AU2015202777B2 - Angiogenin expression in plants (2) - Google Patents

Angiogenin expression in plants (2) Download PDF

Info

Publication number
AU2015202777B2
AU2015202777B2 AU2015202777A AU2015202777A AU2015202777B2 AU 2015202777 B2 AU2015202777 B2 AU 2015202777B2 AU 2015202777 A AU2015202777 A AU 2015202777A AU 2015202777 A AU2015202777 A AU 2015202777A AU 2015202777 B2 AU2015202777 B2 AU 2015202777B2
Authority
AU
Australia
Prior art keywords
angiogenin
plant
gene
sequence
plant cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
AU2015202777A
Other versions
AU2015202777A1 (en
Inventor
Benjamin Graeme Cocks
Matthew Knight
Matthew Mcdonagh
Aidyn Mouradov
German Spangenberg
Jianghui Wang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agriculture Victoria Services Pty Ltd
Original Assignee
Agriculture Victoria Services Pty Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2009905627A external-priority patent/AU2009905627A0/en
Priority claimed from AU2010321676A external-priority patent/AU2010321676B2/en
Application filed by Agriculture Victoria Services Pty Ltd filed Critical Agriculture Victoria Services Pty Ltd
Priority to AU2015202777A priority Critical patent/AU2015202777B2/en
Publication of AU2015202777A1 publication Critical patent/AU2015202777A1/en
Application granted granted Critical
Publication of AU2015202777B2 publication Critical patent/AU2015202777B2/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to plant-produced angiogenins, to related plant cells, plant calli, plants, seeds and other plant parts and products derived therefrom and to uses of plant-produced angiogenins. 5 The present invention also relates to expression of angiogenin genes in plants and to related nucleic acids, constructs and methods.

