc.). Chromatography was performed at a constant linear velocity of 240cm/h throughout. Culture supernatant was applied to a 6cm bed heingt. 2,OmL packed bed pre-equilibrated with 5OmM sodium acetate pHS.3. Following load the column was washed with 10 column volume (CV) of equilibration buffer then 50mM ammonium acetate pH8.0 (10CV). Product was elated with either 50mM ammoniur acetate 10mM octanoate pH8.0, 50mM Ammonium Acetate 30mM Sodium 200mM Sodium Chloride pH7.0 or 200mM Potassium thiocyanate. The column was cleaned with 0.SM NaOH (3cv) and 20mM NaOH (3,5cv). Eluate fraction from each albumin variant were concentrated and diafiltered against 10 volumes of 50mM sodium chloride (Vivaspin20 10,000 MWC PES with optional diafiltration cups, Sartorius) Purified albumin variants were quantified by GP-HPLC as described above, Purification of albumin-fusion variants from shake flask Albumin-fusion variants were purified from shake flask culture supernatant using a single chromatographic step using an albumin affinity matrix (AlbuPurew ProMetic BioSciences, Inc.). Chromatography was performed at a constant linear velocity of 240cm/f throughout. Culture supernatant or concentrated culture supernatant was applied to a 6cm bed height 2.mL packed bed pre-equilibrated with 50mM sodium acetate pH5.3. Following load the column was washed with 10 column volume (cv) equilibration buffer then 50mM ammonium acetate pH8.0 (10cv). Product was eluted with either 50mM ammonium acetate 10mM octanoate pH8.0 50mM Ammonium Acetate 30mM Sodium Octanoate 200mM Sodium Chloride pH7.0, 50mM Anmonium Acetate 100mM Sodium Octanoate pH9.0 or 200mM Potassium tnocyanate. The column was cleaned with 0.5M NaOH (3cv) and 20mM NaOH (3,5cv), Eluate fraction from each albumin variant-fusion were concentrated and diafiltered against 10 volumes of 25 mM Tris 150 mM NaCI. 2 mM KC, pH 7.4 (Vivaspin20 10,000 MWCO PES with optional diafiltration cups, Sartorius) Purfied albumin-fusion variants were quantified by GP-HPLC as described above. Purification of albumin variants from fermentation 49 Albumin variants were purified from high cell density fed batch fermentaion supernatants after separation by centrifugation, using a Sorvall RC 30 centrfuge (DuPont) Culture senatant was chromatographed through an 11m bed height column 3.6mL packed bed packed with a custom synthesised albumin affinity matrix (AlbuPureA ProMetic BioSciences.inc.) as described above, Product was eluted using elution buffers describe above at a flow rate of 120cm/h. The eluate fraction(s) was analysed by GP-HPLO. (above) and reducing SDS-PAGE for purity and if required concentrated (Vivaspin20 10,000 MWCO PES) and applied to a 24x96cm column packed with Superdex 75 run at a flow rate of 39cm/h in 25 mM Tris, 150 mM NaCl, 2 mM KCL, pH 7A The peak was fractionated, assayed by GP-HPLC and pooled in order to generate the monomeric protein of interest, Pooled fractions were concentrated (Vivaspin2fl 10,000 MWCO PES, Sartorilus). All proteins to be assayed for receptor (FoRn) binding properties and or other analysis were quantified by GP-HPLC as described above corrected for their relative extinction coefficients. Example 2, Determination of receptor (shFcRn) binding properties of blood derived HSA and recombinant human albumin Essentially fatty acid-free HSA (Sigma-Aldrich) was further purified by size exclusion chromatography as described in Andersen af al (2010) JBiolChem. 285, (7),4826-4836 Ten p:M of monomeric HSA and rHA were analysed using SPR as described above and the data presented in Figure 4. Direct comparison of HSA (blood derived) with recombinant human albumin (Recombumin) at the same concentration (10pM) (Figure 4A and 4B) shows for both samples binding to immobilized shFcRn (pH6.0, pH7,4 respectively) was reversible and pH dependent. In addition, comparison of HSA vs recombinant human albumin by Bosse et a (2005)- J C. lin, Pharmacol 45; *657~57. demonstrated equivalent half life in vivp human study Example 3, Determination of receptor (shFcRn) binding properties of albumin variants Two established FcRn binding assays were used, ELISA and SPR, There are major differences between the assaysIn the ELISA system HSA is coated directly in wells and shFcRr GST is added in solution whereas in the SPR assay shFoRn-GST is immobihzed to a OMS chip and HI-SA injected in solution. The pH can be varied in both systems. The variants were analysed using ELISA at pH 6,0 and pH 74 Results are disclosed in Figure 5. The EL ISA values represent the mean of duplicates, 50 The variants were analysed using SPR analysis at pH 6.0 and pH 7.4. Results are disclosed for a representative number of variants in Figure 6 using a concentration of the variants of 0.2 pM and in Figure 7 using a concentration of the variants of 1 pM, The SPR data disclosed in Figures 6 and 7 were normalized and the relative binding of variants at each concentration is shown in Figure 8 A and B respectively. The conclusions of the analysis are that all tested variants have the characteristic binding to the receptor at pH 6.0 but no binding at pH . The variants D494N .QA E495QA T496A, and D494N+T496A show reduced binding to the receptor compared to HSA; Example 4. Determination of receptor (shFcRnismFcRn) binding properties of albumin variants Using the SPR analysis method below the association constant Ka , the dissociation constant Kd and the binding constant KD calculated for HSA and mouse serrni albumin (MSA) binding to human and mouse FcRn (Table 8), SPR analyses- SPR analyses were performed on a BlAcore 3000 instrument (GE Heaithcare) using OM5 chips and immobilization of smFcRn-GST and shFcRr-GST variants or smFcRn was performed using the amine coupling kit (GE Heaithcare) Protein samples (10 pg/mI) were ejected in 10 mM sodium acetate at ph 4.5 (GE Healthcare), all as described by the manufacturer. Unreacted moieties on the surface were blocked with I M ethanolamine, For all experiments, phosphate buffer (67mM phosphate buffer 015 M NaCI 0 005% TWEEN@ 20) at pH 6.0 or pH 74, or HBS-P buffer (0.01 M HEPES, 0.15 M NaI, 0.005% surfactant P20) at pH 74 were used as running buffer or dilution buffer, Kinetic measurements were performed using a low density immobilized surface (100200 resonance units (RU)). Serial dilutions of hIgGI (2000.0-31 .2 nM) nlgGI (1000.015,6 nM) MSA (20043 pM) and HSA (200 L-3 pM) were injected at pH 6,0 or pH 7.4, at a flow rate 50 puminute at 25"C, Additive binding was recorded by injecting HSA (10 pM). MSA (5 pM), hIgG (100 nM) or rnIG1 (100 nI) alone or two at a time at 250C at .20 p1/minute at pH 6,0 over immobilized shFoRn (-600 RU) or smFcRn (-600 RU). Competitive binding was measured by injecting shFcRn (50 nM) or smFcRn (100 nM) alone or together with diffnt amounts of HSA or MSA (100-0,05 pM) over immobilized HSA (-2600 RU) or MSA (-2000 RU) In all cases, to correct for nonspecific binding and bulk buffer effects, responses obtained from the control surfaces and blank injections were subtracted from each interaction curve, Kinetic rate values were calculated using predefined models (Langmuir 11 igand model, heterogeneous ligand model and steady state affinity model) provided by the BlAevaluation 4.1 software. The closeness of the fit, described by the statistical value 7 that represents the mean square, was lower than 2.0 in all affinity estimations 51 Table 8: Binding constants of HSA and MSA shFcRn and smFeRn., Albumin FcRn Ka Kd KID KD Species Species (10 JMs) (10Is) (pM) Req. IpM) MSA Mouse 4 5 2 1394±31 9.3±0,4 ND SA Human 380 .1 01. 