AU2013337537A1

AU2013337537A1 - Method for biologically removing sulfate and metals

Info

Publication number: AU2013337537A1
Application number: AU2013337537A
Authority: AU
Inventors: Davor COTORAS TADIC; Cristian Alejandro HURTADO CARRASCO; Plabia Elicer VIEDMA ELICER
Original assignee: Universidad de Chile
Current assignee: Universidad de Chile
Priority date: 2012-10-31
Filing date: 2013-10-04
Publication date: 2015-03-26
Anticipated expiration: 2033-10-04
Also published as: WO2014067024A8; PE20150539A1; CL2012003057A1; AU2013337537B2; CA2883147A1; WO2014067024A1

Abstract

The invention relates to a method for biologically removing sulfate and metals from mining effluents, acid mine drainages and various industrial liquid residues, wherein said method comprises at least the steps of: (a) subjecting the effluent to at least one first step of removing the metals in solution by means of biosorption with a bacterial biomass; and (b) subjecting the liquid that has previously been treated in the biosorption step to a second step of continuous removal of sulfate in an anaerobic bioreactor.

Description

- 1 METHOD FOR THE BIOLOGICAL REMOVAL OF SULFATE AND METALS APPLICATION FIELD FOR THE INVENTION This invention relates to a process for the biological removal of sulfate and metals from mining effluents, mine acid drainages and different industrial liquid residues. DESCRIPTION OF WHAT IS KNOWN IN THE ART During the wastewater anaerobic treatment the sulfate contained is reduced producing sulfhydric acid. The sulfhydric acid is a toxic gas that corrodes metallic structures and produces an unpleasant odor in the water in which it is contained. The water from mines and effluents produced in different industries may contain high concentrations of sulfate and require a treatment to avoid the issues mentioned (Tait et a/., 2009. "Removal of sulfate from high-strength wastewater by crystallization". Water Res. 43: 762-772; US 5.587.079). There are currently some alternatives to remove sulfate from water, anyhow these alternatives pose important issues such as not reducing the concentration of sulfate to the levels required or being cost-ineffective. Considering the above issues the need for developing an alternative that is profitable and efficient for the removal of sulfate is required. One of the alternatives proposed for the treatment of water with high levels of sulfate is the use of sulfate-reducing microorganisms. Anyhow, this alternative is limited by two reasons: the first one is that a profitable substrate for the sulfate-reducing microorganisms is not available; and the second one is that in the case of mining effluents that, on top of having high concentrations of sulfate, they contain metals that have a toxic effect on the sulfate-reducing microorganisms (Utgikar et al., 2002. "Quantification of toxic and inhibitory impact of copper and zinc on mixed cultures of sulfate-reducing bacteria". Biotechnol. Bioeng. 82: 306-312). The fact that the typical substrates for sulfate-reducing microorganisms are not profitable is because they are low weight molecules such as ethanol, lactate or pyruvate that have high costs. The use of complex substrates for the reduction of sulfate represents advantages since they are more profitable than the low molecular weight substrates (Boshoff et al., 2004. "The use of micro 6279465_1 (GHMatters) P99198.AU LYNT -2 algal biomass as a carbon source for biological sulphate reducing systems". Water. Res. 38: 2659 2666).Therefore it is necessary a set of microorganisms capable of hydrolizing and fermenting high molecular weight substrates producing low molecular weight metabolites that are substrates useful for the sulfate-reducing microorganisms (US 5.587.079). Different patents presenting systems for the removal of sulfate in waters can be found. Some of these patents propose the use of sulfate-reducing microorganisms to achieve the removal of sulfate in waters. This is the case of patent application EP 0436254 Al and patent US 6.228.263. One important aspect that differentiates these patents is the substrate they consider to maintain the sulfate-reducing microorganism. Thus, as a substrate for the reduction of sulfate the patent application EP 0436254 Al proposes the use of ethanol or alcohol blends and US 6.228.263 proposes the use effluents with organic load such as wastewaters, tannery waters, brewery effluents, industries working with starch and remains of pulp and paper. A common place among the two patents is that they propose precipitating metals that may be present in the waters with the sulfhydric acid producing the sulfate reduction. Another alternative in relation with those mentioned is the patent application US 2004/0168975 consisting of a system for the reduction of sulfate present in waters based on the use of a set of microorganisms. This set of microorganisms would be comprised by sulfate-reducing microorganisms and others with the capability of being used as complex substrates, which are more profitable than the typical substrates of the sulfate reducing bacteria. All the patents mentioned so far correspond to biological systems, anyhow there are treatments that are in part or completely physicochemical. Thus the patent US 7.914.676 presents an alternative for the treatment of water with high contents of metals and sulfate. This system considers the removal of metals by precipitating them as metallic sulfurs. For the removal of sulfate in water the precipitating of sulfate using lime is considered. Then, the precipitated sulfate is reduced using sulfate-reducing microorganisms producing the necessary sulfur for the precipitation of the metals in the first stage of the treatment. On the other hand the patent application US 2010/0108603 corresponds to a chemical alternative for the treatment of waters with high levels of sulfate and metals. It is based on the use of basic substances allowing the precipitation of metals present in the waters. Then by means of a filtration system two effluents are obtained: one with low concentration of sulfate and metals and another one with high concentration of sulfate and metals that is introduced again into the treatment. 