AU2014348780B2 - Biomarker for MELK activity and methods of using same - Google Patents

Abstract

The methods of the present invention, relate to the surprising determination that the level of phosphorylation of position 406 (e.g., a serine residue.) of human eukaryotic initiation factor 4B (cIF4B), or a corresponding phosphorylatafale amino acid of an ortholog thereof, serves as a bhiraarker for MELK enzymatic (e.g., kinase) and/or oncogenic activity. The methods of the present invention further ceiate to the surprising determination that the level of phosphorylation of position 3 (e.g., a threonine residue) and/or position 10 (e.g., a serine residue) and/or position 11 (e.g., a threonine residue) of human Historic M3, or a corresponding phosphorylatable amino acid of an ortholog thereof, also serves as a biomarker for MELK enzymatic (e.g., kinase) and/or oncogenic activity.

Description

BIOMARKER FOR MELK ACTIVITY AND METHODS OF USING SAME Cross-Reference to Related Applications

This application claims the benefit of U.S. Provisional Application Nos. 61/954,046, filed on 17 March 20.14, and 61/902,877, filed, on 12 November 2013; the entire contents of each of said applications is incorporated herein in its entirety by this reference.

Background of t he Invention

The protein kinase, maternal embryonic leucine zipper kinase (MELK), is known to be involved in regulating cell cycle progression, cellular proliferation, apoptosis, and mRNA splicing (Badoncl el al. (2006) Cell (Acte 5:883-889 and Badonel el al. (2010) Exp. Cell Res. 316:2166-2173). MELK has also been identified using gene expression profile analyst's to be associated with a number of cancers, including breast, lung, bladder, lymphoma, and cervical cancer cells and mammary tumor formation in animal models (Komatsu el al. (2013) ./»/../. Oncol. 42:478-506: Pickard ef al. (2009) Breast Cancer Res. 11.-R60: Hebbard ez al. (2010) Cancer Res, 70:8863-8873; Lin el al. (2007) breast Cancer Res. 9:R17; WO 2004/031413; WO 2007/7013665; and WO 2006/085684). Despite this association, however, functional analyses of MELK-mediated oncogenesis have not been performed to date and the mechanisms of MELK-mediated oncogenesis and, by extension, assays for determining agents useful in regulating such oncogenesis, are not known. This lack of understanding has prevented the identification of biomarkers that reliably report MELK enzymatic and/or oncogenic activity. While certain MELK-targeting inhibitors of' kinase activity are known (see, for example, Chung et al. (2012) Oncolargel 3:1629-1640), there is a clear need in the art to identify biomarkers of MELK-mediated ontogenesis in order to provide rapid and effective means for evaluating MELK-targeted anti-cancer therapies.

:»<

The present invention is based, at least in part, on the discovery that the level of phosphorylation of position 406 (e.g., a serine residue) of human eukaryotic initiation factor 4B (el'F4B) is a reliable biomarker for maternal embryonic leucine zipper kinase (MELK) activity suitable for use in measuring MELK enzymatic activity for preelinical and clinical applications. Similarly, the present invention is based, at least in part, on the discovery feat

WO 2015/073509

PCT/US2014/065173 ο

the level of phosphorylation of position 3 a threonine residue) and/or position 10 a serine residue) of human Histone H3 and/or position 11 (e.g., a threonine residue) is also a reliable biomarker for MELK activity suitable for use in measuring MELK enzymatic activity or preclinical and clinical applications.

In one aspect, a. method of identifying an agent which inhibits kinase or oncogenic activity of human maternal embryonic leucine zipper kinase (ME LK) or an ortholog thereof, comprising a) contacting a sample comprising i) human MELK or an ortholog thereof and ii) human eukaryotic initiation factor 4B (clF4B) or an ortholog thereof, with the agent; and b) determining the ability of the agent to inhibi t Ser-406 phosphorylation of human e!F4B or a corresponding phosphorylatable amino acid in the ortholog of hitman eIF4B_} wherein decreased phosphorylation identifies an agent which inhibits kinase or oncogenic activity of human MELK or the ortholog thereof is provided. In one embodiment, the inhibition of said Ser-406 phosphorylation of human eIF4B or a corresponding phosphory latable amino acid in an ortholog of human elF4B is determined by comparing the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human elF4B, in the sample relative to a control. In another embodiment the control is the amount of Ser-406 phosphorylated human el'F4B or a corresponding phosphoryl stable amino acid in. the ortholog of human eIF4B in the sample relative to said amount in the absence of the agent or at an earlier timepoint after contact of the sample with the agent. In still another embodiment, the inhibition of said Ser-406 phosphorylation of human eIF4B or a corresponding phosphorylatable amino acid in an ortholog of human c!F4B is determined by comparing the ratio of the amount of Ser-406 phosphorylated human el.F4B, or a corresponding phosphorylatable amino acid in the ortholog of human elF4B, in the sample relative to the total amount of human elF4B or ortholog thereof, io a control. In yet another embodiment, the control is the ratio of the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B in the sample relative to said ratio in the absence of the agent or at an earlier timepoint after contact of the sample with the agent. In another embodiment, the method further comprises determining the amount of a protein translated from auRNA with highly structured 5’UTR, optionally wherein the protein is selected from the group consisting of cellular myelocytomatosis oncogene (c-Myc), X-linked inhibitor of apoptosis protein (Xl'AP), and ornithine decarboxylase (ODC1). In still another embodiment, the method further comprises a step

WO 2015/073509

PCT/US2014/065173 of determining whether the agent directly binds said human eIF4B or said ortholog thereof, or said human MELK or said ortholog thereof. In yet another embodiment, the sample is selected from the group consisting of?/» v/7ro, ex vivo, and in vivo samples. In another embodiment, the sample comprises cells (¢-./ ., cancer cells, such as a cancer selected from the group consisting of any cancer in which MELK or elF4B is amplified or overexpressed, any cancer having an activating mutation of MELK or e!F4B, and any cancer in which MELK or ciF4B is activated by other kinases). In still another embodiment, the cells are obtained from a subject. In yet another embodiment, the sample is selected from the group consisting of tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow. In ano titer embodiment, the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of h uman eIF4B is determined, by an immunoassay using a reagent which specifically binds with Ser-406 phosphorylated human elF4B or corresponding phosphorylated ortholog of human eIF4B (e.g., a radioimmunoassay, a Western blot assay, a proximity ligation assay, an immunofluoresen.ee assay, an enzyme immunoassay, an immunoprecipitation assay, a chemiluminescence assay, an immunohistochemical assay, a dot blot assay, or a slot blot assay). In still another embodiment, the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human eIF4B or corresponding ortholog of human eIF4B and a detection antibody or fragment thereof which specifically binds with Ser-406 phosphorylated human eIF4B or a corresponding phosphorylated ortholog of human eIF4B. In yet another embodiment, said human eIF4B or ortholog thereof, and/or said human MELK or ortholog thereof, comprises a nucleic acid sequence or amino acid sequence set forth in Table 1. In another embodiment, the agent is a small molecule, or an antibody or antigen-binding fragment thereof. In still another embodiment, the agent decreases the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B by at least 50% .

In another aspect, a method for assessing the efficacy of an agent for inhibiting kinase activity of human MELK or an ortholog thereof in a subject, comprising a) detecting in a subject sample at. a first point in time, the amount of Ser-406 phosphorylated human elF4B or the amount of a human elF4B ortholog phosphorylated at a corresponding amino acid of human elF4B; b) repeating step a) during at one or more subsequent points in time after administration of the agent; and c) comparing the amount of phosphorylated human

WO 2015/073509

PCT/US2014/065173

-4eIF4B or ortholog thereof detected in step a) with said amount detected in step b), wherein a higher amount of Ser-406 phosphorylated human eIF4B or the amount of the human cIF4B ortholog phosphorylated at a corresponding amino acid of human elF4B in the firstpoint in time relative to at least one subsequent point in time, indicates that the agent inhibits kinase activity of human MELK or the ortholog thereof, is provided. In one embodiment, the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B is determined by an immunoassay using a reagent which specifically binds with Ser-406 phosphorylated human eIF4B or corresponding phosphorylated ortholog of human eIF4B (e.g.. a radioimmunoassay, a Western blot assay, a proximity ligation assay, an immunofluoresence assay, an enzyme immunoassay. an immunoprecipitation assay, a. chemiluminescence assay, an immunohistochemical assay, a dot. blot assay, or a slot blot assay). In another embodiment, the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human eIF4B or corresponding ortholog of human elF4B and a detection antibody or fragment thereof which specifically binds with Ser-406 phosphorylated human clF4B or a corresponding phosphorylated ortholog of h uman eIF4B, In still another embodiment, the sample is selected from the group consisting of ex vivo and in vivo samples. In yet another embodiment, the sample comprises cancer cells (<?.£., cancer ceils selected from the group consisting of any cancer in which MELK or eIF4B is amplified or overexpressed, any cancer having an activating mutation of MELK or eIF4B, and any cancer in which MELK or eIF4B is activated. by other kinases). In another embodiment, the sample is selected from the group consisting of tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow. In still another embodiment, the sample in step a) and/or step b) is a portion of a single sample obtained from the subject. In yet another embodiment, the sample in step a) and/or step b) is a portion of pooled samples obtained from the subject. In another embodiment, the subject has undergone treatment for cancer, has completed treatment for cancer, and/or is in remission from cancer between the first point in time and the subsequent point in time. In still another embodiment, said human elF4B or ortholog thereof, and/or said human MELK or ortholog thereof, comprises a nucleic acid sequence or amino acid sequence set forth in Table 1... In yet another embodiment, the agent is a small molecule, or an antibody or antigen-binding fragment thereof. In another embodiment, the agent decreases the amount of Ser-406 phosphorylated human eI.F4B or a

WO 2015/073509

PCT/US2014/065173 corresponding phosphorylatable amino acid m the ortholog of human el.F4B by at least

50%.

In still another aspect, a method of treating a subject afflicted with cancer comprising administering to the subject an agent that inhibits Ser-406 phosphorylation of human eIF4B or a corresponding phosphorylatable amino acid in an ortholog of human eIF4B, thereby treating the subject afflicted with the cancer, is provided. In one embodiment, the agent is administered in a pharmaceutically acceptable formulation. In another embodiment, the agent is a small molecule, or an antibody or antigen-binding fragment thereof. In still another embodiment, the agent directly binds said human eIF4B or the ortholog thereof, or said human MELK or the ortholog thereof. In yet another embodiment, the cancer is selected from the group consisting of any cancer in which MELK or eIF'4B is amplified or overexpressed, any cancer having an activating mutation of MELK or eIF4B, and any cancer in which MELK or eIF4B is activated by other kinases. In another embodiment, said human eIF4B or ortholog thereof, and/or said human MELK or ordiolog thereof, comprises a nucleic acid sequence or amino acid sequence set forth in Table 1. In still another embodiment, the agent is a small molecule, or an antibody or antigen-binding fragment thereof. In yet another embodiment, the agent decreases the amount of Ser-406 phosphorylated human el'F4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B by at least 50% . In another embodiment, the method further comprises administering one or more additional anti-cancer agents.

In yet another aspect, a method of determining the function or activity of human MELK or an ortholog, comprising a) detecting in a sample the amount of Ser-406 phosphorylated human eIF4B or the amount of a human eIF4B ortholog phosphorylated at a corresponding amino acid of human eIF4B; b) repeating step a) in the same sample or a test sample at one or more subsequent points in time after manipulation of the sample and/or manipulation of the same sample or test sample; and c) comparing the amount of phosphorylated human eIF4B or ortholog thereof detected hi step a) with said amount detected in step b), wherein a modulated of Ser-406 phosphorylated human eIF4B or the amount of the human e1F4B ortholog phosphorylated at a corresponding amino acid of human eIF4B in the first point in time relative to at least one subsequent point in time and/or at least one subsequent manipulation of the same sample or test sample, indicates that the function or activity of human MEL or an ortholog thereof is modulated, is provided. In one embodiment, the amount of Ser-406 phosphorylated human eI.F4.B or a

WO 2015/073509

PCT/US2014/065173 corresponding phosphorylatable amino acid in the ortholog of human el.F4B is determined by an immunoassay using a reagent which specifically binds with Ser-406 phosphorylated human el'F4B or corresponding phosphorylated ortho log of human elF4B (e.g., a radioimmunoassay, a Western biot assay, a proximity ligation assay, an immunofluoresence assay, an enzyme immunoassay, an immunoprecipitation assay, a chemiluminescence assay, an immunohistochemical assay, a dot blot assay, or a slot biot assay). In another embodiment, the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human elF4B or corresponding ortholog of human eIF4B and a detection antibody or fragment thereof which specifically binds with Ser-406 phosphorylated human elF4B or a corresponding phosphorylated ortholog of human eIF4B. In still another embodiment, the sample is selected from the group consisting of in vitro, ex vivo, and in vivo samples. In yet another embodiment, the sample comprises cells or the method uses a cell-based assay. In another embodiment, the cells are cancer cells selected from the group consisting of any cancer in which MELK or elF4B is amplified or overexpressed, any cancer having an activating mutation of MELK or eIF4B, and any cancer in which MELK or eIF4B is activated by other kinases. In still another embodiment, the sample is selected from the group consisting of tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow. In yet another embodiment, the same sample or test sample in step a) and/or step b) is a portion of a single sample obtained from a subject. In another embodiment, the same sample or test sample in step a) and/or step b) is a portion of pooled samples obtained from a subject, in still another embodiment, the subject has undergone treatment for cancer, has completed treatment for cancer, and/or is in remission front cancer between the first point in time and the subsequent point in time. In yet another embodiment, said human elF4B or ortholog thereof, and/or said human MELK or ortholog thereof, comprises a nucleic acid sequence or amino acid sequence set forth in Table 1. In another embodiment, the manipulation of the sample is selected from the group consisting of contacting the sample with a test agent, contacting the sample with an upstream signal of the MELK signaling pathway, and contacting the sample with, a MELK inhibitor. In still another embodiment, the test agent, is a small molecule, or an antibody or antigen-binding fragment thereof In yet another embodiment, the test, agent decreases the amount of Ser-406 phosphorylated human clF4B or a corresponding phosphorylatable amino acid in. the ortholog of human eIF4B by at least 50%.

WO 2015/073509

PCT/US2014/065173

In another aspect, a method of identifying an agent which inhibits kinase or oncogenic activity of human MELK or an ortholog thereof comprising; a) contacting a sample comprising i) human MELK or an ortholog thereof and ii) human Histone H3 or an ortholog thereof with the agent; and b) determining the ability of the agent to inhibit Thr-3 phosphorylation of human Histone H3 or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3; and/or Ser-10 phosphorylation of human Histone H3 or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3; and/or Thr-1 1 phosphorylation of human Histone H3 or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3, wherein decreased phosphorylation identifies an agent which inhibits kinase or oncogenic activity of human MELK or the ortholog thereof is provided. In one embodiment, the inhibition of said Thr-3 phosphorylation and/or Ser-10 phosphorylation and/or Thr-II phosphorylation of human Histone H3, or a corresponding phosphoiylatable amino acid in an ortholog of human Histone H3, is determined by comparing the amount of Thr-3 phosphorylated human Histone H3 and/or Ser-10 phosphorylated human Histone H3 and/or Thr-11 phosphorylated .human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3, in the sample relative to a control. In another embodiment the control is the amount of Thr-3 phosphorylated and/or Ser-10 phosphoiyiated and/or Thr-11 phosphorylated human Histone H3, or a corresponding phosphoiylatable amino acid in the ortholog of human Histone H3, in the sample relative to said amount in the absence of the agent or at an earlier timepoint after contact of the sample with the agent. In still another embodiment, the inhibition of said Thr-3 phosphorylation and/or Ser-10 phosphorylation and/or Thr-11 phosphorylation of human Histone H3, or a corresponding phosphory latable amino acid in an ortholog of human Histone H3, is determined by comparing the ratio of the amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated and/or Thr-1.1 phosphorylated human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3, in the sample relative to the total amount of human Histone H3 or ortholog thereof to a control. In yet another embodiment, the control is the ratio of the amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated and/or Thr- El phosphorylated human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3 in the sample relative to said ratio in the absence of the agent or at an earlier timepoint after contact of the sample with the agent In another embodiment, the method further comprises determining the amount of a mitosis-specific protein, in still another embodiment, the

WO 2015/073509

PCT/US2014/065173 method further comprises a step of determining whether the agent directly binds said human Histone H.3 or said ortholog thereof or said human MELK or said ortholog thereof'. In yet another embodiment, the sample is selected from the group consisting of in vitro, ex vivo, and in vivo samples. In another embodiment, the sample comprises cells, such as cancer cells (ug., cells from a cancer selected from the group consisting of any cancer in which MELK or Histone H3 is amplified or overexpressed, any cancer having an activating mutation of MELK or Histone H3, and any cancer in which MELK or Histone H3 is activated by other kinases). In still another embodiment, the cells are obtained from a subject. In yet another embodiment, the sample is selected from the group consisting of tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow. In another embodiment, the amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated and/or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylatabk amino acid in the ortholog of human Histone H3, is determined by an immunoassay using a reagent which specifically binds with Thr-3 phosphorylated or Ser-10 phosphorylated or Thr-11 phosphorylated human Histone H3, or corresponding phosphorylated ortholog of human Histone H3. In still another embodiment, the immunoassay is a radioimmunoassay, a Western blot assay, a proximity ligation assay, an immunofiuoresence assay, an enzyme immunoassay, an immunoprecipitation assay, a chemiluminescence assay, an immunohistochemical assay, a dot blot assay, or a slot blot assay. In yet another embodiment, the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof winch specifically binds with human Histone H3 or corresponding ortholog of human Histone H3 and a detection antibody or fragment thereof which specifically binds with Thr-3 phosphorylated or Ser-10 phosphorylated or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylated ortholog of human Histone H3. In another embodiment, the human Histone H3 or ortholog thereof, and/or said human MELK or ortholog thereof comprises a nucleic acid sequence or amino acid sequence set forth in Table 1. In still another embodiment, the agent is a small molecule, or an antibody or antigen-binding fragment thereof. In yet another embodiment, the agent decreases the amount of Thr-3 phosphorylated and/or Ser1.0 phosphorylated and/or Thr-1.1 phosphorylated human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3, by at least 50%.

In still another aspect, a method for assessing the efficacy of an agent for inhibiting kinase activity of human MELK or an ortholog thereof in a subject, comprising: a)

WO 2015/073509

PCT/US2014/065173 detecting in a subject sample at a first point in time, the amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated and/or Thr-11 phosphorylated human Histone 113, or the amount of a human Histone H3 ortholog phosphorylated at a corresponding amino acid of human Histone H3; b) repeating step a) during at one or more subsequent points in time after administration of the agent; and c) comparing the amount of phosphorylated human Histone H3 or ortholog thereof detected in step a) with said amount detected in step b), wherein, a higher amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated and/or Thr-11 phosphorylated human Histone H.3, or the amount of the human Histone H3 ortholog phosphorylated at a corresponding amino acid of human Histone M3, in the first point in time relative to at least one subsequent point, in time, indicates that the agent inhibits kinase activity of human MELK or the ortholog thereof is provided. In one embodiment, the amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated, and/or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylatablc amino acid in the ortholog of human Histone H3, is determined by an immunoassay using a reagent which specifically binds with Thr-3 phosphorylated human. Histone H3 or Ser-1.0 phosphorylated human Histone H3 or Thr-11 phosphorylated human Histone H3, or corresponding phosphorylated ortholog of human Histone H3. In another embodiment, the inimiiiioassay is a radioimmunoassay, a 'Western blot assay, a proximity ligation assay, an immunofluoresence assay, an enzyme immunoassay, an immunoprecipitation assay, a chemiluminescence assay, an immunohistochemical assay, a dot blot assay, or a slot blot assay. In still another embodiment, the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human Histone M3 or corresponding ortholog of human Histone H3 and a detection antibody or fragment thereof which specifically binds with Thr-3 phosphorylated or Ser-10 phosphorylated or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylated ortholog of human Histone H3. In yet another embodiment, the sample is selected from the group consisting of ex vivo and in vivo samples. In another embodiment, the sample comprises cancer cells (e,g., cancer cells selected from the group consisting of any cancer in which MELK or Histone H3 is amplified or overexpressed, any cancer having an activating mutation of MELK or Histone H3, and any cancer in which MELK or Histone H3 is acti vated bv other kinases). In still another embodiment, the sample is selected from the group consisting of tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow. In yet another embodiment, the sample

WO 2015/073509

PCT/US2014/065173 in step a) and/or step b) is a portion of a single sample obtained from the subject. In another embodiment, the sample in step a) and/or step b) is a portion of pooled samples obtained from the subject. In still another embodiment, the subject has undergone treatment for cancer, has completed treatment for cancer, and/or is in remission from cancer between the first point in time and the subsequent point in time. In yet another embodiment, the human Histone H3 or ortholog thereof, and/or said human MELK or orthoiog thereof, comprises a nucleic acid sequence or amino acid sequence set forth in Table 1. In another embodiment, the agent is a small molecule, or an antibody or antigenbinding fragment thereof. In still another embodiment, the agent decreases the amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated and/or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3, by at least 50%.

In yet another aspect, a method of treating a subject afflicted with cancer comprising administering to the subject an agent that inhibits Thr-3 phosphorylation and/or Ser-10 phosphorylation and/or Thr-11 phosphorylation, of human Histone H3, or a corresponding phosphorylatable amino acid in an orthoiog of human Histone H3, thereby treating the subject afflicted with the cancer is provided. In one embodiment, the agent is administered in a pharmaceutically acceptable formulation, in another embodiment., the agent is a small molecule, or an antibodv or antigen-binding fragment thereof. In still another embodiment, the agent directly binds said human Histone H3 or the orthoiog thereof or said human MELK or the orthoiog thereof. In yet another embodiment, the cancer is selected from the group consisting of any cancer in which MELK or Histone H3 is amplified or overexpressed, any cancer having an activating mutation of MELK or Histone H3, and any cancer in which MELK or Histone H3 is activated by other kinases. In another embodiment, the human Histone H3 or orthoiog thereof, and/or said human MELK or orthoiog thereof, comprises a nucleic acid sequence or amino acid sequence set forth in Table 1. In still another embodiment, the agent is a small molecule, or an antibody or antigen-binding fragment thereof In yet another embodiment, the agent decreases the amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated and/or Thr-11 phosphorylated human Histone H3, or a corresponding phospho.ry.latab.le ami.no acid in the orthoiog of human Histone H3, by at least 50%. In another embodiment, the method further comprises administering one or more additional anti-cancer agents.

WO 2015/073509

PCT/US2014/065173

In another aspect, a method of determining the function or activity of human MELK or an ortholog, comprising: a) detecting in a sample the amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated and/or Thr-11 phosphorylated human histone 113 or the amount of a human Histone H3 ortholog phosphorylated at a corresponding amino acid of human Histone H3; b) repeating step a) in the same sample or a test sample at one or more subsequent points in time after manipulation of the sample and/or manipulation of the same sample or test sample; and c) comparing the amount of phosphorylated human Histone H3 or ortholog thereof detected in step a) with said amount detected in step b), wherein a modulated amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated and/or Thr-11 phosphorylated human Histone H3, or the amount of the human Histone H3 ortholog phosphorylated at a corresponding amino acid of human Histone H3, in the first, point in time relative to at least one subsequent point in time and/or at. least, one subsequent manipulation of the same sample or test sample, indicates that the function or ac tivity of human MELK or an ortholog thereof is modulated is provided. In one embodiment, the amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated and/or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3, is determined by an immunoassay using a reagent which specifically binds with Thr-3 phosphorylated or Ser-10 phosphorylated or Thr-11 phosphorylated human Histone H3, or corresponding phosphorylated ortholog of human Histone H3. In another embodiment, the immunoassay is a radioimmunoassay, a Western blot assay, a proximity ligation assay, an immunofiuoresence assay, an enzyme immunoassay, an immunoprecipitation assay, a. chemiluminescence assay, an immunohistochemical assay, a dot biot assay, or a slot blot assay. In still another embodiment, the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human Histone H3 or corresponding ortholog of human Histone H3 and a detection antibody or fragment thereof which specifically binds with Thr-3 phosphorylated or Ser-10 phosphorylated or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylated ortholog of human Histone H3„ In yet another embodiment, the sample is selected from the group consisting of zn vz/ro, ev vivo, and in vivo samples. In another embodiment, the sample comprises cells or the method uses a cell-based assay. In still another embodiment, the cells are cancer cells selected from the group consisting of any cancer in which MELK or Histone H3 is amplified or overexpressed, any cancer having an activating mutation of MELK or

WO 2015/073509

PCT/US2014/065173

Histone H3, and any cancer in which MELK or Histone H3 is activated by other kinases. In yet another embodiment, the sample is selected from the group consisting of tissue, whole blood, serum, plasma, buccal scrape, sali va, cerebrospinal fluid, urine, stool, and bone marrow. In another embodiment, the same sample or test sample in step a) and/or step b) is a portion of? a single sample obtained from a subject. In still another embodiment, the same sample or test sample in step a?) and/or step b) is a portion of pooled samples obtained from a subject. In yet another embodiment, the subject has undergone treatment for cancer, has completed treatment for cancer, and/or is in remission from cancer between the first point in time and the subsequent point in time. In another embodiment, the human Histone H3 or ortholog thereof, and/or said human MELK or ortholog thereof, comprises a nucleic acid sequence or amino acid sequence set forth in Table 1. In still another embodiment, the manipulation of the sample is selected from the group consisting of? contacting the sample with a test agent, contacting the sample with an upstream signal of the MELK signaling pathway, and contacting the sample with a ,M?E?LK inhibitor. In yet another embodiment, die test agent is a small molecule, or an antibody or antigen-binding fragment thereof. In another embodiment, the test agent decreases the amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated and/or Thr-11 phosphorylated human Histone H3, or a corresponding phosphoryiatabie amino acid in the ortholog of human Histone H3, by at least 50%.