Description

2015202777 22 May 2015 P/00/001 Regulation 3.2
AUSTRALIA
Patents Act 1990
COMPLETE SPECIFICATION STANDARD PATENT
Invention title: ANGIOGENIN EXPRESSION IN PLANTS (2)
The following statement is a full description of this invention, including the best method of performing it known to us: -2- 2015202777 22 May 2015 ANGIOGENIN EXPRESSION IN PLANTS (2)
Related Applications
This application is a divisional of Australian patent application no. 2010321676, the entire disclosure of which is incorporated herein by reference. 5 Field of the Invention
The present invention relates to plant-produced angiogenins, to related plant cells, plant calli, plants, seeds and other plant parts and products derived therefrom and to uses of plant-produced angiogenins.
The present invention also relates to expression of angiogenin genes in plants and to I0 related nucleic acids, constructs and methods.
Background of the Invention
Angiogenin, encoded by the ANG gene, is a member of the ribonuclease (RNase) superfamily. Angiogenin (also known as RNase5) is a 14 kDa, non-glycosylated secreted ribonuclease polypeptide. Angiogenin is known to regulate the formation of 15 new blood vessels through a process called angiogenesis and is known to regulate neuron survival with functional mutations in the protein a cause of the neuromuscular disorder amyotrophic lateral sclerosis (ALS).
During angiogenisis, the angiogenin protein binds to receptors on the surface of endothelial cells and smooth muscle cells and undergoes nuclear translocation where it 20 stimulates the production of ribosomal RNA (rRNA) which is required for the growth and division of cells for capillary formation. Angiogenesis associated with exercise causes capillary growth that allows for greater nutrient and oxygen delivery to muscle tissue.
In our co-pending application PCT/AU2009/000603 we demonstrated that angiogenin increases muscle cell growth and differentiation in vitro, and significantly alleviates the 2015202777 22 May 2015 -3- potent inhibitory effects of myostatin on myoblasts. Angiogenin is enriched in colostrum and milk, secretions which evolved to promote health, growth and development of suckling mammals. When added to the feed of mice, angiogenin purified from bovine milk increased exercising muscle growth by 50% over a 4 week period. We 5 demonstrated that angiogenin is bioavailable when administered orally in our copending application PCT/AU2009/000602.
Angiogenin has also been shown to possess a number of other activities. These include the ability to remove skin defects such as pigmented spots, modulation of immune responses, protection of polymorphonuclear leukocytes from spontaneous degradation, 10 and microbicidal activity against systemic bacterial and fungal pathogens. Angiogenin also appears to be required for effective activity of growth factors such as VEGF, EGF and FGF. In addition, functional mutations in the angiogenin protein cause the neuromuscular disorder amyotrophic lateral sclerosis (ALS).
Angiogenin may have numerous applications, including applications in medicine, dietary 15 foodstuff supplements and cosmetics. However, the use of angiogenin in such applications requires an efficient process for the preparation of the protein on a commercial scale from an appropriate source.
Angiogenin is readily available in bovine milk, however its use as a source of angiogenin is not favoured as angiogenin is only present in bovine milk at a low level. 20 Also, certain proteins, such as caseins, and milk whey proteins such as immunoglobulin, lactoferrin and lactoperoxidase present in milk mask angiogenin, hindering its purification.
Reference to any prior art in the specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common 25 general knowledge in Australia or any other jurisdiction or that this prior art could reasonably be expected to be ascertained, understood and regarded as relevant by a person skilled in the art. 2015202777 22 May 2015 -4-
It is an object of the present invention to overcome, or at least alleviate, one or more of the difficulties or deficiencies associated with the prior art.
Summary of the Invention
In a first aspect, the present invention provides a plant cell, plant callus, plant, seed or 5 other plant part including an angiogenin gene or a functionally active fragment or variant thereof and/or an angiogenin polypeptide.
In a second aspect, the present invention provides methods of using plant cells, plant calli, plants, seeds or other plant parts including an angiogenin, for example as feed stock or for human consumption. 10 In a further aspect, the present invention provides a plant-produced angiogenin.
In a further aspect, the present invention provides a feedstock, food supplement or veterinary product including a plant-produced angiogenin.
In a further aspect, the present invention provides a food, beverage, food supplement, nutraceutical or pharmaceutical including a plant-produced angiogenin. 15 In a further aspect the present invention provides a method for producing a transformed plant cell expressing an angiogenin gene.
In a further aspect, the present invention provides methods of isolating angiogenin from transformed plant cells.
In a further aspect, the present invention provides methods of regenerating transformed 20 plant calli, plants, seeds or other plant parts from transformed plant cells.
In a still further aspect, the present invention provides methods of isolating angiogenin from transformed plant calli, plants, seeds or other plant parts. -5- 2015202777 22 May 2015 ln a still further aspect, the present invention provides methods of enhancing expression, activity or isolation of angiogenin in plants, said methods comprising coexpressing angiogenin with a mediator or modulator of angiogenin activity.
In a still further aspect, the present invention provides an artificial construct including an 5 angiogenin gene, said construct enabling expression of said angiogenin gene in a plant cell.
In a still further aspect, the present invention provides artificial constructs or chimeric sequences comprising an angiogenin gene and a gene encoding a mediator or modulator of angiogenin activity. 10 In a still further aspect, the present invention provides a chimeric sequence comprising an angiogenin gene and a plant signal peptide.
In a still further aspect, the present invention provides an angiogenin gene with codon usage adapted for plants to enable expression of said angiogenin gene in a plant cell.
As used herein, except where the context requires otherwise, the term "comprise" and 15 variations of the term, such as "comprising", "comprises" and "comprised", are not intended to exclude further additives, components, integers or steps.
As used herein, except where the context requires otherwise, the singular forms “a”, “an” and “the” include plural aspects.
Brief Description of the Drawings/Figures 20 Figure 1. Nucleotide sequence of the Bos taurus angiogenin, ribonuclease, RNase A family, 5 (ANG) (SEQ ID NO: 1). NCBI Accession NM_001078144. The 72 bp signal peptide sequence identified by NCBI is in bold and underlined.
Figure 2. Amino acid sequence of the Bos taurus angiogenin, ribonuclease, RNase A family, 5 (ANG) (SEQ ID NO: 2). NCBI Accession NP_001071612. The 24 aa signal 2015202777 22 May 2015 -6- sequence identified by NCBI is in bold and underlined. The angiogenin receptor binding domain is highlighted in ISEBB and the active site residues are highlighted in grey|. The Asp (D) amino acid highlighted in bold and underlined is a possible site for mutation to enhance angiogenin activity. 5 Figure 3. Nucleotide sequence of the Bos taurus angiogenin, ribonuclease, RNase A family, 5 (ANG) (SEQ ID NO: 3) modified for plant codon bias as defined by Murray et al., (1989). No changes in amino acid sequence to that outlined in Figure 2 were observed.
Figure 4. Nucleotide sequence alignment of representative angiogenin genes from I0 different organisms (SEQ ID NOS: 4-12).
Figure 5. Amino acid sequence alignment of representative angiogenin genes from different organisms (SEQ ID NOS: 13-21).
Figure 6. Nucleotide sequence of the Bos taurus angiogenin, ribonuclease, RNase A family, 5 (ANG), minus its signal peptide sequence, modified for monocot plant codon I5 bias (SEQ ID NO: 22).
Figure 7. Nucleotide sequence of the Bos taurus angiogenin, ribonuclease, RNase A family, 5 (ANG), minus its signal peptide sequence, modified for dicot plant codon bias (SEQ ID NO: 23).
Figure 8. Nucleotide sequence alignment, indicating 80.7% similarity, between ANG 20 modified for monocot and dicot plant codon bias. No changes in amino acid sequence to that outlined in Figure 2 were observed.
Figure 9. Nucleotide sequence of Arabidopsis oleosin_ANG fusion gene (SEQ ID NO: 24). The Arabidopsis olesin gene is indicated in plain UPPERCASE. The thrombin -7- 2015202777 22 May 2015 followed by the ANG gene in underlined black protease recognition site is highlighted in UPPERCASE font. The start and stop codons are highlighted in 111!.
Figure 10. Amino acid sequence of the Arabidopsis oleosin_ANG fusion protein (SEQ ID NO: 25). The Arabidopsis olesin protein is indicated in plain UPPERCASE. The thrombin protease recognition site is highlighted in Ι*Π5ΒΕ italics followed by the ANG protein in underlined UPPERCASE font.
Figure 11. Nucleotide sequence of an expression cassette containing the ANG gene with an ER signal retention peptide regulated by the AtRbcS light regulated promoter and nopaline synthase (nos) terminator for accumulation in dicot plant tissue (SEQ ID I0 NO: 26). The expression cassette contains the dicot optimised ANG gene sequence outlined in Figure 7. The AtRbcS promoter is indicated in UPPERCASE italics, the ANG gene is in plain UPPERCASE with the ER signal retention peptide UNDERLINED and the start and stop codon highlighted in Qffcy The nos terminator is presented in lowercase. 15 Figure 12. Vector map of sequence outlined in Figure 11 containing the ANG gene with an ER signal retention peptide regulated by the AtRbcS light regulated promoter and nos terminator for transfection and accumulation in dicot plant tissue.
Figure 13. Vector map of a control expression cassette designed to express the fluorescent reporter (turboGFP) under control of the constitutive CaMV35s promoter 20 from the plant Cauliflower Mosaic virus (CaMV) for confirmation of expression in dicot plant tissue.
Figure 14. Nucleotide sequence of an expression cassette containing the ANG gene with an ER signal retention peptide regulated by the TaRbcS light regulated promoter and nopaline synthase (nos) terminator for accumulation in monocot plant tissue (SEQ 25 ID NO: 27). The expression cassette contains the monocot optimised ANG gene sequence outlined in Figure 6. The TaRbcS promoter is indicated in UPPERCASE italics, the ANG gene is in plain UPPERCASE with the ER signal retention peptide -8- 2015202777 22 May 2015 UNDERLINED and the start and stop codon highlighted in ||||. The nos terminator is presented in lowercase.
Figure 15. Vector map of sequence outlined in Figure 14 containing the ANG gene with an ER signal retention peptide regulated by the TaRbcS light regulated promoter and 5 nos terminator for accumulation in monocot plant tissue.
Figure 16. Vector map of a control expression cassette designed to express the fluorescent reporter (dsRED) under control of the constitutive ubiquitin promoter from Zea mays (ZmUbi) for confirmation of expression in monocot plant tissue.
Figure 17. Nucleotide sequence of an expression cassette containing the ANG gene I0 with an ER signal retention peptide regulated by the AtRbcS light regulated promoter and CaMV35S terminator for transformation and accumulation in dicot plant tissue (SEQ ID NO: 28). The expression cassette contains the ANG gene sequence outlined in Figure 3. The AtRbcS promoter is indicated in UPPERCASE ITALICS, the ANG gene is in plain UPPERCASE with the ER signal retention peptide UNDERLINED and the 15 start and stop codon highlighted in grey. The CaMV35S terminator is presented in lowercase.
Figure 18. Vector map of sequence outlined in Figure 11 containing the ANG gene with an ER signal retention peptide regulated by the AtRbcS light regulated promoter and nos terminator for transformation and accumulation in monocot plant tissue. The base 20 vector sequence contains the necessary elements for Agrobacterium-mediated transformation and regeneration under appropriate selection.
Figure 19. Representative nucleotide sequence of an expression cassette containing the ANG gene with an ER signal retention peptide regulated by the TaRbcS light regulated promoter and terminator for accumulation in monocot plant tissue (SEQ ID 25 NO: 29). The expression cassette contains the ANG gene sequence outlined in Figure 6. The TaRbcS promoter is indicated in UPPERCASE Italics, the ANG gene is in plain -9- 2015202777 22 May 2015 UPPERCASE with the ER signal retention peptide UNDERLINED and the start and stop codon highlighted in grey. The TaRbcS terminator is presented in lowercase.
Figure 20. Vector map of sequence outlined in Figure 14 containing the ANG gene with an ER signal retention peptide regulated by the TaRbcS light regulated promoter and 5 nos terminator for transformation and accumulation in dicot plant tissue. The base vector sequence contains the necessary elements for regeneration under appropriate selection.
Figure 21. Representative nucleotide sequence of an expression cassette containing the ANG gene with an ER signal retention peptide regulated by the LpRbcS light I0 regulated promoter and LpFT4 terminator for accumulation in monocot plant tissue (SEQ ID NO: 30). The expression cassette contains the ANG gene sequence outlined in Figure 6. The LpRbcS promoter is indicated in UPPERCASE italics, the ANG gene is in plain UPPERCASE with the ER signal retention peptide UNDERLINED and the start and stop codon highlighted in ||||. The LpFT4 terminator is presented in lowercase. 15 Figure 22. Representative nucleotide sequence of an expression cassette containing the ANG gene with an ER signal retention peptide regulated by the Brassica napus napin gene seed specific promoter and CaMV35S terminator for accumulation in dicot seeds (SEQ ID NO: 31). The expression cassette contains the ANG gene sequence outlined in Figure 7. The napin gene promoter is indicated in UPPERCASE italics, the 20 ANG gene is in plain UPPERCASE with the ER signal retention peptide UNDERLINED and the start and stop codons highlighted in grey The CaMV35S terminator is presented in lowercase.
Figure 23. Nucleotide sequence of an expression cassette containing the ANG gene with an ER signal retention peptide regulated by the Brassica napus napin gene seed 25 specific promoter and nos terminator for accumulation in dicot seeds (SEQ ID NO: 32). The expression cassette contains the ANG gene sequence outlined in Figure 7. The Bn_napin gene promoter is indicated in UPPERCASE italics, the ANG gene is in plain -10- 2015202777 22 May 2015 UPPERCASE with the ER signal retention peptide UNDERLINED and the start and stop codons highlighted in grey. The nos terminator is presented in lowercase.
Figure 24. Vector map of sequence outlined in Figure 23 containing the ANG gene with an ER signal retention peptide regulated by the Brassica napus napin promoter and nos 5 terminator for transformation and accumulation in dicot seed tissue. The base vector sequence contains the necessary elements for Agrobacterium-mediated transformation and regeneration under appropriate selection.
Figure 25. Representative nucleotide sequence of an expression cassette containing the ANG gene with an ER signal retention peptide regulated by the Zea mays zein 4 I0 gene seed specific promoter and CaMV35S terminator for accumulation in monocot seeds (SEQ ID NO: 33). The expression cassette contains the ANG gene sequence outlined in Figure 6. The Zm zein promoter is indicated in UPPERCASE italics, the ANG gene is in plain UPPERCASE with the ER signal retention peptide UNDERLINED and the start and stop codons highlighted in grey. The CaMV35S terminator is presented in 15 lowercase.
Figure 26. Nucleotide sequence of an expression cassette containing the ANG gene with an ER signal retention peptide regulated by the Zea mays zein 4 gene seed specific promoter and nos terminator for accumulation in monocot seeds (SEQ ID NO: 34). The expression cassette contains the ANG gene sequence outlined in Figure 6. 20 The Zm_zein 4 gene promoter is indicated in UPPERCASE italics, the ANG gene is in plain UPPERCASE with the ER signal retention peptide UNDERLINED and the start and stop codons highlighted in grey The nos terminator is presented in lowercase.
Figure 27. Vector map of sequence outlined in Figure 26 containing the ANG gene with an ER signal retention peptide regulated by the Zea mays zein 4 promoter and nos 25 terminator for transformation and accumulation in monocot seed tissue. The base vector sequence contains the necessary elements for Agrobacterium-mediated transformation and regeneration under appropriate selection. -11 - 2015202777 22 May 2015
Figure 28. Nucleotide sequence of an expression cassette containing the ANG gene with an ER signal retention peptide regulated by the Orysa sativa PR602 gene seed specific promoter and nos terminator for accumulation in monocot seeds (SEQ ID NO: 35). The expression cassette contains the ANG gene sequence outlined in Figure 6. 5 The PR602 gene promoter is indicated in UPPERCASE italics, the ANG gene is in plain UPPERCASE with the ER signal retention peptide UNDERLINED and the start and stop codons highlighted in grey. The nos terminator is presented in lowercase.
Figure 29. Vector map of sequence outlined in Figure 28 containing the ANG gene with an ER signal retention peptide regulated by the Orysa sativa PR602 promoter and nos I0 terminator for transformation and accumulation in monocot seed tissue. The base vector sequence contains the necessary elements for Agrobacterium-mediated transformation and regeneration under appropriate selection.
Figure 30. Nucleotide sequence of an expression cassette containing the ANG gene with an ER signal retention peptide regulated by the Triticum aestivum glutelin gene 15 seed specific promoter and nos terminator for accumulation in monocot seeds (SEQ ID NO: 36) . The expression cassette contains the ANG gene sequence outlined in Figure 6. The glutelin gene promoter is indicated in UPPERCASE italics, the ANG gene is in plain UPPERCASE with the ER signal retention peptide UNDERLINED and the start and stop codons highlighted in grey. The nos terminator is presented in lowercase. 20 Figure 31. Vector map of sequence outlined in Figure 30 containing the ANG gene with an ER signal retention peptide regulated by the Triticum aestivum glutelin promoter and nos terminator for transformation and accumulation in monocot seed tissue. The base vector sequence contains the necessary elements for Agrobacterium-mediated transformation and regeneration under appropriate selection. 25 Figure 32. Representative nucleotide sequence of an expression cassette containing the ANG gene with the tobacco calreticulin apoplast signal peptide regulated by the constitutive CaMV35S promoter and terminator for guttation secretion in plants (SEQ ID NO: 37). The expression cassette contains the ANG gene sequence outlined in Figure 2015202777 22 May 2015 -12- 7. The CaMV35S promoter is indicated in UPPERCASE italics, the ANG gene is in plain UPPERCASE with the apoplast signal peptide UNDERLINED and the start and stop codons highlighted in grey The CaMV35S terminator is presented in lowercase.
Figure 33. Representative nucleotide sequence of an expression cassette containing 5 the ANG gene with the tobacco calreticulin apoplast signal peptide regulated by the Arabidopsis phosphate transporter (AtPHTI) gene root-specific promoter and CaMV35S terminator for secretion in dicot roots (SEQ ID NO: 38). The expression cassette contains the ANG gene sequence outlined in Figure 7. The AtPHTI promoter is indicated in UPPERCASE italics, the ANG gene is in plain UPPERCASE with the 10 apoplast signal peptide UNDERLINED and the start and stop codons highlighted in iill The CaMV35S terminator is presented in lowercase.
Figure 34. Representative nucleotide sequence of an expression cassette containing the ANG gene with the tobacco calreticulin apoplast signal peptide regulated by the Hordeum vulgare phosphate transporter (HvPHTI) gene root-specific promoter and 15 CaMV35S terminator for secretion in monocot roots (SEQ ID NO: 39). The expression cassette contains the ANG gene sequence outlined in Figure 6. The HvPHTI promoter is indicated in UPPERCASE italics, the ANG gene is in plain UPPERCASE with the apoplast signal peptide UNDERLINED and the start and stop codons highlighted in iill. The CaMV35S terminator is presented in lowercase. 20 Figure 35. Representative nucleotide sequence of an expression cassette containing an oleosin_ANG gene fusion regulated by the Arabidopsis oleosin gene promoter and CaMV35S terminator for targeting to the oilbody in dicots (SEQ ID NO: 40). The expression cassette contains the ANG gene sequence outlined in Figure 7. The Arabidopsis oleosin gene promoter is indicated in UPPERCASE italics. The 25 Arabidopsis olesin gene is indicated in plain UPPERCASE and the ANG gene in underlined UPPERCASE with the thrombin protease recognition site highlighted in IflBHS and the start and stop codons highlighted in ||§i. The CaMV35S terminator is presented in lowercase. -13- 2015202777 22 May 2015
Figure 36. Representative nucleotide sequence of an expression cassette containing the tobacco 16sRNA operon (Prrn) promoter and terminator regulatory sequences (Zoubenko,et al., 1994) to express the angiogenin gene in chloroplasts (SEQ ID NO: 41). The 16sRNA operon (Prrn) promoter is indicated in UPPERCASE italics, the ANG 5 gene is in plain UPPERCASE and the start and stop codons highlighted in gref. The 16sRNA operon (Prrn) terminator is presented in lowercase.
Figure 37. A. Mesophyll-derived protoplasts of Nicotiana tabacum recovered from in-vitro grown leaves approximately 4-6 weeks old; 0 days post transfection; B. Assessment of protoplasts vigour, with dead cells indicated by dark staining, showing I0 greater than 95 percent viability using Evan’s Blue Stain; pre-transfection; C. Assessment of protoplast vigour, with dead cells indicated by dark staining, showing greater than 95 percent viability using Evan’s Blue Stain; 36 hours post-transfection.
Figure 38. Assessment of transient expression 36 hours post transfection with plasmid DNA containing the turboGFP gene encoding the green fluorescent protein. Protoplasts 15 visualised under A. bright field and B. fluorescent light. The green fluorescent protein is observed as a bright spot under fluorescent light.
Figure 39. Electrophoresis of Reverse-transcriptase PCR samples and controls. Lane 1: NO-RT control reaction performed with ANG (F and R) primers on tobacco mesophyll protoplasts transfected with 0957286 CaMV35S-p_turboGFP_nos-t. Lane 2: cDNAfrom 20 tobacco mesophyll protoplasts transfected with 0957286 CaMV35S-p_turboGFP_nos-t amplified with ANG (F and R) primers. Lane3: NO-RT control reaction performed with ANG (F and R) primers on tobacco mesophyll protoplasts transfected with 1031308 AtRbcS-p_ANG_nos-t. Lane 4: cDNA from tobacco mesophyll protoplasts transfected with 1031308 AtRbcS-p_ANG_nos-t amplified with ANG (F and R) primers. Lane 5: 25 Negative control reaction performed without template (ANG F and R primers). Lane 6: Positive control reaction performed with plasmid template (ANG F and R primers). Lane 7: 1 kb plus DNA Ladder (Invitrogen) Lane 8: NO-RT control reaction performed with Actin (F and R) primers on tobacco mesophyll protoplasts transfected with 0957286 CaMV35S-p_turboGFP_nos-t. Lane 9: cDNA from tobacco mesophyll protoplasts -14- 2015202777 22 May 2015 transfected with 0957286 CaMV35S-p_turboGFP_nos-t amplified with Actin (F and R) primers. Lane 10: NO-RT control reaction performed with Actin (F and R) primers on tobacco mesophyll protoplasts transfected with 1031308 AtRbcS-p_ANG_nos-t. Lane 11: cDNA from tobacco mesophyll protoplasts transfected with 1031308 AtRbcS-5 p_ANG_nos-t amplified with Actin (F and R) primers. Lane 12: Negative control reaction performed without template (Actin F and R primers).