6279465_1 (GHMatters) P99198.AU LYNT -3 It is important to note that part of the patents mentioned aim to resolve the issue of the presence of metals in the waters. On the other hand, patent US 7.326.344 depicts a system for the removal of heavy metals based on the biosorption process without considering the issue of removing the sulfate. This technology results in concentration of metals below 10 mg/L. This alternative may be used to treat mine acid drainages and remove the metals, although it does not solve the problem of the sulfate high concentrations. The alternatives currently available have different drawbacks so none of them represent a complete alternative for the treatment of waters with high concentration of sulfate. Thus, the use of lime to precipitate the sulfate is not much of an efficient alternative since it does not allow decreasing the concentration of sulfate below 1000 mg/L. Consequently, with this treatment the compliance with the environmental rules for discharging effluents in different countries is not achieved. On the other hand, in the case of effluents with a high concentration of metals, the precipitation of metals in hydroxide form has been suggested. This generates muds that are difficult to treat. Another disadvantage regarding the generation of these muds is that they prevent metals from being removed in waters that in some cases, have a considerable economic value. In the more complex case, the effluent with a high concentration of metals and sulfate, the use of sulfate-reducing microorganisms is difficult because the toxic or inhibitory effect of the metals affect the capacity of reducing the sulfate. Besides, these bacteria use only organic molecules of low molecular weight as electrons donors, such as pyruvate, lactate, ethanol or blends of alcohols. This represents a disadvantage from an economic standpoint because the current high cost of these substrates makes the use of this process at an industrial scale expensive and almost non-viable. This invention solves the issues of the state of the technique using a synergic combination of a treatment system for the removal of metals by means of biosorption with a bacterial biomass to reduce the inhibiting concentration of metals in waters, followed by a process of sulfate removal that uses a halotolerant sulfate-reducing microbial consortium capable of using complex organic substrates such as agroindustrial products or residues thereby decreasing operations costs of the system. The halotolerant characteristic of the consortium provides the process with a higher flexibility to treat mining effluents contaminated with metals that frequently show high levels of salts concentration. 6279465_1 (GHMatters) P99198.AU LYNT -4 DEFINITION OF THE INVENTION The main objective of this invention is a method for the biological removal of sulfate and metals from mining effluents, mine acid drainages and different industrial liquid residues comprising at least the steps of: a) subjecting the effluent to at least a first step of removing the metals in solution by biosorption with a bacterial biomass added on itself forming floccules of easy sedimentation and separation or a bacterial biomass attached to inert support materials forming a biofilm, and b) subjecting the liquid previously treated in the biosorption step to a second halotolerant sulfate continuous removal step in an anaerobic bioreactor by a halotolerant sulfate reducing microbial consortium capable of using complex carbonaceous organic compounds as electrons donors. In an embodiment of the invention, and as additional step before the treatment by biosorption, the invention comprises subjecting the effluent to a pre-treatment with lime to reduce the concentrations of sulfate and metals. In another embodiment of the invention, the bacterial biomass is comprised by natural bacteria consortium that form a biofilm isolated from the environment. In another additional embodiment of the invention, the bacterial biomass is comprised by a population of bacteria selected from the Bacillus, Pseudomonas, Klebisella, Enterobacter genders. In another preferred embodiment of the invention, the bacterial biomass is comprised by the Bacillus sp. VCHB-10 strain deposited as NRRL-B-30881. In an embodiment of the invention, the first removal step for the metals in solution by means of biosorption with a bacterial biomass added on itself, comprises at least the steps of: a) growing the bacteria forming aggregates in a bioreactor, b) sedimenting the aggregates and removing the culture medium from the bioreactor, 6279465_1 (GHMatters) P99198.AU LYNT -5 c) contacting the water containing metal ions with the aggregates in the bioreactor to remove them by biosorption, sedimenting the aggregates, removing the treated water, contacting again the water containing the metal ions with the aggregates as many times as necessary until its biosorption capacity decreases due to the saturation, d) leaving the aggregates to sediment and remove the remaining water from the bioreactor, e) adding a diluted acid to elute the metal ions captured by the aggregates and f) repeating the process from step c. In another embodiment of the invention the first step of removing the metals in solution by biosorption with a bacterial biomass attached to inert support materials forming a biofilm comprises at least the steps of: a) growing bacteria forming a biofilm in a fixed-bed bioreactor, b) removing the culture medium from the bioreactor, c) contacting in a continuous or semi-continuous way the water containing metal ions with the biofilm from the fixed-bed bioreactor to remove them by biosorption until its biosorption capacity starts to decrease due to the saturation, d) adding a diluted acid to elute the metal ions captured by the biofilm, and e) repeating the process from step c. In an embodiment of the invention, the second step of continuous removal of sulfate in a fixed bed anaerobic bioreactor by halotolerant sulfate-reducing microbial consortium comprises at least the steps of: a) growing the sulfate-reducing microbial consortium in a fixed-bed bioreactor containing the support material of the bioreactor and a culture medium comprised by at least one or more complex carbonaceous organic compounds as electrons donors and sulfate, b) re-circulating the culture medium of the bioreactor until a sulfate-reducing consortium biofilm is formed on the support material of the bioreactor, 6279465_1 (GHMatters) P99198.AU LYNT -6 c) contacting in a continuous or semi-continuous way the water previously treated by means of the step of metals biosorption with the biofilm of the sulfate-reducing consortium in the anaerobic bioreactor and simultaneously adding a suspension of one or more complex carbonaceous organic compounds as electrons donors, and d) removing the treated water from the anaerobic bioreactor. In another embodiment