0I8 0.2 ND HSA Nouse NA NA NA 8 2 4A HSA Human 27 T1.3 122 59 45 i0 1 46 05 The KO's were generated using the BAevaluation 4.1 software) A Langjmuir 1 1 ligand model was used throughout The kinetic values represent the average of triplicates, ND means: Not detemined. NA means: Not acquired Example 5. Binding of albumins from other species to human FcRn Commercially available animal albumin (either Sigma-Aldrich or Calbchem) were further purified as described in Andersen et al(2010). JBiol,Chem. 285. (7);4826-4836 The binding of donkey serum albumin, bovine serum albumin, goat serum albumin, sheep serum albumin, rabbi serum albumin, dog serum albumin, hamster serum albumin, guinea pig albumin, rat serum albumin and chicken serum albumin to sh~ckn was determined using the techniques described in Materials and Methods. The ELISA results are disclosed in Figure 9 A-D and the relative bindings summarized in Figure 9 E, The SPR results are shown in Figure 10, where the binding at pH 6.0 and pH 74 for each albumin species are shown. Table 10 shows an overview of the relative binding responses measured using EUSA and SPR: Table 10: Cross-species albuminFcRn binding Albumin IshFcRn specie ELISA SPR _______pH6 0 pH17.4 pH1*0 pH17 4 Human I++ ++4+) Donkey -+ . Cow + Sheep + Goat Rabbit ++++ Do ND ND ++ Ha nster ~+++ + Rat +++ + + M o u s e ----------- --------------------- ------- Chicken I _ 52 Relative binding responses are categorized from strongest (++) to weakest (+) and no binding ( a' Not determined (ND), A hierarchy ranging from strongest to weakest binding is as follows; guinea pig4> rabbit > hamster/dog > rat/mouse > donkey > human > bovine > goat/sheep > chicken. This data shows that animal albumins have different affinities for shFcRn. Example 6, Kinetics of the HSA variant for shFcRn The binding constants for variants according to the invention were determined according to the methods described in Materials and Methods, Table 11, Binding constants of HSA variants for shFcRn Albumin Ka kd KD KD Req Variant (1&/Ms) (10 /sJ) (p) pM WT3,2+0,2 15.25 4, 5.4 D494N 1.7±0.0 18,620,0 10,9 11,8 D494A 2,3±0.1 53.4±0.3 23.2 17. D4940 2.1±0,0 58,213,8 27, ND. E495Q 2,5±010 24.102' 9,6 1. E495A .2,1f0,0 14.0t0,0 7,0 3.6 D494N+T496A 2 5±0.0 11,0 0, 0 4.4 5,5 T496A 2,3±0.0 11.7+0b 5 , 7.1 E492G 4.1±0,0 11,00,0 2.7 ND The KD's were generated using the BiAevaluation 4,1 software) A Langmuir 1:1 ligand model was used throughout. The kinetic value represen t the average of triplicates. ND means: Not determined. The results correspond with the conclusions made in Example 3 based on SPR and ELISA data but in addition shows that E492G has increased affinity to its receptor, Example 7 Competitive analysis of the lISA variants Competitive analysis of the HSA variants prepared in example 1 and WT NSA was performed using the methods described n example 4. Results are shown in Figure 15. The results show that the variant E492G. unlike E492H E492P and E492G+V493P. has stronger binding to shFcRn than NSA.. Example 8. Analysis of 0417 substitutions Using the method of Exarmple 1 variants of NSA having the substitutions Q417A and D494E+Q417H were constructed. The kinetic properties of these variants were tested using the methods in Materials and Methods and are shown in Table 12, 53 Table 12: Bind ing constants of HSA variants for shFcRn Albumin varianC ka kd KD" KD Reqc (10VMs) (1i/s) { M) (pM) WT 3.2 0.2 15 5 2 4.8 5 4 D494E+0417H 3.1441 20 5 0 5 6 ND a: Diutions of HSA varints were injected over immnobiied shFcRn (15O0 RU), b: The kinetic rate constants were obtained using a simple first~order (:1) bimolecular interaction model c: The steady state affinity constant was obtained using an equilibrium (Req) binding model supplied by the BAevaluation 41 software. The kinetic values representthe average of triplicates d: Not determined (ND), The data show that variants 0417A and D494E+Q417H bind weaker to the receptor than the wild-type HSA. Example 9. Analysis of HSA variants in position 499, 500, 536, 537, 538 and 573 Using the method of Example I variants of HSA having the substitutions P499A K500A, K53A, P537A, K538A and K573A were constructed. The receptor binding properties of these vanants were tested as described in Materials and Methods. Results are shown in Figure 11, The data demonstrated that variants P499A KS36A, P537A and K538A had a reduced binding affinity to shFcRn relative to HSA. Variant K500A had almost completely lost its ability to bind to shFcRn and K573A had an increased binding affinity to shFcRn both relative to HSA. Example 10. Analysis of variants in position 501 of HSA Using the method of Example 1 variants of HSA having the substitutions E IA and E501Q were constructed, The kinetic properties of these variants were tested as described in Materials and Methods, Table 13 Sinding constants of NSA variants for shFcR Albumin variant ka kd KD* KD Req* (1IMs) (1W 4 Is) (M) _(gM) WT 3.2±0.2 15 5±2.5 4 8 5.4 E601A 3N30 26.0±00 7 8 D E501Q 2.7±0.1 15.5±0. 5.57 ND ,a: Dilutions of HSA variants were injected over immobilized shFcRn (-1500 RU). b: The kinetic rate constants were obtained using a simple first-order (1:1) bimolecular interaction model. The steady state affinity c a as obtained using an equibiumde sup~plied by the BlAevaluation 4.1 software. The kinetic values represent the average of triphecates d: Not determined (ND). 54 The data shows that variants E501A and E5010 have a slightly decreased binding affinity to shFcRn relative to HSA, Example 11. Analysis of HSA variants in position 573 Using the method of Example 1 variants of HSA having a substitution at position 573 were constructed. Al variants at position 573 were generated and the receptor binding properties of these variants were tested as described in Materials and Methods but with SPR analysis perfomIed at pH55, Results are shown in the table 14 below and Figure 12 and 13. Table 14 - Kietics of HSA K573 smgle point mutants. Albumin variant ka kd KD" (10 Ms) (10A/s) (nM) WT 90j0,0 6.910.176 K573 7A0.0 92±0,0 297 K573C 4,200 11±0.2 2 790.2 410.3 58 K53 .000 2,9*0,0 322 K573F 0.50.1 4 K,573G8.5i00 180,1 K573H 12,04. 0.8±0.0 6 K{5731 8.6±0.0 0,810,2 9 K573L 5,1±0,2 2.30.1 K573M 8.6±0.0 1.9±0,0 221 K573N 7.3t0.2 1,1+0,3 11 K573P 0,80,0 0.60,1 61 K(5730 7.710.2 2,6±0,0 338 K573R 8,5±0,0 3.0±0.2 253 K(573S 7.9±0.2 1,2±0,215 K573T 8.7±02 1.1±0.1 126 K573V 8,1±0,0 0.6±.0.2 30 K1573W 15,±002 0.4±0,3 29 K573Y 22.0±0.1 0.5±0.1 23 K573STOP ND ND 141000 a: Ddutions of HSA variants were injected over immobized shFcRn :1500 RU). b: The kinetic rate constants were obtained using a simple firstorder :1) bimolecular interaction model c: The steady state affinity constant was obtained using an equilibrium (Req) binding model supplied by the BIAevaluation 4.1 software. The kinetic values represent the average of duplicates. d: Not determined (ND) 55 The results show that all variants having substitution in position 573 have improved binding to shFcRn cornpared with WT HSA. In particular the variants K573F, K573H, K5T3P, K573W and K573Y have more than 10 fold lower KD to shFcRn than the parent HSA. The variant K573STOP is a truncated alburnin having a stop codon in position 573, The sensorgram for the K573STOP variant show significantly reduced binding compare to the WT HSA and generated a high KD. The increased affinity that we have shown for the variant K573E. a natural variant characterized by Otagiri (2009), BiobPharn, Bul. 32(4) 527534, is predicted to have increased half-ife .n Wvo. Example 12. Analysis of further HSA variants Using the method of Example I variants of HSA having the substitutions E492G E492G+N503H, NS03H, D550E. E492G+4N503K, E542P, H440, K541G, K541D, D5ON E492+K538H+K54iN+E542D, E492T+N503K+K54 1A, E492P+N53KiK541 G+E542P E492H ES01 PNSO3H,E5D+T506S+T540+K541E. A490D+E492T+V493L+E501P +N503D+A504E+E505K+T5O6F+ K541D, E492G+V493P+ K538 H+K541N+E542D were constructed. The receptor binding properties of