It will also be understood that certain embodiments of the present invention can be used with more than one method described herein, according to knowledge available to the skilled artisan.

Figure 1 shows that MEEK interacts with e'IF4B. Flag-MELK was conditionally expressed in MDA-MB-468 cells. Mitotic lysates were subjected to anti-FIag immunoprecipitation followed by tandem mass spectrometric analysis. The left panel shows the number of peptides recovered from the immunoprecipitates. The right panel shows validation of the interaction between MELK and elF4B during mitosis. Note that Flag-MELK. is doxycycline-inducible.

Figure 2 shows the results of peptide library screening to identify an optimal substrate motif for MELK. The top panel shows the results of a spatially arrayed peptide library subjected to in vitro phosphorylation using recombinant full-length MELK. Each

WO 2015/073509

PCT/US2014/065173 peptide contains one residue fixed at one of nine positions relative to the centrally fixed phosphoacceptor (i.e., serine or threonine). Reactions were spotted onto the membrane and the spots were exposed to a phosphor storage screen. The bottom panel shows a sequence logo generated using quantified and normalized data from the screen. Note that M.ELK has a strong selection for arginine at. the -3 position relative to the phosphoacceptor site.

Figure 3 shows that MELK phosphorylates eIF4B at 8406 in vitro. Recombinant full-length MELK or the kinase domain of MELK was subjected to in vitro kinase assays using immunoprecipitated Flag-eIF4B (wild type) or Fla.g-elF4B (S406A). Robust phosphorylation ofeIF4B at S406 was observed in the presence of MELK. This phosphorylation was abolished when wild type Cwt) ei'F4B was replaced with a mutant C1F4B (S406A).

Figure 4 shows that M.ELK does not phosphorylates eIF4B at S422 in vitro. Recombinant full-length or kinase domain of MELK was subjected to in vitro kinase assay using immunoprecipitated Flag-elFAB (wild type) or Flag-cIF4B (S422A). Reactions were analyzed by immunobiotting.

Figure 5 shows that MELK regulates phosphorylation of eIF4B at 8406 in vivo.

Left panels show MELK knockdown impairs the phosphorylation of elF4B at 8406. MDAMB-468 cells stably expressing tetracycline-inducible (tet-on) small hairpin MELK (shMELK) in the presence or absence of doxycycline were harvested through treatment of nocodazole, and subjected to immunobiotting. Right panels show that a MELK inhibitor impairs the phosphorylation of eIF4B at 8406. Mitotic MDA-MB-468 cells were treated for 30 min with vehicle or 200 n.M OTSSP167, a MELK inhibitor (Chung el al. (2012) Oncotarget 3:1629-1640). Lysates were used for immunobiotting.

Figure 6 shows the results of treating mitotic cells for 30 min with mTOR inhibitors (e.g., Rapamycin and Torin 1) versus treating such ceils with M.ELK inhibitors (e.g., OTSSP67). The results indicate that MELK inhibition, but not mTOR inhibition, suppressed the phosphorylation of eIF4B at S406.

Figure 7 shows that knocking down MELK or eIF4B decreases the protein abundance of XIAP, c-Myc, andODCl during mitosis. MDA-MB-468 and MDA-MB-231 cells stably expressing tet-on shMELK or sh-eIF4B were treated with doxycycline or vehicle control. Mitotic cells were harvested by nocodazole-indnced arrest, at prometaphase. Note that the mRNA of XIAP, c-Myc, and ODCI have been shown to contain structured 5’UTR. and their total levels remain unchanged.

PCT/US2014/065173

WO 2015/073509

- 14Figure 8 shows that knocking down MELK decreases the translation of luciferase driven by the 5’ UTR of c-Myc or ODC1 during mitosis. MDA-MB-23I cells stably expressing tet-on shMELK were transfected with the indicated bicistronic vector in the presence or absence of doxycycline. Nocodazole-arrested mitotic cells were harvested two days after transfection and subjected to a luciferase assay. The ratio of Renilla luciferase to firefly luciferase (RL/FL) was normalized to the value of control vector. Note that the left bar corresponds to Dox (-) and the right bar corresponds to Dox (-+-) for each pair of bars shown in the graph reporting relative RL/FL ratios.

Figure 9 shows that MELK phosphorylates Histone H3 at Thr-3, Ser-10 and Thr-11 in vitro. Recombinant Histone H3 was incubated with or without recombinant MELK (kinase domain) for 30 min. at 30 “C in the presence of ATP. Reactions were terminated by adding SDS sample buffer. Samples were then subjected to immunoblotting using the indicated antibodies.

Figure 10 shows that knocking down MELK decreases the mitotic phosphorylation of Histone H3 at Thr-3, Ser-10 and Thr-1I, but not Ser-28. MDA-MB-468 cells stably transduced with tet-on shMELK were untreated or treated with doxycycline (200 ng/ml) in order to induce gene silencing. Ceils were then treated with nocodazole (200 ng/ml) for 20 hours. Mitotic cells were harvested by shake-off and cell lysates were subjected to immunoblotting usinc the indicated antibodies.

Figure 11 shows that knocking down MELK does not affect the phosphorylation of Aurora kinases, which are known kinases for Histone H3 at Ser 10. MDA-MB-468 cells stably transduced with tet-on shMELK were untreated or treated with doxycycline (200 ng/ml) to induce gene silencing. Celis were treated with nocodazole (200 ng/ml) for 20 hours. Mitotic cells were harvested by shake-off and cell lysates were subjected to immunoblotting using the indicated antibodies.

Figure 12 shows that a MELK. inhibitor suppresses MELK-induced phosphorylation of Histone H3 at Ser 10 in vitro. Recombinant Histone H3 was incubated without or with recombinant. MELK (kinase domain) for 30 min. at 30 X in the absence or presence of OTSSP167 (200 ng/ml final.). Reactions were terminated by adding SDS sample buffer. Samples were subjected to immunoblotting using the indicated antibodies.

Figure 13 shows that a MELK inhibition suppresses the mitotic phosphorylation of Histone H3 at Thr-3, Ser-10 and Thr-11, but not Ser-28_t in a concentration-dependent manner. Mitotic cells were harvested through nocodazole-induced cell cycle arrest at

WO 2015/073509

PCT/US2014/065173 prometaphase (200 ng/ml nocodazole, 20 hours). Cells were treated with the small chemical inhibitor of MELK, OTSSP167, for 30 min, at the indicated concentrations. Cell lysates were then prepared for immunoblotting.

Detailed Description of the Invention

The methods of the present invention relate to the surprising determination that the level of phosphorylation of position 406 (e.g, a serine residue) of human eukaryotic initiation factor 4B (eIF4.8), or a corresponding phosphorylatable amino acid of an ortholog thereof, serves as a biomarker for MELK enzymatic (eg., kinase) and/or oncogenic activity. Specifically, decreased phosphorylation of, for example, Ser-406 of human elF4B (e.g., by directly or indirectly inhibiting MELK-mediated phosphorylation of Ser-406) corresponds with a reduction in MELK enzymatic activity (e.g., kinase activity) and MELK-mediated oncogenic effects. Such a biomarker is particularly advantageous for preclinical and clinical applications because the phosphorylation state of clF4B is directly associated with the MELK oncogene itself. Similarly, the methods of the present invention also relate to the surprising determination that the level of phosphorylation of position 10 (e.g., a serine residue) of human Histone H3, or a corresponding phosphorylatable amino acid of an ortholog thereof and/or the level of phosphorylation of position 11 (e.g., a threonine residue) of human Histone H3, or a corresponding phosphorylatable amino acid of an ortholog thereof, serves as a biomarker for MELK enzymatic (e.g., kinase) and/or oncogenic activity. Specifically, decreased phosphorylation of for example. Thr-3 of human Histone H3 (e.g., by directly or indirectly inhibiting MELK-mediated phosphorylation of Thr-3) and/or Ser-10 of human Histone H3 (e.g., by directly or indirectly inhibiting MELK-mediated phosphorylation ofSer-10) and/or Thr-11 of human Histone H3 (e.g., by directly or indirectly inhibiting MELK-mediated phosphorylation of Thr-11) corresponds with a reduction in MEEK enzymatic activity (e.g.,.kinase activity) and MELK-mediated oncogenic effects. Such a biomarker is particularly advantageous for preclinical and clinical applications because the phosphorylation state of Histone H3 is directly associated with the MELK oncogene itself. In some embodiments, Ser-406 of human eIF4B, Thr-3 of human Histone H3, Ser-10 of human Histone H3, and/or Thr-11 of human Histone H3, as wed as any corresponding phosphorylatable amino acid of an ortholog thereof including in any combination thereof, are contemplated for use according to tire present invention. In other embodiments, Ser-28 of human eIF4B or a corresponding

WO 2015/073509

PCT/US2014/065173 phosphorylatable amino acid of an ortholog thereof is not regulated by MELK and is not used according to the present invention.

A. MELK, eIF4B, and Histone H3 Molecules

As used herein, “MELK” refers to the MELK member of the protein kinase superfamily and is alternatively known as “pEG3 kinase,” “protein kinase Eg3,” “protein kinase,” and “serine/direoninc-ptotein kinase MELK.” At least nine spiicc variants encoding nine distinct human MELK isofonns exist Human MELK transcript variant 1 (NMJH479L3) encodes the long human MELK. isoform I (N.PJ556O6.I). Human MELK transcript variant 2 (NM^OO .1256685.1) lacks an exon in the 3’ coding region compared to transcript variant I, but maintains the reading frame and results in an isoform (NP 001243614.1) that is shorter than isoform I. Human MELK transcript variant 3 (NM_00.l 256687.1) lacks an exon, in the 5’ coding region compared to transcript variant L but maintains the reading frame and results in an isoform (NPJ)()12436I6.1) that is shorter than isoform 1, Human MELK transcript variant 4 (NM 001256688.1) lacks two consecutive exons in the 5’ coding region compared to transcript variant 1, but maintains the reading frame and results in an isoform (NP_001243617,1) that is shorter than isoform 1. Human MELK transcript variant 5 (NM. 001256689.1) initiates translation at an alternate start codon and lacks an exon in. the 5’ coding region compared to transcript variant 1 and thus results in an isoform (NP_001243618.1) that is shorter than and has a distinct N-terminus from isoform 1. Human MELK transcript variant 6 (NM 001256690,.1) initiates translation ar an alternate start codon and lacks two consecutive exons in the 5’ coding region compared to transcript variant I, but maintains the reading frame and results in an isoform (NP_001.2436'19J) that is shorter than and has a distinct N-terminus from isoform 1. Human MELK transcript variant 7 (NM 001256691.1) initiates translation at an alternate start codon and lacks two exons in the 5’ coding region compared, to transcript variant I, but maintains the reading frame and results in an isoform (NP 001243620.1) that is shorter than and has a distinct N-terminus from isoform I. Human MELK transcript variant 8 (NM 001256692.1) lacks three exons in the 5 ’ coding region and initiates translation, at a downstream, in-frame start codon compared to transcript variant .1 and results in an isoform (NP_001243621.1) that has a shorter N-terminus than isoform I. Finally, human MELK transcript variant 9 (NM 001256693.1) lacks two consecutive exons in the 5’ coding region and initiates translation at a downstream, in-frame start codon compared to transcript variant 1 and

WO 2015/073509

PCT/US2014/065173 results in an isoform (NP/10124362.2.1) that has a shorter N-termmus than isoform 1. The protein domains and structural basis for the regulation of MELK autophosphorylation and activation of kinase activities on target proteins is known (see, at least Cao et al (2013) PLaS One 8:e7003 1 and Canevari et al. ¢2013) Biochemistry 52:6380-6387),

Mouse MELK nucleic acid (NM_010790.2) and amino acid (NP/134920.2) sequences are publicly available on the GenBank database maintained by the U.S. National Center for Biotechnology Information. Nucleic acid and polypeptide sequences of MELK orthologs in species other than mice and humans are also well known and include, for example, chimpanzee MELK (XM 00 Π69038.3, XP/101169038.1, XM/)()1168991.3, XP/101168991,1, XM/XJl168745.3, XPJJOl168745.1, XM/Kll 168775.3, XP/X)1168775.1, XMJXB951427.1, XPJ103951476.1, XM 520578.4, XP 520578.3, XM/)01168822.3, XP/101168822.2, XM/)03312085.2, XP/)03312133.1, XM 003951428.1, XP 003951477.1, XM 003312086.2, and XP/)03312I34.I), monkey MELK (XM 001115076.2 and XP/101115076.2), dog MELK (XM„003431578. L XP 003431626.1, XM_538730.3, XPJ538730.2, XM/)0343I579.1, and XP „003431627.1), cow MELK (NM/X.H1I1260.1 and NP „001104730.1), rat MELK (NM.001108662.1 and NP 001102132.1), chicken MELK (NM 001031509.1 and NP/X)1026680.1), and zebrafish MELK (NM_206888.2 andNP_99677L2).

As used herein, “eIF4B” refers to the eukaryotic translation initiation factor 4B member of the eukaryotic translation initiation factor family and is alternatively known as “EIF-4B” and “PROS 843. Human clF4B nucleic acid (NM 001417,4) and amino acid (NP_001408.2) sequences are publicly available on the GenBank database maintained by the U.S. National Center for Biotechnology Information. Nucleic acid and polypeptide sequences of elF4B orthologs in species other than humans are also well known and include, for example, mouse eI.F4B (NM_145625.3 and NP/)63600.2), chimpanzee eIF4B (XMJX13313676,1, XP/)()3313724..1, XMJXH142097.3, and XP/101142097.3), monkey eIF4B (NMJ)01195808.1 and NPJXH 182737.1), dogeIF4B (XM_853888.2, XP„858981.2, XM„ 853812.2, and XPJ58905.2), cow cIF4.B {NM,/)01.035028,2 and NP/X) 1030200.1). rat eIF4B (NM JX)1008324.1 and NP 001008325.1), and chicken elF4B (XM_003643408.2 and XPJX13643456.2). In addition, “Ser-406” of eI.F4.B refers to the amino acid numbering of the human elF4B. Accordingly, a skilled artisan will readily understand th at Ser-406 of the human clF4B polypeptide is conserved across numerous species and that although those specific residues may be referenced herein, the methods of

WO 2015/073509

PCT/US2014/065173 die present invention apply equally well to die corresponding residues (e.g., phosphorylatable amino acids) of isoforms, homologs, and orthologs in other species corresponding to said Ser-406 of human eIF4B.

As used herein, the term “Histone H3” refers to the H3 member of the Histone family, which comprises proteins used to form the structure of nucleosomes in eukaryotic cells. Eukaryotes have chromatin arranged around proteins in the form of nucleosomes, which arc the smallest subunits of chroma t in and inchide approximately 146-147 base pairs of DNA wrapped around an octamer of core histone proteins (two each of H2A, H2B, H3, and H4). Mammalian cells have three known sequence variants of Histone H3 proteins, denoted H3.1, H3.2 and H3.3, that are highly conserved differing in sequence by only a few amino acids. Post-transla tional modification of Histone H3 residues arc important in many cellular processes and phosphorylation of serine 10 and/or serine 28 arc important for cell division and proliferation regulation. Phosphorylated Histone H3 at serine 10 is a speci fic biomarker for mitotic cells, similar to other well-known mitosis-specific markers, such as phosphorylated MPM-2, phosphorylated retinoblastoma protein 1 (Rb), phosphorylated cdc2< BubRl, cyclin Bl, cdc25c, cdkl, cdc27, and the like. Any serine, threonine, or tyrosine residue can be phosphorylated. In some embodiments, other possible phosphorylation sites include threonine 3, threonine 6, threonine 11, serine 31, tyrosine 41, serine 57, threonine 80, and threonine 107.

As used herein, the term “Histone H3” can refer ίο H3.1, H3.2, or H3.3 indi vidually or collectively. These amino acid sequences include a methionine as residue number 1 that is cleaved off when the protein is processed. Thus, for example, serine 11 in the Histone H3 amino acid sequences shown in Table 1 below corresponds to serine (Ser) 10 of the present invention. These three protein variants are encoded by at least fifteen different genes/transeripts. Sequences encoding the Histone H3.1 variant are publicly available as HISTJ.H3A (NMJX13529.2; NP_003520.l), HIST1H3B (NM_003537.3; NPJX13528.1), HISTIH3C (NMJO3531.2; NPJW3522.1), HISTIH3D (NM.„003530.3; NPJ103521.2), HIST1H3E (NM003532.2; NPJW3523.1), HIST1H3F (NM021018.2; NP....066298,1), HIST1H3G (NM 003534,2; NP. 003525.1), HIST1H3H (NM..003536.2; NP003527.1), HIST.1H31 (NM_003533.2; NPJX)3524.1), and HIST1.H3J (NMJ103535.2: NP_003526.l). Sequences encoding the Histone H3.2 variant are publicly available as HIST2H3A (NM..001005464.2; NPJX) 1005464.1), HIST2H3C (NM.021059.2; NPJJ66403.2), and H1ST2H3D (NMjiOl 123375.1; NPJ101Π6847.1). Sequences encoding die Histone H3.3

PCT/US2014/065173

WO 2015/073509

- 19vanant are publicly available as H3F3A (NM_002107.3; NP_002098.1) and H3F3B (NM_005324.3;NP_005315.I). See U.S. Pat. Publ. 2012/0202843 for additional details. Moreover, polypeptide sequences for Histone H3 orthologs, as well as nucleic acid sequences that encode such polypeptides, are well-known in many species, and include, for example, Histone H3.1 orthologs in mice (NM_013550.4; NP_038578.2), chimpanzee (XM...527253.4; XP 527253.2), monkey (ΧΜ...001088298:2; XP. 001088298.1), dog (XM 003434195.1; XP 003434243.I), cow (XMJ102697460.1; XP 002697506.1), rat (XM_001055231.2; XP_00105523U), and zebrafish (NM_00.11001.73.1. ;

NP 001093643.1). Histone H3.2 orthologs in mice (NM J 78215.1; NPJ35587.1), chimpanzee (XM„524859.4; XP„524859.2), monkey (XMJ.K)1084245.2;

XP 001084245.1), dog (XM. 003640147.1; XPJ)03640195.1), cow (XM...002685500.1; XP_002685546.1), rat (NMJJOl 107698.1; NP_00l 101168.1), chicken (XM_001233027.2; ΧΡ...0ΟΓ233028.1), and zebrafish (XM. 002662732.1; XP..002662778.1). Similarly, Histone H3.3 orthologs in mice (XM...892026.4; XP 897119.3), monkey (XMJMH085836.2; XPj)01085836.1), cow (NMJJ01099370.1; NP_001092840.1), mt (NM_O53985.2;

NP..446437.1.), chicken (NM..205296.1; NP. 990627.1), and zebrafish (NM..200003.1;

NP 956297.1), are well-known. Antibodies for the detection of phosphorylated H3 histone, such, as phosphorylated Histone H3 at Thr~3, Ser-10, Thr-11, and other phosphorylatable residues of Histone H3, as well as methods for making such antibodies are known in the art. In addition, for example, “Ser-10” of Histone H3 refers to the amino acid numbering of the human Histone Ή3. Accordingly, a skilled artisan will readily understand that Ser-10 of the human Histone H3 polypeptide is conserved across numerous species and that although those specific residues may be referenced herein, the methods of the present invention apply equally well to the corresponding residues (e.g., pltosphorylatable amino acids) of isoforms, homologs, and orthologs in other species corresponding to said Ser-10 of human Histone IB. The same applies to Thr-3 and Thr-11.