of the invention, the second step of the continuous removal of the sulfate in an anaerobic bioreactor by a halotolerant sulfate-reducing microbial consortium comprises at least the steps of: a) growing the sulfate-reducing microbial consortium in a bioreactor containing a culture medium comprised by, at least one or more complex carbonaceous organic compounds in particulate form as electrons donor and sulfate, b) re-circulating the culture medium of the bioreactor until the sulfate-reducing consortium biofilm is formed on the complex carbonaceous organic compound(s) in particulate form, c) contacting in a continuous or semi-continuous way the water previously treated by the step of metals biosorption with the sulfate-reducing consortium biofilm in the anaerobic bioreactor and simultaneously adding a suspension of one or more particulate complex carbonaceous organic compounds as electrons donors, and d) removing the treated water from the anaerobic bioreactor. In an embodiment of the invention, the halotolerant sulfate-reducing microbial consortium is enriched from an environment sample. In another embodiment of the invention the environment sample is anaerobic mud from a saline pond or a salt flat. In an embodiment of the invention the halotolerant sulfur-reducing microbial consortium is comprised of at least hydrolytic, fermentative, acetogenic and sulfur-reducing microorganisms. In an embodiment of the invention the halotolerant sulfate-reducing microbial consortium is comprised by bacteria and arqueas. 6279465_1 (GHMatters) P99198.AU LYNT -7 In another embodiment of the invention the bacteria belong to at least the phylogenetic groups of proteobacteria a, @, y and 6 and bacteria of the Cytophaga-Flavobacterium group. In an additional embodiment of the invention the halotolerant sulfate-reducing microbial consortium presents the capacity of growing at sodium chloride concentrations between 0 and 100 g/L. In an embodiment of the invention the complex organic compound(s) are products of natural origin rich in polymeric organic compounds. In another embodiment of the invention the products of natural origin rich in polymeric organic compounds are selected from the cellulose group, the products or residues from lignocellulosic vegetables, the starch, the vegetable products or residues that are rich in starch, the sea algae, the microalgae and cyanobacteria. In an embodiment of the invention the support materials used in the biosorption step or sulfate reduction are selected from the group of ceramic, siliceous rock, glass and plastic. Definitions: Microbial consortium: in this invention the concept of microbial consortium is understood as a group of different microorganisms acting together. In a microbial consortium microorganisms with different metabolic capacities can be found. In the particular case of the sulfur-reducing microbial consortium it is comprised by, for example, hydrolytic, fermentative, acetogenic and sulfur reducing microorganisms. Among the hydrolytic microorganisms, proteolytic microorganisms (capable of degrading proteins), saccharolytic microorganisms (capable of degrading several sugars), lipolytic microorganisms (capable of digesting the lipids or fats), or celullitic microorganisms (capable of degrading the cellulose or the vegetable material) could be found. These different metabolic capacities allow the consortium to be capable of degrading a variety of complex organic residues. Description of the Figures FIGURE 1: 6279465_1 (GHMatters) P99198.AU LYNT -8 This figure shows the change occurred in the aspect of the culture medium with starch as substrate before and after culturing the sulfate-reducing microbial consortium. The black color is due to the precipitation of the iron sulfide due to the reaction between the sulfhydric acid produced by the microorganisms and the ferrous ion present in the culture medium. FIGURE 2: This figure shows the hybridization in situ of the microbial consortium cultured in a culture medium with spirulina. The percentage of each group is shown marked with the specific probes with regards to the total microorganisms marked with DAPI. The error bars correspond to the standard deviation between the percentages of microorganisms marked with the probe obtained from at least 3 different images. FIGURE 3: This figure shows the hybridization in situ of the microbial consortium cultures in a medium with starch. The percentage of each group is shown marked with the specific probes with regards to the total microorganisms marked with DAPI. The error bars correspond to the standard deviation between the percentages of microorganisms marked with the probe obtained from at least 3 different images. FIGURE 4: This figure shows the hybridization in situ of the microbial consortium cultures in a medium with cellulose. The percentage of each group is shown marked with the specific probes with regards to the total microorganisms marked with DAPI. The error bars correspond to the standard deviation between the percentages of microorganisms marked with the probe obtained from at least 3 different images. FIGURE 5: This figure shows the concentration of sulfate in media with spirulina and pH 4.0 (+); 5.0 (-+-); 6.0 (-) and 7.5 (-) at different times. The error bars correspond to the standard deviation of three independent cultures. * Shows a significant difference between the concentration of sulfate in media at pH 7.5 and media at pH 4 and 5 as per Duncan trial p<0.05. FIGURE 6: 6279465_1 (GHMatters) P99198.AU LYNT -9 This figure shows the concentration of sulfate in media with starch and pH 4.0 (+); 5.0 (-4-); 6.0 (-) and 7.5 (-,-) at different culture times. The error bars correspond to the standard deviation of three independent cultures. * Shows a significant difference between the concentration of sulfate in media with pH 7.5 and 6 and the media at pH 4 and 5 as per Duncan trial p<0.05. FIGURE 7: This figure shows the concentration of sulfate in media with cellulose and pH 4.0 ('); 5.0 (-4-); 6.0 () and 7.5 (-+-) at different culture times. The error bars correspond to the standard deviation of three independent cultures.. * Shows a significant difference between the concentration of sulfate in media with pH 7.5 and media with pH 4.0; 5.0 and 6.0 as per Duncan trial p<0.05. FIGURE 8: This figure shows the concentration of sulfate in culture media with spirulina with the following concentration of copper 0 (-+-), 100 (+), 120 (+), 140 (-*-), 160 ( . ) and 180 (-4-) mg/L at different culture times. The error bars correspond to the standard deviation of three independent cultures. * Shows a significant difference between the concentration of sulfate in media without copper and in media with copper as per Duncan trial p<0.05. FIGURE 9: This figure shows the concentration of sulfate in culture media with starch with the following concentration of copper 0 (- ), 40 (-4-), 60 (+), 80 (+) and 100 (-x-) mg/L at different culture times. The error bars correspond to the standard deviation of three independent cultures. * Shows a significant difference between the concentration of sulfate in media without copper and in media with copper as per Duncan trial p<0.05. FIGURE 10: This figure shows the concentration of sulfate in culture media with cellulose with the following concentration of copper 0 (.