Figure 40. A. Mesophyll-derived protoplasts recovered from mature leaves of T. aestium, 0 days post transfection; B. Assessment of protoplast vigour, with dead cells indicated by dark staining, showing greater than 95 percent viability using Evan’s Blue I0 Stain; pre-transfection; C. Assessment of protoplast vigour, with dead cells indicated by dark staining, showing greater than 81 percent viability using Evan’s Blue Stain; 24 hours post-transfection.
Figure 41. Assessment of transient expression 36 hours post transfection with plasmid DNA containing the dsRED gene encoding the dsRED protein. Protoplasts visualised 15 under A. bright field and B. fluorescent light. The dsRED protein is observed as a bright spot under fluorescent light.
Figure 42. Electrophoresis of Reverse-transcriptase PCR samples and controls. Lane 1: NO-RT control reaction performed with ANG_F and polyT_R primers on wheat mesophyll protoplasts. Lane 2: cDNA generated by reverse transcription with oligo-dT 20 from total RNA of wheat mesophyll protoplasts amplified with ANG_F and polyT_R primers. Lane3: NO-RT control reaction performed with ANG_F and polyT_R primers on wheat mesophyll protoplasts transfected with 1031312_TaRbcS-p_ANG_nos-t. Lane 4: cDNA from wheat mesophyll protoplasts transfected with 1031312_TaRbcS-p_ANG_nos-t amplified with ANG_F and polyT_R primers. Lane 5: Negative control 25 reaction performed without template (ANG_F and polyT_R primers). Lane 6: 1kb plus DNA Ladder (Invitrogen). Lane 7: NO-RT control reaction performed with Actin _F and polyT_R primers on wheat mesophyll protoplasts. Lane 8: cDNA from wheat mesophyll protoplasts amplified with Actin_F and polyT_R primers. Lane 9: NO-RT control reaction performed with Actin_F and polyT_R primers on tobacco mesophyll protoplasts 2015202777 22 May 2015 -15- transfected with 1031308 AtRbcS-p_ANG_nos-t. Lane 10: cDNAfrom wheat mesophyll protoplasts transfected with 1031312_TaRbcS-p_ANG_nos-t amplified with Actin_F and polyT_R primers. Lane 11: Negative control reaction performed without template (Actin_F and polyT_R primers). 5 Figure 43. Agrobacterium-mediated transformation of Canola (Brassica napus)\ A. seed imbibed on filter paper support; B. synchronous germination of seed; C. preprocessing of germinated shoots; D, processing of cotyledons for use as explants; E. regeneration of shoots following cocultivation with Agrobacterium·, and F. mature plant in glasshouse. I0 Figure 44. Preparation of embryogenic callus and biolistic transformation of perennial ryegrass: A. tillers of flowering glasshouse-grown plants prior to surface-sterilisation; B. an immature inflorescence isolated for culture in vitro\ C. embryogenic callus after culturing of immature inflorescence tissue in vitro for 4-6 weeks; D-E. isolation of 3-5 mm explants of friable embryogenic callus prior to particle bombardment; F. biolistic 15 bombardment of callus with gold particles coated with a transformation construct; G-H. an antibiotic-resistant shoot on selective medium; I. antibiotic-resistant shoots in vessels of root-inducing medium; J. putative transgenic plantlets in soil.
Figure 45. Agrobacterium-mediated transformation of bread wheat: A. donor plants ready for harvest; B&C. harvested material for use as source of embryo explants; D. 20 callus material; E. pre-regeneration material on tissue culture medium; F. callus material illustrating reporter gene expression; G. regenerating shoots from callus; H. rooting shoots on selection media; and I. rooted plant in soil.
Figure 46. Agrobacterium-mediated transformation of white clover: A. isolation of cotyledonary explants from a mature seed; B. selection of antibiotic-resistant shoots on 25 regeneration medium, C. antibiotic-resistant shoots in vessels of root-inducing medium and D. a putative transgenic plantlet in soil. 2015202777 22 May 2015 - 16-
Figure 47. Map of transformation vector containing nos_nptll_nos selectable marker cassette and the AtRbcS_ANG_CamV35S (Figure 17) expression cassette used in Agrobacterium mediated transformation of white clover.
Figure 48. RT-PCR of positive and negative control (lanes 5 and 6) and putative 5 transgenic angiogenin white clover plants (lanes 1 to 4). Primers used were specific to the angiogenin gene.
Figure 49. 2DE gel protein analysis of non-transgenic control and transgenic white clover plants. The three circles represent the ribulose bisphosphate carboxylase small subunit. The angiogenin protein is represented by the square. I0 Figure 50. 2DE gel protein sequence analysis (SEQ ID NO: 42). Sixty seven percent sequence coverage (indicated in bold and underlined) was obtained of the protein extracted from the gel.
Figure 51. Electrophoresis of PCR samples and controls. Lane 1: 1 kb plus DNA Ladder (Invitrogen) Lane 2 and 3: PCR of DNA from Arabidopsis transgenic line 1, transformed 15 with pPFG000023 AtRbcS-ANG_nos-t, amplified with ANG (F and R) primers. Lane 4 and 5: PCR of DNA from Arabidopsis transgenic line 2, transformed with pPFG000023 AtRbcS-ANG_nos-t, amplified with ANG (F and R) primers. Lane 6 and 7: PCR of DNA from wild-type untransformed Arabidopsis amplified with ANG (F and R) primers. Lane 8 and 9: Positive control reaction performed with pPFG000023 plasmid template (ANG F 20 and R primers).
Detailed Description of the Embodiments
In a first aspect, the present invention provides a plant cell, plant callus, plant, seed or other plant part including an angiogenin gene or a functionally active fragment or variant thereof and/or an angiogenin polypeptide. Preferably, said plant cell, plant callus, plant, 25 seed or other plant part is produced by a method as described herein. - 17- 2015202777 20 Μ 2017
In a preferred aspect, the angiogenin gene or functionally active fragment or variant thereof may be co-expressed with a modular or mediator of angiogenin activity.
In a particularly preferred embodiment, the present invention provides a plant cell, plant callus, plant, seed or other plant part including an angiogenin gene or a functionally 5 active fragment or variant thereof, wherein the angiogenin gene is modified to alter its targeting signal sequence to direct the angiogenin to a target sub-cellular component or plant tissue.
By ‘plant cell’ is meant any self-propagating cell bounded by a semi-permeable membrane and containing a plastid. Such a cell also requires a cell wall if further .o propagation is desired. Plant cell, as used herein includes, without limitation, algae, cyanobacteria, seeds suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.
In a second aspect, the present invention provides methods of using the plant cells, plant calli, plants, seeds or other plant parts including an angiogenin as a composition .5 such as a feed stock, food supplement or veterinary product for animals or a food, food supplement, nutraceutical or pharmaceutical suitable for human consumption. For example, the value added plant material, including the angiogenin protein, may be used as an enhanced feedstock for a variety of applications.
Accordingly, the present invention provides a method of using a plant cell, plant callus, 20 plant, seed or other plant part including an angiogenin as feed stock for animals or as a composition suitable for human consumption, said method comprising producing the angiogenin in the plant cell, plant callus, plant, seed or other plant part and preparing it in a form suitable for use as a feed stock for animals or a composition suitable for human consumption. 25 Animals to which the invention may be applied include pigs, chickens (broilers and layers), beef, dairy, goats, sheep are livestock, that can benefit from abundant sources of angiogenin provided by plants, as would companion animals and performance animals eg horses, dogs. 2015202777 20 Μ 2017 -18- lt may be desirable to administer plant derived angiogenin encapsulated or otherwise protected to passage the rumen or stomach more effectively. Less digestible tissues such as seed coat and roots (as opposed to fruit and leaves) may extend gut passage and digestive tract protein release for intestinal binding and uptake. 5 Co-administration with other supplements and treatments, eg growth hormone such as bovine somatotrophin, antibiotics, nutrient supplements for animals, is also contemplated.
In a third aspect, the present invention provides a plant-produced angiogenin. Preferably said angiogenin is produced by a method as described herein. .0 In a further aspect, the present invention provides a feedstock, food supplement or veterinary product including a plant-produced angiogenin. Preferably said angiogenin is produced by a method as described herein.
In a further aspect, the present invention provides a food, beverage, food supplement, nutraceutical or pharmaceutical including a plant-produced angiogenin. Preferably said .5 angiogenin is produced by a method as described herein.
In a further aspect, the present invention provides a method of producing a transformed plant cell expressing an angiogenin gene, said method comprising providing a gene encoding angiogenin or a functionally active fragment or variant thereof, and a plant cell; 20 introducing the angiogenin gene into the plant cell to produce a transformed plant cell; and culturing the transformed plant cell to produce a transformed plant cell expressing the angiogenin gene. 2015202777 20 Μ 2017 - 18a- Ιη a particularly preferred embodiment, the present invention provides a method of producing a transformed plant cell expressing an angiogenin gene, said method comprising: providing a gene encoding angiogenin or a functionally active fragment or variant 5 thereof, and a plant cell; introducing the angiogenin gene into the plant cell to produce a transformed plant cell; and culturing the transformed plant cell to produce a transformed plant cell expressing the angiogenin gene, .0 wherein the angiogenin gene is modified to alter its targeting signal sequence to direct the angiogenin to a target sub-cellular component or plant tissue.
By a ‘transformed plant cell’ is meant a plant cell which has undergone transformation.
By ‘transformation’ is meant the transfer of nucleic acid into a plant cell.
By a ‘gene encoding angiogenin” or ‘angiogenin gene’ is meant a nucleic acid encoding .5 a polypeptide having one or more of the biological properties of angiogenin. The gene encoding angiogenin may be a transgene. The gene encoding angiogenin may include an angiogenin coding sequence optionally operatively linked to a sequence encoding 2015202777 22 May 2015 -19- one or more of a promoter, signal peptide, terminator, and mediator or modulator of angiogenin activity.
By a ‘transgene’ is meant a nucleic acid suitable for transforming a plant cell.
By a ‘functionally active’ fragment or variant of an angiogenin gene is meant that the 5 fragment or variant (such as an analogue, derivative or mutant) encodes a polypeptide having one or more of the biological properties of angiogenin. Such variants include naturally occurring allelic variants and non-naturally occurring variants. Additions, deletions, substitutions and derivatizations of one or more of the nucleotides are contemplated so long as the modifications do not result in loss of functional activity of 10 the fragment or variant.
Preferably the functionally active fragment or variant has at least approximately 80% identity to the relevant part of the specified sequence to which the fragment or variant corresponds, more preferably at least approximately 90% identity, even more preferably at least approximately 95% identity, most preferably at least approximately 98% identity. 15 Preferably the fragment has a size of at least 20 nucleotides, more preferably at least 50 nucleotides, more preferably at least 100 nucleotides, more preferably at least 200 nucleotides, more preferably at least 300 nucleotides.
Such functionally active variants and fragments include, for example, those having conservative nucleic acid changes, those having codon usage adapted for plants, and 20 those in which the signal peptide is removed and optionally replaced by another signal peptide.
By ‘conservative nucleic acid changes’ is meant nucleic acid substitutions that result in conservation of the amino acid in the encoded protein, due to the degeneracy of the genetic code. Such functionally active variants and fragments also include, for example, 25 those having nucleic acid changes which result in conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence. 2015202777 22 May 2015 -20-
By ‘conservative amino acid substitutions’ is meant the substitution of an amino acid by another one of the same class, the classes being as follows:
Nonpolar: Ala, Val, Leu, lie, Pro, Met Phe, Trp Uncharged polar: Gly, Ser, Thr, Cys, Tyr, Asn, Gin 5 Acidic: Asp, Glu
Basic: Lys, Arg, His
Other conservative amino acid substitutions may also be made as follows:
Aromatic: Phe, Tyr, His Proton Donor: Asn, Gin, Lys, Arg, His, Trp 10 Proton Acceptor: Glu, Asp, Thr, Ser, Tyr, Asn, Gin
Particularly preferred fragments and variants include one or more conserved binding domains such as sequences encoding a catalytic core or a cell binding site. Examples of such domains are shown in Figure 2 and preferably include the sequence Arg, Asn, Gly, Gin, Pro, Tyr, Arg, Gly, Asp (SEQ ID NO: 43). 15 Particularly preferred fragments and variants include a catalytic core. By a “catalytic core” is meant an internal region of the polypeptide excluding signal peptide and N- and C-terminal variable regions including catalytic amino acids. Examples of catalytic amino acids are shown in Figure 2.
Two distinct regions of angiogenin are required for its angiogenic activity including a 20 catalytic site containing His-13, Lys-41, and His-115 that is capable of cleaving RNA and a noncatalytic, cell binding site encompassing minimally residues 60-68. RNase activity and receptor binding capacity, while required, are not sufficient for angiogenic activity: endocytosis and nuclear translocation are required as well. -21 - 2015202777 22 May 2015
Catalytic residues in angiogenin include His-13, Lys-40, Gln-12 and Thr-44, for example. These residues may be conserved to retain RNase and/or cellular activity.
Activity may be increased or decreased by changing key amino acids at or near the active site with improved activity substituting Asp-116 to His being an example 5 (Acharva, Shapiro et al). Arg-5 and Arg-33 may also be important for activity.
Cellular uptake of angiogenin in proliferating endothelial cells is mediated by domains and is not dependent upon RNase activity as enzymatically inactive mutants can be internalized. K41Q and H13A mutants for example are enzymatically inactive but are translocated. Improved versions of angiogenin more readily internalised by cells and I0 more potent are within the scope of the present invention, and such variants can be tested for by conducting in vitro uptake and activity tests on epithelial and muscle cells in culture.
Particularly preferred fragments and variants include those lacking a signal peptide. By a “signal peptide” is meant an N-terminal signal sequence. An example of a signal 15 peptide is shown in Figure 2 and includes the sequence Met, Val, Met, Val, Leu, Ser, Pro, Leu, Phe, Leu, Val, Phe, lie, Leu, Gly, Leu, Gly, Leu Thr, Pro, Val, Ala, Pro, Ala (SEQ ID NO: 44).
Particularly preferred fragments and variants have codon usage adapted for plants, including the start of translation for monocots and dicots. Thus, the fragment or variant 20 encodes a polypeptide having one or more of the biological properties of angiogenin, but one or more codons, particularly in the third position, may be changed so that the gene is more readily expressed in plants compared with the corresponding animal gene. Changes to one or more of the nucleotides are contemplated so long as the modifications do not result in loss of functional activity of the fragment or variant. 25 Preferably the fragment or variant has at least approximately 60% identity to the relevant part of the original animal sequence to which the modified gene corresponds, more preferably at least approximately 80% identity, even more preferably at least approximately 95% identity, most preferably at least approximately 98% identity. 2015202777 22 May 2015 -22-
Particularly preferred fragments and variants have cryptic splice sites and/or RNA destabilizing sequence elements inactivated or removed.
It may also be desirable to remove A+T - rich sequences that may cause mRNA instability. This may increase mRNA stability or aberrant splicing and improve efficiency 5 of transcription in plant cell nuclei. This may also eliminate a potential premature poly(A).
Preferably, the angiogenin gene is isolated from or corresponds to an angiogenin gene from an animal, more preferably from a cow, human, gorilla, chimp, monkey, horse, pig, rat, mouse, fish or chicken, even more preferably from Bos taurus (cow). 10 In a particularly preferred embodiment the angiogenin gene encodes a polypeptide comprising the sequence shown in Figure 2.
In another particularly preferred embodiment, the angiogenin gene comprises a sequence selected from the group consisting of the sequences shown in Figure 4; and functionally active fragments and variants thereof. 15 To reduce the possibility of aberrant developmental phenotypes the angiogenin gene may be modified to alter its targeting signal sequence to direct the angiogenin gene to a target sub-cellular component or plant tissue, such as ER, apoplast, peroxisome or vacuole.
More particularly, a chimeric sequence may be created, whereby the signal peptide of 20 the angiogenin gene may be removed and optionally replaced by another signal peptide, for example a plant signal peptide, said plant signal peptide optionally driving angiogenin accumulation to a selected sub-cellular component or plant tissue.
Accordingly, in a still further aspect, the present invention provides a chimeric sequence comprising an angiogenin gene, or a functionally active fragment or variant thereof, and 25 a plant signal peptide. -23- 2015202777 22 May 2015 ln a preferred embodiment, the plant signal peptide may be from or correspond to a signal peptide from an ER-derived protein, such as a protein containing a C-terminus 4-amino-acid retention sequence, KDEL (lys-asp-glu-leu).
The angiogenin gene may be introduced into the plant cell by any suitable technique. 5 Techniques for incorporating the angiogenin gene into plant cells (for example by transduction, transfection, transformation or gene targeting) are well known to those skilled in the art. Such techniques include Agrobacterium-med\ated introduction, Rhizobium-med\aied introduction, electroporation to tissues, cells and protoplasts, protoplast fusion, injection into reproductive organs, injection into immature embryos 10 and high velocity projectile introduction to cells, tissues, calli, immature and mature embryos, biolistic transformation, Whiskers transformation, and combinations thereof. The choice of technique will depend largely on the type of plant cell to be transformed, and may be readily determined by an appropriately skilled person.
The present invention may be applied to a variety of plants, including monocotyledons 15 [such as grasses (e.g. forage grasses including perennial ryegrass, tall fescue, Italian ryegrass, brachiaria, paspalum), sorghum, sugarcane, corn, oat, wheat, rice and barley)], dicotyledons [such as forage legumes (e.g. white clover, red clover, subterranean clover, alfalfa), soybean, lupin, peas, lentils, chickpeas, canola, vegetable brassicas, lettuce, spinach, fruiting plants (e.g. bananas, citrus, strawberries, apples), oil 20 palm, linseed, cottonseed, safflower, tobacco] and gymnosperms.
In a further aspect the present invention provides a method of producing an angiogenin in a plant, said method comprising providing a gene encoding angiogenin or a functionally active fragment or variant thereof, and a plant cell; 25 introducing the angiogenin gene into the plant cell to produce a transformed plant cell; culturing the transformed plant cell to produce a transformed plant cell expressing the angiogenin gene; and isolating the angiogenin produced by the plant cell. -24- 2015202777 22 May 2015
The angiogenin may be isolated by techniques known to those skilled in the art. For example, cation exchange purification (or enrichment), or size selection may be used.
The term “isolated” means that the angiogenin is removed from its original environment, and preferably separated from some or all of the coexisting materials in the 5 transformation system. Preferably, the angiogenin is at least approximately 90% pure, more preferably at least approximately 95% pure, even more preferably at least approximately 98% pure.
In a further aspect, the present invention provides a method of producing transformed plant calli, plants, seeds or other plant parts including angiogenin, said method 10 comprising providing a gene encoding angiogenin or a functionally active fragment or variant thereof, and a plant cell; introducing the angiogenin gene into the plant cell to produce a transformed plant cell; 15 culturing the transformed plant cell to produce transformed plant calli, plants, seeds or other plant parts including angiogenin.
Cells incorporating the angiogenin gene may be selected, as described below, and then cultured in an appropriate medium to regenerate transformed plant calli, plants, seeds or other plant parts, using techniques well known in the art. The culture conditions, such 20 as temperature, pH and the like, will be apparent to the person skilled in the art. The resulting plants may be reproduced, either sexually or asexually, using methods well known in the art, to produce successive generations of transformed plants.
In a further aspect, the method further includes isolating angiogenin from the transformed plant calli, plants, seeds or other plant parts. 25 The angiogenin may be isolated by techniques known to those skilled in the art, for example by extraction. For example, angiogenin may be isolated from ultrafiltrate (Fedorova et al., 2002), including precipitation with ammonium sulfate, followed by -25- 2015202777 22 May 2015 cation exchange purification, or using a placental ribonuclease inhibitor binding assay (Bond and Vallee, 1988). More purification may be required for human applications and processed food ingredients and construction.
In a still further aspect, the present invention provides methods of enhancing 5 expression, activity or isolation of angiogenin in plants. The angiogenin gene may be modified to improve its function in animals, particularly mammals. Plant expression may be tailored for enhanced active protein preparation, digestive uptake and biological activity in humans and other animals. For example, the angiogenin gene may be modified to improve a function selected from the group consisting of cellular delivery, I0 myogenic activity, RNase enzyme activity, rRNA transcriptional activity and/or DNA binding activity, rRNA processing and/or splicing activity and receptor binding and/or endocytosis. For example, protease stability, heat stability and/or pH resistance may be improved, which may in turn assist in processing and/or purification of plant-produced angiogenin. 15 Post-harvest treatment and/or processing may also enhance heat stability, protease stability and/or, cellulase treatment compatibility.