Representative MELK,eIF4B, and Histone H3 orthologs are provided herein (e.g., at least at Table 1 and the Examples) as follows:

lablg.I

Human MELK (isoform 1) cDN A Sequence (NM. 01.4791.3) atgaaagatt aegatgaact tctcaaatat tatgaattac atgaaactat tgggaoaggt ggctttgcaa aggtcaaact tgcctgccat atccetactg gagagarggt ageeataaaa

121 atcatggata aaaacacact. agggagtigat tegccccgga teaaaaegga gattgaggee

PCT/US2014/065173

WO 2015/073509

	181 241 301 351	ttgaagaacc aaaatattca caggatcgcc gettatgtgc	tgagacatea tggttcttga tgtcagaaga acagccaggg	gcatatatgi y.,- ggagacccgg ctatgercac	caactstage ggaggagagc g , , ’. . .* agggacctca	atgtgetaga tgettgacta gtcagat.agi agesagaaaa	- L·- ν<5δν· atstgctgtt trtgctgttt
5	421	•gatgaatatc	ataaattaaa	ger. gat. teas	tttggtctct	gu-Cica aaacc	c aa q gq t a a e
	431	aaggattacc	atctacagac	at.gctgr.ggg	agtctggctt	atgcagcacc	tgagttaata
	S41	caaggcaaat	catatcttgg	at oagag g ca	gatgrttgga	gcatgggcat	aetgrtatat
	601	gttsttatgt	gtggatttet	accatttgat	gatgataatg	taatggcttt	atacaagaag
	oil	attatgagag	gaaaatatga	tgttcccaag	tggetetets	ccagtagcat.	tetgetftett
10	721	caacaaatgc	tgcaggigga	cccaaagaaa	eggattteta	tgaaaaatet	attgaaccat
	731	ccctggatca	tgcaagatta	caaetatcct	gttgagtggc	aaagcaagaa	tccttttatt
	341	eacctcgatg	atgattgcgt	aacagaactt	tctgtacatc	acagaas.saa	caggcaaaca
	$01	atggaggatt	taatttcact	gtggcagtat	gatcacctsa	cggcsaccta
	002	ctagacaaga	aggctegggg	aaaaacagtt	egttaaaggc	rr tetter rt.	cieetgtgga
15	2021	aaagceagtg	ctaaeccaat.	aacagacatc	aagteaaara	attggagtet	ggaagatgtg
	1031	acegeaagtg	ataaaaatta	tgtggcggga	ttaatagact	atgattggtg	tgaagatgat
	1141	ttatcaacag	gtgctgctac	tccccgaaca	teasagitta	ccaagtactg	gasagaatca
	1201	aatggggtgg	aatetaaatc	attaactcca	geettatgea	gaasacctgs	aaataaatta
	1261	35. ¢1 5ίί5.<>	aaaatgtata	tactcctaag	tetgetgtaa	agaatgaaga	gtaciitatg
20	1321	L t. C. C C L C< cl ij C	·.*>·* .·,.; ·;··: .-:.··	agttaa taag	aaccagcata	agagagaaat	actoctacg
	1332		aCKtSSaCC	cteaaaaget.	agaaaccagt	gcotgaaaga	aacr.ee.aatt
	2441		taaattcaae	aggaaeagac	aagttaatga	caggrgtcat	aagccctgag
	ISO!	aggeggtgcc	gctcagagga	atcggatctc	aaccaagcac	atatggagga	gactccaaaa
	1561	¢1 <tCj C;	ccaaagtgtt	tgggagcctt	gaaagggggt	tggataaggi	tatcactgtg
25	1621	ctcaccagga	gcaaaaggaa	gggttctgcc	agagaeggge	ccagaagact	aaagcttcac
	1601	tataacgtga	ctacaactag	attagtgaat	ccagatcaac	tgitgaatga	aataaigtet
	2741	attc	agaagcatgr.	tgacttfcgta	c a a aaggg t	atacaetgaa	gtgtcaaaea
	1802	cagaaagatr.	Otgggaaagt	gaeaatgcaa	tttgaattag	aagtgtgeca	getaeaaaaa
	2861	cacgatgtgg	tgggtatcag	gaggcagcgg	cttaagggcg	atgceagggt	atacaaaaga
30	1822	ttagtggaag	aeatceaatc	tagatgcaag	gtataa

Human MELK (isoform 1) Amino Acid Sequence (NP_55606..l)

	1 mkdydeXiky £1 Ikslxhqhie	yelhetigtg qlyhvletan	glakvklach lltgesivaik isidkatlgsd	Iprikteiea wlxqivsav
kifmvieycp	ggeltdylls	qdxlseeetx
35	121	ayvhsqgyah	rdlkpenllf	deyhklklld	fglcakpkga	kdyhlgtccg	siaytape11
	181	qgksylgsta	«vwSiKgilly	vliaegf Ipf d	ddnvKialykk	iiargkydvpk	wlspssilll
	241	qqtaigvdpkk	rlsffiknllnh	pwimqdynyp	vawqskapry	hidddcvtel	svhhrniwqt
	301	medlislwqy	dhliatyli1	lakkargkpv	ririssfseg	q arsa t pit di	ksrtnw.-siedv
	361	tasdknyvag	1idydweedd	1srgaatprt	sqftkywtes	ngvesksltp	alertpankl
40	421	fcxskenvyfcpk	savkneeyfir.	Opapktpvtk	aqnkrailrt	pnxyttpska	rnqelkatpi
	481	kipvsstgtd	klnitgvxape	rxersveldl	nqahKteetpk	xkgakvfgsl	ergldkvltv
	541	1trskx kgsa	rdgpxrlklh	ynvtttrivn	pdqilneiias	llpkkhvdfv	qkgytlkcgt
	601	qsdf gkvtisq	ielevtglqk	pdwglrrqx	ikgdawykr	Ivedllsaek	V

WO 2015/073509

PCT/US2014/065173

Human MELK (isoform 2) cDNA Sequence (NM_00.1256685.1)

	1 δΐ 121	atgaaagatt ggcttvgcaa ateafeggata	atgatgaact aggtaaaacc aaaacacact	tiitcaaatat tgcctgocat agggagtgat	tatgaakxa·:: avcGttacvg ttgccocgga	atgaaactat gagagatggt tcaaaacgga	tgggaoaggt agctataaaa gattgaggec
5	131	ttgaagaacc	tgagacatca	gcatatatgt	caaotctacc	atgtgctaga	gaoagccaao
	241	aaaatattca	tggttcttga	gtactgccct	ggaggagagc	tgtttgacta	tataatttcc
	301	oaggatcgoc	tgtcagaaga	ggsgacoogg	gttgtcttcc	gtcagatagt	atctgctgtt
	3δ1	gcttatgogc	acagccaggg	a i. a ,.g c Lea c	agggacct.ca	agccagaaaa	cktgctgcct
	421	gatgaatatc	akaaattaaa	gctgattgac		gtgcaaaacc	caagggkaac
10	4S1	aaggataacc	at.ckacagac	atgctgtggg	agkctggcci:	atgcagcacc	r.gagttaaca
	541	caaggcaaat	catatctcgg	atcagaggca	gatgttcgga	gcatgggcac	actgtcatat
	601	gttcttacgt	gtggatttct	accattcgat	gacgataatg	taatggcttt	acacaagaag
	0S1	attatgagag	gaaaatatga	tgttcccaag	tgqctctctc	ccagtagcat	“ctgcttwrt
	“21	~ a c a a a t g c	tg<raggt.gga	0 C C <4 it ql O’ <3. <3 <i	cggatttcta	tgaaaaatct	attgaaccat
15	751	ccctggatca	tgcaagatta	caactatcct	g“tgagtggc	aaagcaagaa	rccttttart
	841	cacctcgatg	atgatxgcgt	aacagaaett	tctgtacatc	acagaaacaa	CcS.C'CJ Cei it :S1 C<3.
	$01	atggaggatt	taatttcact	glggcagtal	gatcacctca	cggctaccta	tct-tctgctt-
	Ml	ctagccaaga	aggctcgggg	aaaaccagtt	cgtttaaggc	tttctocttt	ctcctgtgga

1021	c-aagccagtg	ctacccxatt	cacagacalc	aagtttacca	agtactggac	agaatcaaat
1081	ggggtggaat	ctaaatcatt	aactecagcc	ttatgcagaa	a a c c t g c a aa	taaattaaag
1141	aacaaagaaa	a tgt at. a tac	“cctaagtct	getgtaaaga	atgaagagta	ctttatqttt
1201	cctgagccaa	agactccagt	taataagaac	cagcataaga	gagaaatact	cactacgcca
1201	aatcgttaca	ctacaccctc	aaaagetaga	aaccagtgcc	tgaaagaaac	tecaattaaa
1321	ataccagt.aa	actcaacagg	aacagac-aag	ttaatgacag	gtgtcaOlag	ccctgagagg
1381	cggogccgct	cagtggaatt	ggatctcaac	eaaqcacata	tggaggagac	tccaaaaaga
1441	aagggagcca	aagtgtttgg	gageettgaa	agggggttgg	ataaggttat	cactgtgctc
1001	atcaggagta	aaaggaaggg	ttctgccaga	gacgggccca	gaagactaaa	gcttcactat
1501	aacgtgaeta	caactagatt	agtgaatcca	gateaaetgt	tgaatgaaat	aatgtctatt
1021	c. c. i. cΊ· a aga	agcatgttga	ctttgtacaa	aagggttata	cackgaagtg	tcaaacacag
1081	teaqatttrg	ggaaagtgac	aatgcaattt	gaattagaag	tqtgceagct	tcaaaaaccc
1741	gatgtggtgg	gr.akcaggag	gcagcggctt	aagggcgaog	cctgggttta	caaaagatta
1801	gtggaagaca	tectatetag	ci-gcaaggi-a	taa

Human. MELK (isoform 2) Amino Acid Sequence (NP_00.124361.4.1)

1 mkdydellky yelbetlgtg grakvklisch ilogsanvalk la;dkni.lg.sd Iprikteiea iknlxhqhic qlyhvletan kifmvleycp ggelfdyiis qdrlseeetr vvfrqivsav

121 ayvhsqgyah rdlfcpenllf deyhklklid fglcakpkgn kdyhlqtccg alayaapeli

Xgl qgksylgsea dwsmgilly vhscgflpfd ddnvsialykk iitrgkydvpk wlspssilll

241 qqBilqvdpkk risntknllnh pwimqdynyp vewgskiip·..: hldddcvtel .svhhrnr.rqt

301 med.11 .slwqy dhltaty.il 1 lakkargkpv rlrlssfscg qasatpftdi kftkywtesn

301 gvesksltpa Icrtpanklk nkeavytpks avkneeyfmf pepktpvnka qhkreilttp

421 nryttpskar nqclketpik ipvnstgtdk latgvisper rcrsveldln qahmeetpkr

4S1 kgakvfgsla rgldkvitvl trskrkgsar dgprrlkihy nvtttrlvnp dqllneimsi

541 Ipkkhvdfvq kgytikcqtq sdfgkvtmqf elevcqlqkp dwgiirqrl kgdawvykxi

WO 2015/073509

PCT/US2014/065173

601 vedilssckv

Human MELK (isoform 3) cDNA Sequence (NM_00.1256687,1)

	1	atgaaagatt	atgatgaact	tctcaaatat	t atgaak t ;·.·;.	atgaaactak	tgggacaggt
5	61	ggctttgcaa	aggtcaaack	tgcctgccat	atccilacig	gagagatggt	agc-tataaaa
	121	atcatggata	aaaacacact	agggagtgak	ttgc-cccgga	teaaaaegga	gattgaggee
	181	ttgaagaacc	tgagacatca	gcatatatgt	. ... a a. c. u t a a a.	atgtgetaga	gacagccaac-
	241	aaaatattca	tggttcttga	ggaaaatttg	ergtttgarg	aatatcataa	attaaagetg
	301	atrgactttg	gtxtctgtgt	aaaactcaag	ggtaacaagg	attactatct	a c a g a c a t gc
10	oei	tgtgggagtc	tggcttatgc	ageaeetgag	ttaatacaag	gcaaatcata	tettggatea
	421	gaggcagatg	tttggagcat	gggcatactg	ttatargttc	tratgtgtgg	att&ctacca
	481	tttgatgatg	ataatgtaaa	ggctk ·:.;.: 1 ac	aagaagatta	tgagaggaaa	atatgatgtt
	561	cccaagtggc	.ctctcocag	tagcattctg	cttcttcaac	aaatgetgea	ggtggaccca
	601	aagaaacgga	tttctatgaa	aaatctat.tg	aaccatccct	ggatcatgca	agattacaac
15	661	tatcctgttg	agtggcaaag	caagaatcct	tttattcacc	tegatgatga	ttgcgtaaca
	721	gaactttctg	tacatcacag	aaacaacagg	caaacaatgg	aggatttaat	ttcactgtgg
	781	cisgt a g;; tc	ac<7 l ea egg	tacctauctt	cr.gcttct.ag	ccaagaaggc	iLoggggaaaa
	861	ccagktcgtt	taaggcattc	t’CCUttCtCC	tgtggacaag	ccagtgccac	cccatLcaca
	$81	gacatcaagt	caaataateg	gagteaggaa	gatgtgaeeg	caagagataa	aaattat.gag
20	981	gegggattaa	tagactatga	ttggtgtgaa	gatgatttat	caacaggtgc	tgctactccc
	1021		agtttaccaa	gtactggaca	gaatcaaatg	gggtggaatc	taaatcatta
	1861	ac’cccagccc	tatgcagaac	acetgeaaak	aaattaaaga	acaaagaaaa	tgtatatact
	1141	.' ·*.* - :: :: g'. .' ’. ...	ctgtaaagaa	tgaagagtac	tttatgtttc	ctgagccaaa	gactccagtt
	1281	<iataaga<icc	agcataagag	agaaauctc	La ege c aa	atcgcaacac	tocaccctca
25	1281	aaagotagaa	accagcgcct	77.777:77777	ccaaccaaaa	^LacGagtaaa	ttcaaoagga
	1321	acagacaagt	taargacagg	tgteaekage	cctgagaggc	ggtgeegctc	aglggaacrg
	1381	gapctcaacc	aagcacatat	ggaggagaca	ccaaaaagaa	agggagccaa	agt. m: ttggg
	1441	ageettgaaa	g^gggttgga	taaggttatc	aetgtgetea	ccaggage aa	aaggaagggt
	1501	tctgccagag	acgggcccag	aagaciaaag	cttcactata	acgtgactac	aactagatta
30	1561	g >.. ... ,:::7-:.. C :> .-	atcaactgtt	gaatgaaata	atgtetatte	ttccaaagaa	gcatgttgac
	1621	tttgtacaaa	agggttatac	aetgaagtgt	caaacacagt	cagattttgg	gaaagtgaca
	1601	at.gc«attt.g	aattagaagt	gtgccagctt	caaaaaoccg	axgtggtggg	tatcaggagg
	1741	cageggotta		ctgggtttac	aaaagattag	tggaagacat	cctatctagc
ϊ ς	1801	tgcaaggtat	a a
	Human MELK (isoform 3) Amino Acid Sequence (NP_00l243616.I)
	1	Kikdydellky	yelhetlgrg	gtakvrlach	iltgemvaik	iisdknalgsd	iprikteiea
	81	iknlrhqhic	qlyhvlefcan	kifmvleenl	Itdeydklkl	idlglcakpk	gnkdyhlqtc
	121	ogslayaaps	liggksylgs	e a dv wssTig 11	lyvlmcgf Ip	tdddn v«5aly	kkimrgkydv
40	181	pkwlspssil	llqqrslgvdp	kkx isn-knll	nhpvlrftqdya	ypvewqs knp	1ihldddcvt
	G 4 -L	eisvhhrnnr	gtmedlislw	qydhltatyi	lllakkargk	pvrlrlssfs	cgqasatpft
	301	dikannwle	dvtasdknyv	aglidydwce	ddlstgaatp	rtsqftkywt	esr.gvesksl
	361	tpaiertpan	klknkenvyt	pksavkneey	fmfpepktpv	nkisqhkrei 1	ttpnryttps
	421	karngclket	pikipynseg	cdkli&egvis	perrersvel	dlngatssseet	pkrkgakvfg

WO 2015/073509

PCT/US2014/065173

	431 Sil 601	siergldfcvi fvqkgytlkc ckv	tvltxskrkg qtgsdfgkvt	sardgprrlk rKqfelevcql	Ihynvtttxx qkpdvvgxxx·	vripdqllmi qx x kgdawvy	asilpkkhvg krlvedxlss
5	Human MELK (isoform 4) cDNA Sequence (1	MM 0012566	88.1)
	1	atgaaagatt	atgatgaact	tetcaaatat	' .;:.y	atgaaactat	tgggacsggt
	61	ggctttgcaa	aggtcaaact	tgcctgccat	atcettaetg	gagagatggt	agetataaaa
	SSI	atcatggata	aaaacacact	agggagtgat	ttgccccgga	teaaaaegga	gattgaggee
	131	·.<: <iq aae-e	tgagacatca	gcatatatgt	caactctacc	atgtgetaga	gac-agccaac.
10	241	aaaatatxca	tggt.tct.tga	gggtaacaag	gattaccatc	tacagacatg	etgtgggagt
	301	ctggcttatg	cagcacetga	gttaatacaa	ggcs.aa teat	atettggate;	agaggcagat
	361	gtttggagca	tgggcataci;	gttatatgtt	cvtatgtgtg	gatttetacc	ae.ttgatg«t
	421	gataatgtaa	tggctttata	caagaagatt	atgagaggaa	aatatgatgt	tcccaagtgg
	431	stctctccca	ertagcattct	gcttcttoaa	caaatgctgc	aggtggaccc	aaagaaaegg
15	Sil	atttctatga	aaaatctatt	gaaccatccc	tggatcatgc	aagattacaa	ctatcctgtt
	601	gagtggcaaa	gcaagaatcc	ttttattcac	ctcgatgatg	attgegtaac	agaaetttet
	661	gtacatcaca	gaaaeaacag	gcaaaeaatg	gaggatttaa	tttcaetgtg	geagtatgat
	21	cacckcacgg	otacc’catct	tcagcttcca	gccaagaagg	ttcggggaaa	at. cag t tege.
	781	ctaaggcett	CttCtttttC	etgtggaeaa	gaeagtgeaa	ccccaxtcac	agacatcaag
20	Sil	tcaaataatt	ggagtcagga	agatgtgacc	gcaagtgata	aaaattatgt	ggcgggatta
	331	atagactatg	attggtgtga	agatgattta	tcaacaggtg	ctgctactcc	ccgaacatca
	Ml	cagtttacca	agtactggac	agaatcaaat	ggggtggaat	ctaaatcatt	aactccagcc
	1021	ttatgcagaa	cacctgcaaa	taaattaaag	a a c a a a er a a a	atertatatac	tcctaagtct
	1081	gatgtaaaga	atgaagagca	etttacgttt	c c ag·- c a«	agacceeagt	caataagaae
25	llil	cagcataaga	gagaaaaact	ca.c kaegeta	aatcgataca		aaaagetaga
	1201	a-accagtgec	tgaaagaaac	tccaaataaa	aaaecagtaa	attcaacagg	aaeagacaag
	IMt	ttaatgacag	gtgtcaasag	ccctgagagg	cggtgccgct	tagtggaa ·: t	ggatcteaat
	1321	caagcacata	tggaggaerac	>..c aaa-ag <:	aaggg a gees	aagtgtttgg	gageettgaa
	1381	aqqgggttgq	ataaggttat	cactgtgctc	accaggagca	aaaggaaqgg	ttctgecaga
30	1441	gacgggccca	eraagactaaa	gcttcactat	aacgtgacta	caaertagatt.	agtgaatcca
	1S01	gatcaactgt	tgaatgaaat	aatgtctatt	cxtccaaaga	agcs.tgttga	ctttgtacaa
	1561	aagggttata	cactgaagtg	t.ca aacacag	tcaga tkttg	g q <: a a g t. g a o	aatgeaattt
	1621	gaattagaag	tgtgccagct·	tcaaagsccc	gat.gtggtgg	gtatcaggag	gcageggetr
35	1681 1741	aaqggcgatq	ectgggttta	caaaagatta	gtggaagaca	teetatetag	ctqcaaggta

Human MELK (isoform 4) Amino Acid Sequence (NPJXM 243617.1)

	1 iKkdydellky 61 xkrilrhghic	yeihetigtg gfafcvklach	iltgemvaik irodkntlgsd	iprikteiea gksylgsead
qlyhvlatan	kifisivlegnk	dyhlqtccgs	layaapeliq
40	121	vvrsrtgillyv	Isxcgf Ipfeki	davmalykki	rsrgkydvwkw	Ispssllllg	qmlgvdpkkr
	131	iaiskallahp	vrirsqdynypv	ewgsknpf itr	Idddcvtels	vtihrnnrqtK·	edlislwqyd
	241	hltatyilll	akkargkpvr	Ixlrssf segq	asatpftdik	-snnwsledvt	asdknyvagl
	301	idydwceddl	st gas. “pets	qf tkywtesn	gvesksltya	lertpanklk	nkesvytpks
	361	avknseyfssf	papktyvakn	qhkraixttp	axyttpskar	rsqclketpik	ipvxistgadk

WO 2015/073509

PCT/US2014/065173

421 Xmtgvisper rcxsveidln qahmeetpkr kgakvfgsle xgld.kvitvl trskrkgsaa

481 dgpxrlklhy nvtttrlvnp dqlXneimsi Ipkkhvdivg kgytlkcqtq sdfgkvtmgf

541 alevcqlqkp· dwgirrgrl kgdawvykrl vedilssckv

Human MELK (isoform 5) cDNA Sequence (NM 00I256689.1)

	1 61 lai 131	atgstg&act cpgatcaaaa taccatgtgc gagctgtttg	tctcaaatat cggagattaa tagagacagc actatataat	tatgaattaa ggccttgaag caacaaaata t“cccaggat	atgaaactat aacctgagac tocatggtoc cgcctgtcag	tgggacaaag atcagcatat ttgagtactg aagaggagac	tgattfcgcGC atgtcaactc c oct. g g a g g a ccgggttgtc
10	241	ttccgtcaga	tagtatctgc	tgttgcttat	gtgcacagec	agggctatgc	tcacagggaG
	301	c I. c a a g a a a g	aaaatt?;gct	gttkgatgas	tatca east	taaagetgak	tgacettggt.
	361	ctctgtgcaa	...?? aag:;..,;	taacaaggat	taGcatctaG	agacatgctg	tgggagtc eg
	421	gcttatgcag	cacctgagtt	aatacaaggc	aaateatatc	ttggatcaga	ggcagatgtt
	431	tggagcatgg	gcatacigtt	atetgttctt	atgtgtggat	ttctaccatt	tgatgatgat
15	541	aatgtaatgg	ctttatacaa	gaagattatg	agaggaaaat	atgatgttcc	caagtggctc
	601	tctcccagta	gcattctgct	tcttcaacaa	atgetgeagg	tggacccaaa	gaaaeggatt
	661	Oatatgaaaa	atekattgaa	ga'-.. c o g 1 g g	aeoatgeaag	attacaacta	aGGtgttgag
	21	tggcaaagca	agaatccttt	taatGaccta	gatgaagatt	gcgtaacaga	acttectgta
	761	catcaaagaa	acaaaaggaa	aacaaaggag	gatttaatet	cactgaggca	gkatgatcac
20	841	ctcacggcta	cctatcttct	gcttctagcc	aagaaggctc	ggggaaaacc	agttcgttta
	901	aggctttctt	ctttctcctg	tggacaagcc	agtgctaccc	cattcacaga	cat.caagtca
	Ml	aataattgga	gt.ctggaaga	tgtgaccgca	agtgataaaa	attatgtggc	gggattaata
	1021	gactatgatt	ggtgtgaaga	tgatttatca	acaggtgctg	ctactccccg	aacatcacag
	2061	kttaccaagt	acaggacaga	atcaaatggg		aatcaataac	CGGagCCtva
25	1242	tgcagaacac	ctgcaaaoaa	aaaaaagaaa	aaagaaaatg	ca kataee.ee	taageetget
	2201	gtaaagaatg	aagagtacaa	tatgtaOGCt	gagacaaaga	ctccagttaa	eaagaaccag
	1262	cataagagag	aaatacecac	tacgccaaat	cgttaoacta	c a c cc t c a a a	agceagaaac
	1321	cagtgcctga	aagaaactcc	aattaaaata	ccagtaaatt	caacaggaac	agacaagtta
	1321	atgacaggtg	tcattagccc·	tgagaggcgg	tgcogcr.cag	tggaattgga	tctcaaccaa
30	1441	gcacatatgg	aggagactcc	aaaaagaaag	ggagccaaag	tgtttgggag	ccttgaaagg
	1501	gggttggata	aggttatcac	tgtgctcacx	aggagcaaaa	ggaagggttc	tgccagagac
	1561	gggcccagaa	gactaaagct	tcactataac	gtgactacaa	caagattagfc	gaaeccagat.
	1621	caactaaaga	atgaaataac	gtctapkctt	'J '.2·® C? L?·	atgtegaett	egtacaaaag
	1631	agti.akaaaa	t.gaagtgt.C*	aacacagtca	gattttggga	aagtgacaat	gcaattt.gaa
35	2741	ktegaag kgt	gcaagcttaa	aaaacaagat	geggtgggea	tcaggaggca	goggettaag
	1801	gaegatgc:ct	gggtttacaa	aagattagtg	gaagacatcc	tatc-tagctg	caaggtataa

Human MELK (isofonn 5) Amino Acid Sequence (NP_OO.1243618.1)

	1	KissrsfsBiKiny	•sikl iggsdlc	rlkteiealk	nlahqhicql	yhvleeanki	fsavleycpgg
40	6 2	elfdyiisqd	riseeetrvv	frgivsavay	vhsqgyatrd	Ikpenllfde	yhklklidfg
	121	Icakpkgnkd	yhlgtccgsl	ayaapeliqg	ksyigseadv	wsmgilXyvl	mcgfIpfddd
	181	nvisalykkiis	rgkydvpkwl	spsrsilllqq	mXqvdpkkri	arftknl Irihpw	imqdynypve
	341	wgsknpfIhl	dddcvtelsv	hhrunrqttae	dlislwgydh	lt.aty.Ulla	kkargkpvrl
	301	rlssfsegqa	saepltdiks	nnwsledvta	sdkGvvagli	dydirceddls	egaatpx esq

WO 2015/073509

PCT/US2014/065173

	361	f r.kyatesng	veskslppal	crtpankikn	kenvytpkaa	vkaeeylmfp	epfctpvaknq
	421	hkxeilttpn	xyttpakarn	qclkepplki	pvastgtdkl	KsPgvispexx	crsveldlnq
	431	ahmeetpkrk	gakvf gsler	gldkvitvlt	rskrkgsard	gprrlkihyn	vtttrlvnpd
	341	gXlneimsil	pkkhvdfvqk	gytXkcqtqs	dfgkvtmgfs	levcqlqkpd	wgirrqr Ik
5	401	gdawvykrlv	ediissckv

Human MELK (isoform 6) cDNA Sequence (NM 001256690.1)