-), 20 (-4-), 40 ('), 60 (-+) and 80 (-x-) mg/L at different culture times. The error bars correspond to the standard deviation of three independent cultures. 6279465_1 (GHMatters) P99198.AU LYNT -10 * Shows a significant difference between the concentration of sulfate in media without copper and in media with copper as per Duncan trial p<0.05. FIGURE 11: This figure shows the concentration of sulfate in culture media with starch with the following zinc concentrations 0 (..-), 100 (+), 120 (-. ), 140 ( . ), 160 ( :+:) and 180 (-4-) mg/L at different culture times. The error bars correspond to the standard deviation of three independent cultures. * Shows a significant difference between the concentration of sulfate in media without zinc and in media with zinc as per Duncan trial p<0.05. FIGURE 12: This figure shows the concentration of sulfate in culture media with cellulose with the following zinc concentrations 0 (--), 40 (-4-), 60 (+), 80 (---) and 100 ( :--) mg/L at different culture times. The error bars correspond to the standard deviation of three independent cultures. * Shows a significant difference between the concentration of sulfate in media without zinc and in media with zinc as per Duncan trial p<0.05. FIGURE 13: This figure shows the concentration of sulfate and sulfhydric acid in the effluent of the bioreactor without support during the semi-continuous operation period. Day 66 corresponds to the day the feeding of the bioreactor is started in a semi-continuous way. The concentration of sulfate (.--) and sulfhydric acid (-0-) in the effluent of the bioreactor, concentration of initial sulfate of the culture medium (- ), maximum limit of sulfate established for superficial waters (rule 182637, Decree Supreme 90, Chile) ( - ). The error bars correspond to the standard deviation of three measurements done to the same sample. FIGURE 14: This figure shows the concentration of sulfate and generation of sulfhydric acid in the effluent of the bioreactor with silica gravel as support during the semi-continuous operation period. Day 98 corresponds to the day when the feeding of the bioreactor in a semi-continuous way starts. The concentration of sulfate (---) and sulfhydric acid (-4-) in the effluent of the bioreactor, sulfate 6279465_1 (GHMatters) P99198.AU LYNT -11 initial concentration of the culture medium (-), maximum limit of sulfate established for superficial waters (rule 182637, Decree Supreme 90, Chile) ( The error bars correspond to the standard deviation of three measurements done to the same sample. FIGURE 15: This figure shows the concentration of sulfate and generation of sulfhydric acid in the effluent of the bioreactor with Celite R-635 as support during the semi-continuous operation period. Day 98 corresponds to the day when the feeding of the bioreactor in a semi-continuous way starts. The concentration of sulfate (+) and sulfhydric acid (--) in the effluent of the bioreactor, sulfate initial concentration of the culture medium (-), maximum limit of sulfate established for superficial waters (rule 182637, Decree Supreme 90, Chile) (--). The error bars correspond to the standard deviation of three measurements done to the same sample. FIGURE 16: This figure shows the concentration of sulfate and sulfhydric acid in the effluent of the bioreactor with Celite R-635 fed with MAD in a semi-continuous way. Day 1 the feeding with culture medium started and day 9 with MAD. Sulfate (-) and sulfhydric acid (-4-) concentration in the effluent of the bioreactor, concentration of sulfate of the culture medium or the MAD (-), maximum limit of sulfate established for superficial waters (rule 182637, Decree Supreme 90, Chile) (- -). The error bars correspond to the standard deviation of three measurements done to the same sample. FIGURE 17: This figure depicts the flow diagram of a particular application of the process for the biological removal of sulfate and metals from mining effluents, mine acid drainages or different industrial liquid residues. The following examples describe some actual applications of the invention although they do not intend to limit the framework or scope of this invention. EXAMPLES Example 1 6279465_1 (GHMatters) P99198.AU LYNT - 12 Sulfate-reducing microbial consortium culture using complex carbonaceous substrates. The microbial consortium is enriched from the anaerobic sediment of a saline pond. The culture of the microbial consortium with complex substrates (microcrystalline cellulose, starch, spirulina and industrial starch) is done in 15 cm high by 1.5 cm wide test tubes with 10 mL culture medium. The modified Postage "C" culture medium is used (Barton and Tomei, 1995. "Characteristics and activities of sulfate-reducing bacteria". In: Sulfate-Reducing Bacteria. Ed: Baron I. L. 1-32.). Table 1 shows the composition of each of the culture media with their respective substrates. The starch corresponds to insoluble corn starch from Merck, Germany. The cellulose corresponds to Microcrystalline Cellulose Sigmacell provided by Sigma USA. The spirulina corresponds to Spirulina GNC supplied by General Nutrition Centers, U.S.A. The industrial corn starch corresponds to normal corn starch 034010, Buffalo supplied by Inducorn S.A., Chile. Once the culture media are prepared the pH is set at 7.5 and are autoclaved for 15 minutes at 121 *C. Once sterilized the media are covered with paraffin oil (Biom6rieux, France) still hot in order to keep the anaerobiosis in the culture medium. The sterile media are inoculated with approximately 500 pL of the former culture and is kept at 28 *C. Table 1: Composition of the modified Postgate "C" culture media with different nutrients. Compound [g/L] Culture media Starch Cellulose Spirulina Industrial starch