The present invention also contemplates silage compatible expression in plants. Antimicrobial co-expression may be used to stabilize native protein by protecting from or reducing bacterial and/or fungal degradation. Examples include antimicrobial peptides 20 made by bacteria (bacteriocins) or plants (eg thionines, plant defensins) or fungi (AFP and PAF from filamentous fungi) or animals (cathelicidins, defensins, lysozymes). Angiogenin may be complexed with RNase inhibitor to enhance angiogenin expression when co-expressed to reduce toxicity in plants.
The present invention also contemplates co-expressing an angiogenin gene or 25 functionally active fragment or variant thereof with a gene encoding a mediator or modulator of angiogenin activity.
By a ‘ mediator or modulator of angiogenin activitiy’ is meant a molecule that enhances or otherwise modifies expression, activity or isolation of angiogenin in a plant cell, plant -26- 2015202777 20 Μ 2017 callus, plant, seed or other plant part. For example, the mediator or modulator of angiogenin activity may improve protein accumulation, enhance protein action or activity, or make isolation of the protein more effective. Other examples include enhancement of post-harvest treatment, silage compatibility or processing, 5 improvement of protease stability or heat stability and improvement of treatment compatibility.
For example, the angiogenin gene may be co-expressed with a gene encoding one or more of antimicrobials, protease inhibitors, RNase inhibitors, follistatin, and delayed plant organ senescence gene or genes. .0 The present invention also contemplates artificial constructs or chimeric sequences comprising an angiogenin gene or functionally active fragment or variant thereof and a gene encoding a mediator or modulator of angiogenin activity.
In a particularly preferred embodiment, the present invention provides an artificial construct capable of enabling expression of an angiogenin gene or a functionally active .5 fragment or variant thereof in a plant cell, said artificial construct including a promoter, operatively linked to an angiogenin gene, or a functionally active fragment or variant thereof, wherein the angiogenin gene is modified to alter its targeting signal sequence to direct the angiogenin to a target sub-cellular component or plant tissue.
By a ‘chimeric sequence’ is meant a hybrid produced recombinantly by expressing a 20 fusion gene including two or more linked nucleic acids which originally encoded separate proteins, or functionally active fragments or variants thereof.
By a ‘fusion gene’ is meant that two or more nucleic acids are linked in such a way as to permit expression of the fusion protein, preferably as a translational fusion. This typically involves removing the stop codon from a nucleic acid sequence coding for a 25 first protein, then appending the nucleic acid sequence of a second protein in frame. The fusion gene is then expressed by a cell as a single protein. The protein may be engineered to include the full sequence of both original proteins, or a functionally active fragment or variant of either or both. 2015202777 20 Μ 2017 -26a-
The present invention also provides an angiogenin gene with codon usage adapted for plants, said angiogenin gene being capable of being expressed in a plant cell which has been transformed with said gene.
Preferably, the angiogenin gene is isolated from or corresponds to an angiogenin gene 5 from an animal, more preferably Bos taurus (cow). 2015202777 22 May 2015 -27- ln a particularly preferred embodiment the angiogenin gene encodes a polypeptide comprising the sequence shown in Figure 2.
In another particularly preferred embodiment, the angiogenin gene comprises a sequence selected from the group consisting of the sequences shown in Figure 4; and 5 functionally active fragments and variants thereof.
By an ‘angiogenin gene with codon usage adapted for plants’ is meant that the angiogenin gene encodes a polypeptide having one or more of the biological properties of angiogenin, but that one or more codons, particularly in the third position, have been changed so that the gene is more readily expressed in plants compared with the 10 corresponding animal gene. Changes to one or more of the nucleotides are contemplated so long as the modifications do not result in loss of functional activity of the fragment or variant. Preferably the angiogenin gene with codon usage adapted for plants has at least approximately 60% identity to the relevant part of the original animal sequence to which the modified gene corresponds, more preferably at least 15 approximately 80% identity, even more preferably at least approximately 95% identity, most preferably at least approximately 98% identity.
In a further aspect of the present invention, there is provided an artificial construct capable of enabling expression of an angiogenin gene in a plant cell, said artificial construct including a promoter, operatively linked to an angiogenin gene, or a 20 functionally active fragment or variant thereof.
By ‘artificial construct’ is meant a recombinant nucleic acid molecule.
By a ‘promoter’ is meant a nucleic acid sequence sufficient to direct transcription of an operatively linked nucleic acid sequence.
By ‘operatively linked’ is meant that the nucleic acid(s) and a regulatory sequence, such 25 as a promoter, are linked in such a way as to permit expression of said nucleic acid under appropriate conditions, for example when appropriate molecules such as -28- 2015202777 22 May 2015 transcriptional activator proteins are bound to the regulatory sequence. Preferably an operatively linked promoter is upstream of the associated nucleic acid.
By ‘upstream’ is meant in the 3’->5’ direction along the nucleic acid.
By ‘gene’ is meant a chain of nucleotides capable of carrying genetic information. The 5 term generally refers to genes or functionally active fragments or variants thereof and or other sequences in the genome of the organism that influence its phenotype. The term ‘gene’ includes DNA (such as cDNA or genomic DNA) and RNA (such as mRNA or microRNA) that is single- or double-stranded, optionally containing synthetic, nonnatural or altered nucleotide bases, synthetic nucleic acids and combinations thereof. 10 In a preferred embodiment, the artificial construct according to the present invention may be a vector.
By a ‘vector’ is meant a genetic construct used to transfer genetic material to a target cell.
The vector may be of any suitable type and may be viral or non-viral. The vector may be 15 an expression vector. Such vectors include chromosomal, non-chromosomal and synthetic nucleic acid sequences, eg. derivatives of plant viruses; bacterial plasmids; derivatives of the Ti plasmid from Agrobacterium tumefaciens; derivatives of the Ri plasmid from Agrobacterium rhizogenes; phage DNA; yeast artificial chromosomes; bacterial artificial chromosomes; binary bacterial artificial chromosomes; vectors derived 20 from combinations of plasmids and phage DNA. However, any other vector may be used as long as it is replicable or integrative or viable in the plant cell.
In a preferred embodiment of this aspect of the invention, the artificial construct may further include a terminator; said promoter, gene and terminator being operably linked.
The promoter, gene and terminator may be of any suitable type and may be 25 endogenous to the target plant cell or may be exogenous, provided that they are functional in the target plant cell. -29- 2015202777 22 May 2015
The promoter used in the constructs and methods of the present invention may be a constitutive, tissue specific or inducible promoter. For example, the promoter may be a constitutive cauliflower mosaic virus (CaMV35S) promoter for expression in many plant tissues, an inducible ‘photosynthetic promoter1 (eg. ribulose 1,5-bisphosphate), 5 capable of mediating expression of a gene in photosynthetic tissue in plants under light conditions, or a tissue specific promoter such as a seed specific promoter, for example from a gene selected from the group consisting of Brassica napus napin gene, Zea mays zein 4 gene, Orysa sativa PR602 gene and Triticum aestivum glutelin gene. A variety of terminators which may be employed in the artificial constructs of the present I0 invention are also well known to those skilled in the art. The terminator may be from the same gene as the promoter sequence or a different gene. Particularly suitable terminators are polyadenylation signals, such as the CaMV35S polyA and other terminators from the nopaline synthase (nos) and the octopine synthase (ocs) genes.
The artificial construct, in addition to the promoter, the gene and the terminator, may 15 include further elements necessary for expression of the gene, in different combinations, for example vector backbone, origin of replication (ori), multiple cloning sites, spacer sequences, enhancers, introns (such as the maize Ubiquitin Ubi intron), antibiotic resistance genes and other selectable marker genes [such as the neomycin phosphotransferase (nptll) gene, the hygromycin phosphotransferase (hph) gene, the 20 phosphinothricin acetyltransferase (bar or pat) gene], and reporter genes (such as beta-glucuronidase (GUS) gene (gusA)]. The artificial construct may also contain a ribosome binding site for translation initiation. The artificial construct may also include appropriate sequences for amplifying expression.
Those skilled in the art will appreciate that the various components of the artificial 25 construct are operably linked, so as to result in expression of the angiogenin gene. Techniques for operably linking the components of the artificial construct of the present invention are well known to those skilled in the art. Such techniques include the use of linkers, such as synthetic linkers, for example including one or more restriction enzyme sites. 2015202777 22 May 2015 -30-
Preferably, the artificial construct is substantially purified or isolated. By ‘substantially purified’ is meant that the artificial construct is free of the genes, which, in the naturally-occurring genome of the organism from which the nucleic acid or promoter of the invention is derived, flank the nucleic acid or promoter. The term therefore includes, for 5 example, an artificial construct which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or which exists as a separate molecule (eg. a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. It also includes an artificial construct which is part of a hybrid gene 10 encoding additional polypeptide sequence. Preferably, the substantially purified artificial construct is at least approximately 90% pure, more preferably at least approximately 95% pure, even more preferably at least approximately 98% pure.
The term “isolated” means that the material is removed from its original environment (eg. the natural environment if it is naturally occurring). For example, a naturally 15 occurring nucleic acid present in a living plant is not isolated, but the same nucleic acid separated from some or all of the coexisting materials in the natural system, is isolated. Such nucleic acids could be part of a vector and/or such nucleic acids could be part of a composition, and still be isolated in that such a vector or composition is not part of its natural environment. 20 As an alternative to use of a selectable marker gene to provide a phenotypic trait for selection of transformed host cells, the presence of the artificial construct in transformed cells may be determined by other techniques well known in the art, such as PCR (polymerase chain reaction), Southern blot hybridisation analysis, histochemical assays (e g. GUS assays), thin layer chromatography (TLC), northern and western blot 25 hybridisation analyses.
Applicant has surprisingly found that the methods of the present invention may result in enhanced yield of angiogenin in the transformed plant cell relative to yields of proteins typically produced in transgenic plant cells. -31 - 2015202777 22 May 2015
In a preferred embodiment the methods of the present invention provide a yield of between approximately 0.1% and 5%, more preferably between approximately 5% and 10%, more preferably between approximately 10% and 30%, of total soluble protein.
Examples 5 Example 1
Cloning of the bovine angiogenin gene
The Bos taurus (cow) angiogenin, ribonuclease, RNase A family, 5 (ANG), mRNA sequence is available from the National Centre for Biotechnology Information (NCBI), accession number AM_0011078144. The predicted open reading frame (ORF) contains I0 444 base pairs (bp) (Figure 1) encoding a 148 amino acid (aa) (Figure 2) sequence. Using the SignalP 3.0 server to predict the presence and location of signal peptide cleavage sites in amino acid sequences a 24 aa (72 bp) signal peptide sequence was identified (Figures 1 and 2).
The angiogenin protein sequence has been analysed by comparison to a database of 15 known allergens, the Food Allergy and Resource Research Program at the University of Nebraska allergen protein database (FARRP Allergen Online version 7.0). A BLASTp for every 80 amino acid peptides contained within the protein was searched against the FAARP Allergen Online database. None of the amino acid peptides contained 35% or higher identity to any of the known allergens of the database, a standard often used as 20 a threshold for allergenicity concern. A BLASTp for the angiogenin protein in its entirety was also searched against the FARRP Allergen Online dataset. The angiogenin protein did not contain eight or more consecutive amino acids in common with any member of the database, a standard frequently used as a threshold for allergenicity concern.
Using the angiogenin NCBI sequence, primers were designed to amplify a modified 25 ANG gene adapted for plant codon usage as defined by Murray et al. (1989) (Figure 3). No changes in amino acid sequence to that outlined in Figure 2 were observed.
The angiogenin gene from divergent organisms -32- 2015202777 22 May 2015
Using the bovine angiogenin gene as a query sequence a range of different sequences have been identified and are available from NCBI. Nucleotide and amino acid sequence alignments of angiogenin from divergent organisms have been produced (Figures 4 and 5). 5 Codon optimisation of angiogenin genes for expression in plants
Different ANG nucleotide sequences to those outlined in Figure 1 and 3, optimised by alternate methods for codon bias of both monocot and dicot plants have been produced to enhance protein expression in plants (Figures 6 and 7). Negative cis-acting sites which may negatively influence expression were eliminated wherever possible and GC I0 content was adjusted to prolong mRNA half life. An alignment to indicate the difference in sequence homology between the monocot and dicot optimised sequences is presented in Figure 8. The degree of sequence homology between the two sequences is 80.7%. The codon optimisation undertaken did not alter the amino acid sequence translation that is outlined in Figure 2 (without the signal peptide sequence). 15 Example 2
Production of fusion proteins for greater accumulation, enhanced action, or improved extraction, of angiogenin
It is possible to create fusion proteins of angiogenin with mediators or modulators of its activity to assist in the improvement of protein accumulation, enhancement of protein 20 action, or for effective extraction of the protein.
Fusion proteins for enhancing the action of angiogenin
Yeast two-hybrid technology has identified potential ANG-interacting molecules (Goa and Xu, 2008) such as alpha-actin 2 (ACTN-2) (Hu et al., 2005), regulatory proteins such as follistatin (FS) (Goa et al., 2007) and extracellular matrix proteins such as 25 fibulin-1 (Zhang et al., 2008). It is hypothesised that through interacting with ACTN-2, ANG may regulate the movement or the cytokinesis of the cells, follistatin may act as a regulator on angiogenin’s actions and interaction between ANG and fibulins may facilitate cell adhesion. -33- 2015202777 22 May 2015
Follistatin is known to have a role in muscle growth and regulates muscle cell development through binding and blocking myostatin, a TGF family member and potent negative regulator of myoblast growth and differentiation. In partnership with RNase5, follistatin can act directly and synergistically as a positive regulator of muscle growth 5 and differentiation. It has been demonstrated that RNase5 activation of muscle cell growth and differentiation in vitro is enhanced by follistatin (patent PCT/AU2009/000603). Creation of a translational fusion of these two genes, codon optimised for expression in plants, can be used to enhance the ability of angiogenin to control muscle development.
The activity of angiogenin may be blocked by ribonuclease inhibitors. Co-expression of 10 angiogenin with ribonuclease inhibitor both codon optimised for expression in plants, may be used to regulate the intracellular activity of angiogenin and improve expression by reducing toxicity in plants.
Fusion proteins for the improved extraction of angiogenin
Oleosins provide an easy way of purifying proteins which have been produced 15 recombinantly in plants. Oleosins are structural proteins found in a unique seed-oil storage organelle know as the oilbody. It is suggested that a central hydrophobic domain within the oleosin gene is most likely to play a role in localisation to the oil body. Therefore, through covalent fusions with oleosin a recombinant protein can be directed to the oil bodies allowing easy extraction. Abenes et al. (1997) showed that an 20 Arabidopsis oleosin-GUS fusion protein could be expressed and targeted to oil bodies in at least five species of oilseeds. Consequently, the angiogenin protein may be directed to the oil body by the creation of an oleosin_angiogenin fusion sequence (Figures 9 and 10). Incorporating a protease recognition site between the two sequences allows the oleosin to be cleaved from the protein of interest. 25 Example 3
Identification of promoter sequences for targeted expression of angiogenin
Promoters with tissue-specificity are required to drive expression of transgenes in crops to target accumulation in particular tissues/ organs and to avoid unwanted expression -34- 2015202777 22 May 2015 elsewhere. Therefore highly expressing but yet tightly controlled promoters are desirable.
Tissue specific or regulated promoters
The choice of promoters affects transgene expression concentration, as well as 5 developmental, tissue and cell specificity. Examples of different promoters to drive transgene expression for different objectives are presented in Table 1.
Table 1. Examples of different promoters to drive transgene expression.
Targeted expression Gene promoter Organism Reference Constitutive Constitutive Ubiquitin, Ubi Zea mays (maize) Christensen et al. (1992) CaMV35S2 Cauliflower mosaic virus Kay et al. (1987) Polyubiquitin, RUBQ2 Oryza sativa (rice) Liu et al. (2003) Actin 1, Os Act 1 Oryza sativa (rice) McElroy et al. (1990) Tissue Specific Tuber and stolon specific Sucrose synthetase, Sus4 Solanum tuberosum (potato) Lin et al. (2008) Cathepsin D inhibitor gene, Cathinh Solanum tuberosum (potato) Herbers et al. (1994) Root and shoot of sugar beet Helicase -like genes, helA, helB and heIC Pseudomonas plasmid Zhang et al. (2004) Root specific Phosphate T ransporter AtPHTI Arabidopsis thaliana Koyama et al., (2005) Phosphate Transporter HvPHT 1 Hordeum vulgare (barley) Schunnman et al., (2004) -35- 2015202777 22 May 2015
Targeted expression
Seed specific
Seed - Aluerone
Fruit specific
Phloem
Xylem
Xylem - lignified
Gene promoter
Organism
Reference β-conglycinin, a soybean seed storage protein 11S seed storage protein gene
Napin gene
Glutelin A
Glutelin
Zein gene, ZmZ4
Endoperm Specific, OsPR602
Maize regulatory gene B-Peru
Fruit specific E8
Sucrose synthase, Suc2 phenylalanine ammonialyase gene 2, PAL2
4-coumarate:coenzyme A ligase. 4CL cinnamoyl coenzymeA reductase (OCR) and
Glycine max (soybean)
Chen et al. (1988)
Coffea Arabica (coffee bean)
Marraccini et al. (1999)
Brasica napus (canola)
Lee et al. (1991)
Oryza staiva (rice)
Triticum aestivum (wheat)
Zea mays (maize)
Oryza staiva (rice)
Zea mays (maize)
Tomato
Zea mays (maize)
Nicotiana benthamiana (tobacco)
Nicotiana benthamiana (tobacco)
Eucalyptus gunnii
Hashizume et al. (2008)
Lamacchia et al. (2001)
Penderson et al. (1982) Schernthaner et al. (1988)
Li et al., (2008)
Selingeret al. (1998)
Ramierez et al. (2007)
Yang and Russell (1990)
Keller and Baumgartner (1991)
Hauffe et al. (1993)
Baghdady et al. -36- 2015202777 22 May 2015
Targeted expression Gene promoter Organism Reference cells cinnamyl alcohol dehydrogenase (CAD2) (Eucalyptus) (2006) inducible Cold, dehydration and salt stress responsive Calcium dependent protein kinases,OsCPK6, OsCPK13, Os CPK25 Oryza sativa (rice) Wan et al. (2007) Dehydration stress early responsive to dehydration stress, ERD1 Arabidopsis thaliana Tran et al. (2004) Stress responsive Rd29A Arabidopsis thaliana Yamaguchi-Shinozaki and Shinozaki (1993) Sucrose responsive ADP-glucose pyrophosphorylase, IbAGPI Ipomoea batatas (sweet potato) Kwak et al. (2005) ADP-glucose pyrophosphorylase, LeAgp S1 Lycopersicon esculentum (tomato) Li et al. (2001) 14-3-3 protein family, 16R Solanum tuberosum (potato) Szopa et al. (2003) Ethylene responsive ethelyene responsive binding elements, GhERF4 Gossypium hirsutum (cotton) Jin and Lui (2008) Cold responsive wcs120 Triticum aestivum (wheat) Ouellet et al. (1998) Dessication responsive in leaves, flowers and green fruit St DS2 Solanum tuberosum (potato) Doczi et al. (2005) L eDS2 Lycopersicon esculentum Doczi et al. (2005) 2015202777 22 May 2015 -37-
Targeted Gene expression promoter Organism Reference Oxidative stress Peptide meth induced by high reductase A, light and ozone onine sulfoxide Arabidopsis thaliana PMRSA Romero et al. (2006) Wound Wun1, proteir genes of pota lase inhibitor II Solanum tuberosum to (potato) Siebertz et al. (1989) Starch ADP Glucose Pyrophospho Arabidopsis thaliana ylase, ADPGIc Stark et al. 1992 Light regulated Ribulose-1,5-carboxylase/c subunit, TaRL and LpRbcS bisphosphate Triticum aestivum xygenase Small (wheat), Arabidopsis )cS, AtRbcS, thaliana, and Lolium espectively perenne respectively Zeng, et al., (1995), Sasanuma, (2001) Chlorophyll a/ Protein, LpCA b Binding Lolium perenne B (ryegrass)
Representative examples of promoters for light regulated, seed and root specific linked to the angiogenin gene are presented in Figures 11-34.
Example 4 5 Identification of signal peptide sequences for targeted expression of angiogenin
Signal peptides are short (3-60 amino acids long) peptide chains that direct the transport of a protein to different subcellular compartments such as the nucleus, mitochondrial matrix, endoplasmic reticulum (ER) , chloroplast, apoplast, vacuole and peroxisome. 10 Most proteins that are transported to the ER have a sequence consisting of 5-10 hydrophobic amino acids on the N-terminus. The majority of these proteins are then transported from the ER to the Golgi apparatus unless these proteins have a C-terminus 4-amino-acid retention sequence, KDEL (lys-asp-glu-leu), which holds them in the ER. 2015202777 22 May 2015 -38-
The nucleus and nucleolus can be targeted with either a nuclear localization signal (NLS) or a nucleolar localization signal (abbreviated NoLS or NOS), respectively. The signal peptide that directs to the mitochondrial matrix is usually called the mitochondrial targeting signal (MTS). There are two types (N- and C- terminus) peroxisomal targeting 5 signals (PTS). PTS1, consists of three amino acids at the C-terminus while PTS2, is made of a 9-amino-acid sequence present on the N-terminus of the protein.
Constructs containing tissue specific or regulated promoters
Signal peptides are desirable to target accumulation of recombinant proteins for extraction from plant secretions or plant tissue. Examples of different signal peptides to I0 drive target protein accumulation in different sub-cellular compartments are presented in Table 2.
Table 2. Examples of different signal peptide sequences for targeted transgene expression.