these variants were tested as described in Materials and Methods, and the results are shown in Table 15 and Figure 14. Table 15: Binding constants of HSA variants fnr shFcR Albumin Ka kd KD" KD Req" variant" (I/Ms) (10'/s) (M (M) WT 3.2±0.2 15,5±2,5 4,8 5,4 E492G 4,1±0,0 11.0±0&' 2 7 ND E492G!N503H 6.9±0.1 14.5±0,5 2,1 ND N03H 5.4 0 24,0±01 4.4 ND D550E 3.2±0,4 11.8±0.0 3.6 ND E492G1N503K 5.9±0.1 16,0±0,0 2.7 ND E542P 3.4±0.0 15.7±0.2 4.7 ND H440Q 3.2±0.1 20.8±0,0 6.5 ND K541G 32±.0 23.0 ±00 7.1 ND K541D 2,6±0.0 24.0±0.0 9.2 ND D550N 2.510-0 30.0±0.0 12,0 ND * a: Dilutions of HSA variants were injected ovei rmmobilized shFcRn ( 1500 RU) b: The kinetic rate constants were obtained using a sirnple first-order (1:1) bimolecular interaction model. c: The steady state affinity constant was obtained using an equilibrium (Reg) binding model supplied by the BIAevalkation 4.1 software. The kinetic values represent the average of tiplicates. d, Not determined(ND 56 The results show that for position 6550 a substitution to E results in an increased affinity whilst a substitution to N resulted in reduced affinity for shFcRn at pH6,0, When this analysis was repeated for the D650E substitution at pHS5 however no observable increase in affinity was seen, The substituted for an acid amino acid (E) maintains and improves the binding. However the substitution for an uncharged aide amino acid reduces binding at pH6.0, Based on this observation, we would predict for this positionthat substitutions to basic amino acids (H, K and R) would result in further reductions in binding. Example 13, Mutations in His residues The following variants were generated using the methods described in Example 1: H4400 H464Q, H510Q and H5350. Figure 15 shows SPR sensorgrams of these variants interacting with shFcRn as described in Materials and Methods. It was found that the variant H4400 bound with comparable affinity as HSA. In contrast H464Q H5100 and H5350 had sigrificantly reduced affinity to shFcRn, This supports the previously published observations that mutagenesis of these Histidine residues significantly reduced HSA binding to shFcRn (Wu et at (2010). PFEDS23(10)789 2 9) Wu et a! show a reduced half-life for a diabody fusion proteins (scFv-Dll)2 in mice with an order of remova from slowest to fastest; Db-Dil WT>H535A>HI10A>H464A>Db. Based on affinity to shFcRn and when compared to srnFcRn (example 5) we would predict the clearance order in humans to be (for glutamine (Q) substitutions) WT> H440Q>H5100>H464Q>H535. Example 14. Further variants The following variants were generated using the methods described in Example 1 K574N and :580Kin HSA.Binding -f the variants to FcRn was tested using the SPR assay as described in Materials and Methods and the results are shown in Table 16, The results show that variants K574N and 0580K bound stronger to shFcRn. Tablel6: Following kinetic data was found for these variants Albumin variant ka kd KD (10&/Ms) (10"/s) (pM) WT 9,7±0,0 130.0t0.1 3,1 K574N 4.9t01 84±01 1 Q580K 6,0±0,0 9,10,0 1,5 Example 15. Analysis of HSA variants in position 500 57 Using the method of Example 1 variants of HSA having a substitution at position 500 were constructed, All variants at position 500 were generated and the receptor binding properties of these variants were tested. Biacore X, Biacore X100 and Sensor Chip "M5 were used for all arlyses, both supplied by G E Healthcare. shFcRn produced by GeneArt AG (Germany) (diluted to 1'pg/bmL in 10mM sodium acetate pH5.0 (G E Heaithcare)) was immobilised on flow cell 2 (F2) to levels between 1600 2200 response units (RU) via standard amine coupling as per manufacturers instructions (G E Healthcare), A blank immobilisation was performed on flow cel I (PC) for it to serve as a reference cell, To stabilse the assay, 3-5 start up cycles were run first, with running buffer (67mM phosphate buffer O.5M NaCL 0&0% Tween 20 at pH5.75 0.25) only, followed by regeneration. WT rHA and K500 library variants were injected at various concentrations (1pM - 150pM) for 90s at a constant flow rate of (30p1/min) at 25 C followed by regeneration of the surface using HBS-EP buffer pH74 (G E Healthcare) until approximate initial baseline RU was restored (usually 12s pulse would suffice), Results are shown in the Tabie 17 and Fgure 16 Table 17: Kinetics of [HSA K500 single point mnutants Albumin ka kd KUD KO Req' variant (10&JMs) (1W 3 1s) (pM) (pM) K5U0R 4,42 7.21 1.63 K50i 5.1$ 109 , WT 4,24 9.222 K500L 373 11,0 32 K5000 1,07 34 312 K500V 3.29 11,0 3 K500Y 3,97 14.6 3 7 K500M 2,43 21 5 8.7 K500T 2 13,4 11.2 KS00W 0,5 5.4 11.7 K500N 1.3 18,2 14 K500F 5,17 73.7 14.3 K500H 4 63,8 16 K500P ND ND ND 51 K5000 2.38 124 52 K500S ND ND - ND 70.2' K500A 2.61 208 799 K500D ND ND ND 83,3' K500G ND ND ND 95,4 K500E KD not calculable see Figure 16 K500 STOP Null binder 58 a: Mean of 4 values. b, The kinetic rate constants were obtained using a simple first-order(1:1) molecular interaction model. c: The steady state affinity constant was obtained using an equilibrium (Req) binding mode supplied by the BIAevaluation 41 software, The results show for variants K50OR and K500, have increased and comparable affinity for shFcRn compared to WT HSA respectively. Variant K500E bound tightly to immobiiised shFcRn but still demonstrated the characteristic pH-dependency of the FcRn interaction This complex was very stable, such that kinetic analysis was not possible (Figure 16), All other variants have reduced binding to shFcRn than wt rHA, All variants bound to shFcRn (@o some extent) at pH51 No binding of K500 library variants to shFcRn was detectable at pH74, Example 16, Fusion polypeptides The generation of albumin fusions containing albumin muteins Piasmids containing expression cassettes for the production of scFv (vHvL) genetically fused to HSAS at either the N- or C-terminus or both. (described in, Evans et at 2010. Protein Expression and Purification. 73113-124) were modified to allow the production of albumin fusions using in vivo cloning (describe above) That is, pDB3017 (Figure 17), pDB3021 (Figure 18), pDB3056 (Figure 19) were digested with NsASpel and Nsil fragments corresponding 9.511kb, 9,569kb and 8.795kb, respectively, were purified using standard techniques. Purified Nsil fragments were self-igated and used to transform chemically competent £ coli DHf5a to produce pDB4168, pDB4169 and pDB4170, respectively (Table 18), Sirmlarly pDIS3165 (containing the bivalent fusion) figuree 20) was digested with No/I and the expression cassette (4,506kb fragment) was purified before being ligated into Notldigested pDB3927 to produce pDB4172 (Figure 21, Table 18) Synthetic Sa/l/Bstr36 DNA fragments (269bp), which contain point mutations within the albumin encoding nucleotide sequence to introduce amino acid substitutions corresponding to K500A, or 050N or K573P into the translated albumin protein sequence, were generated by gene assembly (GeneM AG, Germany), The Sail/Bsu361 fragments were individually ligated into Sai/BsuS6-digested pDR4168-pDB4170 and pDB4172 and used to transform chemically competent E coil DHo. using standard techniques to generate plasmids pDB4265 - pDB4276 (Table 18), Table 18: Albumin variant fusions tPlami 59 59 pDB3017 scFv (anti-FITC) - [HSA -FLAG p63021 HSA- GS linked ~scFv (antiTC )- FLAG pOB3056 HSA - FLAG pD3165 scFv (antiFlTC) -HSA GS linker - scFv (anfi-FITC) - FLAG pDB4168 scFv (anti-FITC) - HSA FLAG pDB 4 16 HiSA O GS linker - scFv (anti-FITC) - FLAG p0B41 7 0 HSA - FLAG pDB 4 17 2 scFv (antFITC) HSA - GS linker - scFv (antiTC )- FLAG iDF 4 2 65 scFv (anti-FITC ) - HSA K500A - FLAG pD64266 soRv (anti-FITC ) - HSA DSSON -- F LAG pDB 4 267 scFv (anti-FITC - HSA K573P - FLAG pDB426 iSA K500A GS linker -scFv (antrFlTC)- FLAG p0B4269 HiSA D550N - GS