K

2

HPO

4 0,5 0,5 0,5 0,5

NH

4 CI 1,0 1,0 1,0 1,0 Na 2

SO

4 1,0 1,0 1,0 1,0 CaC1 2 .6H 2 0 0,1 0,1 0,1 0,1 MgSO 4 97H 2 0 2,0 2,0 2,0 2,0 NaCl 60 60 60 60 FeSO 4 97H 2 0 0,5 0,5 0,5 0,5 Yeast extract 0,5 0,5 0,5 0,5 Starch 40 ---- ---- -- Cellulose ---- 40 ---- -- Spirulina ---- ---- 20 -- Industrial starch --- --- --- 20 6279465_1 (GHMatters) P99198.AU LYNT -13 The growth of the microbial consortium is determined by means of the appearance of black precipitate which corresponds to FeS. The former is produced by the reaction of H2S produced by the reduction of sulfate with iron present in the culture medium. Figure 1 is an exemplary illustration of the change produced when culturing the microbial consortium in a medium containing starch as substrate. Figure 1A shows the sterile culture medium and Figure 1B shows the culture medium after having inoculated and cultured for 20 days. The same change in color can be seen in all culture media with the different substrates (cellulose, spirulina and industrial starch). The characterization of the microbial populations enriched in the different complex organic compounds was done using the in situ hybridization technique. Table 2 shows the probes and their characteristics used to perform the in situ hybridization with fluorescent probe. Table 2: Sequences, position in the target rRNA and specificity of the probes used in the hybridization in situ (Amann et al. 1995. "Phylogenetic identification and in situ detection of individual microbial cells without cultivation". Microbiol. Rev. 59: 143-169). Probe Sequence rRNA position Specificity EUB 338 GCTGCCTCCCGTAGGAGT 16S, 338-355 Bacteria Archaea GTGCTCCCCCGCCAATTCCT 16S, 915-934 Arqueas Sub-class a of the ALF lb CGTTCGYTCTGAGCCAG 16S, 19-35 Proteobacteria Sub-class @ of the BET 42a GCCTTCCCACTTCGTTT 23S, 1027-1043 Proteobacteria. Sub-class y of the GAM 42a GCCTTCCCACATCGTTT 23S, 1027-1043 Proteobacteria. 6279465_1 (GHMatters) P99198.AU LYNT - 14 Most of the members of sub BRS 385 CGGCGTCGCTGCGTCAGG 16S, 385-402 class 6 of the Proteobacteria. CF319a TGGTCCGTGTCTCAGTAC 16S, 319-336 Cytophaga-Flavobacterium In order to perform the microbial consortium hybridization in situ 100 IpL of culture is taken and placed in 900 IpL PBS and centrifuged for 5 minutes at 4724 x g. Once the centrifuging is done the supernatant is discarded and the pellet is re-suspended in 900 IpL PBS, then centrifuged for 3 minutes at 111.8 x g. From the supernatant of the second centrifuging 50 IpL are taken and placed on a microscope slide where the sample is fixed with heat. Once fixed, 20 IpL 37% formaldehyde is added on each sample for 20 minutes. Then 50 IpL of the hybridization solution is added to each sample (see Table 3) containing 20 mg of probe marked on each of the samples. They are incubated for one and a half hours at 37 *C. Then a rinse with the rinsing solution (see Table 4) is performed for half hour at 37 *C. Table 3: Hybridization solution composition for the hybridization in situ. The composition of this solution depends on the probe used. The hybridization solution 1 was used for probes ALF lb and EUB 338, while the hybridization solution 2 was used for probes BET42a, GAM42a, CF319a and BRS385. Compound Hybridization 1 Hybridization 2 Formamide 20 % 35% NaCl 0,9 M 0,9 M Tris/HCI pH 7,2 20 mM 20 mM SDS 0,01% 0,01% Once rinsed the microscope slides are left to dry and dyed later with DAPI (4',6-Diamidino-2 phenylindole). The stain with DAPI is done adding 20 IpL of a solution containing this fluorochrome at a 50 pL/mL concentration. After 10-15 minutes it is rinsed with distilled water to eliminate the excess of DAPI. Once the hybridization is done, it is watched in an epifluorescence microscope with Zeiss N* 20 filter for probe marked with CY3 and Zeiss N* 09 filter to see the bacteria marked with DAPI. The samples were photographed using