Signal target Gene signal peptide Organism Reference ER H/KDEL (C-terminal) Plant species Hara-Nishimura et al., (2004) apoplast Proteinase inhibitor II T obacco Denecke et al., (1990) Calreticulin Borisjuk et al., (1998) peroxisome SKL, SQL, -SML, -SSL, -SAL (all C-terminal) T obacco Kragleret al., (1998) vacuole NTPP (N-terminal) Plant species Marty, (1999) CTPP (C-terminal) 2015202777 22 May 2015 -39-
Example 5
Generation of vectors for transfection of dicot and monocot protoplasts Generation of vectors for transfection of dicot protoplasts
An expression vector was generated for transient expression of Angiogenin in dicot 5 protoplast cells. The nucleotide sequence of the expression cassette contains the ANG gene with an ER signal retention peptide regulated by the AtRbcS light regulated promoter and nopaline synthase (nos) terminator from Agrobacterium tumefaciens for accumulation in dicot plant tissue (1031312_AtRbcS-p_ANG_nos-t; Figures 11 and 12). A control vector (0957286 CaMV35s-p_turboGFP_nos-t; Figure 13) encoding a cassette I0 for expressing a fluorescent marker (turboGFP) in dicot plant cells was also used to confirm protein expression. The cassette consists of the CaMV35S promoter, coding sequence for the turboGFP protein which was codon-optimised for expression in dicots and the nopaline synthase (nos) terminator.
Generation of vectors for transfection in monocot protoplasts 15 An expression vector was generated for transient expression of Angiogenin in monocot protoplast cells. The nucleotide sequence of the expression cassette contains the ANG gene with an ER signal retention peptide regulated by the TaRbcS light regulated promoter and nopaline synthase (nos) terminator from Agrobacterium tumefaciens for accumulation in monocot plant tissue (1031308_TaRbcS-p_ANG_nos-t; Figures 14 and 20 15). A control vector (0957284 ZmUbi-p_dsRED_nos-t; Figure 16) encoding a cassette for expressing a fluorescent marker (dsRED) in monocot plant cells was also used to confirm protein expression. The cassette consists of the Ubiquitin promoter from Zea mays, coding sequence for the dsRED protein which is codon-optimised for expression 25 in wheat, and the nopaline synthase (nos) terminator. -40- 2015202777 22 May 2015
Example 6
Generation of vectors for stable transformation and production of transgenic plants
Expression of the recombinant protein in edible tissue for feed stock or human 5 consumption offers a convenient and inexpensive source of delivery. However, an added value may also be obtained by the extraction of a recombinant protein as a byproduct from the primary source. Accordingly, the combination of elements chosen to regulate the expression, and direct the angiogenin protein, is central to both these methods. 10 Production of expression vectors for biolistic and Agrobacterium-mediated transformation
Base transformation vectors are required to contain all the necessary elements for bilolistic and Agrobacterium mediated transformation of plants. To this end, various selectable marker cassettes, containing a selectable marker gene controlled by 15 promoter and terminator regulatory sequences, are required for selection within different transformation process, and for distinct plant types.
Expression vectors are generated for biolistic and Agrobacterium mediated transformation by the introduction of expression cassettes, containing the ANG gene with a modified signal sequence driven by targeted expression promoters, into different 20 base vectors. Expression cassette promoters and signal sequences will be optimised to a particular strategy such that the strength and targeted delivery of the protein will be suited to the final processing of the transgenic plant.
Expression cassette containing an ER signal peptide and light regulated promoter for accumulation in dicot plant tissue 25 To achieve high levels of protein accumulation in photosynthetic dicot plant tissue a light-regulated promoter (AtRbcS) was combined with the Figure 3 modified ANG gene -41 - 2015202777 22 May 2015 containing the KDEL ER retention signal, and the cauliflower mosaic virus CamV35S terminator sequence (Figure 17).
An expression vector was generated for stable expression of Angiogenin in dicot cells. The nucleotide sequence of the expression cassette contains the ANG gene with an ER 5 signal retention peptide regulated by the AtRbcS light regulated promoter and nopaline synthase (nos) terminator from Agrobacterium tumefaciens for accumulation in dicot plant tissue (pPFG000023 AtRbcS-p_ANG_nos-t; Figures 11 and 18).
Expression cassette containing an ER signal peptide and light regulated promoter for accumulation in monocot plant tissue I0 To achieve high levels of protein accumulation in photosynthetic monocot plant tissue light-regulated promoters (TaRbcS and LpRbcS) were combined with the Figure 6 modified ANG gene containing the KDEL ER retention signal, and the cauliflower mosaic virus CamV35S terminator sequence (Figures 20 and 21 respectively).
Expression cassette containing a ER signal peptide and Brassica napus napin 15 gene promoter for accumulation in dicot plant seed
Recombinant seed offers the possibility of direct use as edible plant tissue or is a promising target for extraction. To achieve high levels of protein accumulation in dicot plant seed, a seed specific promoter (Brassica napus napin gene) was combined with, the Figure 7 modified ANG gene containing a KDEL ER retention signal, and the 20 cauliflower mosaic virus CaMV35S or nos terminator sequences (Figure 22, 23 and 24).
Expression cassette containing a ER signal peptide and Zea mays Zein gene promoter for accumulation in monocot plant seed
Recombinant seed offers the possibility of direct use as edible plant tissue or is a promising target for extraction. To achieve high levels of protein accumulation in plant 25 monocot seed, a seed specific promoter (Zea mays zein gene) was combined with, the Figure 6 modified ANG gene containing a KDEL ER retention signal, and the cauliflower mosaic virus CaMV35S or nos terminator sequences (Figure 25, 26 and 27). -42- 2015202777 22 May 2015
Expression cassette containing an apoplast signal peptide and constitutive promoter for secretion in guttation fluid
Targeted secretion has the potential of increasing the efficiency of recombinant protein production technology by increasing yield, abolishing extraction and simplifying its 5 downstream process. For example, by using endoplasmic reticulum signal peptides fused to recombinant protein sequences plants may secrete the protein through the leaf intracellular space into guttation fluid. Guttation is liquid formation at the edges of plant leaves produced at night due to excess water potential. Guttation fluid can be collected throughout a plant’s life, thus providing a continuous and non-destructive system for 10 recombinant protein production.
To achieve high levels of protein secretion through guttation in both monocots and dicots, the cauliflower mosaic virus (CaMV35S) constitutive promoter and terminator sequences were combined with, the Figure 7 modified ANG gene containing a tobacco calreticulin apoplast signal peptide (Figure 32). 15 Expression cassette containing an apoplast signal peptide and root-specific promoter for rhizosecretion in dicots
Targeted and directed expression can be also used to generate rhizosecretion, a method for the production and secretion of recombinant proteins from roots (Gleba, et al., 1998). Expression of ANG using an Arabidopsis root specific promoter (AtPHTI) 20 and targeted by a tobacco calreticulin apoplast signal peptide the recombinant protein could be extracted from rhizosecretion of hydroponically grown transgenic monocot plants (Figure 33).
Expression cassette containing an apoplast signal peptide and root-specific promoter for rhizosecretion in dicots 25 Targeted and directed expression can be also used to generate rhizosecretion, a method for the production and secretion of recombinant proteins from roots (Gleba, et al., 1998). Expression of ANG using a Hordeum vulgare root specific promoter 2015202777 22 May 2015 -43- (.HvPHTI) and targeted by a tobacco calreticulin apoplast signal peptide the recombinant protein could be extracted from rhizosecretion of hydroponically grown transgenic plants (Figure 34).
Expression cassette containing an oleosin promoter and ANG_oleosin fusion 5 gene for extraction from oil bodies
To achieve high levels of protein in oil bodies, the Arabidopsis oleosin promoter and CaMV35S terminator were combined with, the oleosin_ANG fusion gene (Figure 9) to produce an expression cassette (Figure 35).
Expression cassette for transformation of the plant chloroplast genome 10 Many biopharmaceutical transgenes have been stably integrated and expressed using the tobacco chloroplast genome to confer desired agronomic traits or express high levels of protein (Daniell et al., 2005). The Figure 7 modified ANG gene has been paired with the tobacco 16sRNA operon (Prrn) promoter and terminator sequences (Zoubenko,et al., 1994) to express the angiogenin gene in chloroplasts (Figure 36). 15 Example 7
Production of transgenic plants expressing chimeric angiogenin genes
The genetic constructs may be introduced into the plant by any suitable technique. Techniques for incorporating the genetic constructs of the present invention into plant cells (for example by transduction, transfection or transformation). Such techniques 20 include Agrobacterium-med\ated introduction, electroporation of tissues, cells and protoplasts, protoplast fusion, injection into reproductive organs, injection into immature embryos and high velocity projectile introduction to cells, tissues, calli, immature and mature embryos, biolistic transformation and combinations thereof. The choice of technique will depend largely on the type of plant to be transformed and the appropriate 25 vector for the method chosen will be used. -44- 2015202777 22 May 2015
Cells incorporating the genetic constructs of the present invention may be selected, as directed by the vectors used, and then cultured in an appropriate medium to regenerate transformed plants, using techniques well established. The resulting plants may be reproduced, either sexually or asexually, to produce successive generations of 5 transformed plants.
The present invention may be applied to a variety of plants, including monocotyledons [such as grasses (e.g. forage grasses including perennial ryegrass, tall fescue, Italian ryegrass, brachiaria, paspalum), sorghum, sugarcane, corn, oat, wheat, rice and barley)], dicotyledons [such as forage legumes (e.g. white clover, red clover, 10 subterranean clover, alfalfa), soybean, lupin, peas, lentils, chickpeas, canola, vegetable brassicas, lettuce, spinach, fruiting plants (e.g. bananas, citrus, strawberries, apples), oil palm, linseed, cottonseed, safflower, tobacco] and gymnosperms.
Example 8
Transfection of dicot and monocot protoplasts 15 Dicot protoplast transfection of Angiogenin
Protoplasts were released from mesophyll tissue of the dicot, Nicotiana tabacum using the method described in Spangenberg and Potrykus, 1996. The viability of tobacco protoplasts was assessed using Evans Blue stain as described in Huang et al., 1986 (Figure 37). 20 DNA from two plasmids encoding either an expression cassette designed to express the ANG protein under control of the AtRbcS promoter (1031312_TaRbcS-p_ANG_nos-t; Figures 11 and 12), or a control expression cassette designed to express the fluorescent reporter (turboGFP) under control of the constitutive CaMV35S promoter (0957286 CaMV35s-p_turboGFP_nos-t; Figure 13), were purified. 25 Both plasmid vectors were linearised by restriction endonuclease digestion and delivered to aliquots of protoplasts cells. After 24 hours, successful delivery and gene 2015202777 22 May 2015 -45- expression were confirmed by visualisation of the fluorescent marker in the control samples (Figure 38).
Transient gene expression and detection of Angiogenin in dicot protoplasts
To detect expression of Angiogenin, DNA-free RNA was purified from protoplast 5 samples. Complimentary DNA (cDNA) was synthesised and reverse transcriptase-PCR (RT-PCR) analysis of each sample was conducted using primers, as outlined in Table 3, to Angiogenin (ANG F and R) and the endogenous house-keeping gene, Actin (Actin F and R).
Table 3. Primers for detection of ANG transgene and endogenous Actin expression.
Primer Name Primer Sequence SEQ ID NO: ANG_Forward (F) 5’ G AAC G AC AT C AAGG CTATCTG 3’ 45 ANG_Reverse (R) 5' AG CAC C GTATCTACAAG GAG 3' 46 Actin_Forward (F) 5' CCCTCCCACATGCTATTCT 3' 47 Actin_Reverse (R) 5' AG AG C CTC C AAT C C AG AC A 3' 48 oligo-dT_Reverse (R) 5' TTCTAGAATTCAGCGGCCGCT30RN 3' 49 poly-T _Reverse (R) 5' TTCTAGAATTCAGCGGCCGCT 3' 50 10
Each PCR sample was loaded onto an agarose gel, subjected to electrophoresis and the DNA was visualised (Figure 39). 2015202777 22 May 2015 -46-
The integrity of the cDNA of both turboGFP and ANG transfected protoplast samples was confirmed by the presence of a band of expected size (524bp) from samples amplified with the Actin primers. (Figure 39, lanes 9 and 11, respectively). Confirmation that product amplification does not occur from the transfected DNA template can be 5 observed by the absence of a band from both turboGFP and ANG transfected protoplast samples amplified with the same primers to which no reverse-transcriptase was added (Figure 39, lanes 8 and 10).
Expression of Angiogenin was confirmed by the presence of a band of expected size (138bp) in samples amplified with primers to ANG from cells transfected with 1031308 I0 AtRbcS-p_ANG_nos-t (Figure 29, lane 4) and the absence of a band in samples with the same primers to which no reverse-transcriptase was added (Figure 39, lane 3). A positive control performed with ANG primers and 1031308 AtRbcS-p_ANG_nos-t plasmid DNA is observed in Figure 39, lane 6 and indicates the size of the expected fragment. 15 Monocot protoplast transfection of Angiogenin
Protoplasts were released from mesophyll tissue of the monocot, Triticum aestivum using the method described in Spangenberg and Potrykus, 1996. The viability of tobacco protoplasts was assessed using Evans Blue stain as described in Huang et al, 1986 (Figure 40). 20 DNA from two plasmids encoding either an expression cassette designed to express the ANG protein under control of the TaRbcS promoter (1031308_AtRbcS-p_ANG_nos-t; Figures 14 and 15) or a control expression cassette designed to express the fluorescent reporter (dsRED) under control of the constitutive ubiquitin promoter from Zea mays (0957284 ZmUbi-p_dsRED_nos-t; Figure 16), were purified. Plasmid DNA 25 was delivered to aliquots of protoplasts cells. After 24 hours, successful delivery and gene expression were confirmed by visualisation of the fluorescent marker in the control samples (Figure 41). -47- 2015202777 22 May 2015
Transient gene expression and detection of Angiogenin in monocot protoplasts
To detect expression of Angiogenin, DNA-free RNA was purified from protoplasts and cDNA was synthesised with a oligo-dT reverse primer (Table 3). RT-PCR analysis of each sample was conducted using forward primers designed to Angiogenin or Actin and 5 a poly-T reverse primer (Table 3) designed to anneal to the adapter sequence of the oligo-dT primer from which cDNA was synthesised, ensuring that there was no amplification from plasmid template.
Each PCR sample was loaded onto an agarose gel, subjected to electrophoresis and the DNA was visualised (Figure 42). 10 The integrity of the cDNA of all wheat protoplast samples was confirmed by the presence of a band of expected size (920bp) from samples amplified with the Actin_F and poly-T_R primer. (Figure 42, lanes 8 and 10) and absence of a band from samples amplified with the same primers to which no reverse-transcriptase was added (Figure 42, lanes 7 and 9). 15 Expression of Angiogenin (Rnase5) was confirmed by the presence of a band of expected size (740bp) in samples amplified with primers to ANG_F and poly-T_R primer from cells transfected with 1031312 TaRbcS-p_ANG_nos-t (Figure 42, lane 4) and the absence of a band in samples with the same primers to which no reverse-transcriptase was added (Figure 42, lane 3) and from samples that were not transfected with 20 1031312 TaRbcS-p_ANG_nos-t (Figure 42, lanes 1 and 2).
Example 9
Agrobact&rium-mediated transformation of canola (Brassica napus) for expression of chimeric angiogenin genes
Binary vectors containing chimeric ANG genes under control of different promoters are 25 used for Agrobacterium-mediated transformation of Brassica napus hypocotyl segments as outlined below and demonstrated in Figure 43. -48- 2015202777 22 May 2015
Brassica napus seeds are surface sterilised in 70% ethanol for 2 minutes, washed 3 times in sterile water then further surface sterilised in a solution containing 1% (w/v) Calcium hypochlorite and 0.1 % (v/v) Tween 20 for 30 minutes. The seeds are washed at least 3 times in sterile water and planted in 120 ml culture vessels containing a 5 solidified germination medium containing 1x Murashige and Skoog (Murashige and Skoog Physiol. Plant, 15\ 473-497, 1962) macronutrients, 1x micronutrients and B5 organic vitamins, supplemented with 500 mg/L MES, 2% (w/v) sucrose at a pH of 5.8 with the addition of 4 g/L Gelrite. The vessels are incubated at 25 °C under 16h light/8h dark conditions for 7 days to encourage germination. I0 After 7 days, seedlings of Brassica napus (whole seedlings) are transferred to a liquid medium consisting of 1x Murashige and Skoog macronutrients, 1x micronutrients and B5 organic vitamins, supplemented with 500 mg/L MES, 3% (w/v) sucrose at a pH of 5.8. Seedlings are grouped together and the roots and cotyledons removed prior to cutting the hypocotyls into 7-10mm sections and plating on 9 X 1.5 cm petri dishes 15 containing a preconditioning medium consisting of 1x Murashige and Skoog macronutrients, 1x micronutrients and B5 organic vitamins, supplemented with 500 mg/L MES, 3% (w/v) sucrose at a pH of 5.8 solidified with 6.4 g/l Bacto-Agar.
Hypocotyl sections are cultured for 24 hours prior to inoculation with an Agrobacterium suspension OD6oo = 0.2 for 30 minutes consisting of 1x Murashige and Skoog 20 macronutrients, 1x micronutrients and B5 organic vitamins, supplemented with 500 mg/L MES, 100 μΜ Acetosyringone, 3% (w/v) sucrose at a pH of 5.8.
Following inoculation, hypocotyl sections are blotted on sterile paper towels and transferred to 9 x 1.5 cm petri dishes containing 1x Murashige and Skoog macronutrients, 1x micronutrients and B5 organic vitamins, supplemented with 500 25 mg/L MES, 100 μΜ Acetosyringone, 1 mg/L 2,4-D, 3% (w/v) sucrose at a pH of 5.8 solidified with 8 g/l Bacto-Agar. Explants are incubated at 25°C under 16h light/8h dark conditions for 72 hours for co-cultivation.
Following co-cultivation, 20-30 hypocotyl explants are transferred to 9 X 1.5 cm petri dishes containing a solidified selection medium consisting of 1x Murashige and Skoog 2015202777 22 May 2015 -49- macronutrients, 1x micronutrients and B5 organic vitamins, supplemented with 500 mg/L MES, 1 mg/L 2,4-D, 3% (w/v) sucrose at a pH of 5.8 solidified with 8 g/l Bacto-Agar, supplemented with 250 mg/l timentin and 10 mg/l hygromycin to select for hygromycin-resistant shoots. Plates are incubated at 25°C under 16h light/8h dark 5 conditions.
After 7 days hypocotyl explants are transferred to 9 X 2.0cm petri dishes containing a solidified regeneration media consisting of 1x Murashige and Skoog macronutrients, 1x micronutrients and B5 organic vitamins, supplemented with 500 mg/L MES, 1 mg/L 2,4-D, 3% (w/v) sucrose at a pH of 5.8 solidified with 8 g/l Bacto-Agar, supplemented with 4 I0 mg/l BAP, 2 mg/l Zeatin, 5 mg/l Silver Nitrate, 250 mg/l timentin and 10 mg/l hygromycin. Plates are incubated under direct light at 25°C under fluorescent light conditions (16 hr light/8 hr dark photoperiod; 55 pmol m'2 sec'1) for 4 weeks to encourage shoot development.
Regeneration is monitored weekly and hypocotyl explants transferred to fresh 9 X 15 2.0cm petri dishes containing solidified regeneration media, RM supplemented with 4 mg/l benzyladenine, 2 mg/l zeatin, 5 mg/l silver nitrate, 250 mg/l timentin and 10 mg/l hygromycin for 6-8 weeks to encourage shoot development.
Hygromycin-resistant (Hygr) shoots are transferred to 120 ml vessels containing solidified root induction medium, RIM1, consisting of 1x Murashige and Skoog 20 macronutrients, 1x micronutrients and B5 organic vitamins, supplemented with 500 mg/L MES, 1 mg/L 2,4-D, 1% (w/v) sucrose at a pH of 5.8 solidified with 8 g/l Bacto-Agar supplemented with 250 mg/l timentin. Shoots are incubated under direct fluorescent light at 25°C (16 hr light/8 hr dark photoperiod; 55 pmol m'2 sec'1) to encourage shoot elongation and root development over 4-5 weeks. All Hygr shoots with 25 developed shoot and root systems are transferred to soil and grown under glasshouse conditions. -50- 2015202777 22 May 2015
Example 10
Biolistic transformation of wheat (Triticum aestivum L.) for expression of chimeric angiogenin genes
Transformation vectors containing chimeric ANG genes are used for biolistic 5 transformation of wheat (Triticum aestivum L. MPB Bobwhite 26) as outlined below.
Step 1 (Donor Plant Production):
Triticum aestivum (Bobwhite 26) seed is used for the production of donor plant material. Wheat plants are grown in a nursery mix consisting of composted pine bark, perlite and vermiculite, with five plants per pot to a maximum pot size of 20 cm. Plants are kept I0 under glasshouse conditions at approximately 22-24° C for 12-16 weeks (Figure 45A). Once the first spike emerges from the flag leaf, plants are tagged and embryos collected from the tallest heads 12-15 days post anthesis.
Step 2 (Day 1):
Spikes at the desired stage of development are harvested (Figure 45B). Caryopsis are 15 removed from the spikes and surface sterilised for 20 minutes in a 0.8% (v/v) NaOCI solution and rinsed at least four times in sterile distilled water.
Embryos up to 10 mm in length are aseptically excised from each caryopsis (removing the axis) using a dissecting microscope and cultured axial side down on an osmotic medium (E3maltose) consisting of 2x Murashige and Skoog (1962) macronutrients, 1x 20 micronutrients and organic vitamins, 40 mg/L thiamine, 150 mg/L L-asparagine, supplemented with 15% (w/v) maltose, 0.8% (w/v) Sigma-agar and 2.5 mg/L 2,4-D (Figures 45C and D). Embryos are cultured on 60 mm x 15 mm clear polypropylene petrie dishes with 15 mL of media. Culture plates are incubated at 24 °C in the dark for 4 hours prior to bombardment. Embryos are bombarded using a BioRad PDS1000 gene 25 gun at 900 psi and at 6 cm with 1 pg of vector plasmid DNA precipitated onto 0.6 pm gold particles. Following bombardment, embryos are incubated overnight in the dark on the osmotic media. 2015202777 22 May 2015 -51 -
Step 3 (Day 2):
Embryos are transferred to a callus induction medium (E3calli) consisting of 2x Murashige and Skoog (1962) macronutrients and 1x micronutrients and organic vitamins, 40 mg/L thiamine, 150 mg/L L-asparagine, supplemented with 6% (w/v) 5 sucrose, 0.8% (w/v) Sigma-agar and 2.5 mg/L 2,4-D. Embryos are cultured for two weeks at 24 °C in the dark.
Step 4 (Day16):
After 2 weeks of culture on E3calli, embryos have produced embryogenic callus and are subcultured onto a selection medium (E3Select) consisting of 2x Murashige and Skoog I0 (1962) macronutrients and 1x micronutrients and organic vitamins, 40 mg/L thiamine, 150 mg/L L-asparagine, supplemented with 2% (w/v) sucrose, 0.8% (w/v) Sigma-agar, 5 mg/L of D,L phosphinothricin (PPT) and no plant growth regulators (Figures 45E-G). Cultures are incubated for further 14 days on E3Select at 24 °C in the light and a 12-hour photoperiod. 15 Step 5 (Day 30):
After 14 days culture on E3Select, embryogenic callus is sub-cultured onto fresh E3Select for a further 14 days (Figures 45E-G).
Step 6 (Day 44):