linker -s. (anti-FITC) - FLAG pDB 4 2 7 0 HSA K573P - GS tinker -cv (anti-FIT ) - FLAG pDB4271 HSA K500A - FLAG pD64272 HSA D5501N -- FLAG pDB 4 273 HSAK573P- FLAG pDB4274 scFv (anti-FITC) -[HSA K500A -OS linker ~scFv (anti-FITC) -FLAG p064275 sc~y (anti-FIT) - HSA DSSON - GS linker - scFv (anti-FITC) - FLAG pDB 4 2 7 6 cv (anti-FITC) - HSA K573P - GS linker - scFv (anti-F TC) - FLAG pDB4277 cv (anti-PITC) - HSA K573A - FLAG pDB4278 HSA K573A GS linker so-v (anti-FITC) FLAG pDB4279 HSA K573A F LAG U-134280 soR'., (anti-FIT) - SA K57i3A -GS linkr sFy (antbiFlTO) -FLAG pDB4281 HSA K500A -GS linker ~ scFv (anti-FITC) pD42832 HSA DSSON - GS linker - scFv (anti-FITC Q0134283 [SA KST3,Pl - S linker Fo~ (aiFTO) pDB4284 [HSA - GS linker - scFv (anti-FiTC pDB2613 HSA- GS linker -iL1RA (N840) p064285 [iSA Kb,,5 B:A- GS inkerilP N$0 pDB4286 HSA DO5N- GS linker -lRA(N84Q) pD64287 HSA K500A- Glinker -ILIRA (N84Q) Y1, S lnker-IL RA(N 540) Similarly. a DNA fragment was generated by PCR (using standard techniques) to introduce a K573A substtution in the translated albumin protein sequence, PCR was performed using the New England Biolabs Phusion kit using pDB4267 (Figure 22) as template DNA and oligonucleotides xAP238 (SEQ 1D NO: 53) and xAP239 (SEQ ID NO;54): Table 19 describes PCR cycling. Table 19: PCR cycing 60 98*C or 2 in cycle 98t forl~sec 5 cycle 57"O for 30sec 7980 for 10sec '2tfo r 50 c 35 cycles 7V'0 for 5 Mir, yl The PGR product was purified diestd with Sai/Bsul.36 and the fragment (269bp) isolated was igated into Sall/Ssu366digested pDB4168-pDB4170 and pDB4172 and used to transform chemically competent E coil DHSQ Resuling plasmids (pDB 4 277 - pDB 42 80) are listed in Table 18. The nucleotide sequence encoding the FLAG tag was removed from plasmids pDB4168 and pDB4268-4270 (pLasnids for the expression of scFv N-terminally fused to HSA and HSA muleins K500A, DS0N and K573P, respectively. pDB4168 and pDB 4 268-42 7 0 (Table 18) were digested with Bsu361/Sphl to remove a 231bp product comprising 3' region of HSA-encoding gene, nucleotide sequence encoding FLAG tag and 5' region of ADH1 terminator, A Bsu361iSphl fragment (207bp) comprising 3 region of NSA-encoding gene and 5' region of mADHi terminator (SEQ ID1) from pDB418 1 was ligated into Bsu3USphl-digested pDB4168 and pDB 42 68-pDB4270 using standard techniques. Ligation mixtures were used to transform chemically competent E, cohl OHa using standard techniques to generate plasmids pDb4281-p0B4284 (Table 18) pDB4265-pDB4284 were digested with BstEll/Bel and the linearised DNA molecules were purfied using standard techniques, One hundred ng BatEII/&sri DNA samples were mixed with 100ng AccoSl!BamnHI-digested pDB3936 and used to transform . cerevisiae SXP10cir 0 using the Sigma Yeast Transformation kit described below, i each case the expression plasmid was generated in the yeast by homologous recombination (in vivo cloning) between the albumin-fusion containing plasmid (pDB4265-p0b4280) (Table 18) and pDB3936. Plasmids pDB3017, pDB3021, pDB3056 and pDB3165 (wild type HSA fusions, described by Evans et 2010. Protein Expression and Purification. 73,113 124) were used to transform S cerevisiae Strain Acirl (described in WO 2005061718) using the Sigma Yeast Transformation kit described below. The nucleotide sequence encoding human ILAIRA (interleukin-1 receptor antagonist) (accession number: CAA59087) could be syntheticaly generated by gene assembly The nucleotide sequence of the 708bp synthetic fragment (Bsu36/Sphl fragment) is given in SEQ 0 NO: 55 and includes the region of the gene encoding HSA, the nucleotide sequence eno ding a GS tinker. the nucleotide sequence encoding human IL-1RA (N84Q to abolish the N-linked glycosylation motif) and the 5' region of the ADHI terminator. The synthetic DNA fragment could be ligated into Bsu36I/Sphidigested p0B3927 to produce p02588. 61 P'asmids containing the expression cassettes for the production of l-I RA genetically fused to the C-terminus of HSA and the HSA variants K500A, DS0ON, K573A and K673P were prepared as follows. pDB2588 was digested with Bsu361/Sphi and a 705bp fragment containing the 3 region of the HSA encoding gene, nucleotide sequence encoding a GS linker, nucleotide sequence encoding human ILI-RA (N84Q) and the 5 region of a modified S. cerevisiae ADH1 terminator (SEQ ID3) was purified using standard techniques then ligated into Bsu36/Sph -digested pDB4006 (containing HSA K573A expression cassette), pDB4010 (containing HSA D50N expression cassette) pDB4086 (containing HSA K500A expression cassette), pDB4110 (containing HSA K573P expression cassette) to generate pDB4287, pDB4286, pD4285 and pDB4288, respectively (for an example, see Figure 23). p0B4285-pDB4288 were digested with NsiU/Pvul and the lineansed DNA molecules were purified using standard techniques, One hundred ng Nsil/Pvul digested DNA samples were mixed with 100ng Acc65l/BamH-digested pOB3936 (9721bp) (ie. in vivo cloning) and used to transform S. cerevisiae (i.e, by in vivo cloning) using the Sigma Yeast Transformation kit described below, Preparation of an S. cerevisie strain expressing wild type HSA genetically fused to a GS linker and IL1-RA (N84Q) (see Table 18) cou1d also be generated following the methods described above. The fusion polypeptides were analysed for their binding to FcRn using the SPR method described above and following results were obtained: Table 20; Kinetics of HSA fusion variants. Albumin variant" ka kd KD (10&/Ms) (1l4/s) (pM) HSAWT 9.7±0.0 30.0±0,1 3.1 K574N 4.9±01 8.4±0.1 1,7 Q580K 6,0±0.0 9.3±0.0 1.5 K573P 2.8t0.0 0,4+0,0 0,1 HSA-WT-FL AG 8,2±0,2 24 00 0 2.9 HSA-D550N-FLAG 5.9±0.0 49.0±0,1 8.3 HSA-K500A-FLAG ND' ND ND HSA-K57;3A-FLAG 6.1±0.1 7.1±0,1 1.1 HSA-K573P-FLAG 6.2t0.1 1,2+0,1 02 HSA-WT-iL1RPA 6,2±0,0 25.00 0 40 HSA-K500AIL1RA ND ND NID HSA-D550N-.iL1RPA 7,3±0,2 38.0±0,0 5.2 HSA-K573A-.i1RA 6.1±0.0 7.1±0,1 1.1 HSA-K573P-IL1RPA 6.2t0.1 1,3+0.1 0.2 scFv-HSA-K500A~FtLAG NO ND ND 62 ScFv-HSA-D550N~FLAG 6.210.0 18.0±0.0 2.9 scFv-HSA-K573A-FLAG 6,4±0 57±0.2 ±0 scFv-HSA-.K573PFLAG b fN+Q.0 1,1±0,1 u.2 scFv-HSA-W T-scFv- 750 ,0 15.0±0.2 20 FLAG scFv-HSA-K500A-scFv- ND NID ND FLAG scFv-HA-D550 N-scFv- 4.1+0, 27.0±0.2 6 scFv-HdSA-K573P-~scFv-. 6. 02 0.7±0.1 0,1I HSA i500A-scFv-FLAG ND ND ND HSA-D550N-bscFv-FLAG 7, '0,1 42 0±0,3 5,8 HISA-K573A-scFv-FLAG 6.410. 570,1 0.9 HSA-K573P-scFv-FLAG 4,7±0, 0.7±0.1 '0,1 scFv-HSA-K500A ND ND ND scFv-HSA-D550N 7.5+0, 19.0002 2,5 srFv-HSA-K573P 7A +0,1 08 ±0.1 0,1 a: Dilutions of HSA variants were injected over imnmobilz.ed shFcRnl(~1500 RU). b: The kinetic rate constants were obtained using a simple first-.order (1:1) molecular interaction model The kinetic values represent the average of duplicates. c: Not determined due to weak binding (ND). In example 8 it was shown that the K500A variant did not significantly bind shFcRn, in Example 10 it was shown that the K573P' and KS73A variants bind shFcRn stronger than HSA and in Example 11 it was shown that the D550N variant binds Foan weaker than HSA. In the present example it is shown that these observed difference in binding properties also are reflected in fusion poiypeptides in different configurations: C>temiinai fusions with a small moiety (HSA FLAG) Gaterminai fusions with a larger polypeptide (HSA4~L1RA); Ndternminal fusions with polypeptide (scFv-ISA); N~. and G-terminal fusions (scFv-HSA~FLAG and scFv-HSA..scFv~ FLAG); Example 17. Conjugation of Horseradish peroxidase protein to Albumin and the K573P variant For conjugation analysis, commercially available recombinant alburnin (Recombumin? 