	1 61	atgatgaact ggagagctge	tetcaaatat ttgacxatat	tatgaattac aaettcccag	a“.gaaa~tat gategeetgi	tgggacagta cagaagagga	C t g c C c v g q a gacccgggtt
10	121	gtctteegtc	agatagtatc	tgctgr.-tqct	tatgtgcaca	gccagggcta	cqctcaeaqg
	131	gacctcaagc	cagaaaa ttt	gccgtttgaz	gaataxcata	a a r,t a sag ci.	gategaettt
	241	ggtctccgtg	caaaacccaa	gggtaacaag	ga:: t accacc	tacagacatg	ctgtgggagt
	301	etggattatg	cageacctga	gttaatacaa	ggcaaatcat	atertggate	agaggeagat
	361	gtttggagca	tgggcatact	gttatatgtt	cttatgtgtg	gatttctacc	atttgatgat
15	421	gataatgtaa	tggctttata	caagaagatt	atgagaggaa	aatatgatgt	tcccaagtgg
	431	cfccectccca	gtagcattct	gcttcttcaa	caaatgctgc	aggtggaccc	aaagaaaegg
	541	atttccatga	aaaatctacc	gaacca tccc	tggatcatgc	aagaccacaa	ctatcctgct
	401	gagcggcaaa	gcaagaatcc	tcctattcae	ctcgacgatg	aetgegtaao	agaaetttet
	6 61	gtacaccaca	gaaacaacag	gcaaacaatg	gaggattt.aa	tttcactgtg	gcagtat.gat
20	221	·' acctcacgg	ctacctatct	tevgetteta	gccaagaagg	cteggggaaa	accagtxcgt
	731	ttaaggctt.t		ctgtggacaa	gccagtgcta	ccccatt.cac	agacatcaag
	841	tcaaataatt	ggagtcCgga	agatgtgacc	gcaagtgata	aaaattatgi	ggcgggatta
	031	atagactatg	attggtgtga	agatgattta	tcaacaggtg	ctgctactcc	ccgaacatca
	$61	cagtt. caeca	agcactggac	agaat.caaat	ggggtggaat	ctaaaccatt	aactccagcc
25	1021	tt.acgcagaa	cacctgcaaa	t.aaattaaag	aacaaagaaa	acgtatacac	tcccaagtct
	1031	getgtaaaga	at.gaagagca	ctttacgttt	ccOgagccaa	agacccGagt	•caataagaac
	1141	cagcataaga	gagaaacact	cactacgcca	aatcgctaca	ccacaccccc	aaaagetaga
	1231	aaccagtgcc	tgaaagaaac	tccaattaaa	ataccagtaa	attcaacagg	aacagacaag
	1281	ttaatgacag	gtgtcaptag	ccctgagagg	cggtgccgct	cagt-ggaatt	ggatcfccaac
30	1321	caagcacata	tggaggagac	>..c aaa.a.g	aaggga gcca	aagtgtttgg	gageettgaa
	1381	agggggctgg	ataaggttat	cactgrgctc	accaggagca	aaaggaaggg	ttctgccaga
	14 41	gacgggccca	ga a	q c z t. cac va z	a a c q c q a c ¢. a	caactagaat	agtgaatcca
	1301	gateaaetgt	tgaatgaaac	aatgtotatt	catccaaaga	ageaegt-tga	cte.tgtacaa
	1881	aagggetata	cactgaagtg	tcaaacacag	tcagalxttg	ggaaagtgac	aatgcaattt
35	1621	gaattagaag	tgegee ;: :	tcaaaaaccc	gatgtggtgg	gtat.caggag	gcagcggcct
	1681	aagggcgat ·.;	cctgggttta	caaaagatta	gtggaagaca	tcctatctag	etgeaaggta

141 taa

Human MELK (isoform 6) Amino Acid Sequence (NPJXH243619..1)

40	1	8 sriliany	mkllqqycpg	gelfdyiisq	drlseeetrv	vfxqivsava	yvhsggyahr
	61	dikpenlifd	eyhklklief	glcakpkgnk	dyhlqtccgrs	layaapeliq	gksyIgsead
	121	vwsmgillyv	liacgflpfdd	dnvmalykki	’crgkg3vg-;w	lapssiillq	sgmlqvdpkkr
	131	istaknllnhp	wiffigdynypv	ewqsknpfib	idddevfcels	vbh xnnxqran	a di 1sIwqyd
	241	hltatyilli	akkargkpvx	Irlssfscgq	asatpftdik	snawsledvt	aadknyvagl

WO 2015/073509

PCT/US2014/065173

	301	idydwceddl	stgaatprts	qrikywtesn	gvesksltpa	lertpanklk	nkenvytpks
	381	avkneeyfrsf	pepktpvskn	qhkrellttp	nxyttpskar	sqclketpik	ipvnstgtdk
	321	1 ,mtg vis per	rcrsveldln	qahmeetpkr	kgakvfgsle	rgldkvitvl	trskrkgsar
	431	cigprrlklhy	nvtttrlvnp	dq.:.i.neimsi	Ipkkhvdfvq	kgytlkcqtq	ed f gkvtiaqf
5	531	elevcql.qkp	dvvgirrqr.l	kgdawvykr1	vedilssckv

Human MELK (isoform 7) cDNA Sequence (NM 001256691 ..1)

	1 »1	atgatgaact cggatcaaaa	toteaaatat cggagattga	tatgaattac ggccttgaag	atgaaaetat aacttgagac	tgggacagag atcageatai	tgatttgeoc atgtcaactc.
10	121	“accs“q“gc	tagagacagc	caacaaaata	trcatggtrc	ttgaggaaaa	“ “ ttgct az ~ t
	131	gsrgaatstc	ctaaair.saa	gctgattgac	tttggcctct	g?;gcaasacc	caagggtaac
	241	aaggattacc	atctacagac	atgetgtggg	agtctggctt	atgoagcacc	tgagiiaata
	ltd	eaaggcaaat	eatatctfcgg	atcagaggca	gatgtttgga	gcatgggcac	actgttatat
	361	gttcttatgt	gtggatttct	accatttgat	gatgaraatg	taatggetti	atacaagaag
15	421	attatgagag	gaaaatatga	tgttcccaag	tggct ·. tsic	e eagt «gear.	tetgettett
	331	caacaaatgc	tgeaggtgga	cccaaagaaa	cggatttcta	tgaaaaatci	attgaaceat
	541	CGCtygaloa	tgcaagatta	G-aactalGct	gttgagtgge	aaagcaagaa	tcciiCtatt
	602	caccccgatg	atgategogt	aacagaactt	tctgtaaate	acagaascaa	caggoaaaca
	6 61	atggaggatt	taatttcact	gtggcagtat	gateacetca	eggs«accta	tcticigctt
20	221	ctagacaaga	aggctcgqgg	aaaaccagtt	cgtttaaggc	tttcttcttt	ctcctgtgga
	731	caagccagtg	ctaccccatt	oacagacatc	aagtcaaata	atiggagtei	ggaagatgtg
	831	accgcaagtg	ataaaaatta	tgtggc-ggga	ttaatagact	al.gaiiggl.g	tgaagatgat
	931	ttatcaacag	gtgctgctae	tccccgaaca	teasagitta	ccaagtactg	gacagaatea
	$61	aatggggtgg	aa^ctaaatc	ittaactcca		gaacacetgc	aaaiaaatta
25	1022	aagaacaaag	aaaatgtata	tactectaag	teigetgtaa	agaatgaaga	gisetttaig
	1031	ittcetgagc	esaagactss	«gttsalaag	sassages·:, a	agagaqaaat	actcactacg
	1131	ecaaatcgte	«cactacjcc	otcaaaagct	agaaaceagt	geetgaaaga	aaccccaatt
	1301	aaaataccag	taaattcaae	aggaaeagac	aagttaatga	caggtgtcai	tagccctgag
	1281	agqeggtgcc	gcicagl.gga	attggatctc	aaccaagcac	atatggagga	gactccaaaa
30	1321	<4 Cl CtCj C; i; <5A-i	ccaaagrgtt	tgggagcctt	gaaagggggt	tggataaggi	tatcactgtg
	1381	ctcaccagga	gcaaaaggaa	gggttctgec	agagaeggge	ecagaagact	aaagcttcac
	1432	tsraacgtga	ο t. a c a a c t a g	attagtgaa	CC i<3 :✓ x.'·>:ϊ ci C	tgtigaatga	aataatgtct
	1501	attcttosaa	ssaagcatsr.	tgactttgta	caaaagggtt	aiatactgaa	gtgtcaaaca
	1581	cagtcagatt	ttgggaaagt	gacaaigcaa	tttgaattag	aagtgtgcca	gettcaaaaa
35	1621	cacgaegtgg	tpqgtatcaq	gaggcagcgg	cttaagggcg	aigcctgggi	alacsassya
	1681	ttagtggaag	aeatcctatc	tagctgcaag	gtataa

Human MELK (isofonn 7) Amino Acid Sequence (NP_00.1243620.1)

	1	ismnf sniKinv	•sikllgqsdlp	rikteieaik	nlrhqhicql	vhvletanki	fKivlesnllf
40	61	deyhklklid	fglcakpkgri	kdy'hlqictg	slaysape21	qgksylgsea	dvwsmgilly
	121	vimcgfIpfd	ddnvmalykk	iHirgkydvpk	wlrspssilll	qq>«lqvdpkk	riemknllnh
	181	pwirsqdynyp	vewgsknpfi	hldddcvtel	svhhrnnrqt	iKsdlislwqy	dhltatyl11
	331	Iskkargkpv	rlrissfseg	qasatpftdi	ksmwsledv	tasdknyvaq	lidydwcedd
	301	Istgastpri	sqftkywtes	ngvssksltp	alertpanki	knkenvytpk	Sovkneeyf®

WO 2015/073509

PCT/US2014/065173

	361 421 431	fpepktpvnk rrcxsveldl ynvtttrlvn	nghkreiltt pnryttpska raqclketpi	kipvastgtd Itrskrkgsa qsdfgkvtrsq	kimtgviape xdgpxrlklh felevcqlqk
nqahmeetpk pdqllrseiiKa	rkgakvfgal ilpkkhvdfv	exgldkvitv qkgytIkcqt
c	541	pdvvgirrqr	Ikgdawvykr	lved.1Issck	V
ft	Hunu	m MELK (isoform 8) cDNA Sequence (NM„0012566$	>2.1)
	1	atggttctk.g	aggaaaattt	gctgtttgat	gaatatcata	aattaaagct	gatlgacttt
	61	ggtcteagtg	£ <5. <3 c: C C £ <1 <3	gggtaacaag	gattaccatc	tacagacatg	cagtgggagt
	121	ctggcttatg		gccaatacaa	ggcaaatcat	accttggacc	agaggcagat
10	161	gtttggagca	tgggcatacr.-	gttatatgtt	ccaatgtgcg	gatttctacc	atttgatgat
	341	•gacaatgtaa	tggcttsata	caagaagar ?;	atgagaggaa	<3 a 6-a <. ga -, q 0	tcccaagtgg
	301	ctctctccca	gtagcattct	gcttcctcaa	caaatgctgc	aggtggaccc	aaagaaacgg
	361	atttctatga	aaaatctatt	g a a c c a t c c c	rggatcatgc	aagattacaa	ctatcctgtt
	421	gagtggcaaa	gcaagaatcc	ttttattcac	ctcgatgatg	attgcgtaac	agaactttct
15	461	gtacatcaca	gaaacaacag	gcaaacaatg	gaggatttaa	tttcactgtg	gcagtatgat
	541	cacctcacgg	ctacctatct	tctgcttcta	gccaagaagg	ctcggggaaa	accagttcgt
	601	ataaggcktt	ctaoPttc’cc	ctgtggacaa	gacagtgcva	ccccavtcac	agacatcaag
	661	tcaaataafc	ggagtcagga	agakqtgacc	qcaagrgata	aaaattaag 6	ggcgggatta
	721	atagaana kg	at.aggtgtga	agatgattta	caacaggvg	ctgccactcc	acgaacatca
20	721	cagr.r.tacca	agtactggac	agaatcaaat	ggggtgqaat	ctaaatcatt	aactccagcc
	341	ttatgcagaa	cacctgcaaa	taaattaaag	a a c a a a g a a a	atgtatatac	tcctaagtct
	901	gctgtaaaga	atgaagagta	ctttatgttt	cctgagcc-aa	agactcxagt	taataagaac
	961	cag cat aaga	gagaaatact	cactacgc-ca	aatcgttaca	ctacaccctc	aaaagctaga
	1021	aaccagngac	tgaaagaaac	tccaaalaaa	avaacagt.aa	attcaacagg	aacagacaag
25	1031	tt.aakgacag	gtgtcaatag	agagg	cggt.gcaqct	aagtggaaak	ggatckcaac
	1141	aaagcacata	tggaggagac	tccaaaaaga	aagggagcaa	a agt.gr.t t gg	gagcctt.gaa
	1201	agggggttgg	«taaggttat	cackgtgcnc	accaggagca	aaaggaaggg	ttctgccaga
	1261	gacgggccc-a	gaagactaaa	gcttcactat	aacgtgacta	caactagatt	agtgaatcca
	1321	gatcaactgt	tgaatgaaag	aatgtctatt	c-ttccaaaga	agcatgttga	ctttgtacaa
30	1331	aagggttata	cactgaagtg	tcaaacac-ag	tcagattttg	ggaaagtgac	aatgcaattt
	1441	gaattagaag	tgtgccagct	tcaaaaaccx	gatgtggtgg	gtatcaggag	gcagcggctt
	1501	aagggcgatg	cctgggstta	caaaagat.a	gtggaagaca	ccctatccag	ctgcaaggta
	1561	taa
35	Human MELK (isoform 8) Amino Acid Sequence (NP 001243621,1)
	1	tnvieenllf d	eyhklkiidf	glcakykgnk	dyhlgaccgs	layaapeliq	gksylgsead
	61	vws.ngillyv	liiicgflpfdd	dnvisialykki	KsrgkydvpkK	Ispssilllg	qwlqvdpkkr
	121	IsKiknllnhp	winiqdynypv	ewqsknpfid	Idddcvfcels	vhbsnnrqtsn	edlislwqyd
	161	hltatyllli	akkargkpvx	irlssfaegg	asatpftdik	snnwsledvt	asdknyvagl
40	241	idydwcaddl	stgaatprts	qitkywtesn	gvesksltpa	lort.pa.nklk	nkenvytpks
	301	avkneeyfmf	pepktpvnkn	qhkreiittp	r.ryttpskar	ngclkefcpik	ipvnstgtdk
	361	Imtgvisper	rcrsveldln	gahmeet ρ k r	kgakvfgale	rgldkvitvl	trskrkgsar
	421	dgprrlklhy	nvtttrivnp	dglIneimsi	Ipkkhvdfvq	kgytlkcgtg	sdfgkvtmgf
	481	elavcqlqkp	dvvgirrgx1	kgdawykrl	vedilssckv

WO 2015/073509

PCT/US2014/065173

Human MELK (isoform 9) cDNA Sequence (NM_001256693.1)

	1 61 121	atggqcatao atcggcctkat agtagcatte	tgttatatgt acaagaagat tgcttettca	:·.at gtgt tatgagagga aeaaatgctg	ggatttctac aaatatgaag c.aggtggacc	catttgatga ttccoaagtg caaagaaaog	tgataakgta gctctctccc gatttctatg
5	181	aaaaatctat	tgaaccatcc	ctggatcatg	caagattaca	actatcctgt	tgagtggcaa
	241	agcaagaatc	ctxttattca	cctcgatgat	gattgegtaa	cagaactttc	tgtacatcac
	301	ag a a a c a a c a	ggcaaacaat	ggaggattta	atttcactgt	y. i' ·;	tcacctcacg
	361	«CtaCCCatC	ttctgcttcc	agccaagaag	goteggggaa	a a<- c aq u i. c g	tktaaggett
	421	-a.	cctgtggaca	agocagtgct.	accccalkca	cagacatcaa	gtcasataat
10	4S1	tggagcctgg	aagatgtgao	cgcaagtgat	aaaaattaag	tggcgggatt	aatagaccat
	541	gattggtgtg	aagatgattt	atcaacaggt	gctgctactc	c e. c g a a. c a x. c	acagtttauc
	601	aagtactgga	cagaatcaaa	•t-mgy λ	tctaaatcat	taactccagc	ettatgeaga
	561	a c a c a t g c a a	at«aattaa«	gaacaaagaa	aatgtatata	ctoctaagto	tgctgtaaag
	“21	aa“g«agag“	actttatgtt	tcctgagcca	aagactccag	ttaataagaa	c a a q c a t a ag
15	751	agagaaatac	tcactacgcc	aaatcgttac	actacacect	caaaagctag	aaaccagtgc
	841	ctgaaagaaa	ctccaattaa	aataccagta	aattcaacag	gaacagacaa	gttaatgaca
	$01	ggtgtcatt.a	gccctgagag	g ugg v eg u	tcagtggaat	tggatctcaa	ccaagcacat
	$£1	atggaggaga	ctccaaaaag	aaagggagcc	aaagtgtttg	ggagccttga	aagggggttg
	1021	gataaggtt.a	tcactgtgct	caccaggagc	aaaaggaagg	gttctgccag	agacgggccc
20	1051	agaagactaa	agctteacta	taacgtgact	acaactagat	tagtgaatcc	agatcaactg
	1141	ttgaatgaaa	taatgtctat	tctrxxaaag	aagcargttg	actttgtaca	aaagggttat
	1201	acactgaagt	g - c a a a c ac a	gtcagatttt	gggaaagtga	caatgcaatt	tgaattagaa
	1381	gtgtgccage	ttcaaaaacc	cgatgtggtg	ggtatcagga	ggcagcggct	taagggegat
0 5	1321	gcctgggttt	acaaaagatt	agtggaagac	atcc-tatcta	getgeaaggt	at a a
	Human MELK (isoform 9) Amino Acid Sequence (NP 001243622.1)
	1	®gi 1 lyvlttc	g f.lpf dddsi v	taa lykk.irarg	kydvpkwlsp	ssilllgqpl	qvdpkkrlstii
	61	knllnhpwiis	qdynypvewg	sknpfihldg	dcvtslsvhh	rnnrqtmedl	islwgydhlt
	121	atylillakk	axgkpvxirl	ssfseggasa	tpftdiksnn	wsledvtasd	knyvaglldy
30	131	dwceddlstg	aatpxtsqft	kywtessgve	sksitpalex	tpaiiklknke	nvytpksavk
	241	neeyfmfpep	kxpvnknqbk	reiittpnxy	ttpskaxeqc	Iketpiklpv	nstgtdkln-t
	301	gvisperrcr	avaldloqah	meetpkrkga	kvfgel&rgl	dkvltvltrs	krkgsardgp
	261	rrlklhynvt	ttrlvnpdql	IneimsiIpk	khvdfvqkgy	t.:.kcqt<jsdf	gkvtmqfela
35	421	vcqlqkpdvv	girrqrIkgd	awykrlved	ilssckv

Mouse MELK cDNA Sequence (NM_010790.2)

	1 61 121	atgaaagatt ggctttgcaa atcatggata	atgacgaact aygt a aaa.v u agaatgeget	cctcaaatac ggcctgucat Oggagtg.e.	tatgaactat gtcctcactg ttgccccgag	atgaaaegat gagagatggt teaaaaetga	tgggacagqt agetataaaa gategatgeg
40	161	etgaagagte	tgagaoatca	gcacatatgt	cagctciacc	atgtgctgga	gacaaagaac
	341	aaaatattea	tggttctgga	gtactgtcca	ggaggagagc	tgtttgacta	cataatctcc
	301	caggatcgcc	tgteggaaga	ggagacccgg	gtcgtctfccc	gtcagatact	gtctgcagtt
	361	gegtatgtec	acagccaggg	e“at.gc~eae	agggacctca	aaccagaaaa	tttart-attt
	421	gatgaaaatc	ataagetaaa	gctgattgac	txtggtctxt	gtgcaaaacc	caagggcaac
45	461	aaggactacc	atctgcagac	gtgctgtggg	a g u t t tg c ~ t	atgcagctcc	tgaactaata

WO 2015/073509

PCT/US2014/065173

541	caagggaagt	cgtaccttgg	atcagaggca	gatgtttgga	gcstgggcat	cctcc-tgtat
¢01	gtgctcatgt	gt.ggattt.ct	accat-ttgat	gatgataatg		gtacaagaag
561	ataatgagag	ggaaataega	agttcctaag	tggctctctc	ClSQ'v SlL< Οδ G	tctgcttctc
221	cagcagatgt	tgcaggtgg»	cccaasgaaa	eggattteta	tgaga«atct	cctgaaccat
“51	cectgggtea	tgcaagatta	cagctgtccc	gtggagtggc	a. <s a<3C aaga c	tcctttgact
S41	cacctegatg	aggattgegt.	gacagagctt	tctgtacatc	s. c e cf g <s c? c ζ·	caggcagaca
501	atggaggafc	eaatVcogtx·	g-cggcagtac	gatcacctca	c a ci c c 5. c c l- s	cc va '...g ex. v
$61	ct-agccaaga	aggcccgggg	g a a g1_- C; g c u	cgtc-tacagc	tcctgtcctt	ct.cttgtgga
1021	accgccagca	ccactccaaa	gtcaaagaat	ctgagcctgg	aagatatgag	cacaagtgat
1061	gataaetgt-g	tggctggatt	gatagact-at	gaattgtgtg	aagataaatt	atr.agctccc
1141	aagacgccac:	aggttac.e.a«	acacttggca	gaatcaaatc	acgcagcatc	t a a .¾ t c a c c a
1201	gcgccagggg	tacgcagagc	agtggcaaat	aaattaatgg	acaaagaaaa	tgtgtgcact
1261	cecaagcctt;	ctgtgaagaa	tgaagagcag	tetgtattet	etgageegaa	gattccagct
1321	agtaagaacc	agtataagag	agaaatacce		ccogtttcco	aacaectgca
1361	aaagetagag	cceagtgccc	gagagaagee	ccg^ttagaa	caccagggaa	tCGcgcagga
1441	gcagacacac	t.aacgacagg	tgtoattagc	C <- <-· Q 3 £? c[ a.	ggtgeegetc	ggacgtg
1501	gatctcaacc	aggcacacat	ggaggatacc	c cgs s « aaga	aaggaaccaa	tgtgtttggg
1501	ageettgaga	gaggaetgga	taaggttctc	aetgegetea	c si a c? G « £t ¢: 3. a	gaagaagggc
1521	tctgccagag	atggaccaag	aaagegaaag	ctgcactaca	atgtgactac	aactcgcctg
1561	gtgaaccccg	ace;agctcc?L	gagegaaate	a aggctatac	ttscaaagaa	gaacgtggac
1741	ttegCacaga	aaggtaacac	tecaaagtgc	eaaacgcagt	ccgatttxgg	caaagegaca
1S01	atgcagct.tg	aaalggaagt	gtgccagctg	cagagacctg	.'. ' ':'.. *? ’' Λ g	·..:<· eggaga
1331	cageggetga	agggtgatgc	c-cgggtttac	aagagaktag	•eggaagavac	cttgcctggc
1S21	tgcaagatgt	ga
Mouse MELK Amino Acid Sequence (NP034920.2)
1	Hikdydeilky	yelyetagtg	gfakvklach	vltgerfivaik	irndknalgsd	Iprvkteida
61	Iksirhqhie	qlyhvletkn	ki fnwleycp	ggelxdylit	qdtieaaate	vvfrgi. leav
121	ayvhsqgyah	rdlkpenll f	denhklklid	f glcakpkgr»	kdyhlgtccg	slayaapal1
151	ggk.sylgsaa	dvwttiigilly	vlxacgf ipf d	ddnvtaslykk	ixargkyevpk	wispsstill
241	qqs<2qvdpkk	risinsmllBb	pwv itgay a cy	veyqsktylt-	hldedcvtel	svhhrssxqt
301	iiiedlisswgy	dhltatylll	lakkaegkpa	vigilsIseg	tasttpksku	Isledmstsd
361	drscvaglidy	elcedkllap	ktpqvtkhla	eanhaasksp	apgvrxavaa	klmdke-xvc.t
421	pkasvkneaq	fvfsapkipv	skngykreip	asptrfptpa	karaqclrea	pvrtpgnsag
461	adtlttgvis	parrcrsmdv	dlngahntedt	pkkkgtKvfg	slergldkvl	taitrakkkg
541	sardcprkrk	Ihynvtttr1	vnpdqllsei	Kiailpkknvd	fvqkgytlkc	qtqsdfgkvt
301	•«qf elsvcql	qrpdwcgirr	qxIkgdawvy	krlvedilag	c»