After about 4 weeks on E3Select, developing plantlets are excised from the embryonic 20 callus mass and grown for a further three weeks in 65 mm X 80 mm or 65 mm x 150 mm polycarbonate tissue culture vessels containing root induction medium (RM). Root induction medium consists of 1x Murashige and Skoog (1962) macronutrients, micronutrients and organic vitamins, 40 mg/L thiamine, 150 mg/L L-asparagine, supplemented with 2% (w/v) sucrose, 0.8% (w/v) Sigma-agar, and 5 mg/L of PPT 25 (Figure 45H). Remaining embryogenic callus is sub-cultured onto E3Select for another 14 days. 2015202777 22 May 2015 -52-
Step 7 (Day 65+):
Regenerated plantlets surviving greater than 3 weeks on RM with healthy root formation are potted into a nursery mix consisting of peat and sand (1:1) and kept at 22-24 °C with elevated humidity under a nursery humidity chamber system. After two weeks, plants 5 are removed from the humidity chamber and hand watered and liquid fed Aquasol™ weekly until maturity. The T0 plants are sampled for genomic DNA and molecular analysis. Ti seed is collected and planted for high-throughput Q-PCR analysis.
Example 11
Agrobacterium-med\ated transformation of wheat (Triticum aestivum L.) for I0 expression of chimeric angiogenin genes
Agrobacterium-med\ated transformation of bread wheat is represented in Figure 45. Wheat donor plants ready are harvested for use as source of embryo explants for Agrobacterium mediated transformation. Post infection from Agrobacterium, callus material is regenerated on tissue culture medium under appropriate selection until 15 regenerating shoots are observed. Following several rounds of selection the rooted plant is potted in soil.
Example 12
Agrobacterium-med'iated transformation of tobacco (Nicotiana benthamiana) for expression of chimeric angiogenin genes 20 In tobacco Agrobacterium-transformation adventitious shoots can be regenerated at high frequencies from leaf explants. Agrobacterium-mediated tobacco transformation is a four stage process. 1. Inoculation of regenerative explants with a cell suspension of Agrobacterium. 2. Co-cultivation of inoculated explants on regeneration medium for 2-3 days during 25 gene transfer occurs. 2015202777 22 May 2015 -53- 3. Regeneration and selection of transformed shoots and the elimination of bacteria. 4. Biochemical and molecular analysis of putative transgenic plants.
Example 13
Agrobacterium-mediated transformation of alfalfa (Medicago sativa) for 5 expression of chimeric angiogenin genes
Binary vectors containing chimeric ANG genes under control of different promoters are used for Agrobacterium-med\ated transformation of Medicago sativa petiole explants from highly-regenerable alfalfa {M. sativa) clones.
Following co-cultivation with Agrobacterium tumefaciens strain LBA 4404 harbouring the I0 binary vector, the alfalfa explants were washed with medium containing cefotaxime and used for induction of embryogenic callus under selective medium containing 25 mg/l kanamycin. Transgenic embryogenic alfalfa calli were recovered and allowed to regenerate transgenic alfalfa shoots, which were transferred on rooting medium leading to the recovery of transgenic alfalfa plants expressing chimeric ANG genes. 15 Example 14
Biolistic transformation of perennial ryegrass (Lolium perenne) for expression of chimeric angiogenin genes
Biolistic co-transformation of perennial ryegrass with the vectors containing the TaRbcS and LpRbcS regulatory sequences, driving the expression of the ANG gene (Figures 20 19, 20 and 21) and the pAcH1 vector for hygromycin resistance is conducted on embryogenic calli for perennial ryegrass. The pAcH1 vector was previously constructed and has been used successfully in plant transformation experiments (Bilang, et al., 1991; Spangenberg, et al., 1995a; Spangenberg, et al., 1995b; Ye, et al., 1997; Bai, et al., 2001). The perennial ryegrass biolistic transformation method is outlined in Figure 25 44. 2015202777 22 May 2015 -54-
Example 15
Agrobacterium-mediated transformation of white clover (Trifolium repens) for expression of chimeric angiogenin genes
Vectors containing chimeric ANG genes under control of different promoters are used 5 for Agrobacterium-mediated transformation of Trifolium repens cotelydons as outlined below.
All material in tissue culture are grown at 24 °C with a 16 h light/8 h dark regime. White clover seeds are washed in 70% v/v ethanol, surface-sterilised in 1.5% sodium hypochlorite (12.5 g/L active chlorine), rinsed in sterile distilled water and imbibed I0 overnight at 4 °C in the dark. Cotyledonary explants are excised with a 1-2 mm segment of hypocotyl attached. Explants are incubated in Agrobacterium culture (OD6oo = approx 0.35) for 40 min and co-cultivated on regeneration medium, consisting of: 1 x Murashige and Skoog Basal Medium (Sigma), 30g/L sucrose, 5 M thidiazuron (Sigma), 0.5 M naphthalene-acetic acid, 250 mg/L cefotaxime (Claforan, Hoechst) and 8 g/L Bacto-I5 Agar (Becton-Dickinson), pH 5.75, supplemented with 40 mg/L acetosyringone. Explants are co-cultivated for 3 days at 24 °C, and transferred to regeneration medium containing an appropriate selective agent and are subcultured every 2-3 weeks. Regenerated shoots are transferred to root-inducing medium, consisting of: 1 x MS basal medium, 15 g/L sucrose, 1.2 M indole-butyric acid, 250 mg/L cefotaxime, an 20 appropriate selective agent and 8g/L Bacto-Agar, pH 5.75. Antibiotic-resistant plantlets are transferred to soil and established under glasshouse conditions. The white clover Agrobacterium-medi\atedi transformation method is demonstrated in Figure 46.
Example 16
Production of transgenic white clover plants expressing chimeric angiogenin 25 genes
Use of constructs containing a light regulated promoter and endoplasmic reticulum retention signal -55- 2015202777 22 May 2015
The AtRbcS_ANG_35S expression cassette was incorporated into a vector backbone containing a selectable marker cassette of the neomycin phosphotransferase (npt II) gene driven by the nopaline synthase (nos) promoter and terminator sequences (Figure 47). This vector was inserted into the white clover genome by Agrobacterium mediated 5 transformation.
Example 17
Characterisation of transgenic white clover plants expressing chimeric angiogenin genes
Detection of angiogenin expression in transgenic white clover I0 Total RNA was extracted from leaves and stems of white clover transformed with AtRbcS_ANG_35S and an untransformed control. Reverse transcriptase polymerase chain reaction (RT-PCR) analysis was performed using primers specific to the angiogenin gene to detect angiogenin expression in the transgenic plants (Figure 48).
Detection of the angiogenin protein in transgenic white clover 15 Total protein extract was obtained from non-transgenic (control) and transgenic white clover plant tissue and separated using 2DE gel apparatus. Two dimensional protein profiles were compared between the non-transgenic and transgenic plants. The transgenic tissue was observed to contain a rich protein spot not observed in the control material (Figure 49). The MOWSE scoring algorithm was used to determine the identity 20 of this rich protein spot in the transgenic white leaf clover. This was achieved as follows.
The protein spot of interest was excised from the 2DE gel and digested with overnight porcine trypsin. The digested protein sample was then C18 zip-tipped and spotted onto an MALDI-TOF/TOF mass spectrometry target. The spotted protein sample was then 25 sequenced using MALDI-TOF/TOF mass spectrometry (Figure 50). The observed peptide masses obtained from the peptide mass fingerprint data and the observed peptide ion fragmentation masses obtained from the peptide ion fragmentation pattern 2015202777 22 May 2015 -56- were then combined together and searched against the NCBInr sequence database of known calculated peptide masses and known calculated ion fragmentation masses. The mass spectra obtained by MALDI-TOF/TOF mass spectrometry matched bovine angiogenin in the NCBInr sequence database. The protein score and ion scores 5 received were positive for bovine angiogenin using the MOWSE scoring algorithm.
Protein quantification of bovine angiogenin in soluble transgenic white leaf clover extract
Approximately, 50ug of the soluble transgenic white leaf clover extract was loaded on to the 2DE gel. Bovine angiogenin represents 10% of the soluble transgenic white leaf I0 clover extract and is therefore 5mg of the soluble transgenic white leaf clover extract. This was determined by densitometry using Progenesis PG240 software (Non Linear Dynamics, Newcastle upon Tyne, UK).
The soluble transgenic white leaf clover extract was prepared by homogenising 200mg of ground plant tissue in 1.5ml of homogenistion buffer. The level of expression in 15 transgenic white leaf clover equates to 7.5mg of bovine angiogenin per milligram of plant extract. This level is equivalent to angiogenin expression in bovine cows milk which is between 4 - 8mg/ml.
Example 18
Production of transgenic plants co-expressing angiogenin and other proteins for 20 enhanced angiogenin productivity
It would be possible to pyramid existing technologies to generate a significant impact on the efficacy of a variety of applications by increasing the range of productivity in plants.
The productivity of angiogenin expressed in plants may be enhanced through coexpression with antimicrobials, protease inhibitors, RNase inhibitors, follistatin or 25 delayed plant organ senescence nucleic acids and constructs. 2015202777 22 May 2015 -57-
Technologies for the extend life of plants (patent PCT/AU01/01092), increased biomass and high fructans (patent PCT/AU2009/001211), have been established. Pyramiding the current application technology with technologies that address these other factors should greatly increase plant health and production which should, in turn, increase 5 animal health and production, as well as enhance the generation of value added products in plant biomass.
Example 19
Agrobacterium-mediated transformation of Arabidopsis (Arabidopsis thaliana) for expression of chimeric angiogenin genes I0 Vectors containing chimeric ANG genes under control of different promoters are used for Agrobacterium-mediated transformation of Arabidopsis thaliana as outlined below. 1. Inoculation with a cell suspension of Agrobacterium to Arabidopsis using infiltration to facilitate access of Agrobaterium to immature flowers where T-DNA transfer may then take place. 15 2. Plant growth and monitoring and collection of potentially transgenic seed. 3. Regeneration and selection of transformed seeds on germination media with appropriate selection antibiotic. 4. Biochemical and molecular analysis of putative transgenic plants.
Example 20 20 Production of transgenic Arabidopsis plants containing chimeric angiogenin genes
Use of constructs containing a light regulated promoter and endoplasmic reticulum retention signal 2015202777 22 May 2015 -58-
The AtRbcS_ANG_nos expression cassette (Figure 11) was incorporated into a vector backbone containing a selectable marker cassette of the hygromcin phsophotransferase (hptll) gene driven by the CSVMV promoter and CaMV35S terminator sequences (Figure 18). This vector was inserted into the Arabidopsis genome by Agrobacterium 5 mediated transformation.
Example 21
Characterisation of transgenic white clover plants containing chimeric angiogenin genes
Detection of the angiogenin gene in transgenic Arabidopsis I0 DNA was extracted from Arabidopsis leaves of two different transgenic lines with AtRbcS_ANG_nos and a wild-type untransformed control. Polymerase chain reaction (PCR) analysis was performed using primers specific to the angiogenin gene (Table 3) to detect the presence of the angiogenin gene in the transgenic plant lines (Figure 51). -59- 2015202777 22 May 2015
References
Abenes, M., Holbrook, L., and Moloney, M. (1997) Transient expression and oil body targeting of an Arabidopsis oleosin-GUSreporter fusion protein in a range of oilseed embryos. Plant Cell Reports, 17: 1-7. 5 Acharya, K.R., Shapiro, R.,SC, Allen, S.C., Riordan, J.F., Vallee, B.L. Crystal structure of human angiogenin reveals the structural basis for its functional divergence from ribonuclease.
Baghdady, A,. Blervacq, A., Jouanin, L., Grima-Pettenati, J., Sivadon, P., Hawkins, S. (2006) Eucalyptus gunnii CCR and CAD2 promoters are active in lignifying cells during 10 primary and secondary xylem formation in Arabidopsis thaliana. Plant Physiol.
Biochem., 44:674-683.
Bai, Y., et al. (2001) Genetic transformation of elite turf-type cultivars of Tall Fescue. International Turfgrass Society Research Journal, 9: 129-136.
Bilang, R., et al. (1991) The 3'-terminal region of the hygromycin-B-resistance gene is 15 important for its activity in Escherichia coli and Nicotiana tabacum. Gene, 100: 247-250.
Bond, M.D., and Vallee, B.L. (1988). Isolation of bovine angiogenin using a placental ribonuclease inhibitor binding assay. Biochemistry 27: 6282-6287.
Borisjuk, N., Sitailo, L., Adler, K., Malysheva, L., Tewes, A., Borisjuk, L., Manteuffel, R. (1998) Calreticulin expression in plant cells: developmental regulation, tissue specificity 20 and intracellular distribution. Planta, 206: 504-14.
Chen, Z. et al. (1988) A DNA sequence element that confers seed-specific enhancement to a constitutive promoter. EMBO J., 7 :297-302.
Christensen, A.H., et al. (1992). Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following 25 transfer to protoplasts by electroporation. Plant Mol Biol., 18: 675-689. -60- 2015202777 22 May 2015
Daniell, H., Kumar, S. and Dufourmantel, N. (2005) Breakthrough in chloroplast genetic engineering of agronomically important crops .TRENDS in Biotechnology, 23: 238-245.
Denecke, j., Botterman, J. and Deblaere, R. (1990) Protein secretion in plant cells can occur via a defult pathway. Plant Cell, 2: 51-59. 5 Doczi, R., et al. (2005) Conservation of the drought-inducible DS2 genes and divergences from their ARS paralogues in solanaceous species. Plant Phys .Biochem., 43: 269-276.
Fedorova, T.V., Komolova, G.S., Rabinovich, M.L., Tikhomirova, N.A., and Shalygina, A.M. (2002) Milk ultrafiltrate as a promising source of angiogenin. Prikl. Biokhim. I0 Mikrobiol., 38: 221-224.
Gao, X., Hu, H., Zhu, J. and Xu, Z. (2007) Identification and characterisation of folistatin as a noverl angiogenin-binding protein. FEBS Lett., 581:5505-5510.
Gao, X., and Xu, Z. (2008) Mechanisms of action of angiogenin. Acta Biochim Biophys Sin., 40: 619-24. 15 Gleba, D., Borisjuk, N.V., Borisjuk, L.G., Kneer, R., Poulev, A., Skarzhinskaya, M., Dushenkov, S., Logendra, S., Gleba, Y.Y. and Raskin, I. (1999) Use of plant roots for phytoremediation and molecular farming. Proc. Natl. Acad. Sci. USA, 96: 5973-5977.
Hara-Nishimura, I., Matsushima, R., Shimada T., Nishimura, M. (2004) Diversity and formation of endoplasmic reticulum-derived compartments in plants. Are these 20 compartments specific to plant cells. Plant Physiol., 136: 3435-3439.
Harper, J.W., Vallee, B.L. (1988) Conformational characterization of human angiogenin by limited proteolysis. J Protein Chem., 7: 355-363.
Hashizume, F., Hino, S., Kakehashi, M., Okajima, T., Nadano, Aoki D.N. and Matsuda, T. (2008) Development and evaluation of transgenic rice seeds accumulating a type II-25 collagen tolerogenic peptide. Transgenic Res., 17: 1117-1129 2015202777 22 May 2015 -61 -
Hauffe K.D., Lee S.P., Subramaniam R., Douglas C.J. (1993) Combinatorial interactions between positive and negative cis-acting elements control spatial patterns of 4CL-1 expression in transgenic tobacco. Plant J., 4: 235-253.
Huang, C.N., Cornejo, M.J., Bush, D.S., Jones, R.L. (1986) Estimating Viability of Plant 5 Protoplasts Using Double and Single Staining. Protoplasma, 135:80-87.
Herbers, K., et al. (1994) Cloning and characterization of a cathepsin D inhibitor gene from Solanum tuberosum L. Plant Mol Biol., 26:73-83.
Hu, H.goa, X,. Sun, Y.,, Zhou, J., Yang, M. and Xu, Z. (2005) alpha-actin-2, a cytoskeletal protein binds to angiogenin. Biochem. Biophys. Res. Commun. 329: 661-I0 667.
Jin, L. and Lui, J. (2008) Molecular cloning, expression profile and promoter analysis of the novel ethylene responsive transcription factor gene GhERF4 from cotton. Plant Phys Biochem., 46: 46-53.
Kay, R., et al. (1987). Duplication of CaMV35S promoter sequences creates a strong 15 enhancer for plant genes. Science, 236: 1299-1302.
Keller, B. and Baumgartner C. (1991) Vascular-Specific Expression of the Bean GRP 1.8 Gene Is Negatively Regulated. Plant Cell, 3: 1051-1061.
Kishimoto K, et al., (2005) Endogenous angiogenin in endothelial cells is a general requirement for cell proliferation and angiogenesis. Oncogene, 24:445-456. 20 Kragler F, Lametschwandtner G, Christmann J, Hartig A, Harada JJ. (1998) Identification and analysis of the plant peroxisomal targeting signal 1 receptor NtPEX5. Proc. Natl. Acad. Sci. USA, 95: 13336-41. -62- 2015202777 22 May 2015
Kwak, M., et al. (2005) Two sweet potato ADP-glucose phsophorylase isoforms are regulated antagonistically in response to sucrose content in storage roots. Gene, 366: 87-96.
Lamacchia, C., Shewry, P.R., Di Fonzo, N., Forsyth, J.L., Harris, N., Lazzeri, P.A., 5 Napier, J.A., Halford, N.G., Barcelo, P., (2001) Endosperm-specific activity of a storage protein gene promoter in transgenic wheat seed. J Exp Bot. 52:243- 50.
Lee, W.S., Tzen, J.T., Kridl, J.C., Radke, S.E. and Huang, AH. (1991) Maize oleosin is correctly targeted to seed oil bodies in Brassica napus transformed with the maize oleosin gene. Proc. Natl. Acad. Sci. USA, 88: 6181-6185. I0 Li M., Singh, R., Bazanova, N., Milligan, A.S., Shirley, N., Langridge, P., Lopato, S., (2008) Spatial and temporal expression of endosperm transfer cell-specific promoters in transgenic rice and barley. Plant Biotechnol J. 6:465-476.
Li, X., et al. (2001) Sucrose regulation of ADP-glucose pyrophosphorylase subunit genes transcript levels in leaves and fruit. Plant Science, 162: 239-244. 15 Lin, K., et al. (2008) Generation and analysis of the transgenic potatoes expressing heterologous Thermostable B-amylase. Plant science, 174: 649-657.
Liu, D., et al. (2003) High transgene expression levels in sugarcane (Saccharum officinarum L.) driven by the rice ubiquitin promoter RUBQ2. Plant Science, 165: 743-750. 20 Marked, Y., Koditz, J., Mansfeld, J., Arnold, U., Ulbrich-Hofmann, R. (2001) Increased proteolytic resistance of ribonuclease A by protein engineering. Protein Eng., 14: 791-796.
Marraccini, P., Deshayes, A, Petiard, P., Rogers, W.J. (1999) Molecular cloning of the complete 11S seed storage protein gene of Coffea arabica and promoter analysis in 25 transgenic tobacco plants. Plant Physiol. Biochem., 37: 273-282. 2015202777 22 May 2015 -63-
Marty, F. (1999) Plant Vacuoles. Plant Cell, 11: 587-600.
McElroy, D., et al. (1990). Isolation of an efficient actin promoter for use in rice transformation. Plant Cell, 2: 163-171.
Murray, E.E, Lotzer, J. and Eberle, M. (1989) Codon usage in plants. Nuleic Acids 5 Research, 17:477-498.
Ouellet, F., et al. (1998) The wheat wcs120 promoter is cold-inducible in both monocottyledeonous and dicotelydonous species. FEBS Letters, 423: 324-328.
Pedersen,K., Devereux,J., Wilson,D.R., Sheldon,E. and Larkins,B.A. (1982) Cloning and sequence analysis reveal structural variation among related zein genes in maize. I0 Cell, 29: 1015-1026.
Ramirez, Y., Tasciotti, E., Gutierrez-Ortega, A., and Torres, A.J.D. (2007) Fruit-Specific Expression of the Human Immunodeficiency Virus Type 1 Tat Gene in Tomato Plants and Its Immunogenic Potential in Mice. Clin Vaccine Immunol. 14: 685-692.
Romero, H., et al. (2006) Expression profile analysis and biochemical properties of the 15 peptide methionine sulfoxide reductase A (PMSRA) gene family in Arabidopsis. Plant Science, 170: 705-714.
Sasanuma, (2001). Characterization of the rbcS multigene family in wheat: subfamily classification, determination of chromosomal location and evolutionary analysis. Mol Genetics Genomics, 265: 161-171. 20 Schernthaner, J.P., Matzke, M,A,, Matzke, A.J., (1988) Endosperm-specific activity of a zein gene promoter in transgenic tobacco plants. EMBO J. 7:1249-1255.
Schunmann, P.H.D., Richardson, A.E., Smith, F.W. and Delhaize, E. (2004) Characterization of promoter expression patterns derived from the Pht1 phosphate -64- 2015202777 22 May 2015 transporter genes of barley (Hordeum vulgare L.). Journal of Experimental Botany, 55: 855-865.
Selinger, D.A., Lisch, D. and Chandler, V.L. (1998) The Maize Regulatory Gene B-Peru Contains a DNA Rearrangement That Specifies Tissue-Specific Expression Through 5 Both Positive and Negative Promoter Elements. Genetics, 149: 1125-1138.
Siebertz, B., et al. (1989) cis-Analysis of the wound inducible promoter wun-1 in transgenic tobacco plants and histochemical localisation of its expression. The Plant Cell, 1: 960-968.
Spangenberg, G., et al. (1995a). Transgenic tall fescue and red fescue plants from I0 microprojectile bombardment of embryogenic suspension cells. J Plant Physiol., 145: 693-701.
Spangenberg, G. and Potrykus, I. (1996) Polyethylene glycol-mediated direct gene transfer to tobacco protoplasts and regeneration of transgenic plants: Gene transfer to plants (eds. I Potrykus and G. Spangenberg, Springer-Verlag Berlin, Heidelberg New 15 York, pp59-65)
Shapiro, R. and Vallee, B.L. (1987) Human placental ribonuclease inhibitor abolishes both angiogenic and ribonucleolytic activities of angiogenin. Proceedings of the National Academy of Sciences USA, 84: 2238-2241.
Spangenberg, G., et al. (1995b). Transgenic perennial ryegrass (Lolium perenne) plants 20 from microprojectile bombardment of embryogenic suspension cells. Plant Sci., 108: 209-217.
Stark, D. et al. (1992) Regulation of the Amount of Starch in Plant Tissues by ADP Glucose Pyrophosphorylase. Science, 258: 287-292. 25
Szopa, J., et al. (2003) Structural organisation, expression, and promoter analysis of a 16R isoform of 14-3-3 protein gene from potato. Plant Phys Biochem., 41: 417-423. 2015202777 22 May 2015 -65-
Takayoshi Koyama, Toshiro Ono, Masami Shimizu, Tetsuro Jinbo, Rie Mizuno, Keiji Tomita, Norihiro Mitsukawa, Tetsu Kawazu, Tetsuya Kimura, Kunio Ohmiya and Kazuo Sakka (2005) Promoter Of Arabidopsis Thaliana Phosphate Transporter Gene Drives Root-Specific Expression of Transgene in Rice. Journal of Bioscience and 5 Bioengineering, 99: 38-42.
Tran, L. et al. (2004) Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell, 16: 2481-98.
Wan, B., et al. (2007) Expression of rice Ca2+ -dependent protein kinases (CDPKs) 10 genes under different environmental stresses. FEBS Letters, 581: 1179-1189.
Xiangwei, G., et al., (2007) Identification and characterization of follistatin as a novel angiogenin-binding protein. FEBS letters, 581: 5505-5510.
Xu, Z., Monti D.M., and Hu, G. (2001) Angiogenin activates human umbilical artery smooth muscle cells. Biochem Biophysi Res Commun, 285: 909-914. 15 Yamaguchi-Shinozaki K. and Shinozaki K. (1993) Characterisation of the expression of a desiccation-responsive rd29 gene of Arabidopsis thaliana and analysis of its promoter in transgenic plants. Mol. Gen. Genet., 236: 331-340.
Yang, N.S. and Russell, D. (1990) Maize sucrose synthase-l promoter directs phloem cell-specific expression of GUS gene in transgenic tobacco plants. Proc. Natl. Acad. 20 Sci. USA, 87: 4144-4148.
Ye, X., et al. (1997) Transgenic Italian ryegrass (Lolium multiflorum) plants from microprojectile bombardment of embryogenic suspension cells. Plant Cell Rep., 16: 379-384. 2015202777 22 May 2015 -66-
Zeng, W. K., et al. (1995). PCR Amplification and Sequencing of a Wheat rbcS Gene Promoter. Acta Bot Sinica 37: 496-500.
Zhang, X., et al. (2004) The indigenous plasmid pQBR103 encodes plant-inducible genes, including three putative helicases. FEMS Micro. Ecol., 51: 9-17. 5 Zhang, H., et al., (2008) Interaction between angiogenin and fibulin 1: Evidence and implication. Acta Biochimica et Biophysica Sinica, 40: 375-380.
Zoubenko, O.V., Allison, L.A., Svab, Z. and Maliga, P. (1994) Efficient targeting of foreign genes into the tobacco plastid genome. Nucleic Acids Res., 22: 3819-3824.