4 ) was used as a control molecule. F or this example, a final 200mig/mL albumin K573P variant of the invention was purified from a fed batch fermentation by means described in Material and Methods. A two step purificationrwas carried out; 63 The first step used a column (bed volume approximately 400mL, bed height 11cm) packed with AlbuPureTM matrix (ProMetic), This was equibrated with 50mM sodium acetate, pH 5.3 and loaded with neat culture supematant, at approximately pH 5-5~6,5, to approximately 20 mg/mL matrix, The column was then washed with approximately 5 column volumes each of 50mM sodium acetate, pH 5.3. 50mM sodium phosphate, pH 5.0, 50mM sodium phosphate, pH 7.0 ard 50mM ammonium acetate, pH 8.0, respectively. Round protein was eliuted using approximately two column volumes of 50mM ammonium acetate, 10mM octanoate, pH 7,0, The flow rate for the entire purification was 154mlnir. For the second step, the eluate from the first step was diluted approximately two fold with water to give a conductivity of 2.5±0.5 mS/cm after adjustment to pH 5.5±0.3 with acetic acid. This was loaded onto a DEAFSepharose Fast Flow (GE Healthcare) column (bed volume approximately 400mL, bed height 11cm), equilibrated with 80mM sodium acetate 5mM octanoate. pH 5.5. loading was approximately 30mg protein/mb matrix. The column was washed with approximately 5 column volumes of 80mM sodium acetate, 5m M octanoate, pH &5. Followed by approximately 10 coumn volumes of 157mM potassium tetraborate pH 9.2. The bound protein was eluted using two column volumes of 110mM potassium tetraborate. 200mM sodium chloride, approximately pH 9.0. The flow rate was 183m/min during the load and wash steps and 1V9mLmi during the elution step, The eluate was concentrated and diafiltered against 145mM NaCl. using a Pall Centramate Omega 10 000 Nominal MWCO membrane, to give a final protein concentration of approxmatey 200mg/ 1 mL Both 200mg/mL stock solutions of the rHA and K573P variant albumin were diluted down to 5mg/mL, using phosphate buffer saline (PBS); pH adjusted to pH 6.5-6- This ensured a favourable pH environment for the maleimide reactive group of the EZ-Link® Maleimide Activated Horseradish Peroxidase (Thermo Scientific) to react with the free sulphydryl, to form a stable thioester bond, 2mg of the EZ-Link@ Maleimide Activated Horseradish Peroxidase (HRP) was mixed with either 1mL of the 5mg/ML rHA or K573P variant albumin. This mixture ensured an approximate 2 fold molar excess of the albumin, or K573P variant albumin. This mixture was minimally incubated at 4 'C, for 24 hours. The reaction mixtures were then checked for conjugation, using GPIHPLC. To separate unconjugated species (rHA, or Albumin variant K573P and unreacted HRP) from the corresponding conjugated species the samples were first concentrated (Vivaspirt20, 10,000 MWOO PES Sartorius) and then individually applied to a Tricorn Superdex 200. 10/300 GL column (GE Healthcare), run at a flow rate of 45cm/hr in PBS. The elution peak was fractionated and GP-HPLC analysed. Fractions containing the conjugated species were pooled, 64 concentrated and diafiltered against 50mM NaV and analysed by CPRHPLC to demonstrate (Figure 24) These samples were then assayed using the Biacore method described herein (Table 21), This example demonstrates that the K,573P maintains its increased affinity for shFcRn compared the the WT H SA. Example 18. Conjugation of Fluorescein to Albumin and the K573P variant. The two same albumin samples used in Example 17, were also the start materials for this example. Le, Approximately 200mg/mL rHA or the K573P albumin variant, Fluorescein-5-Maleimide, Thermo Scientific (F5M) was dissolved in dim ethylformamide, to give a finaI concentration of 25mg/mnL This was then further diluted into 13mls of PBS, pH adjusted to approximately pH 6.5. To this solution either 1Iml of 200mghmL rHA or 1mL of 200mg/mL K573P van'ant was added. This gave an approximate 20 fold final molar excess of FSM, These samples were incubated and allowed to conjugate overnight at 4C. in the dark, to allow the malelmide groups on the FSM to react with predominantly the frce suifhydryl, present in both albumin species Following ovemight incubation aliquots of the reaction mixtures were extensively diafiltered against 50mM NaCi to remove unconjugated F5M (Vivaspin20, 10,000 MWCO PES Sartorius) Conjugation was confirmed by ultraviolet visualization of conjugated Fluorescein::Aibunins Following standard SDS-PAGE (Figure 25). These diafiltered samples were then assayed using the Biacore method described herein (Table 21). This example demonstrates that the conjugation of a small molecule to either rHA or a variant, e.g. K573P does not affect the trend in binding affinities to shFcRn. Table 2.1: Representative Biacore assay KDf values of conjugated rHA or a variant (K(573P) when binding to immobilized shFcRn, Analyte KD (pM) rHA::HRP3, K573P::HRP 0,02 rHA::F5M 7.3 K573P::F5M' 2.5 65 Example 19. Further albumin variants. The following variants were generated using the methods described in Example 1 E492T, N503D, E492T+N6O3D, K538H. E542D, D494N+E495Q+T496A, E495Q+T496A N403K, K541A and K541 N SPR analysis was carried out as described in Example 15 and the results presented in Figure 26 and figure 27. ngure 30A and 30B shows the effect on shFoRn binding for the albumin variants Substitutions N503D, D494N+E45Q+T496A E492T+N503D, E496Q+T496A within HSA had a negative inpact on binding to shFcRn at pH5,5. Example 20 Variants of albumin at the C4ermini, The following variants were generated using the methods described in Example 1, Binding to the shFoRn was determined as described in Materials and Methods and the results are presented in Table 22. Table 22: Kinetics of the NSA C-terrmnal swapped variant interactions with shFcRn. Albumin ka kd KD' variant" (10 IMs) (10 /s) (M HSA 4.4+& 0 2, 0,i 5,4 MacSA 3,1±0,1 8,6±0.1 2.7 HSA-1MacC 4.1 .1- 5+0 0 1 MousesA'' 3,8±0,0 3,1±0.1 0.8 HSA-MouseC 3.7±0.1 1.310,0 0.3 RabbitSA 4 1.9±0.3 1,7±0.1 0.9 HSA-RabO 3.5±0.0 1.6±0. 0.4 SheepSA ND ND ND HSA-SheepC 3.3t0.0 2.1±0.0 0.6 a: Dilutions of HSA variants were injected over immobilized shFcRn (-1500 RU). b: The kinetic rate constants were obtained using a simple lirst-order (1:1) bimolecular interaction model c: Data from Tablie 2 d: Data from TabNe 3 Not determined due to weak binding (ND) 66 This example demonstrates that for all C-terrinal swaps to human albumin tested an increase in binding over the donor albumin was observed. All donor sequences contain the K573P substitution shown to significantly increase binding but less that the K573P alone (Table 20), Example 21 Competitive binding analysis of variant albumin fusions Competitive binding studies, using variant albumin fusions and a selection of variant alburnins prepared as described in Example I, were performed as described in Example 4 Results are presented in Figures 2831 The competitive binding hierarchy was identical for the variants fusions of HSAFLAG and N+C--terminal scFv HSA-FLAG to the hierarchy of the individual HSA variants (unfused and fused) affinity data, For the ILIRa variants K573P, K573A, and the K500A were as predicted, however the D550N appears to inhibit more efficientlyhan the WT fusion. Example 22. Further HSA variants The following variants were generated using methods described in Example 1: HSA E492G+K573A, HSA E492G+ N503K+ K573A, HSA E492G+ N503H + K573A, HSA E492G + K573P, HSA E492G + NSO3K + K573P, HSA E492G + N503H + K573P SPR analysis was performed as described in Materials and Methods. Results (Figure 32) showed that all HSA variants bound more strongly to shFeRn compared to wild type HSA at pH 5.5, No binding was observed at pH 74 HSA E492G+K573A, HSA E492G+ N503K+ K573A, unlike HSA E492G+ NSO3H + K573A had marginally improved binding beyond that of HSA K573A, The combination variants containing K573P did not show improved binding over the K573P single variant. 67