Human eIF4B cDNA Sequence (NM 001417.4)

1	at g g c g g c c t.	cagcaaaaas	gaagaataag	aaggggaaga	ctatctccct	aacagacttt
31	etggetgagg	atgggggCac	tggeggagga	csgcacckcstg	tcCGcaaacc	agtcagatgg
121	getgatgaaa	cggatgaccr..	ggaaggagat	gtttcgacct	cttggcacag	caacgatgac
131	qavg kgtata	gggcgcct.ee	aackgaccgt	tccacccttc	ccactgctee	aegggotget
241	cgcp'jaaccc· a	atafeogaeeg	gageegfeott	C- .- C C> C- t c.y c	caccctacac	tgcttttcta
301	ggaaacctac	cctatgatgt	tacagaagag	tcaattaagg	aattctttcg	aggattaaat

WO 2015/073509

PCT/US2014/065173

	361 421 431 541	atcagtgcag tgcgtxtacc acgtgaaccc	agcaatccag cteagtgccg gctgatcaag gatstctgacs	agaggttgaa tgagtetcaa C ei-C ctQ-gA ci £ aaaoaejatae	aggttttggt tgaagagxct agacsgggat agaetggagg
tatgctgaat ctaggtaaca gatcgttett	ttgaggacct ggattccctg ggagaattcg agtggacgt~
ttggccgtga	tagaaategg
5	«01	gctegtcctg	ct st c a. g <ϊ ca g	ttr.-tgatgae	tacccaccta	gaagaggtga	tgatagcttt
	661	ggagacaagt	ategagateg	ttatgattca	gaccggtatc	gggatgggta	tcgggatggg
	21	tatcgggatg	gcccacgccg	ggatatggat	cgataxggtg	geoggga-eeg	cta’cgatgac
	'tol	cgaggcagc-a	gagac-tatga	tagaggetat	gattcccgga	Oaggcagkgg	cagaagagca
	S41	tttggcagtg	ggXatcgcag	ggat.gatgac	tacagaggag	'.''•kOjX'a'a	ctatgaagac
10	$01	cgatatgaca	gacgggatga	teggtegtgg	agctccagag	axgattactc	tegggatgat
	$S1	tataggegtg	atgstagagg	tccaccccaa	.> g a v-... a a	tgaatetaaa	gcctcggagt
	1021	actectaagg	aagatgattc	ctetgetagt	acetcecagt	ccactegage	tgettetate
	1061	tttggagggg	caaagcctga	tgacaoagct	geSagagaas	gagaagtaga	agaaeggeta
	1141	cagaaggaaa	aagagaagtt	gcagcgtcag	tggaxga ger	xaaaacrxaga	acgaeqgccrt
15	1201	cgggagagac	acecaagctg	gegaagtgaa	gaaactcagg	aacgggaacg	gtcegaggaea
	12S1	ggaaptgagt	catcacaaac	tggpacctcr;	accacatcta	gcagasatgc.	acgaaqgaga
	1321	gagagtgaga	agtct.ctaga	aaatgaaaca	ctcaatsagg	a ger a a gat ter	ccacxctcca
	1301	setteessac	ctcccaaaec	tgatcsgccc	ctsaaggtas	tg11 agcc11	tercattaaag
	1441	gagaatgctt	gggtgaagcg	aagttctaac	cctcccgctc	gatctcagag	ctcagscaca
20	1501	gagcagesgt	cccctacaaj	tggtggggga	aasgtagete	er a g c x. c a a er a	a tertgaggaa
	1501	ggaecaggaa	ggaaagaeg a	aaataaagca	gatgggatga	atgcccrcaaa	aggccaaact
	1521	gggaaaxcta	geegtggtee	aggagaegga	gggaacagag	acreraxaggaa	ggagteragat
	1031	aggaaagatg	geaaaaagga	tcaagactce	agatctgcac	ctgagccaaa	gaaaeetgag
	1741	gaaaatccag	cttccaagtt	cagttctgca	agcaagtatg	ctgctctctc	tgttgatggt
25	1S01	gaagatgaaa	atgagggaga	agattatgee	gastag
	Human eIF4B Arnim) Acid Sequence (NP 001408.2)
	1	maasskkknk	kgktisltdf	iaedggtggg	styvskpvaw	aeletddlegd	v.-sttwhsndd
	SI	dvyxappidx	silptapxaa	xapnidrsxl	pksppytail	gnxpydvtee	sikef Ixglis
30	121	iaavrlprep	sr.perlkgfg	yaefedidsl	laaislnees	Ignrxlxvdv	adqagdkdi'd
	101	drafgrdrnx	dsdktdtdwr	axpatdsfdd	ypprxgddaf	gdkyrdrydx	dryxdgyrdg
	241	yxdgprrrdtftd	ryggrdrydd	xgsrdydxgy	dsrigsgrra	xg sex yrs: ddd	yrgggdryad
	301	rydrxrddrsw	ssrddysrdd	yrrddxgppg	xpklnlkpxs	tykes rids gas·	csqstxraasi
	3S1	fggakpvdta	akereveerl	qkeqeklqxq	Idepklexrp	xexhpsaxse	etqexeksrt
35	421	gssssgagts	ttssrnarxx	eseksleust	Inkaedchsp	tskppkpdqp	Ikvrsyapppk
	421	enawvkrssa	pparsqsadt	: ·.;·.! apts ggg	kvapagpsee	gpqxkdaakv	dgrrsaapkggt
	541	gnssrgpgdg	gsrdhwkesd	rkdgkkdqds	csapepkkpa	enpaskfssa	skyaalsvdg
	601	edenegedya	e
40	Mouse eIF4B cDNA Sequence (NM 145625.3)
	1	atggcggcct	cagcaaasaa	ga agaataag	aaggggsaga	ccstctccct	aacggscttt
	01	ctagctgsgg	atggaggaac	tggtggagga	agcacrctatg	tccccaaacc	agtcagctgg
	121	getgstgaaa	cagaegatct	ggaaggagar.	gtgteaacaa	ettqgcatag	taaegatgat
	101	gacgtgxaca	gggcgccti.re	aattgaccgt	tccatccttc	c er: x c e. q c t er er	aegggetget

WO 2015/073509

PCT/US2014/065173

	241 361 361	cgggaaccc-«t atattgaccg gagccgtctv	U <2C-ci ciki <· U -'-'C- U ciUU?’2 ’-·<? -ci v uccattaagg attxctttag	tgctttdcta aggattaaat aggtttcgga tgaagagtet
gggaatctgc at.cagcgct.g eacgcagaat	octatgatgt tacgcttacc ttgagga act.	gacagaagag acgggaaccc ggattcectg
agcsatccag cteagtgate	acaggttgaa tgagtctcaa
5	431	~ t a ej g 1. a. a o a	ggagaa t teg	tgtggatgt t	gctgatcaag	cacaggataa	agaeagggat
	541	qaccgttctt	ttgqtcgaga	tagaaatcgg	gattetgaea	aaacagaerac	agaetggagg
	601	gcccgtccca	ccacagacag	tvitgatgao	tacccaccta	gaagaggtga	tgatagcttx
	661	ggagacaagt	atcgagatcg	ttacgatt-ca	gaccggtato	gggatgggta	tagggaegga
	721	tatcgggacg	gcccacgoag	agacatggac	cgctatgggg	geegggateg	ctatgatgac
10	751	cgaggcagc-a	gagac-tatga	c-cgaggct-at	gactccagga	taggcagtgg	cagaagggca
	841	tttggaagtg	ggtaccggag	a gat gat gar.	taeragaggag	gtggggaccg	etatgas.gac
	521	egctatgaca	gacgggatga	tcggt~gtgg	agetecaggg	atgactaatc	tegggatgat
	$61	tataggergtg	atgacagagg	tccccerccag	agacccagac	tgaacstcaa	gcctcgaagc
	1022	gc-ccctaagg	aggat.gacgc	cteegccage	a cc t £ c C3 g -:	eeagccggga	• . r - *? r'...
15	2021	tttggagggg	cgaagcctgc	tgacaeagct	getagggaaa	gagaagtaga	ggageggeta
	1141	eragaaggsigt:	aggagaagct	gcagcgtcag	etggatgage	caaaactags	ccgccggccc
	1221	cgggagagac	acccaagctg	gcgaagtgaa	gaaactcagg	aaagagaacer	gtcaaggaca
	1261	ggaagtgagt	catcgcagac	tggggcetca	gccacatater	g ''..a.ga a at. a ?	aegaaggaeja
	1321	gagagtgaga	agtct.ctaga	aaatgaaacc	ctcaataa.ag	a a era a gas ter	tcactctcrca
20	2381	.·: . * *.' ·:: * ' .; .	c t. c c. t a a ac c	tgaccagcct	c ta aagg t.a a	c. g a c a g c: er er a	tccaccaasg
	1442	gagaatgcg-c	gggtgaagcg	aagetctaae	cctccagccc	gacetcagag	ctcagacaca
	2521	gagcagccgt	cccctacaag	tggtggaggg	aaagtageeg	c a g t £ ca g er ?:	eectgaggaa
	IS £2	ggaccatcaa	gaaaagacgg	aaacaaagtg	gatgeggtgg	gtgccacaaa	aggcaaagert
	1621	ggaagctgca	gccgt ggtc: ·.	cggggatgga	gggagcagag	accactggaa	ggacttggat
25	1682	aggaaggatg	gcaaaaaaga	tcaagactcc	agatetgege	ttgagccaaa	gaaacctgag
	1741	Cf <3 C;:« S C C C <3 C.·	cctctaagtt	cagctctgca	agcaagtacg	ctgctcrgtc	tgtggatggc
	2521	gaggatgagg	atgagggcga	cgactgcact.	gagtag
	Mouse eIF4B Amino Acid Seqnc	race (NP 663600.2)
30	1	maasakkknk	kgktisltdf	iaedggtggg	styvpkpvaw	adetddiegd	v.-sttwhsndd
	61	dvyrappidr	slxptapraa	rapni dr·. r 1	pksppytafX	gnlpydvtad	sikdffrgln
	122	Isavrrlprep	sp.pdr Ikgfg	yaefedldsl	Isalslates	Igiirrirvdv	adgaqeskdrd
	261	drsfgxdrnr	dsdktdtdwr	arpttdsadd	yppxrgddal	gdkyxdryds	drytdgyrdg
	242	yrdgpxrdffid	xyggrdxydd	rgsrdydrgy	dsrlgsgrra	fgsgyrrddd	yrgggdryad
35	321	rydrrddrsw	ssrddysrdd	yrrddrgppg	rprinlkprs	apkeddasas	csqssraasi
	361	fggakpvdta	axereveeri	gkeqeklgrg	Idepkldtrp	rerkpsiersg	etgexeisrt
	421	gsessgtgas	atsgrntrrr	esekslenet	Inkeedchsp	“skppkpdqp	IkvKpapppk
	481	:;·· e.-: .e a sa	pparsqssdt	eqpsptsggg	kvaavqppee	gpsrkdgnkv	dvvgatqgqa
	541	gscsrgpgdg	qerdhwkdld	rkdgkkdgds	csapepkkpe	enpaskfssa	rkyaalsvdg
40	621	ededegddct	a
	Monkey el'F4B c'DNA Sequence	(NMJ.MH 195808.1)
	i.	£ vC “CC	atggcggcct	0 <3 A.J O it <>	gaagaataag	asggggaaga	ctatctocct
	61		ctggctgagg		tggtggagga	ageraeatatg	attccaaaec

WO 2015/073509

PCT/US2014/065173

	id 1 8ΐ a /4 :. 301	agtcageegg taatgacgac ac.gggct.gcx r,gcttxt.cta	getgatgaaa gatgtgtaca cgggaaccca gggaacctac	cggatgacct gggcgcctee atategaeeg cctatgatgt	ggaaggagat aattgaccgt gageegtett. gacagaagaa	gtttcaacaa tecatcettc cccaaatcgc tcaattaagg	egtggcaeag ccactgctce K.acc <.-1 ?;·.-ac aattcttxag
5	381	aggattaaai	atcagtgcag	tgcgtttaec	a c g t q a a c c c	agcaatccag	ageggttgae
	421	aggttitggt	tar.gctgaa r.	ttgaggacct	ggattccctg	et ~e.gi.gcc~	igagt ci.eaa
	481	tgaagagtee	claeg'. aaca	ggagaatteg	sgtggacgtt	getgateaag	caeaggataa
	541	agacagggat	gategttett	ttggccgtga	tagaaategg	gattctgaca	aaacagatac-
	60 ΐ	agaetggagg	getegteetg	ctacagacag	etttgatgae	tacccaccta	gaagaggtga
10	861	tgatagettt	ggagacaagt	ategagateg	ttatgattca	gaceggtatc	gggatgggta
	721	tcgggatggc	ccacgceggg	atatggateg	atatggtggc	egggateget	at gadget? eg
	~81	aggcagcaga	gaetatgata	gaggetatga	ttcccggata	ggcagtggca	gaagagcatt
	S41	kggcagtggg	taacgcaggg	atgatgacta	eagaggaggc	ggggaccgat	atgaagaeeg
	201	atacgacaga	egggavgate	ggeegtegag	cteeagagat	gaitacteec	gegaegatta
15	$61	iaggegegat	gacagaggvc	cccetcaaag	aeccaaaevg	aatevaaage	ei.cggagx.ac
	1021	tcei.aaggaa	gatgattact	ctgciagtac	ctcctagtce	agtcgagetg	..·: t
	1081	tggaggggca	aagcctgttg	acacagct.gc	tagagaaaga	gaagtagaag	aacggctaca
	1141	gaaggaacaa	gagaagttgc	ag~gtc?.gct	ggatgageca	aaacxagaac	gacggccxcg
	1201	ggagagacac	ccaagctgge	ga agtgaaga	aact.caggaa	cgggaacggt	cgaggacagg
20	1201	aagtgag ica	v a a c a g a e t g	gga~e?Lccgc	eacatctggc	agaaatgcac	gaaggagaga
	1321	gagagagaag	ictetagaaa	avgaaacaec	caataaggag	gaagattgac	acteeccaae
	1301	itctaaacct	cecaaacevg	atcagcccct	aaaggtaavg	ccageccctc	eaccaaagga
	Itei	gaaegettgg	gtgaagcgaa	gccctaaccc	tccagctcga	vctcagagct	cagacacaga
	1501	gcagcaat.cc	cctacaagtg	gtgggggaaa	agtagctcca	gctcaaccat	etgaggaagg
25	1SS1	accagcaagg	aaagatgaaa	ataaagtaga	tgggatgaat	gtcccaaaag	gccaaactgg
	1521	gacctctagc	cgtggaccag	gagaeggagg	gaacaaagac	cactggaagg	agt.cagatag
	1801	gaaaga ?;ggc	aaaaaggatc	aagae?;ccag	atctgcaeck	gagecaaaga	aacctg/sgga
	1741	aaaaccagev	icgaageica	gveetgeaag	caagvatgct	gcictcteeg	ttgaeggtga
	1501	agatgaaaac	gagggagaag	attatgeega	acagacctci.	acatectgtg	eittcteeea
30	1801	gtvactctee	accetggaac	avaegagage	aaateaaaae	eactateeag	aeaagacaaa
	1921	ataaaactca	ccatctcctg	aagacctt.tc	ttacctttt.	ttaaaaacaa	aaaatgaaat
	1281	t attetgc at	getgetgeag	ccti.taaagt	attaaagtaa	etggagaate	gccaatatag
	2041.	ceagagagaa	«gggaeiaca	gcr.xttt.aga	ggaagagttg	iggtgtgits
35	Monkey eIF4B Amino Acid Sequence (NPJ)OI 182737.1)
	1	naasakkknK	kgktlsltdf	laedggtggg	styvskpvsw	adeiddlegd	vsttwhsndd
	81	dvyrappidr	silptapraa	repr» idrsr 1	pksppytafl	gelpydviee	si .kef f xg.:.n
	121	isavrlprep	snperlkgfg	yasfedldal	isalslnees	Ignxrirvdv	adqaqdkdrd
	101	drsfgrdrnr	dsdktdtdwr	arpatdsfdd	ypprrgddssf	gdkyrdryds	dryrdgyrdg
40	241	p r s: d ttid r y g g	x dryddvgsr	dydxgydsrl	gsgrraigsg	yrrdddyrgg	g d r y a d r y d r
	301	rddxswssrd	dysrddyrxg	dxgppqrpkl	«ikpxstpke	ddssastaqs	sraasifgga
	361	kpvdtaarer	aveerlgkeg	eklqxgxdsp	klexrprarh	pswxseetq®	xeasrtgses
	421	sgtgosatsg	xrsarrxesek	sleneti r.ke	edch.spt.skp	pkpdgplkvm	papppkenaw
	431	vkrssnppar	sgsadteggs	pisgggkvap	aqpseegpar	kdeukvdgrs.n	vpkggtgtas

WO 2015/073509

PCT/US2014/065173 ·

xgp^dggnm hwKesarxag kkaqdsxsap epttpeeapa sxisaaskya sgadyaa atsvogegen elF4BcDNA Sequence (NM_OO1O35O28.2) atggcggcct ctggetgagg geagatgaaa gatgtgtatc cgggaaccca gggaacetgc stcagtgcag tattjcagagt ctaggraaca gatcattrctr. <i c c c gc c t g ggagacaagt taccgtgatg cgaggtggca ttcggtagcg agaPatgaca Paeaggcggg acPcctaagg tt-cggagggg '*·<> kj Cl <4 ' g C; <>. <>.<,· cgggagagac ggaagpgagt gagagtgaga acttcPaage gagaaagctP gagcagcagt ggatccagcaa gggagctcca aggasagatg gaaaatccag •gaagstgaaa

O ct Of O <0 <1 <i ·:; -2,0. atggagggac cagaegatct gggcacatea atategaeeg cctat.gatgt t.gcgtttacc ttgaggacct ggagaatteg ttggcegaga ctgcagacag ategagateg gcccacgccg gag?.ctat.g« ggtaccggag gaegagat,ga atgatagagg aagatgaPact caaagcccgt aggagaaact acccaagctg catcacagac agtePPPaga ctcccaaacc gggtgaageg cccctacaag ggaaagatga gccgtggt.cc gcaaaaagga ectcgaagtt atgagggaga gaagaat.aag tggt.ggaggc ggaaggggat aaPtgaccgP gageegtett gacagaagac gcgt.gaaccc ggattccttg agtggacgPt tagaaatega ePPPgatgac ttaegattea ggacat.ggat cagaggctac ggatgatgae ccggtectgg tccccctcaa c P c c ct ct tag c Pgacacagtt gcagcgtcag gegaagtgaa tgggacctca aaatgaaacc Pgaacagcet aagtt.ctr.aac tggrggaggg aaataaagta gggagatggg t. c a c g a a t. c ct cagatctgca ttacacegaa aaggggaaga agcacctatg gtttcaacca tccatcctgc cccaaatetc PccatPaagg a g c a a r. c c t g ctcagtgcct gctgatcaag gaPtetgaca Pacccgccea gacagatatc cgataegggg gattccagg?. tacagaggag agttccagag ci : :ί C '0 CO ci ci cl vaectcccagt gctagagaac cPggatgagc gsaactcagg gccacatctg eecaataaag ePaaaggtaa t ct Leet, g ‘t ret aaagaagtPc gat.ggggtga gggaactaaag agatctgcac agcaagtacg tag etatctcect Pcceeaaacc c-ttggca-cag ccactgctcc caccctacac aattcPttag agaggttaaa tgagcctcaa cacaggaPaa aaacagarac gaaggggpga gtgatgggta geegagateg taggcagtgg gcggggaceg a teg a * ·.··: ;.*.-**. rgaacctaaa ccacttctgpgc gagaagtaga caaaactaga aacgggaacg gcagaaatgc aggaagacPg rgccagccctc gatcrctagag pagcPcaactr. gtgctccaaa a a c a c- c, g g a etgagccaaa ctactctcgc aacagacPPt agtcagetgg taargatgat aegggetget. tgcttttcPa aggaPtaaat aggttttggt egaagagtet agacagggat agaettggagg eg aPageaat tcgggacagt ctatgatgac ca.gaagagca ctatgaagac tegggatgat gccactggagt agccPctaac agageggeta acgaeggcct stcgaggsca aaga a gaaga t ct a g p c t. ct ct a tccaccaaag etcagacacta aPetgaggaa aggccaaagt ggaggcagac gaaagetgaa. cattgaeggt eIF4B Amino Acid Sequence (NP 001030200. Γ) maasakkkr.k kgktialtdf iaedggtggg styvpkpvsw adet.ddiegd d^yrappidr silptapraa repisidrsrl. pksppytafl galyydvtad isavrlprep snperlkgfg yaefsdidsl Isalslaaea Igarritvdv drsfgxdrnx dsdktdtdwr axpaadsfdd ypprxgddsf gdkyrdryds yrdgpxxdscd ryggtdrydd tggrdydtgy dsrigsgrra tgsgyxtddd rydxxddrsw ssrddysxdd yxxddrgppq xpklnlkprs tpkeddsaas fggakpvdta arereveerl gkegeklgrg idepklerrp rerhpswrse vsttwhsndd sxkeffrgln adqaqdkdrd dryxdgyxds yrgggdxyed tsxpssxaasi etqerer.'srt

WO 2015/073509

PCT/US2014/065173

	421 401 541	gseseqtgts eaawvkrssn gsssrgpgdg	atsgxnarxx ppatsqssdt gakdtwkead	esekslenet eggsptsggg rkdgkkdhds	pnkeedegap kwpaqlsss rsapepkkae	t skppkpeqp gsaxkdenkv enpaakfrsa	Ikvispapppk dgvaapkgqs skyatlaidg
5	401	edenegdyte
	Rat e!F4B cDNA Sequence (NM 001008324.1)
	1	atggcggcct	cagcaaaaaa	gaagaataag	aaggggaaga	ccatctccct	aacagacttt
	01	ctagctgagg	atgggggaa c	tggtggagga	agcaactatg	tccoeaaacc	agtcagetgg
	121	gctgatgaaa	cagacgatct	ggaaggagat	gtgtcaacaa	cttggcatag	taacgatgac
10	101	gatgtgtaca	g gg c a c c t c c	tattgaccgt	tccatccttc	acactgctcc	aegggetget
	241	C i) i} G /1U C C <3	at tga teg	gageegtett	c c c a ag t. c a c	caccctacac	tecta
	301	gggaatctgc	ectatgatge	gacagaagac	tetattaagg	atttcottag	ageattaaat
	302	atcagcgctg	taegettgee	gtgtgagctc	agcaatccag	acaggttgaa	aggttttggc
	421	tatgccgaat	ttgaggatet	ggattctctg	ctcagtgctc	tgagtetcaa	tgaagagtet
15	401	ctaggtaaca	ggagaatteg	ggtggatgtt	gctgatcaag	cacaggataa	agacagggat
	541	gaccgttctt	ttggtcgaga	tagaaategg	gattctgaca	agacagacac	agaetggagg
	601	a g a c gc a t g	ccacagacag	ctttgatgac	CacccKcea	gaegaggtga	egacageeta
	561	ggagacaagt	ategagateg	teaegagtea	gaccggtatc	gggatgggta	tagggacgga
	721	tatcgggaag	gcccacgcag	agacasggac	cgctatgggg	geegggateg	ctatgatgaa
20	231	cgaggeagca	gagactatga	ccgaggctat	gactccagga	taggcagtgg	cagaagagca
	341	tttggaagtg	ggtaccggag	ggatgacgac	tacagaggag	gtggggaccg	ctatgaagat
	901	cgctatgaca	gaegggaega	teggteatgg	agctccaggg	acgattactc	tegggaegat
	961	tacaggagtg	atgacagagg	tcccccccaa	agacccaaac	tgaatetaaa	gcctcggagt
	2021	actcctaaag	aagatgattc	g c c e g stag c	acGtcccagt	; . ; egage	ggettstate
25	1032	ttaggagggg	egaageetgt	tgacacagcs	getagagaaa	gagaagtaga	ggagcgecta
	2141	cagaaggagc	aggagaaget	gcagcg taag	•reggatgago	caaaactaga	ccgccggccc
	1201	cgggagagac	acccaagttg	gegaagtgaa	gaaactcagg	aaagagaacg	gtcgaeeaca
	2261	ggaagtgagt	catcgcagae	tgggaectca	gccacatctg	gcagaaatac	aegaaggaga
	1321	gagagtgaga	agtetetaga	aaatgaaacc	c-tcaataaag	aagaagactg	tsactctssa
30	2331	acctctaagc	ctcctaaacc	fcgaccagcct	ctaaaggtaa	tgccagcccc	tccaccaaag
	1441	gagaatgcgt	gggtgaagcg	aagctctaac	cctcctgctc	gatctcagag	ctcagacaca
	1502	gagcagccgt	C- c c c v a. c a a g	tggtggaggg	aaagttgctc	cagctcagcc	ctctgaggaa
	1561	ggaccatcaa	ggaaagatga	aactaaagtg	gatggggtga	gcaccaccaa	aggccagact.
	1621	ggacactcca	gcsgtggtcc;	tggggatgga	gggttg ^^gag	accactggaa	ggagttggat
35	1601	aggaaggaeg	gcaaaaaaga	tcaagactcc	agatctgcac	ctgagccaaa	gaaatetgag
	1741	gagaaecgag	cctctaagtt	caytxetgea	agcaagtacg	etgetetgte	tgtgqacggt
	1801	gaggatgagg	atgagggaga	egactgcact	gagtag