Claims (20)

  1. THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:
    1. A plant cell, plant callus, plant, seed or other plant part including an angiogenin gene or a functionally active fragment or variant thereof, wherein the angiogenin gene is modified to alter its targeting signal sequence to direct the angiogenin to a target subcellular component or plant tissue.
  2. 2. A plant cell, plant callus, plant, seed or other plant part according to claim 1, wherein said angiogenin gene comprises a sequence selected from the group consisting of: (a) sequence shown in SEQ ID NO: 3; (b) functionally active fragments of the sequence recited in (a) having a size of at least 200 nucleotides; (c) functionally active variants having at least 95% identity to the sequences recited in (a) and (b); and (d) sequences encoding a polypeptide comprising a sequence shown in SEQ ID NO: 2.
  3. 3. A plant cell, plant callus, plant, seed or other plant part according to claim 2, wherein said functionally active fragments and variants have a size of at least 300 nucleotides.
  4. 4. A plant cell, plant callus, plant, seed or other plant part according to any one of claims 1 to 3, wherein said angiogenin gene has codon usage adapted for plants.
  5. 5. A method of producing a transformed plant cell expressing an angiogenin gene, said method comprising: providing a gene encoding angiogenin or a functionally active fragment or variant thereof, and a plant cell; introducing the angiogenin gene into the plant cell to produce a transformed plant cell; and culturing the transformed plant cell to produce a transformed plant cell expressing the angiogenin gene, wherein the angiogenin gene is modified to alter its targeting signal sequence to direct the angiogenin to a target sub-cellular component or plant tissue.
  6. 6. A method according to claim 5, wherein said angiogenin gene comprises a sequence selected from the group consisting of: (a) sequence shown in SEQ ID NO: 3; (b) functionally active fragments of the sequence recited in (a) having a size of at least 200 nucleotides; (c) functionally active variants having at least 95% identity to the sequences recited in (a) and (b); and (d) sequences encoding a polypeptide comprising a sequence shown in SEQ ID NO: 2.
  7. 7. A method according to claim 5 or 6, wherein the method further comprises isolating the angiogenin produced by the plant cell.
  8. 8. A method according to any one of claims 5 to 7, wherein the method further comprises culturing the transformed plant cell to produce transformed plant calli, plants, seeds or other plant parts including angiogenin.
  9. 9. A method according to any one of claims 5 to 8, wherein expression, activity or isolation of angiogenin in the plant cell is enhanced by co-expressing angiogenin with a mediator or modulator of angiogenin activity.
  10. 10. A method according to claim 9, wherein said mediator or modulator of angiogenin activity is selected from one or more of antimicrobials, protease inhibitors, RNase inhibitors, follistatins, and delayed plant organ senescence proteins.
  11. 11. An artificial construct capable of enabling expression of an angiogenin gene or a functionally active fragment or variant thereof in a plant cell, said artificial construct including a promoter, operatively linked to an angiogenin gene, or a functionally active fragment or variant thereof, wherein the angiogenin gene is modified to alter its targeting signal sequence to direct the angiogenin to a target sub-cellular component or plant tissue.
  12. 12. An artificial construct according to claim 11, wherein said angiogenin gene comprises a sequence selected from the group consisting of: (a) sequence shown in SEQ ID NO: 3; (b) functionally active fragments of the sequence recited in (a) having a size of at least 200 nucleotides; (c) functionally active variants having at least 95% identity to the sequences recited in (a) and (b); and (d) sequences encoding a polypeptide comprising a sequence shown in SEQ ID NO: 2.
  13. 13. An artificial construct or chimeric sequence according to claim 12, wherein said angiogenin gene has codon usage adapted for plants.
  14. 14. An artificial construct or chimeric sequence according to claim 12 or 13, wherein said artificial construct further includes a gene encoding a mediator or modulator of angiogenin activity.
  15. 15. An artificial construct according to any one of claims 12 to 14, wherein said promoter is selected from the group consisting of a constitutive cauliflower mosaic virus (CaMV35S) promoter, an inducible photosynthetic promoter capable of mediating expression of a gene in photosynthetic tissue in plants under light conditions, or a tissue specific promoter, such as a seed specific promoter.
  16. 16. A method of using a plant cell, plant callus, plant, seed or other plant part including an angiogenin as feed stock for animals or as a composition suitable for human consumption, said method comprising producing the angiogenin in the plant cell, plant callus, plant, seed or other plant part according to any one of claims 1 to 4 and preparing it in a form suitable for use as a feed stock for animals or a composition suitable for human consumption.
  17. 17. A plant cell, a method or an artificial construct according to any one of claims 1 to 16, wherein the target sub-cellular component is an ER, apoplast, peroxisome, oilbody, nucleus, nucleolus, mitochondrial matrix, chloroplast or vacuole.
  18. 18. A plant cell, a method or an artificial construct according to any one of claims 1 to 17, wherein the angiogenin gene is modified to remove its signal peptide and to include a plant signal peptide, wherein said plant signal peptide contains a C-terminus 3-/4-amino-acid sequence KDEL, CTPP, SKL, SQL, SML, SSL or SAL, an N-terminal 4-amino-acid sequence NTPP, an N-terminal MTS or sequence encoding proteinase inhibitor II, calreticulin or oleosin, or an N-/C-terminal NLS or NOS.
  19. 19. A plant cell, a method or an artificial construct according to claim 18, wherein said plant signal sequence contains the C-terminus 4-amino-acid sequence KDEL.
  20. 20. An angiogenin produced by a method according to any one of claims 5 to 10.
AU2015202777A 2009-11-18 2015-05-22 Angiogenin expression in plants (2) Active AU2015202777B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2015202777A AU2015202777B2 (en) 2009-11-18 2015-05-22 Angiogenin expression in plants (2)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
AU2009905627 2009-11-18
AU2009905627A AU2009905627A0 (en) 2009-11-18 Gene expression in plants
AU2010321676A AU2010321676B2 (en) 2009-11-18 2010-11-18 Angiogenin expression in plants
PCT/AU2010/001543 WO2011060490A1 (en) 2009-11-18 2010-11-18 Angiogenin expression in plants
AU2015202777A AU2015202777B2 (en) 2009-11-18 2015-05-22 Angiogenin expression in plants (2)