Claims (18)

1. A Method for preparing a variant of albumin. fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof, comprising folowing steps a. Providing a nucleic acid encoding a parent albumin having at least 80% sequence identity to SEQ ID NO: 2; b, Modifying the sequence of step a, to encode a variant albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof having one or more substitutions corresponding to the substitutions in SEQ ID NO: 2 selected among: 041 7A COD E, F, G HK LN P, RS TWY; H440ACDEFO. G,KLMNPQPRSTVWY; A490CDE. FGHIK LM.N<P, RSTV VVY E492A. QDFG KL NAQ.R. S TV W, Y; V493A, CD EFGHIK L MNP Q R S TVY: D494AC~EFG4 HK L MN P QASTVWY; E495,-,AC,DFS.H IKL,M, N,Q, R,,ST,,'VY E495AC.DEFGH& LMNPQRS.VWY; T496A. CID E ,F G0 H1 l K L Ml N P QRST 'W K500AQ.D.E FQGH. V6N. QRSTNV,WX £501A C D F GS, K .L M.N PQR ST WXV; N503AC RE FGH4KsLM RQR;STAWYY A5040C,DG,H,ILM.NP.Q.RSTVWN,; ESOCAC DF G H KKL.N P Q.R,TXYN.Y; T506A C, DSFG HJ K LMAN.PQA,RSV,W,Y; H510A(CDRF.G. LtMNPQ.RS TVWY H9535AC ,LOFG l KLM.NP.QARS .W 'Y K536AQDEFGOH~ LMN NP.QARSTtWY P53s7A.C DE.RF3GHKLM<N. QR SST.V WY; T540A.CDE.F. H11 LM.NP QR S ,V K; K541 AQE,DEFG,I, LMNAPQRS.TAWY; E542A4ZC,D, G H.IK LM NP QRPSsV W Y; 68 D550ACEF G4-IKL,M NPQ RSTWV ,Y: K573ACD ,EGH LMNQRSTVAWY K574ACD.EFGH LjAMNEPQ R.STW Q580ASCGDE7FGSHK LMNPRSTVWY A581CDEFGH.KL M PNQ.RS .,VWY; A582CD.ELGHAKLM.NPQRSsTEVWY: or G584ASC D E. F KLMNPQR.S.TVWY; c. Introducing the modified sequence of step b., in a suitable host cell; d. Growing the ceils in a suitable growth medium under conrdion leading to expression of the variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof; and e, Recovering the variant of albumin, fragments thereof or fusion polypeptide comprising said variant abumin or fragment thereof from the growth medium: wherein the variant of albumin fragments thereof or fusion poIypeptide comprising said variant albumin or fragment thereof, has an altered plasma haff-life compared with the parent albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof,