Rat eIF4B Amino Acid Sequence (NPjiO l.008325.1)

40	1	maasakkkr.k	kgktisltdf	laedggtggg	styvpkpvsw	adetddlegd	vsttwhsndd
	61	dvyrappidr	silptapraa	repaidrsr1	pkrsppytaf 1.	gnlpydvted	cikdffrgln
	121	isavrlprep	snpdrlkgfg	yaefedldsl	isalslnees	IgnrrIrvdv	adqaqdkdrd
	101	drsfgrdrnr	dsdktdtdwr	arpatdsfdd	ypprrgdctef	gdkyrdryes	dryrdgyrdg
	241	y rdgpx x chad	ryggrdeydd	rgsrdydrgy	dsrigsgtra	;gsgyxrddd	yrgggdryed

WO 2015/073509

PCT/US2014/065173

- 35 3V1 xyarraaxsw ssxaaysraa yrrdd.xgppg. rpkxnxKpxs tpKeaassas tsqssraasx

3£1 fggakpvdta axereveerl qkeqeklqxq idepkldxrp xexhpswxse etqexexsrt

421 gsessqtgts atsgrntrrr esekslenet Inkeedchsp tskppkpdqp ikvmpapppk

481 eoawvkrssa pparsqssdt eqpsptsggg kvapaqpsee gpsxkdetkv dgvsttkgqt

541 ghssrgpgdg gsrdhwkeld xkdgkkdqds xsapepkks® enraskfssa skyaalsvdg

661 ededegddct e

Human Histone H3.1 Amino Acid Sequence (NP 003520.1) martkqtark stggkapxkq latkaarkaa patggvkkph ryxpgtvalx eirryqkste liirklpi'qr ivxeietqdfk tdlrfqssav malqeaceay ivglfedtnl caihakrvti

121 ffipKdiQlarr irgera

Mouse Histone HU Amino Acid Sequence (NPJ138578.2):

isiaxakqtaxk stcggkaprkq lackaaxksa patggvkkph ryrpgtvalr eixxyqkst® llii'klpfqr Ivxe Laqdfk kdlrfqssav i&aiqcaceay Ivglxsdtnl c«xhakxvri

121 ttspkdiqlax-x irgex-a

Human Histone H3.2 Amino Acid Sequence (NP 001005464.1);

martkqtaxk stggkapxkq latkaaxksa patggvkkph ryrpgtvslr eixryqkste £1 llixklpfqx· ivreiaqdSk tdlxfqssav malqeaseay Ivgifedtnl caihakxvPi 121 mpk-diglarr irgara

Mouse Histone H3.2 Amino Acid Sequence (NP 835587.1.):

martkquark stggkapxkq latkaarksa parggvkkcr; ryrpgtvalr girryqksrc

SI llirklpfqr Ivralagdrk tdirfqssav malqeaseay laglkadan1 cadhakrvtl

121 mpkdiqlaxr irgexa

Human Histone H3.3 Amino Acid Sequence (NPji02098.1):

maxtkqtark stggkapxkq latkaarkaa pstggvkkph xyxpgtvalx sirxyqkste llirklpfqr Ivreiaqdfk tdlrfqsaai galqeaseay ivglfedtnl caihakrvti 121 jRpkdiqlarx ixgara

Mouse Histone H3.3 Amino Acid Sequence (NP 032237,1):

martkgtaxk stggkaprkq latkaarkaa yatggvkkph ryrygtvalr ei.rrygkate illrklpfqr Ivreiaqdxk tclxxgaaal gaiqeaseay Ivglfedtnl caihakxvci

121 isipkdiqlaxx irgexa

Nucleic acid and protein molecules (ag., those of .MELK, eIF4B, and orthologs thereof across species) that differ due to degeneracy of the genetic code or due to encoding or having “non-essential” “conservative”, “stereoisomers”, or “unconventional” amino acids that do not appreciably alter the enzymatic (g.g., kinase) and/or elF4B Ser-406regulatory ability of MELK are included within the scope of the invention. A “conservative amino acid substitution ’ is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Stereoisomers (e.g., 'D-ami.no acids) of the twenty'

WO 2015/073509

PCT/US2014/065173

-36 · conventional amino acids, unnatural amino acids such as alpha,alpha-dlsubsututed amino acids, N-alkyl amino acids, lactic acid, and other unconventional amino acids may also be suitable components for polypeptides described herein. There is a known and definite correspondence between the amino acid sequence of a particular protein and the nucleotide sequences that can code for the protein, as defined by the genetic code (shown below). Likewise, there is a known and definite correspondence between the nucleotide sequence of a particular nucleic acid and the amino acid sequence encoded by that nucleic acid, as defined by the genetic code.

GENETIC CODE

Alanine {Ala, A)		GCA,	GCC,	Gee,	OCT
Arginine (Arg, R)		AbA ,	a.Ce,	CGA,	CGC,	cgg,	CGT
Asparagine {Axn, N)		AAC,	AAT
Aspartic acid (Asp,	D)	GAG,	GAT
Cysteine (Cys, C)		TGC,	TGT
Glutamic acid (Glu,	E)	GAA,	gag
Glutamine (Gin, Q)		CAR,	GAG
Glycine (Gly, G)		GGA,	GGC,	ggg ,	GGT
Histidine (His, H)		CAC,	CAT
Isoleucine (lie, I)		ATA,	ATC,	ATT
Leucine {Leu, L)		CTA,	CYC,	CTG,	CTT,	TTA,	TT'G
Lysine (Lys, K)		AAA,	AAG
Methionine {Met, M)		ATG
Phenylalanine (the,	e;	TTC,	TTT
Proline (Pro, P)		CCA,	CCC,	CCG,	CCT
Serine (Ser, S)		AG (J-,	AGT,	TCA,	TCC,	TCG,	TCT
Threonine (Thr, T)		ACA,	ACC,	ACG,	ACT
Tryptophan (Trp, W)		TGC
Tyrosine (Tyr, Y)		TA.C,	TAT
Valine (Vai, V)		GT A,	GTC,	GTG,	GTT
Texminat ion signal	(end)	ΤΑΆ,	T Aw,	TGA

An important and well known feature of the genetic code is its redundancy, whereby, for most of the amino acids used to make proteins, more than one coding nucleotide triplet may be employed (for example, illustrated above). 'Therefore, a number

WO 2015/073509

PCT/US2014/065173 of different nucleotide sequences may code for a given amino acid sequence. Such nucleotide sequences are considered functionally equivalent since they result in the produc tion of the same amino acid sequence in all organisms (although certain organisms may translate some sequences more efficiently than they do others). Moreover, occasionally, a methylated variant of a purine or pyrimidine may be found in a given nucleotide sequence. Such methylations do not affect the coding relationship between the trinucleotide codon and the corresponding amino acid.. In addition, a skilled artisan will understand how to mutate nucleotides of a specific codon so as to specifically alter an encoded amino acid based on the relevant codon chart. Additional desired nucleic acid and/or amino acid modifications can be engineered using site-directed mutagenesis and PCR-mediated mutagenesis techniques.

The “nucleic acid” can take any of a number of forms (e.g., DNA, mRNA, cDNA) that encode a biomarker described herein. For example, such biomarker nucleic acid molecules include DNA (e.g., genomic DNA and cDNA) comprising the entire or a partial sequence of a desired gene or the complement or hy bridizing fragment of such a sequence. The biomarker nucleic acid molecules also include RNA comprising the entire or a partial sequence of a desired gene or the complement of such a sequence, wherein all thymidine residues are replaced with uridine residues. A “transcribed polynucleotide” is a polynucleotide (e.g., an RNA, a cDNA, or an analog of one of an RNA or cDNA) which is complementary to or homologous with all or a portion of a mature RNA made by transcription of a biomarker of the present in vention, at least in part, and norma! posttranscriptional processing (e.g., splicing), if any, of the transcript, and reverse transcription of the transcript.

The terms “homology” or “identity,” as used interchangeably herein, refer to sequence similarity between two polynucleotide sequences or between two polypeptide sequences, with identity being a more strict comparison. The phrases ‘percent, identity or homology” and “% identity or homology” refer to the percentage of sequence similarity found in a comparison of two or more polynucleotide sequences or two or more polypeptide sequences. Two or more sequences can be anywhere from 0-100% similar, or any integer value there between. Identity or similarity can be determined by comparing a position in each sequence that, may be aligned for purposes of comparison. When a position in the compared sequence is occupied bv the same nucleotide base or amino acid, then the molecules are identical at that position. A degree of similarity or identity between

WO 2015/073509

PCT/US2014/065173

-3.8 · polynucleotide sequences is a function of the number of identical or matching nucleotides at positions shared by the polynucleotide sequences. A degree of identity of polypeptide sequences is a function of the number of identical amino acids at positions shared by the polypeptide sequences. A degree of homology or similarity of polypeptide sequences is a function of the number of amino acids at positions shared by the polypeptide sequences. The term “substantial homology” refers to homology of at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or more (e.g„ about 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more). In one embodiment, biomarker nucleic acid molecules encode a protein or portion thereof which includes an amino acid sequence which is sufficiently homologous to an amino acid sequence described herein such that the protein or portion thereof maintains, for example, the ability to phosphorylate eIF4B, to phosphorylate Histone H3, and/or the ability to be phosphorylated by MELK,

The comparison of sequences and determination of percent homology between two sequences can be accomplished using a mathematical algorithm. The alignment can be performed using the Clustal Method, Multiple alignment parameters include GAP Penalty ^::: 10, Gap Length Penalty ^::: 10. For DNA alignments, the pairwise alignment parameters can be Htuple~2. Gap penalty-S, Windowed, and Diagonal savedM. For protein alignments, the painvise alignment parameters can be K tuple-1, Gap pena.lty-3, Window-5, and Diagonals Saved-5. Similarly, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch (./, Mo/. Biol. (48):444-453 (1970)) algorithm which has been incorporated into the GAP program in the GCG software package (available online), using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14,12, 10,8, 6, or 4 and a length weight of 1, 2, 3,4,5, or 6. In yet another embodiment, the percent identity' between two nucleotide sequences is determined using the GAP program in the GCG software package (available online), using a NWSgapd.na.CMP matrix and a gap weight of 40, 50,60, 70, or 80 and a length weight of 1,2, 3,4, 5, or 6. In another embodiment, the percent identity between two amino acid or nucleotide sequences is determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4:11-17(1989)) which has been incorporated into the ALIGN program (version 2.0) (available online), using a ΡΑΜΙ20 weight residue table, a gap length penalty of 12 and a gap penalty of 4.

WO 2015/073509

PCT/US2014/065173

-39Methods for the production of nucleic acids (e.g., MELK, eIF4B, and/or mRNAs translated from nucleic acids having structured 5’ regions are known in the art and include standard hybridization, PCR, and/or synthetic nucleic acid techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.

A “biomarker protein” is a protein encoded by or corresponding to a biomarker of the present invention. The terms “protein.” and “polypeptide” are used interchangeably herein. In one embodiment, the protein is at. least 50%, 60%, 70%, 80%, 90%, and 95% or more tug., 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99,9% or more) homologous to the entire amino acid sequence of a MELK and/or eIF4'B and/or Histone H3 protein described herein. In addition, biologically active portions of MELK and/or el.F4B and/or Histone H3 proteins described herein are included which have at least. 50%, 60%, 70%, 80%, 90%, and 95% or more (e.g., 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more) homology to a fragment of a MELK. and/or eIF4B and/or Histone H3 protein described herein, e.g., a domain or motif, and that is capable of phosphorylating e!F4B, phosphorylating Histone H3, or being phosphorylated by MELK. Typically, biologically active portions (peptides, e.g., peptides which are, for example, 5, 10, 15, 20. 30, 35, 36, 37, 38, 39, 40, 50, 100, 150, 200.250, 300, 350, 400, 450, or more amino acids in length) comprise a domain or motif, e.g., a MELK kinase domain, e!F4B domain encompassing an amino acid residue phosphorylatable by MELK such as a MELK-mediated phosphorylation substrate motif having an arginine at -3 amino acid residue positions relative to serine/threomne (e.g., Ser406 or Ser422 of human eIF4B), or Histone H3 domain encompassing an amino acid residue phosphorylaiable by MELK such as a human Histone H3 region comprising SerlO. Moreover, other biologically active portions, in which other regions of the protein are deleted, can be prepared by recombinant techniques and evaluated for one or more of the activities described herein.

Methods for the production of proteins (e.g., MELK and/or eIF4B and/or Histone H3) arc known in the art and include e.g;, the expression of the protein in appropriate cells starting from a cDNA or the production by subsequent addition of amino acids to a starting amino acid (see Current Protocols, John Wiley & Sons, Inc., New York). Furthermore, methods for the production of protein fragments are known in the art and include t he cleavage of the protein with appropriate proteases or the generation of nucleic acid

WO 2015/073509

PCT/US2014/065173

- 40 · fragments encoding the protein fragments and subsequent expression of the fragments in appropriate cells. Methods for the production of mutated proteins, e.g., by exchanging and/or deleting one or more amino acids, are known in the art.

B. Diagnostic Methods

Methods are provided for identifying agents, such as small molecules and antibodies, which inhibit oncogenic and/or kinase activity of human MELK or an ortholog thereof, comprising: a) contacting a sample comprising i) human MELK or an ortholog thereof and ii) human eukaryotic initiation factor 4B (eIF4B) or an ortholog thereof, with the agent.; and b) determining the ability of the agent to inhibit Ser-406 phosphorylation of human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B, wherein decreased phosphorylation identifies an agent which inhibits kinase or oncogenic activity of human MELK or the ortholog thereof Similarly, methods are provided for identifying agents, such as small molecules and antibodies, which inhibit oncogenic and/or kinase activity of human MELK or an ortholog thereof, comprising: a) contacting a sample comprising i) human MELK or an ortholog thereof and ii) human Histone H3 or an ortholog thereof, w ith the agent; and b) determining the ability of the agent to inhibit Thr*3 phosphorylation and/or Ser-1.0 phosphorylation and/or Tlw-11 phosphorylation of human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone M3, wherein decreased phosphorylation identifies an agent which inhibits kinase or oncogenic activity of human MELK or the ortholog thereof These methods are also referred to herein as drug screening assays and typically include the step of screening a candidate/iest compound or agent for the ability to interact with (eg., bind to) a MELK and/or eIF4B and/or Histone H3 protein, io modulate the phosphorylation of e.IF4B by MELK.. to modulate the interaction of a phosphorylatable residue of eiF4B w ith a MELK-mediated intracellular signaling target, to modulate the phosphorylation of Histone H3 by MELK, and/or to modulate the interaction of a phosphorylatable residue of Histone H3 with a MELK-mediated intracellular signaling target. Test compounds or agents which have one or more of these abilities can be used as drugs to treat disorders characterized by aberrant, abnormal, and/or unwanted MELK and/or eIF4B and/or Histone Π3 nucleic acid expression and/or protein activity, such as cancer. Candidate/tesr compounds include, for example, small organic and inorganic molecules (e.g., molecules obtained from combinatorial and natural product libraries). Similarly, antibody agents that, for example

WO 2015/073509

PCT/US2014/065173 bind to MELK in a manner that modulates phosphorylation of a residue by MELK, modulates el.F4B activity normally driven by MELK-mediated phosphorylation, and/or modulates Histone H3 activity normally driven by MELK-mediated phosphorylation, can be useful agents. The skilled artisan can also readily make other modulatory agents, such as aptamers, antisense RNA, siRNA, that are capable of interacting with MELK nucleic acids and/or proteins to affect MELK-mediated phosphorylation of eIF4B or Histone H3 (see. at least Chung et ai. (2012) 3:1629-1640; WO 2013/109388; WO 2012/016082; WO 2013/045539; each of which is incorporated herein in its entirety by this reference.

The term “sample, “tissue sample,” “subject sample;’ “subject cell or tissue sample or “specimen” each refer to a collection of similar ceils obtained from a tissue of a subject or subject either as in vitro (e.g., cultured), ex w'w, or tn v/vo (e.g., isolated primary cells) samples. The source of the tissue sample may be solid tissue as from a fresh, frozen and/or preserved organ, tissue sample, biopsy, or aspirate; blood or any blood constituents; bodily fluids such as whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow, amniotic fluid, peritoneal fluid or interstitial fluid; or cells from any time in gestation or development of the subject. The tissue sample may contain compounds that are not naturally intermixed with the tissue in nature such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics or the like. The sample may further comprise cancer cells, such as ovarian, lung, breast, and multiple myeloma cancer cells or any cancer in which MELK and/or eIF4B and/or Histone H3 is amplified or overexpressed, has an activating mutation, or is activated by other kinases.

The terms “subject.” and “patient” are used interchangeably. As used herein, the terms “subject” and “subjects” refer to an animal, e.g., a mammal including a non-primaie (e.g, a cow, pig, horse, donkey, goat, camel, cat, dog, guinea pig, rat, mouse, sheep) and a primate (e.g, a monkey, such as a cynomolgous monkey, gorilla, chimpanzee and a human).

The term “inhibit” refers to a statistically significant decrease in a metric of interest, such as the reduction of Thr-3 phosphorylated. and/or Ser- IO-phosphorylated. and/or Thr-11 phosphorylated Histone H3, Ser-406-phosphorylated el'F4B, MELK enzymatic activity (e.g, kinase activity), cancer progression, and the like. Such statistically significant decrease can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%. or more relative to a control, For example, a test compound administered and analyzed according to the methods described herein can comprise a bona fide inhibitor of MELK enzymatic

WO 2015/073509

PCT/US2014/065173 activity (e.g., kinase activity) by decreasing Ser-406-phosphorylated e.lF4B amounts, Thr-3 phosphorylated Histone H3 amounts, Ser-10-phosphorylated Histone H3 amounts, and/or Ifir-11-phosphorylated Histone H3 amounts by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more relative to that of no MELK ligand administration or over a given amount of time. In one embodiment, the term “MELK inhibitor” is a substance, such as a small molecule, antibody, antisense nucleic acid, small interfering nucleic acid, which in terferes with the phosphorylation of human. C.IF4B a t Ser-406 or at a corresponding phosphorylation site in an eIF4'B ortholog thereof, the phosphorylation of human Histone H3 at Thr-3 or at a corresponding phosphorylation site in a Histone H3 ortholog thereof, the phosphorylation of human Histone H3 at Ser-10 or at a corresponding phosphorylation site in a Histone H3 ortholog thereof, and/or the phosphorylation of human Histone H.3 at Thr11 or at a corresponding phosphorylation site in a Histone H3 ortholog thereof. Exemplary MELK inhibitors are well known in the art, such as OTSSP167, siomycin A, thiostrepton, and anti-MELK antibodies are disclosed, for example, m Chung et al (2012) Oncotarget 3:1629-1640; WO 2013/045539; WO 2013/109388; and WO 2012/016082; each of which is incorporated in its entirety herein by this reference.

The term “altered amount” of a biomarker or “altered le vel” of a biomarker refers to increased or decreased expression, modification, and/or activity of a biomarker of the present invention, at least in part in a sample as compared to that in a control sample.

The amount of a biomarker in a subject is “significantly” higher or lower than the normal amount of a biomarker, if the amount, of the biomarkcr is greater or less, respectively, than the normal level by an amount greater than the standard error of the assay employed to assess amount, or at least two, three, four, five, ten or more times that amount. Alternatively, the amount of the biomarker in the sub ject can be considered “significantly” higher or lower than the normal amount if the amount is at least about two, at least about three, at least about four, or at least about five times, higher or lower, respectively, than the normal amount of the biomarker te.g., in a control sample or the average expression level of the biomarkers of the present invention in several control samples).

“Likely to,” as used herein, refers to an increased probability, that an item, object, thing or person will occur such as at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 1.80%, 190%, 200%, or more (or any range inclusive). Thus, in one embodiment, an agent that is likely to inhibit MELK-mediated phosphorylation of

WO 2015/073509

PCT/US2014/065173 el'F4B has an increased probability of inhibiting Ser-406 phosphorylation of human eIF4B or a corresponding phosphorylatable amino acid in an ortholog of human eIF4B. In another embodiment, an agent that is likely to inhibit MELK-mediated phosphorylation of Histone H3 has an increased probability of inhibiting Thr-3 phosphorylation, Ser-10 phosphorylation, and/or Thr-1.1 phosphorylation of human Histone H3, or a corresponding phosphorylatable amino acid in an ortholog of human Histone H3.

Test compounds of the present invention, at least in pan, can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the 'one-bead one-compound’ library method; and synthetic library’· methods using affinity chromatography selection. The biological library' approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K.S. (1997) JntiarweerDrug Des. 12:145).

Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt er al. (1993) Proc. Nall. Acad. Sci. U.S.A. 90:6909; Erb er al. (1994) Proc. Natl. Acad. .Sci. USA 91:11422; Zuckennann ei al (1994) J. Med. Chem. 37:2678: Cho ei al. (1993) Science 261.: 1303; Carrell ei al. (1.994) Angew. Chem. Int. Ed Engl. 33:2059; Carell el al. (1.994) .dngew. Chem. Jut. Ed. Engl. 33:2061; and in Gallop er al. (1994)./. Λ-fofo Chem. 37:1233.

Libraries of compounds may be presented in solution (e.g., Houghton (1992) Btolechntipfos 13:412-421), or on beads (Lam ¢1991) Atoi/re 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner USP 5,223,409), spores (Ladner USP '409), plasmids (Cull er al. (1992) /’roc Nall A cad Sci USA 89:1865-1869) or on phage (Scott and Smith (1990) Science 249:386-390); (Devlin (1990) Science 249:404-406); (Cwiria ei al. (mt))Proe. Nall. Acad. Sci. 87:6378-6382); (Felici (1991) J. Mol. Biol. 222:301-310); (Ladner supra.).

In one embodiment, the inhibition of Ser-406 phosphorylation, of human eIF4B or a corresponding phosphorylatable amino acid in an ortholog of human eiF4B is determined by comparing the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatable amino acid in. the ortholog of human elF4B, in the sample relative to a control. The control, can be the amount of amount of Ser-406 phosphorylated human elF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B in the

WO 2015/073509

PCT/US2014/065173 .44.

sample relative to said amount in the absence of the agent or at an earlier timepomt after contact of the sample with the agent. The phosphorylation level of eIF4B is generally determined by measuring the amount of phosphorylated eIF4B protein and, optionally, of unphosphorylated elF4B, and normalizing the amount of phosphorylated protein to the total protein in the sample being analyzed. The calculated response phosphorylation level in the presence of the test compound and the basal or background phosphorylation levels (e.g., in the absence of the test compound or at a earlier timepoint after test compound administration) are thus not affected by differences in the absolute quantity' of the indicator protein at a given time.

The discriminatory time point, or predetermined time after administering the test compound to cells, can be selected to achieve a calibrated statistically significant difference between Ser-406 phosphorylation levels in the sample relative to controls. The difference may be maximal at the predetermined time but that is not required and depends on other parameters of the test In addition, whereas the calculation of ratios as described herein is beneficial in providing useful comparative numbers, calculation, of absolute differences between phosphorylated eIF4B levels upon administration of test compounds relati ve to controls, and between test subjects and control subjects, could also be employed and would be effective.