a Canon PowerShot sx110 IS camera and the Remote Capture v.3.0.1.8 software. The images were processed using the ImageJ software to decrease the background in those that needed it. With the images obtained a counting of the 6279465_1 (GHMatters) P99198.AU LYNT -15 microorganisms marked is done with each of the specific probes and the total microorganisms marked with DAPI. The hybridization in situ is applied to the microbial consortiums cultures between 5 and 7 days in test tubes with cellulose, starch and spirulina media as nutrients. Table 4: Composition of the rinse solution for hybridization in situ. The composition of this solution depends on the probe to be used. The rinse solution 1 was used for probes ALF lb and EUB 338, while rinse solution 2 was used for probes BET42a, GAM42a, CF319a and BRS385. Compound Rinse 1 Rinse 2 Tris/HCI pH 7,2 20 mM 20 mM SDS 0,01% 0,021% NaCl 180 mM 40 mM EDTA 5mM 5mM When spirulina is used as complex organic compound the results show that the microbial consortium is comprised by microorganisms of all the groups studied (Figure 2). So, approximately 56% of microorganisms correspond to bacteria while 7% are arqueas. On the other hand, the proteobacteria 6 correspond to a considerable percentage within the microorganisms present in the sample reaching 21% of the total. This percentage is higher to the one found using the specific probes for proteobacteria a, @ and y and bacteria of the group Cytophaga-Flavobacterium since the percentages found with these are below 11%. As can be seen in Figure 3, the microbial consortium kept in a medium with starch is comprised by microorganisms of all the groups studied as well as the consortium cultured in media with spirulina. This way near 47% of the microorganisms correspond to bacteria, while 13% of microorganisms present are Arqueas. On the other hand, the presence of proteobacteria 6 can be observed in the sample and reach 14% of the total microorganisms. Unlike what is observed in the culture medium with spirulina, the proteobacteria 6 do not represent a majority and can be found in a proportion similar to the microorganisms marked with the probes specific for proteobacteria a and bacteria of the Cytophaga-Flavobacterium group that correspond to 15 and 12% respectively of the total microorganisms. Instead in a similar way to what was found in the medium with 6279465_1 (GHMatters) P99198.AU LYNT -16 spirulina, the microorganisms marked with the specific probe for proteobacteria @ and y reach 5 and 4% respectively. When cellulose is used as complex organic compound, the results also show that the sulfate reducing consortium is formed by all the groups studied (Figure 4). In the sample of the microbial consortium, 34% of the microorganisms correspond to bacteria and near 2% of microorganisms present are Arqueas, both percentages are lower as compared to what was found with the culture media with spirulina and starch. The percentage of proteobacteria 6 within the sulfate-reducing consortium reaches 13% of the total microorganisms. Also, the presence of proteobacteria a, @ and y and bacteria of the Cytophaga-Flavobacterium group is detected in percentages below 9%. Therefore, the halotolerant sulfate-reducing microbial consortium is comprised by bacteria and arqueas. Its proportion depends on the complex carbonaceous organic compound used for its culture. Regarding bacteria, these belong to, at least, the phylogenetic groups of proteobacteria a, @, y and 6 and bacteria of the Cytophaga-Flavobacterium group. Its ratio also depends on the type of electrons donor with which it is cultured. Example 2 Effect of the pH on the microbial consortium's capacity of reducing sulfate. The culture media composition is the one used for Example 1, although the pH is set at 4.0, 5.0, 6.0 and 7.5; using potassium hydroxide (KOH) to alkalify and phosphoric acid (H 3