2. A variant of albumin, fragments thereof or fusion polypeptides comprising said variant albumin or a fragment thereof having altered plasma half-ife compared with the parent albumin, fragment thereof or fusion polypeptide comprising said parent albumin or fragment thereof comprising one or more substitutions in positions corresponding to the positions in SEQ ID NO:2 selected among: 573, 500, 550, 492,580 74 417 440 464 490, 493, 494, 495 496, 499, 501, 503. 504, 505. 506, 510, 535, 536; 537, 538,540, 541, 542, 575. 577, 578, 579, 581, 582 and 584 where the variant is not the variant consisting of SEQ ID NO: 2 with the substitution D494 N ESG1 K, K541E 5 Df:50,A, K573E orK574N

3, The variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof according to claim 2, having a longer plasma half life than the parent albumin.

4. The variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof according to dlaim 3, comprising one or more substitutions corresponding to the following substitutions in SEQ ID NO 2 K573YWPHFN I,T ,G, MC,A,E;ARLD 69 K573P+K574N+A5TT+A58R+S579C+Q580K+A5810+G584A K573 P+A577 E+±A783+Q580K+±A582T K573P+±A578S+S579T+G584A. K573P+L575F+G584A, E492G, N503K, K60OR N1503, D550E K574N, Q580K and E492G+N503K, E492G-N53H. E492H+E501P+N503H+E5O5D+T506S+T540S+K54-1,E E492G+K573A, E492G+N503K+K573A, E492G+N503H, E492G+K573P, E492G+N503K+K573P E492G+50H+K573P