In some embodiments, the methods described, above can further comprise determining the amount of determining the amount of a protein translated from an mRNA with highly structured 5’ untranslated region (5’UTR), optionally wherein the protein is selected from the group consisting of cellular myelocytomatosis oncogene (c-Myc), Xiinked inhibitor of apoptosis protein (XIAP), and ornithine decarboxylase (ODC l). It is known that elF4B stimulates the helicase activity of eIF4A for unwinding the secondary structure of 5’UTR. of mRNA and that ef.F4B is important for the translation of mRNA with structured 5’UTR (Dmitriev el al, (2003) Mol. Cell Biol. 23:8925-8933 and Shahbazian el al. (2010) Afo/. Cell Biol, 30 1478--1485). The skilled artisan is well aware of mRNA with structured 5’UTR encoding oncogenic proteins, such as c-Myc, XIAP (X-linked inhibitor of apoptosis protein), ODC (ornithine decarboxylase), VEGF, H1F-1 alpha, and the like (see, at least Bert el«/. (2006) 12:1074-1083).

Phosphorylation is a biochemical reaction in which a phosphate group is added to Ser, Thr or Tyr residues of a protein and is catalyzed by protein kinase enzymes. Phosphorylation normally modifies the functions of target proteins, often causing

WO 2015/073509

PCT/US2014/065173 activation. As part of the cell’s homeostatic mechanisms, phosphorylation is only a transient process that is reversed by other enzyme called phosphatases. Therefore, protein phosphorylation le vels change over time and can be evaluated in a number of well-known manners, including, for example, by immunological approaches. For example, the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphoryls table amino acid in an ortholog of human eIF4B is determined by an i mmunoassay using a reagent which specifically binds with Ser-406 phosphorylated human elF4B or corresponding phosphorylated ortholog of human eIF4B. Such an immunoassay comprise a number of well known forms, including^ without limitation, a radioimmunoassay, a Western blot assay, an immunofluorescence assay, an enzyme immunoassay, an immunoprecipitation assay, a chemiluminescence assay, an immunohistochemical assay, a dot blot assay, or a slot blot assay. General techniques to be used in performing the various immunoassays noted above and other variations of the techniques, such as in situ proximity ligation assay (PLA), fluorescence polarization immunoassay (FP1 A), fluorescence immunoassay (Fl A), enzyme immunoassay (E1A), nephelometric inhibition immunoassay (NIA), enzyme linked immunosorbent assay (ELISA), and radioimmunoassay (RIA), ELISA, etc. alone or in combination or alternatively with NMR, MALDI-TOF, LC-MS/MS, arc known to those of ordinary¹ skill in rhe art.

In one embodiment, the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment: thereof which specifically binds with human eIF4B or corresponding ortholog of human cIF4B and a detection antibody or fragment thereof which specifically binds with Ser-406 phosphorylated human e.IF4B or a corresponding phosphorylated orthoiog of human e.IF4B. Such an enzyme immunoassay is particularly advantageous because identifying differences in protein levels between related kinase family members or isoforms given the relatively high homology between kinases among themselves and also among their phosphorylated forms.

Immunological reagents for identifying eIF4B in both phosphorylated and nonphosphorylated forms, as well as for detecting MELK, are well known in the art and can be generated using standard techniques, such as by inoculating host animals with appropriate elF4B phosphor-peptides. Such anti-MELK, anti-eIF4B, and/or anti-phospho-elF4B antibody reagents (e.g., monoclonal antibody.) can be used to isolate and/or determine the amount of the respective proteins such as in a cellular lysate. Such reagents can also be used to monitor protein levels in a cell or tissue, e.g., white blood cells or lymphocytes, as

WO 2015/073509

PCT/US2014/065173

- 46 · part of a clinical testing procedure, e.g., in order to monitor an optimal dosage of an inhibitory agent. Detection can be facilitated by coupling (e.g., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of' bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 'T, I, -' S or *' H.

The screening assays described above can further be adapted to identify candidate/test compounds which modulate (e.g., stimulate or inhibit) the interaction (and most likely MELK and el.F4B oncogenic activity as well) between an eIF4B protein and a target c!F4B protein with which, the elF4B protein normally interacts or modulates to verify that MELK-mediated enzymatic activity has been reduced in accordance with the reduced amounts of phosphorylated eIF4B levels. Examples of such target molecules or substrates include certain protein encoded by mRNA with structured 5T1TR, such as those described further herein.

As described above for the identification of eIF4B phosphorylation, Thr-3 phosphorylation, Ser-10 phosphorylation, and/or Thr-11 phosphorylation of human Histone H3, or a corresponding phosphorylaiable amino acid in an ortholog of human Histone H3, and modulation (e.g., inhibition.) thereof, can similarly be determined.

In another embodiment, the invention provides assays for screening candidate/test compounds which interact with te.g., bind to) MELK and/or eIF4B and/or Histone H3 protein. “Binding compound” shall refer to a binding composition, such as a small molecule, an antibody, a peptide, a. peptide or non-peptide ligand, a protein, an oligonucleotide, an oligonucleotide analog, such as a peptide nucleic acid, a lectin, or any other molecular entity' that is capable of specifically·' binding to a target protein or molecule or stable complex formation with an analyte of interest, such as a complex of proteins. “Binding moiety” means any molecule to which molecular tags can be directly or indirectly attached that is capable of specifically·' binding to an analyte. Binding moieties include, but

WO 2015/073509

PCT/US2014/065173 are not limited to, antibodies, antibody binding compositions, peptides, proteins, nucleic acids and organic molecules having a molecular weight of up to about .1000 daltons and containing atoms selected from the group consisting of hydrogen, fluoride, carbon, oxygen, nitrogen, sulfur and phosphorus. Typically, the assays are cell-based assays. The cell, for example, can be of mammalian origin expressing MELK and/or eIF4B and/or Histone H3, e.g., a cancer cell.

In other embodiments, the assays are cell-free assay s which include the steps of combining a MELK and/or eIF4B and/or Histone H3 protein or a biologically active portion thereof, and a candidate/test compound, e.g., under conditions which allow for interaction of (e.g., binding of) the candidate/test compound to the MELK and/or elF4B and/or Histone H3 protein or biologically active portion thereof to form a complex, and detecting the formation of a co mplex, in which the a bility of the candidate compound to interact with (e.g., bind to.) the MELK and/or eIF4B and/or Histone H3 polypeptide or biologically active fragment thereof is indicated by the presence of the candidate compound in the complex. Formation of complexes between the MELK and/or eIF4B and/or Histone H3 protein and the candidate compound can be quantitated, for example, using standard immunoassays. Such analyses would identify test compounds as MELK and/or clF4B and/or Histone H3 ligands.

To perform the above drug screening assays, it can be desirable to immobilize either MELK and/or eIF4B and/or Histone H3 or its target molecule to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay, interaction (e.g., binding of) of MELK and/or eIF4B and/or Histone H3 to a target molecule, in the presence and absence of a candidate compound, can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microlitre plates, test tubes, and. micro-centrifuge tubes. In one embodiment, a fusion polypeptide can be provided which adds a domain that, allows the polypeptide to he bound to a matrix. For example, glntaihione-S-transferase-MELK, Histone H3, and/or -eIF4B fusion polypeptides can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St, Louis, Mo.) or glutathione derivatized microlitre plates, which are then combined with the cell lysates (e.g., '^,s S-labeled) and the candidate compound, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly,

WO 2015/073509

PCT/US2014/065173 or in the supernatant after the complexes are dissociated. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of MELK-, Histone H3-, and/or e'IF4B-binding polypeptide found in the bead fraction quantitated from the gel using standard electrophoretic techniques.

Other techniques for immobilizing polypeptides on matrices can also be used in the exemplary' drug screening assays of the invention. For example, MELK and/or eIF4B and/or Histone H3 or its target molecule can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated MELK and/or eIF4B and/or Histone H3 molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g., biotinylation kit. Pierce Chemicals, Rockford, III), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies reactive with MELK. and/or eIF4.B and/or Histone H3, but which do not interfere with binding of the polypeptide to its target molecule can be derivatized to the wells of the plate, and MELK and/or eIF4B and/or Histone H3 trapped in the wells by antibody conjugation. As described above, prepara tions of a MELK- and/or eIF4B-binding polypeptide and a candidate compound are incubated in the MELK- and/or elF4B- and/or Histone H3presenting wells of the plate, and the amoun t of complex trapped in the well can be quantitated. .Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the MELK and/or eIF4B and/or Histone H3 target molecule, or which are reactive with MELK and/or eIF4B and/or Histone H3 polypeptide and compete with the target molecule; as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the target molecule.

In another aspect, a method for assessing the efficacy of an agent for inhibiting kinase activity of human MELK or an ortholog thereof in a subject, comprising: a) detecting in a subject sample at a first point in time, the amount of Ser-406 phosphorylated human e.IF4B or the amount of a human C.IF4B ortholog phosphorylated, at a corresponding amino acid, of human. elF4B; b) repeating step a) during at one or more subsequent points in. time after administration of the agent; and c) comparing the amount of phosphorylated human elF4B or ortholog thereof detected in step a) with said amount detected in step b), wherein a higher amount of Ser-406 phosphorylated human elF4B or the amount of the h uman el'F4B ortholog phosphory lated at a corresponding amino acid of human elF4B in. the first point in time relative to at least one subsequent point in time, indicates that the

WO 2015/073509

PCT/US2014/065173 agent inhibits kinase activity of MELK or die ortholog thereof, is provided. Simnilarly, a method for assessing the efficacy of an agent for inhibiting kinase activity of human MELK or an ortholog thereof in a subject, comprising: a) detecting in a subject sample at a first point in time, the amount of Thr-3 phosphorylated, Ser-10 phosphorylated, and/or Thr-11 phosphorylated human Histone H3, or the amount of a human Histone H3 ortholog phosphorylated at a corresponding amino acid of human Histone H3; b) repeating step a) during at one or more subsequent points in time after administration of the agent; and c) comparing the amount of phosphorylated human Histone H3 or ortholog thereof detected in step a) with said amount detected in step b), wherein a higher amount of Thr-3 phosphorylated, Ser-10 phosphorylated, and/or Thr-H phosphorylated human Histone H3, or the amount of the human Histone H3 ortholog phosphorylated at a corresponding amino acid of human Histone H3 in the first point in time relative to at least one subsequent point in time, indicates that the agent inhibits kinase activity of MELK or the ortholog thereof, is provided.

A.s used herein, “time course” shall refer to the amount of time between an initial event and a subsequent event. For example, with respect to a subject's cancer -progression, time course may relate to a subject's disease and may be measured by gauging significant events in the course of the disease, wherein the first event, may be diagnosis and the subsequent event may be proliferation, metastasis, etc.

Once binding is confirmed, additional assays, such as kinase assays to determine inhibition of phosphorylation effects, can be performed according to well-known methods in the art. For example, assays for determining MELK kinase activity are well known in the art (see, for example, the publications described herein and incorporated by reference in their entirety). Briefly, MELK can be incubated with a suitable substrate in a buffer allowing phosphorylation of eIF4.B or Histone H3. Phosphorylation of t he substrate can be detected using a labeled phosphate group, such as the use of the radioactive label '^UP present as the ATP source in the buffer. Alternatively, antibodies specific for the phosphorylated products of eIF4B catalytic activity can be used to detect activity. As will be apparent to those of ordinary skill in the art, the assays arc easily amenable to high through-put technologies using robotics and automated processes. Alternatively, the MELK kinase activity can be assayed using a synthetic substrate, such as a peptide library. MELK acti vity can also be assayed by detecting downstream targets of the kinase such, as those described herein.

WO 2015/073509

PCT/US2014/065173

- 50 Ser-406-phosphorylated el.F4B can be analyzed according to any of the methods and using any of the samples described herein (e.g., single subject samples or pooled subject samples). Candidate compounds which produce a statistically significant change in phosphorylated-e!F4B-dependent responses (e.g., inhibition of human eIF4B phosphorylation at Ser-406 or a corresponding phosphorylatable amino acid residue in an eIF4B ortholog thereof) can be identified. Such statistically significant changes can be measured according to a number of criteria and/or relative to a number of controls. For example, significant modulation of phosphorylation of Ser-406 can be assessed if the output under analysis is inhibited by 1.1-, 1.2-, 1.3-, 1.4-, 1.5-, 1.6-, 1.7-, 1.8-, 1.9-, 2.0-, 2.1-, 2.2-, 2.3-, 2.4-, 2.5-, 2.6-, 2.7-, 2.8-, 2.9-, 3.0-, 3.1-, 3.2-, 3.3-, 3.4-, 3.5-, 3.6-, 3.7-, 3.8-, 3.9-, 4.0-, 4.1-, 4.2-, 4.3-, 4.4-, 4.5-, 4.6-, 4.7-, 4.8-, 4.9-, 5.0-, 5.5-, 6.0, 6.5-, 7.0-, 7.5-, 8.0-, 8.5, 9.0- 9.5-, 10-, I I-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-fold or more different (including any range inclusive), relative to a control. In one embodiment, between the first point in time and the subsequent point in time, the subject, has undergone treatment for cancer, has completed treatment for cancer, and/or is in remission from cancer.

As described above for the identification and/or analysis of elF4B phosphorylation, Thr-3 phosphorylated, Ser-10 phosphorylated, and/or Thr-11 phosphorylated Histone H3, or a corresponding phosphorylatable amino acid in an ortholog of human Histone H3, and. modulation (e.g., inhibition) thereof, can similarly be identified and/or analyzed.

The term ‘‘cancer” refers to the presence of ceils possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, and certain characteristic morphological features. Cancer cells are often in the form of a tumor, but such cells may exist alone within an animal, or may be a non-tumorigenic cancer cell, such as a leukemia cell. As used herein, the term “cancer” includes prcmalignant as well as malignant cancers. Cancers include, but are not limited to, B cell cancer, e.g., multiple myeloma, WaldenstrSm’s macroglobulinemia, the heavy chain diseases, such as, for example, alpha chain disease, gamma chain disease, and mu chain disease, benign monoclonal gammopathy, and. immunocytic amyloidosis, melanomas, breast cancer, lung cancer, bronchus cancer, colorectal cancer, prostate cancer, pancreatic cancer, stomach cancer, ovarian cancer, urinary bladder cancer, brain or central nervous system cancer, peripheral nervous system cancer, esophageal cancer, cervical cancer, uterine or endometrial cancer, cancer of the oral cavity or pharynx, liver cancer, kidney cancer, testicular cancer, biliary tract cancer, small bowel or appendix cancer, salivary gland

WO 2015/073509

PCT/US2014/065173 cancer, thyroid gland cancer, adrenal gland cancer, osteosarcoma, chondrosarcoma, cancer of hematological tissues, and the like. Also included are any cancers in which the gene encoding MELK and/or cIF4B and/or Histone H3 is amplified or overexpressed, or has an activating mutation, or the MELK and/or e1.F4B and/or Histone H3 is hyper-activated by other kinases. In some embodiments, ovarian cancers, including serous cystadenocarcinoma, head and neck cancers, including non-small cell lung cancer (NSCLC), squamous cell carcinoma, pancreatic cancer, colon cancer, prostate cancer, and/or gliomas can be preferred.

“Treat,” “treatment,” and other forms of this word refer to the administration of an agent that inhibits the ability of I) MELK to phosphorylate eIF4B and/or Histone H3 and/or 2) the ability' of eIF4B or Histone H3 to be phosphorylated by MELK, to cause a cancer to be ameliorated, to extend the expected survival time of the subject and/or time to progression of a cancer or the like.

“Responsiveness,” to “respond/’ to treatment, and other forms of this verb, as used herein, refer to the reaction of a subject to treatmen t with an agent capable of inhibiting the ability of 1) MELK to phosphorylate elF4B or Histone H3 and/or 2) the ability of eIF4B or Histone H3 to be phosphorylated by MELK. As an example, a subject responds to treatment of the subject or cell thereof with an agent if the assayed condition is modulated by at least 10%, 2(1%. 30%, 40%, 50%, 60%, 70%, 80%, 90% or more relative to that of no administration of the agent or over a given amount of time.

C Treatment Methods

MELK and/or ei’F4B and/or Histone H.3 inhibitors described herein can be used to treat cancer. In one embodiment, a method of treating a subject afflicted with cancer comprising administering to the subject an agent that inhibits Ser-406 phosphorylation of human eIF4B or a corresponding phosphorylatable amino acid in an ortholog of human eIF4B, for example an agent that specifically modulates Ser-406 phosphorylation, thereby treating the subject afflicted with the cancer. In another embodiment, such MELK and/or eIF4B and/or Histone H3 inhibitors can also be used to determine the efficacy, toxicity, or side effects of treatment with such an agent. These methods of treatment generally include the steps of administering modulators in a pharmaceutical composition, as described further below, to a subject in need of such treatment, e.g., a subject with cancer or at risk for developing cancer.

WO 2015/073509

PCT/US2014/065173

The tersn “administering” is mtended. to mclude routes of administration which allow the agent to perform its intended function of inhibiting the ability of MELK to phosphorylate eIF4B, the ability of eIF4B to be phosphorylated by MELK, the ability of MELK to phosphorylate Histone H3, and/or the ability of Histone H3 to be phosphorylated by MELK. Examples of routes of administration which can be used include injection (subcutaneous, intravenous, parenterally, intraperitoneally, intrathecal, etc.), oral, inhalation, and transdermal. The injection can. be bolits injections or can be continuous infusion. Depending on the route of administration, the agent can be coated with or disposed in a selected material to protect it from natural conditions which may detrimentally affect, its ability to perform its intended function. The agent, may be administered alone, or in conjunction with a pharmaceutically acceptable carrier. The agent also may be administered as a prodrug, which is converted to its active form in vivo.

The term “effective amount” of an agent inhibiting the ability of MELK to phosphorylate eIF4B and/or the ability of elF4B to be phosphorylated by MELK is that amount necessary or sufficient to inhibit the ability of MELK to phosphorylate eIF4B and/or the ability of elF4B to be phosphorylated by MELK in the subject or population of subjects as measured, for example, by the levels of Ser-406-phosphorylated human eIF4B or a. corresponding phosphorylatable residue in an elF4B orthoiog thereof according to the methods described above. The same analysis applies to inhibiting the ability of MELK to phosphorylate Histone H3 and/or the ability of Histone H3 to be phosphorylated by MELK. The effective amount can vary depending on such factors as the type of therapeutic agent(s) employed, the size of the subject, or the severity of the disorder.

It will be appreciated that individual dosages may be varied depending upon the requirements of the sub ject in foe judgment of the attending clinician, the severity of the condition being treated and the particular compound being employed. In determining the therapeutically effective amount or dose, a number of additional factors may be considered by the attending clinician, including, but not limited to: foe pharmacodynamic characteristics of the particular agent and its mode and route of administration; the desired time course of treatment; foe species of mammal: its size, age, and general health; the specific disease involved; the degree of or involvement or the severity of the disease: the response of the individual subject: the particular compound administered; the mode of administration; the bioavailability characteristics of foe preparation administered; the dose regimen selected; the kind of concurrent treatment; and other relevant circumstances.

WO 2015/073509

PCT/US2014/065173

Treatment can be initiated with smaller dosages that are less than the effective dose of the compound. Thereafter, in one embodiment, the dosage should be increased by small increments until the optimum effect under the circumstances is reached. For convenience, the total daily dosage may be divided and administered in portions during the day if desired.

The effectiveness of any particular agent to treat, cancers can be monitored by comparing two or more samples obtained from subjects undergoing cancer treatment. In general, a first sample is obtained from the subject prior to beginning therapy and. one or more samples during treatment. In such a use, a baseline of expression of cells from subjects with cancer prior to therapy is determined and then changes in the baseline state of expression of cells from subjects with cancer is monitored during the course of therapy. Alternatively, two or more successive samples obtained during treatment can be used without the need of a pre-treatment baseline sample. In such a use, the first, sample obtained from the subject, is used as a baseline for determining whether the expression of cells from subjects with metabolic disorders is increasing or decreasing.

MELK and/or ei.F4.B and/or Histone H3 inhibitors can be administered in pharmaceutically acceptable compositions which comprise a therapeuticaliy-effective amount of the inhibitor formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents. For example, formulations can be adapted for (1) oral administration, for example, drenches (aqueous or non-aqueous solations or suspensions), tablets, boluses, powders, granules, pastes; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension; (3) topical application, for example, as a cream, ointment or spray applied to the skin, buccal, or sublingual surfaces; (4) intravagmally or mtrarectally, for example, as a pessary, cream or foam; or (5) nasaVaerosol, for example, as an aqueous aerosol, liposomal preparation or solid particles containing the compound, based on well-known methods in the pharmaceutical arts.

The phrase “pharmaceutically acceptable” is employed herein to refer to those agents, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefivrisk ratio.

T he phrase “pharmaccutically-aceeptabie carrier as used herein means a pharmaceuticaily-acceptabie material, composition or vehicle, such as a liquid or solid

WO 2015/073509

PCT/US2014/065173 filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject chemical .from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials which can serve as pharmaceuticaily-acceptabie carriers include: (.1) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium, carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth· (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, coni oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (.12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer’s solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.

The term “pharmaceuticaily-acceptabie salts” refers to the relatively nun-toxic, inorganic and organic acid, addition salts of foe agents that reduce foe phosphorylation levels of PKC-iota and/or activity encompassed by the invention. These salts can be prepared in situ during the final isolation and purification of foe agents, or by separately reacting a purified agents agent in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosvlate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, .lactobi onate, and lauryl sulphonate salts and the like (See, for example, Berge el al. (1977) “Pharmacemicai Salts”, J. Phartn. Sci. 66:119).

In addition, the methods described herein can further comprise treating subjects with MELK and/or el'F4B and/or Histone H3 inhibitors in addition to administering one or more additional anti-cancer agents and/or use samples from subjects exposed to such anti-cancer agents. Anti-cancer agents are well known to the skilled artisan and include, without limitation, chemotherapy and radiation, as well as immunotherapy, hormone therapy, and

WO 2015/073509

PCT/US2014/065173

- * gene therapy using nucleic acid molecules and/or proteins dial are Jinked to die initiation, progression, and/or pa thology of a tumor or cancer.

Chemotherapy includes the administration of a chemotherapeutic agent. Such a chemotherapeutic agent may be, but. is not. limited to, those selected from among the following groups of compounds: platinum compounds, cytotoxic antibiotics, antimetaboluies, anti-mitotic agents, alkylating agents, arsenic compounds, DMA topoisomerase inhibitors, manes, nucleoside analogues, plant, alkaloids, and toxins; and synthetic derivatives thereof. Exemplary compounds include, but. are not limited to, alkylating agents; cisplatin, treosulfan, and trofosfamide; plant alkaloids: vinblastine, paclitaxel, docetaxel; DNA topoisomerase inhibitors: teniposide, erisnatol. and mitomycin; anti-folates: methotrexate, mycophenolic acid, and hydroxyurea; pyrimidine analogs: 5fluorouracil, doxiflnridine, and cytosine arabinoside; purine analogs; mercaptopuriue and thioguanine; DNA antimeiaboliics: 2'-deoxy-5fluorouridine, aphidicolin glycinate, and pyrazoloimidazole; and antimitotic agents: halichondnn, colchicine, and rhizoxin. Compositions comprising one or more chemotherapeutic agents (e.g., FLAG, CHOP) may also be used. FLAG comprises fiudarabine, cytosine arabinoside (Ara-C) and G-CSF, CHOP comprises cyclophosphamide, vincristine, doxorubicin, and prednisone. In another embodiment, PA.RP (e.g·, PARP-l and/or .PARP-2) inhibitors are used and such, inhibitors are well known in the art (e.g,, Olaparib, ABT-888, BSI-201, BGP-15 (N-Gene Research Laboratories, Inc,):. INO-1001 (Inotek Pharmaceuticals Inc,); PJ34 (Soriano ei al., .2001; Pacher et al., 2002b); 3-am.inobenzamidc (Trevigen); 4-amino-l,8-naphthalimide; (Trevigen); 6(5H)-phenanthridinone (Trevigen); benzamide (U.S. Pat. Re, 36,397); and NU1025 (Bowman el ciL). In still another embodiment, the chemotherapeutic agents are platinum compounds, such as cisplatin, carboplatin, oxaliplatin, nedapiatin, and iproplatin. Other antineoplastie platinum coordination compounds are well known in the art, can be modified according to well-known methods in the art, and include the compounds disclosed in U.S. Pat. Nos, 4,996,337, 4,946,954,5,091,521,5,434,256, 5,527,905, and 5,633,243, all of which are incorporated herein by reference. The foregoing examples of chemotherapeutic agents are illustrative, and are not intended to be limiting.