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
AU2010321676A Division AU2010321676B2 (en) 2009-11-18 2010-11-18 Angiogenin expression in plants

Publications (2)

Publication Number Publication Date
AU2015202777A1 AU2015202777A1 (en) 2015-06-11
AU2015202777B2 true AU2015202777B2 (en) 2017-09-14

Family

ID=53276500

Family Applications (1)

Application Number Title Priority Date Filing Date
AU2015202777A Active AU2015202777B2 (en) 2009-11-18 2015-05-22 Angiogenin expression in plants (2)

Country Status (1)

Country Link
AU (1) AU2015202777B2 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000020557A2 (en) * 1998-10-07 2000-04-13 Boyce Institute For Plant Research At Cornell University Gemini virus vectors for gene expression in plants
WO2001032714A1 (en) * 1999-11-03 2001-05-10 King's College London Recombinant fusion molecules

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000020557A2 (en) * 1998-10-07 2000-04-13 Boyce Institute For Plant Research At Cornell University Gemini virus vectors for gene expression in plants
WO2001032714A1 (en) * 1999-11-03 2001-05-10 King's College London Recombinant fusion molecules

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Jamal et al. 2009. Role of genetic factors and environmental conditions in recombinant protein production for molecular farming. Biotechnology advances 27: 914-923. *
LIENARD, D. et al. Biotechnology Annual Reviews, 2007, vol. 13, pages 115-147 *
TWYMAN, R.M. et al. Trends in Biotechnology, 2003, vol. 21, no. 12, pages 570-578 *

Also Published As

Publication number Publication date
AU2015202777A1 (en) 2015-06-11

Similar Documents

Publication Publication Date Title
US11692185B2 (en) Angiogenin expression in plants
Tabe et al. A biotechnological approach to improving the nutritive value of alfalfa
AU2007286176B2 (en) Production of high tryptophan maize by chloroplast targeted expression of anthranilate synthase
Saalbach et al. The vacuolar targeting signal of the 2S albumin from Brazil nut resides at the C terminus and involves the C-terminal propeptide as an essential element
HRP20020506A2 (en) A process for converting storage reserves of dicot seeds into compositions comprising one or more gene products
KR20100132516A (en) A method for the production of a human protein in a plant, in particular a human recombinant lysosomal enzyme in a cereal endosperm
Bosch et al. A trout growth hormone is expressed, correctly folded and partially glycosylated in the leaves but not the seeds of transgenic plants
CA2607678C (en) Production of animal proteins in n-glucosaminyltransferase i-deficient plants
TWI534265B (en) Method, genetic construct and transgenic p;ant cell for manipulating fructan biosynthesis in photosynthetic cells of a plant
US20080010697A1 (en) Methods of Expressing Heterologous Protein in Plant Seeds Using Monocot Non Seed-Storage Protein Promoters
AU2015202777B2 (en) Angiogenin expression in plants (2)
WO2008120193A1 (en) Plants over-expressing pme
US20040117874A1 (en) Methods for accumulating translocated proteins
Madgwick et al. Genetic manipulation of rubisco: Chromatium vinosum rbcL is expressed in Nicotiana tabacum but does not form a functional protein
US20040132153A1 (en) Nucleic acids coding for a plant phosphatase of the mipp type with phytase activity and uses
AU2023201738A1 (en) Nepenthesin-1 derived resistance to fungal pathogens in major crop plants
CA2350328A1 (en) Gene encoding oxalate decarboxylase from aspergillus phoenices
WO2005001088A1 (en) Application of promoter capable of functioning by sugar deficiency in plant cultured cell to secretory production of useful protein

Legal Events

Date Code Title Description
FGA Letters patent sealed or granted (standard patent)