5. The variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof according to claim 2, having a shorter plasma half-life than the parent albumin

6, The variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof according to claim 5, comprising one or more substitution(s) corresponding to the substitutions in SEQ ID NO 2 selected among: K50E G0D,A,S.CP HFN WTMYVQL R D550N, H464Q, H5100, H5350 D494N(Q A E495QA, T496A, E492G+V493P K541GD, 0D494N+E495Q+T496A E4950+T496A E492G+V49SF'+K538H+K541N+E542D, N503KD P499A K541AN D494E + Q 4 1

7 H 0Q 4 1 7 A E 4 9 2 T + N -5 0 3 D, A490D+E492T+V493L +E651{IP+N503D+A504E+E505K+T506F+K541D . 536A P537A E601A,Q, E492G+K538H+K544E542D, 7, The variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof according to any of the previous claims, comprising one or more further alteration that generates thick group on the surface

8, The variant of albumin, fragments thereof or fusion polypeptide comprsing said variant albumin or fragment thereof according to the previous claims, wherein the sequence identity of the variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof to SEQ 10 NO; 2 is more than 80%, preferably more than 90%, more preferred more than more than 96% even more preferred more than 97% more preferred more than 98% and most preferred more than 99%.The variant of albumin, fragments thereof or fusion polypeptide composing said variant albumin or fragment thereof according to the previous claims being a variant fragment of albumin or a fusion polypeptide comprising a variant fragment of albumin wherein the fragment is at least 20 amino acids, preferably at least 50 amino acids, preferably at least 100 amino acids. 70 more preferred at least 200 amino aids, more preferred at least 300 amino adds, more preferred at least 400 amino acids and most preferred at least 500 amino acids,

9, A nuclec acid encoding the variant of albumrin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment Thereof of claim 2,

10 A conjugate comprising the variant albumin or fragment thereof according to claim 2 and a beneficial therapeutic moiety.

11 An Associate comprising the variant albumin or fragment thereof according to claim 2 and a beneficial therapeutic moiety.

12. A fusion polypeptide comprising a variant albumin or fragment thereof according to claim 2 and a fusion partner polypeptide,

13, A composition comprising a variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof or a conjugate comprising said variant albumin, wherein the binding to FcRn is stronger than for the corresponding albumin or fragment thereof or fusion polypeptide comprising said albumin or fragment thereof or a conjugate comprising said albumin

14, The composition of claim 13 where the binding to FcRn is stronger than the binding of HSA to FoRn.

15 The composition of claim 14, wherein the binding coefficient of the variant of albumin fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof or a conjugate comprising said variant albumin to FcRn is less than 0.9X KID for HSA more preferred less than 05X KD for HSA. more preferred less than Q.X KD for HSA even more preferred less than 0,05X KD for HSA, even more preferred less than 0.02X KD for HSA and most preferred less than 0.01 X KD for HSA.

16 The composition according to any of claims 12-15, comprising a variant albumin or a fragment thereof according to claim 1, a conjugate of claim 10, an associate of claim 11 or a fusion polypeptide of claim 12,

17 The composition according to any of claims 13-16, comprising a vMant albumin or a fragment thereof according to claim 1, further comprising a compound comprising a ABD and a pharmaceutical beneficial moiety, 71

18. The composition according to any of the claims 13-17, beng a pharmaceutical composition. 72