Radiation therapy can also comprise an additional anti-cancer agent. The radiation used in radiation therapy can be ionizing radiation. Radiation therapy can also be gamma rays, X-rays, or proton beams. Examples of radiation therapy include, but are not limited to, external-beam radiation therapy, interstitial implantation of radioisotopes (1-125, Pd

WO 2015/073509

PCT/US2014/065173

103, l.r-I92), intravenous administration of radioisotopes such as strontinm-89, thoracic radiation therapy, intraperitoneal 'Ψ radiation therapy, and/or total abdominal and pelvic radiation therapy. For a general overvie w of radiation therapy, see Hellman, Chapter 16: Principles of Cancer Management: Radiation Therapy, 6th edition, 2001, DeVita er aL, eds., J. B. Lippencott Company, Philadelphia. The radiation therapy can be administered as external beam radiation or teletherapy wherein the radiation is directed from a remote source. The radiation treatment can also be administered as internal therapy or brachytherapy wherein a radioactive source is placed inside the body close to cancer cells ora tumor mass. Also encompassed is the use of photodynamic therapy comprising the administration of photosensitizers, such as hematoporphyrin and its derivatives, Vertoporfm (BPD-ΜΑ), phthalocyanine, photosensitizer Pc4, demethoxy-hypocrellin A; and 2BA-2DMHA.

Additional anti-cancer agents include immunotherapy, hormone therapy, and gene therapy. Such therapies include, but are not limited to, the use of antisense polynucleotides, ribozymes, RN A interference molecules, triple helix polynucleotides and the like, where the nucleotide sequence of such compounds are related to the nucleotide sequences of DNA and/or RNA of genes that are linked to the initiation, progression, and/or pathology of a tumor or cancer. For example, oncogenes, growth factor genes, growth factor receptor genes, cell cycle genes, DNA repair genes, and others, may be targeted in such therapies.

Immunotherapy may comprise, for example, use of cancer vaccines and/or sensitized antigen presenting cells. Immunotherapy can also involve derepression of immunoinhibitory pathways, such as by targeting PD-Ll, PD-L2, PD-1, CTLA-4, and the like. The immunotherapy can involve passive immunity for short-term protection of a host, achieved by the administration of an antibody directed against a cancer antigen or disease antigen (e.g., administration of a monoclonal antibody, optionally linked to a chemotherapeutic agent or toxin, to a tumor antigen). Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines.

Hormonal therapeutic treatments can comprise, for example, hormonal agonists, hormonal antagonists (eg., fiutamide, bicalutamide, tamoxifen, raloxifene, leuprolide acetate (LUPRON), LFI-RH antagonists), inhibitors of hormone biosynthesis and processing, and steroids (e.g., dexamethasone, retinoids, deltoids, betamethasone, cortisol, cortisone, prednisone, dehydrotestosterone, glucocorticoids, mineralocorticoids, estrogen, testosterone, progestins), vitamin A derivatives (e.g., all-trans retinoic acid (ATRA));

WO 2015/073509

PCT/US2014/065173 vitamin D3 analogs; anttgesiagens (e.g., mifepristone, onapnstone), or antiandrogens (e.g., cyproierone acetate).

In one embodiment, anti-cancer therapy used for cancers whose phenotype is determined by the methods of the invention can comprise one or more types of therapies described herein including, but not limited to, chemotherapeutic, agents, immunotherapeutics, anti-angiogenic agents, cytokines, hormones, antibodies, polynucleotides, radiation, and photodynamic therapeutic agents. For example, combination therapies can comprise one or more chemotherapeutic agents and radiation, one or more chemotherapeutic agents and immunotherapy, or one or more chemotherapeutic agents, radiation and chemotherapy.

Exemplification

This invention is further illustrated by the following examples, which should not be construed as limiting.

Example 1: Materials and Methods For Examples 2-3

a. Plasmids

Human el.F4B was cloned from the reverse transcription products of total RNA exh-acted from human, mammary epithelial cells (HMECs), using the primers (forward: ATGGCGGCCTCAGCAAAAAAG; reverse: C1ATTCGGCATAATC1TCTC). The 1.8 kb PGR product was then used as template for amplifying Flag-tagged or HA-tagged eIF4B with restriction sites. The constructs (pWzl-Flag-ei'F4B, pTrex-elF4B-HA) were verified by sequencing. Site-directed mutagenesis of elF4B was performed using QuiekChange XL (Stratagene), and all mutant constructs were confirmed by sequencing.

To generate pLKO-tet-on shRNA targeting human elF4B, syn thesized oligonucleotides were annealed and ligated with, digested pLKO vector. The sequences for scramble, sh-elF4B-l, sh-eIF4B-2 are GTGGACTCITGAAAGTACTAT, GGACCAGGAAGGAAAGATGAA, and GCGGAGAAACACCTTGATCTT, respectively.

b. Retroviral and leativiral gene delivery

Retroviruses were generated by transfecting HEK293T cells with retroviral plasmids and packaging DN A. Generally, 1.6 pg pWzl DNA, 1.2 pg pCG-VSVG and 1.2 pg pCG-gap/pol, 12 ul lipid of Metafectene Pro (Biontex) were used. DN A and lipid were

WO 2015/073509

PCT/US2014/065173 dikned in 300 μΙ PBS respectively and mixed. After 15 minutes (mm J of incubation, they were added to one 6~cm dish that was seeded with 3 million HEK293T cells one day earlier. Viral supernatant was collected 48 hours (h) and 72 hours post-transfection. The supernatant was filtered through 0.45 pm membrane, and was added to target cells in the presence of 8 pg/nil polybrene (Millipore). Lentiviruses were generated with a similar approach with the exception of HEK293T cells that were transfected with 2 pg pLKO DNA, 1.5 pgpCMV-dR8.9l, and 0.5 pg pMD2-VSVG. Cells were selected with antibiotics starting 72 h after initial infection. Puromycin and blasticidin were used at the final concentration s of 1.5 pg/ml and 4 pg/ml respectively.

c. Immunoblotting

For treatment with nocodazole, ceils were refreshed with medium containing nocodazole (200 ng/ml). Twenty hours after treatment, floating mitotic cells were harvested by gental shake-off. For drug treatment; cells were seeded in multi-well plate, in the presence of OTSSP167 (CheniExpress, HY15512; 10 mM stock made in DMSO).

Cells were harvested and lysed with RIPA buffer (25 mMTris, pH 7.4, 150 mM NaCl, l%Non.idet P-40, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl sulfate) supplemented with protease inhibitors cocktail (Roche) and phosphatase inhibitors cocktail (Thermo Scientific). Cleared lysates were analyzed for protein concentration using a BCA kit (Thermo Scientific). Equal amount of protein (10-20 pg) was resolved on SDS-PAGE, and was subsequently transferred onto a nitrocellulose or polyvinylidene difluoride membrane (Amersham). The membrane was blocked with 5% non-fat milk and was then incubated with primary antibodies overnight at 4°C. After washing, the membrane was incubated with fluorophore-conjugated secondary antibodies for 1 h at room temperature. The membrane was then washed and scanned with an Odyssey® Infrared scanner (Li-Cor Biosciences),

The following antibodies were used for immunoblotting or immunoprecipitation, MELK (Epitomics, 2916), p-eIF4B (84(16) (Ceil Signaling, 8151), p-eIE4B (S422) (Cell Signaling; 3591), eIF4B (Cell Signaling, 3592), c-Myc (Cell Signaling, 56()5), XIAP (Cell Signaling, 2045), p-Akt (S473) (Cell Signaling, 4060), p-.MAPK (T202/Y204) (Cell Signaling, 4370), cleaved PARE (Asp214) (Cell Signaling, 9541), Aurora A (Cell Signaling, 4718), Aurora B (Cell Signaling, 3094), p-Aurora A (T288)/Aurora B (T232)/Aurora C(T198) (Cell Signaling, 2914), p-Histone H3 (T3) (Cell Signaling, 13576), p-Histone H3 (S10) (Cell Signaling, 3377), p-Histoue H3 (Τ11) (Cell Signaling, 9767), pWO 2015/073509

PCT/US2014/065173

- 59 Histone H3 (S28) (Cell Signaling, 9713), ODC (Sigma, Ol 136), Vinculin (Sigma, V9131, alpha-tubulin (Sigma, TOO 16), anti-HA magnetic beads (Pierce, 88836), anti-Flag magnetic beads (Sigma, M8823). Secondary antibodies used were Alexa Fluor 680 goat anti-rabbit IgG· (Invitrogen, A-21I09) and IRDye800-conj«gated anti-mouse IgG (Rockland).

d. In vitro kinase assay

Flag-tagged elF4B or Flag-elF4B (S406A) was transfected into HEK293T cells (4 pg DNA for cells in one 60 mm dish). Thirty-six hours after transfection, cells were lysed with IP buffer (100 mM NaCI, 50 mM. Tris, pH 7.5,0.5% NP-40,0.5% Sodium deoxycholate, supplemented with protease/phosphatase inhibitor cocktail). Lysates were cleared via incubating with anti-mouse IgG conjugated to magnetic beads (4^aC, 30 min), and then immunoprecipitated with anti-Flag M2 magnetic beads (Sigma) (4°C, 120 min). The beads with bound antigens were washed 5 times with IP buffer. Beads during the last wash were aliquoied into 1.5 ml m.icrocenirifuge tubes. After removal of IP buffer, the beads were washed once with l x kinase buffer without ATP (5 mM Tris, pH 7.5, 5 mM - β glycerophosphate, 2 mM. dithioihreitol, 0.1 mM .Na3VO4, 10 mM Mg€l2; Cell Signaling). After the wash, 40 p.l Lx kinase buffer with 200 mM ATP was added to each tube, followed by 5 ul buffer without or with 500 ng recombinant MELK. The reaction was incubated at 30*C for 30 min, and terminated by adding 40 ul. 2x SDS sample buffer. The samples were then boiled and subjected, to immunoblotting. In vitro kinase assays with. Histone H3 were performed as above, except that recombinant Histon H3.1 (New England BioLabs, M2 503 S) was used ( 50 ng per reaction),

e. Positional scanning peptide library screen

Active full-length human MELK was purified from insect cells. The positional scanning peptide library screen was performed as described in Turk er al. (2006) Aot. Protocol 1:375. Briefly, a set of 180 (or 198) biotin Conjugated peptides with the following sequence, Y-A-X-X-X-X-X-S/T-X-X-X-X- A-G-K-K-biotin, was used. In the sequence, S/T means an equimolar mixture of Ser and Thr. For each peptide, one of the nine X positions represents one of the twenty total amino acids. Peptides were arrayed in a 384-well plates in buffer containing 50 mM HEPES, pH 7,5,20 mM MgCh, 0.02 mg/ml BSA, 0.0.1 % Brij 35, 5 mM DTT, 0.5 mM EGTA, and active MELK and y-p2p]-ATP was added to wells (final [peptide] ~ 50 μΜ, and [ATP] ~ 100 μΜ, 0,025 uCi/ui in each well). After incubating for 2 b at 30°C, aliquots of t he reactions were spotted onto a streptavidin

WO 2015/073509

PCT/US2014/065173 membrane. The membrane was quenched, washed extensively, dried, and exposed to a phosphor storage screen.

Example 2: Phosphorylatioa Status of eIF4B is a Biomarker of MELK Enzymatic and Oncogenic Activity

To seek a potential molecular mechanism underlying the importance of MELK for cancer (such as basal-like breast cancer (BBC)), multiple experimental approaches, including immunopieeipiiation-tandem mass spectrometry, and phospho-peptide mapping, were explored. When Flag-ragged MELK. was immunoprecipitated in mitotic cell lysates and subsequently subject to mass spectrometry analysis, it was found that a translation initiation factor, elF4B, had a strong association with MELK during mitosis (Figure I). Using positional phospho-peptide mapping, an optimal substrate motif for MELK was identified having a strong selection for arginine ar rhe -3 position relative to serine/threonine (Figure 2).

There are two regions flanking the residues of human elF4B at Ser406 and Ser422), which contain the MELK phosphorylation motif (Figures 3 and 4). To test whether MELK is capable of phosphorylating human el.F4B at these two sites, in vitro kinase assays were performed using purified recombinant MELK with immunoprecipitated el.F4B. It was found that Ser406, but not Ser422, of human elF4B was readily phosphorylated by full-length MELK or the kinase domain of MELK, and that the observed phosphorylation was abolished when the serine at 406 of human eIF4B was mutated to alanine or other manipulations of MELK (Figures 3-5). These results are specifically dependent upon MELK, as inhibition of mitotic cells with mTOR inhibitors, such as rapamycin and torins, do not produce the same results (Figure 6; van Corp et al (2009) Offcogem? 28:95-106). These data indicate that MELK is a kinase that phosphorylates human cIF4B at S406 and that eIF4B orthologs in other species are similarly phosphorylated due to the highly conser ved sequence and structural composition of the eIF4B polypeptide region harboring the phosphorylation site (Table 2).

WO 2015/073509

PCT/US2014/065173

Table 2 elF 4B S406

Human	S406	RERHPSWRSE
Chimpanzee	S406	RERHPSWRSE
Monkey	S402	RERHPSWRSE
Cattle	S406	RERHPSWRSE
Dog	S406	RERHPSWRSE
Mouse	S406	RERHPSWRSE
Rat	S406	RERHPSWRSE
Zebrafish	S403	RERHPSWRSE
Fission yeast	S315	RERSTSRK.PS

It is known that eIF4B stimulates the helicase activity of eIF4A for unwinding the secondary structure of 5'VTR of mRNA (Dmitriev el al. (2003) ME Cell Biol. 23:89258933 and Shahbazian er a/. (2010) Afo/. Cell Biol. 30 1478-1485). Many of these mRNAs encode oncogenic proteins, such as c-Myc, XlAP (X-linked inhibi tor of apoptosis protein) and ODC (ornithine decarboxylase). It was determined herein that down-regulation of MELK reduced phosphorylation of eI.F4B (p-elF4B) at S406 in MDA-MB-468 cells during mitosis, which also resulted in markedly reduced levels of c-Myc, XlAP and ODC1 (Figures 7 and 8). Thus, MELK-mediated S406 phosphorylation of eIF4B during mitosis, is functionally important for the optima! translation of mRNAs with highly structured 5’UTR, many of which arc known to be oncogenic, such as c-Myc, XlAP, and ODC1. Together, these data indicate that MELK is a novel kinase that regulates elF4B during mitosis and thereby mediates the translation of mRNAs that harbor structured 5’-UTR and are important for the survival and proliferation of cancer cells. Thus, the level of eIF4B phosphorylation mediated by MEEK is a target engagement biomarker for MELK oncogenic activity useful for preclinical and clinical applications.

Example 3: Phosphorylation Status of Histone H3 is a Biomarker of MELK Enzymatic and Oncogenic Activity

Since .MEEK protein abudance is highest during mitotis, a cell cycle phase when Histon H3 is hea vily phosphorylated, a l ink between MELK and Histone H3 phosphorylation was suggested. In fact, the region flanking the residues of human Histone H3 at Thr-11 contains the optimal MELK phosphorylation motif described in Example 2 above.

SUBSTITUTE SHEET (RULE 26)

WO 2015/073509

PCT/US2014/065173

To fest whether MELK is capable of phosphorylating human Histone H3 at threonine 3 (Thr3), serine 10 (SerlO) and threonine 11 (Thrl 1 ), in vitro kinase assays were performed using a purified recombinant kinase domain of human MELK and human Histone H3, It was found that Thr3, SerlO, and Thrl 1 of human Histone H3 were readily phosphorylated by the kinase domain of MELK (Figure 9).

Down-regulation of MELK reduced phosphorylation of Histone H3 at Thr3, SerlO and Thrl I in MDA-MS-468 coils during mitosis, but did not affect the phosphorylation of Aurora kinases A, B, or C, which are known kinases that phosphorylate Histone H3 at Ser i 0 (Figures 10 and 11). Similarly, inhibition of MELK using the small chemical MELK inhibitor, OTSSP167, inMDA-MB-468 cells reduced phosphorylation of Histone H3 at Thr3/SerlO/Thrl I (Figure 12). An OTSSPI67 concentration-dependent reduction in phosphorylation of Histone H3 at Thr3, Seri 0 and Thrl 1, but not Ser28, was also observed (Figure 13).

These data indicate that MELK is a kinase that phosphorylates human Histone H3 at least at Thr3, SerlO and Thrl 1, but not Ser28, and that Histone H3 orthologs in other species are similarly phosphorylated due to the highly conserved sequence and structural composition of the Histone H3 polypeptide region harboring the phosphorylation site (fable 3).

Histone H3
Human	T3/S10/T11	MARTKQTARKSTGGKA
LilinipaBZCc Monkey	Lt'dlv· I 11 T3/S10/TH	MARTKQTARKSTGGKA
Cattle	T3/S10ZTI1	MARTKQTARKSTGGKA
Dog	T3/S10/TI1	MARTKQTARKSTGGKA
Mouse Rat	T3/S10/T11 T3/SI0/TT1	MARTKQTARKSTGGKA MARTKQTARKSTGGKA
Zebrafish Fission yeast	T3/S10/TH T3/S10/T11	MARTKQTARKSTGGKA MARTKQTARKSTGGKA

Together, these data indicate that MELK is a novel kinase that regulates Histone H3 phosphorylation during mitosis and is therefore potentially important for the proliferation of cells (e.g., cancer cells). Thus, the level of Histone H3 phosphorylation mediated by MELK is a target engagement biomarker for MELK oncogenic activity useful for preclimcal and clinical applications.

- 62 SUBSTITUTE SHEET (RULE 26)

-632014348780 19 Nov 2018

Incorporation by Reference

The contents of all references, patent applications, patents, and published patent applications, as well as the Figures and the Sequence Listing, cited throughout this application are hereby incorporated by reference.

Equivalents

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following 10 claims.

Throughout this specification, unless the context requires otherwise, the word comprise, or variations such as comprises or comprising, will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers 15 but not the exclusion of any other step or element or integer or group of elements or integers.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all 20 of form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each of the appended claims.

Claims (15)

1. -64What is claimed:

   1. A method of identifying an agent which inhibits kinase or oncogenic activity of human maternal embryonic leucine zipper kinase (MELK) or an ortholog thereof, comprising:

   a) contacting a sample comprising i) human MELK or an ortholog thereof and ii) human eukaryotic initiation factor 4B (eIF4B) or an ortholog thereof, with the agent; and

   b) determining the ability of the agent to inhibit Ser-406 phosphorylation of human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B, wherein decreased phosphorylation identifies an agent which inhibits kinase or oncogenic activity of human MELK or the ortholog thereof.
2. 2. The method of claim 1, wherein the inhibition of said Ser-406 phosphorylation of human eIF4B or a corresponding phosphorylatable amino acid in an ortholog of human eIF4B is determined by comparing (i) the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B, in the sample relative to a control; and/or (ii) the ratio of the amount of Ser-406 phosphorylated human eIF4B, or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B, in the sample relative to the total amount of human EIF4B or ortholog thereof, to a control.
3. 3. The method of claim 2, wherein the control is (i) the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B in the sample relative to said amount in the absence of the agent or at an earlier timepoint after contact of the sample with the agent; and/or (ii) the ratio of the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B in the sample relative to said ratio in the absence of the agent or at an earlier timepoint after contact of the sample with the agent.
4. 4.

   The method of any one of claims 1-3, further comprising

   2014348780 03 Dec 2018 (i) determining the amount of a protein translated from an RNA with highly structured 5’UTR, optionally wherein the protein is selected from the group consisting of cellular myelocytomatosis oncogene (c-Myc), X-linked inhibitor of apoptosis protein (XIAP), and ornithine decarboxylase (ODC1);

   (ii) determining whether the agent directly binds said human eIF4B or said ortholog thereof, or said human MELK or said ortholog thereof; and/or (iii) determining the amount of a mitosis-specific protein.
5. 5. A method for assessing the efficacy of an agent for inhibiting kinase activity of human MELK or an ortholog thereof in a subject, comprising:

   a) detecting in a subject sample at a first point in time, the amount of Ser-406 phosphorylated human eIF4B or the amount of a human eIF4B ortholog phosphorylated at a corresponding amino acid of human eIF4B;

   b) repeating step a) during at one or more subsequent points in time after administration of the agent; and

   c) comparing the amount of phosphorylated human eIF4B or ortholog thereof detected in step a) with said amount detected in step b), wherein a higher amount of Ser-406 phosphorylated human eIF4B or the amount of the human eIF4B ortholog phosphorylated at a corresponding amino acid of human eIF4B in the first point in time relative to at least one subsequent point in time, indicates that the agent inhibits kinase activity of human MELK or the ortholog thereof.
6. 6. A method of determining the function or activity of human MELK or an ortholog, comprising:

   a) detecting in a sample the amount of Ser-406 phosphorylated human eIF4B or the amount of a human eIF4B ortho log phosphorylated at a corresponding amino acid of human eIF4B;

   b) repeating step a) in the same sample or a test sample at one or more subsequent points in time after manipulation of the sample and/or manipulation of the same sample or test sample; and

   c) comparing the amount of phosphorylated human eIF4B or ortholog thereof detected in step a) with said amount detected in step b),

   2014348780 03 Dec 2018

   -66wherein a modulated of Ser-406 phosphorylated human eIF4B or the amount of the human eIF4B ortholog phosphorylated at a corresponding amino acid of human eIF4B in the first point in time relative to at least one subsequent point in time and/or at least one subsequent manipulation of the same sample or test sample, indicates that the function or activity of human MELK or an ortholog thereof is modulated.
7. 7. The method of any one of claims 1-6, wherein the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B is determined by an immunoassay using a reagent which specifically binds with Ser-406 phosphorylated human eIF4B or corresponding phosphorylated ortholog of human eIF4B.
8. 8. The method of any one of claims 1-6, wherein the immunoassay is a radioimmunoassay, a Western blot assay, a proximity ligation assay, an immunofluoresence assay, an enzyme immunoassay, an immunoprecipitation assay, a chemiluminescence assay, an immunohistochemical assay, a dot blot assay, or a slot blot assay.
9. 9. The method of any one of claims 1-6, wherein the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human eIF4B or corresponding ortholog of human eIF4B and a detection antibody or fragment thereof which specifically binds with Ser-406 phosphorylated human eIF4B or a corresponding phosphorylated ortholog of human eIF4B.
10. 10. The method of any one of claims 1-6, wherein the sample (i) is selected from the group consisting of in vitro, ex vivo, and in vivo samples;

    (ii) comprises cells;

    (iii) comprises cancer cells selected from the group consisting of any cancer in which MELK or eIF4B is amplified or overexpressed, any cancer having an activating mutation of MELK or eIF4B, and any cancer in which MELK or eIF4B is activated by other kinases;

    (iv) is selected from the group consisting of tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow; and/or (v) is obtained from a subject.

    2014348780 03 Dec 2018
11. 11. The method of claim 5 or 6, wherein the sample or test sample in step a) and/or step b) is a portion of a single sample obtained from a subject; is a portion of pooled samples obtained from a subject; and/or wherein between the first point in time and the subsequent point in time, the subject has undergone treatment for cancer, has completed treatment for cancer, and/or is in remission from cancer.
12. 12. The method of any one of claims 1-6, wherein said human eIF4B or ortholog thereof, and/or said human MELK or ortholog thereof, comprises a nucleic acid sequence or amino acid sequence set forth in Table 1.
13. 13. The method of claim 6, wherein the manipulation of the sample is selected from the group consisting of contacting the sample with a test agent, contacting the sample with an upstream signal of the MELK signaling pathway, and contacting the sample with a MELK inhibitor.
14. 14. The method of any one of claims 1-6 and 13, wherein the agent or the test agent is a small molecule, or an antibody or antigen-binding fragment thereof.
15. 15. The method of any one of claims 1-6, 13, and 14, wherein the agent or the test agent decreases the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B by at least 50%.