PO

4 ) to acidify. The effect of the pH on the microbial consortium's capacity of reducing sulfate is determined by the concentrations of sulfate in media with spirulina, cellulose and starch at different culture times. To determine the concentration of sulfate a turbidimetric technique is used. Between 600 1000 IpL sample from the culture media are taken and centrifuged for 15 minutes at 4724 x g. From the supernatant obtained 500 IpL was taken and placed in 39.5 mL distilled water. From the resulting solution 10 mL is taken and the initial turbidity is measured, then 3g barium chloride is added (BaCI 2 ) in the 10 mL sample and shaken for 1 minute. When adding the BaCl 2 a precipitate is produced and this corresponds to BaSO4. The turbidity measured is proportional to the amount of precipitate and therefore to the amount of sulfate present in the sample since BaCL 2 is added in excess (American Public Health Association, American Water Works Association y Water 6279465_1 (GHMatters) P99198.AU LYNT -17 Environment Federation. 1998. "4500-SO42-E". En: "Standard Methods for the Examination of Water and Wastewater". Ed. 20.). Once shaken, the sample is left to decant those larger particles for 5 minutes and the turbidity of the sample is measured at 890 nm. By means of a calibration curve prepared from a sulfate standard solution, the correlation between turbidity and concentration of sulfate is obtained. So, by the difference between the initial turbidity and the turbidity obtained after adding barium chloride, the concentration of sulfate in the samples is determined. Figure 5 shows the concentration of sulfate in time when cultivating the sulfate-reducing microbial consortium in media with different pH and spirulina as substrate. In the culture media with spirulina at pH 6.0 and 7.5after nine days culture of the microbial consortium there is a decrease in the concentration of sulfate, reaching values near to 11 and 10 mM respectively. On the other hand, in the culture media with pH 5.0 and 4.0 until day 17 of culture, no decrease in the levels of sulfate is observed. The statistical analysis, by means of the Duncan trial with p<0.05 indicates there is a significant difference between the concentration of sulfate in the culture medium with pH 7.5 with regards to the media with pH 4.0 and 5.0 on days 14 and 17 of culture. Figure 6 shows the concentration of sulfate in time when culturing the sulfate-reducing microbial consortium in media with different pH and starch as substrate. In the media culture with pH 6.0 and 7.5 there is a decrease in the concentration of sulfate unlike the media with pH 4.0 and 5.0. The difference between initial and final concentration of sulfate in the media with pH 6.0 and 7.5 is statistically significant as per Duncan's trial. The levels of sulfate decrease up to approximate values of 5.5 mM sulfur in media with pH 7.5. On the other hand, in the culture medium at pH 6.0 the concentration of sulfate is reduced at levels below 7.0 mM. Duncan's statistical trial shows that there are significant differences among the concentrations of sulfate measured in the media at pH 4.0 and 5.0 as compared to the media with pH 7.5 and 6.0 on days 19 and 26 of culture. Moreover, there is not a significant statistical difference between the concentration of initial and final sulfate in the culture media with pH 4.0 and 5.0; unlike the media with pH 6.0 and 7.5 where there actually is difference. Figure 7 shows the concentration of sulfate in time when culturing the sulfate-reducing microbial consortium in media with different pH and cellulose as substrate. The higher decrease in the sulfate levels is produced at pH 7.5 being the initial and final concentrations of sulfates significantly different as per Duncan's trial. In the culture medium with pH 6.0 also a decrease in 6279465_1 (GHMatters) P99198.AU LYNT - 18 sulfate levels between the initial and final concentration of sulfate is also observed. Although this decrease is smaller than that with the medium at pH 7.5, likewise it is statistically significant. The culture media with pH 4.0 and 5.0 do not show a considerable sulfate decrease and this is confirmed by the statistical analysis indicating that there is no significant difference. Moreover, there is a statistically significant difference between the concentration of sulfate in the medium with pH 7.5 as compared to the media with pH 4.0, 5.0 and 6.0 on day 26 of culture. Example 3 Effect of the presence of metals in the microbial consortium's capacity of reducing sulfate. Preparing culture media with spirulina, starch and cellulose as substrate the same way as was done in Example 1 although with different metal concentrations. Metals used Zn 2 ' and Cu 2 ' are added as salts (ZnC1 2 y CuC1 2 respectively). The culture media with spirulina have the following concentrations 0, 100, 120, 140, 160 and 180 mg/L copper. The culture media with starch have the following concentrations 40, 60, 80 and 100 mg/L copper and 100, 120, 140, 160 and 180 mg/L zinc. For the media with cellulose culture the following concentrations are used 20, 40, 60 and 80 mg/L copper and 40, 60, 80 and 100 mg/L zinc. Figure 8 shows the concentration of sulfates in media with spirulina and different concentration of coppers where the microbial consortium was cultured. The control shows a tendency to decrease the levels of sulfate on culture days 2, 4 and 6 that is not seen in culture media with copper. Duncan's statistical trial indicates that there is a significant difference between the control without copper and the medium with 200 mg/L copper on day 2 and between the control and the medium with 140 mg/L on culture day 4. This means that the removal of sulfate in a culture medium without copper would happen before than in the media with copper. Figure 9 shows the concentration of sulfate in cultures with starch at different concentration of copper. The microbial consortium cultured in a medium with starch is capable of reducing the sulfate levels in the presence of copper but in less amount with respect to the control without copper. Using the Duncan trial a significant difference in the concentration of sulfate on culture day 11 between the control and the media with copper can be found. Moreover, there is a significant difference between the control and the media with 60, 80 and 100 m/L copper on days 22 and 27. 6279465_1 (GHMatters) P99198.AU LYNT - 19 Figure 10 shows the concentration of sulfate in cultures with cellulose and different concentration of copper. Duncan's statistical trial indicates that there is only significant difference between the initial and final concentration of sulfate of the control cultures without copper. Moreover, there is a significant statistical difference in the concentration of sulfate on culture days 29 and 38 between the control without copper and the culture media with copper. With all concentrations of copper used there was an inhibition in the capacity of the microbial consortium of reducing sulfate. Figure 11 shows the concentration of sulfate in cultures with starch and different concentration of zinc. The control condition without zinc is the only one where a decrease in the levels of sulfate occurs. Duncan's statistical analysis indicates that there is a significant difference in the sulfate levels from culture day 7 on between the control condition without zinc and the culture media with zinc. Figure 12 shows the concentration of sulfate in cultures with cellulose and different concentrations of zinc. In the control condition without zinc, such as in cultures with 40 and 60 mg/L zinc there is a decrease in the concentration of sulfate. Anyhow, this decrease is only statistically significant in control cultures and with 40 mg/L zinc. Duncan's trial indicates that on culture day 29 there are significant differences between the concentration of sulfate of the control without zinc and the culture media with zinc. On the other hand on culture day 39 there is a significant difference between the control and culture media with 60, 80 and 100 mg/L zinc. Example 4 Removal of sulfate using a sulfate-reducing microbial consortium kept in a bioreactor without support material. Use a glass bioreactor with a useful volume of 496 cm 3 , (dimensions: 49 cm high x 3.6 cm wide). The bioreactor is filled with culture medium with the composition shown in Table 1 and industrial starch as substrate at a concentration of 2 g/L. In order to keep the anaerobiosis thioglycolic acid in the culture medium at a 0.1 g/L concentration is used. The bioreactor is inoculated with an already grown culture from the sulfate-reducing microbial consortium kept without support material. The bioreactor is kept at 28 *C. The bioreactor operates for 65 days as batch until the 6279465_1 (GHMatters) P99198.AU LYNT - 20 sulfate-reducing consortium biofilm is formed on the starch. In this case, and because it is partially in the form of solid particles in the culture medium, the starch itself acts simultaneously as substrate and solid material for the attachment of the microorganisms. As of day 66 it starts to be fed daily in a semi-continuous way. For the feeding and re-circulation of the bioreactors Cole Parmer Instrument Co., U:S.A. peristaltic pumps model 7554-30,1- 100 rpm are used. Table 5: Modified parameters during the operation of the bioreactor without support. Batch Semi-continuous Days 1-34 35-65 66-78 79-81 82-85 86-90 Re-circulation* --- 50 % 100 % 100 % 100 % 100 % Feeding* --- --- 10% 20% 40% 30% pH --- --- 7.5 7.5 9 9 * Percentage of the total volume of the bioreactor re-circulated and fed daily. Table 5 shows the modifications in re-circulation, feeding and pH of the medium used to feed the bioreactor at different times. Figure 13 shows the concentration of sulfate and sulfhydric acid in the effluent of the bioreactor during the semi-continuous period. The concentration of sulfate at the moment of starting the feeding is over the regulation (maximum sulfate level established for superficial waters in rule 182637 Decree Supreme 90, Chile) and is kept until day 72 when it decreases to approximately 9 mM. By day 74 a concentration of sulfate in the vicinity of 7.3 mM is registered which is kept stable between 7.0 and 7.5 mM until day 81. The concentration of sulfate is kept below 7.5 mM despite that on day 79 of operation the daily feeding volume is increased from 10 to 20%. Anyhow, when the daily feeding volume is increased to 40% of the volume of the bioreactor, an increase in the concentration of sulfate in the bioreactor's effluent is produced thereby causing an increase in the concentration of sulfate in the bioreactor's effluent hence taking its value on day 85 above the regulation. Finally it can be seen that the concentration of sulfate at the end of the 6279465_1 (GHMatters) P99198.AU LYNT - 21 experiment reaches values below the regulation because the feeding volume decreases by 30%. The sulfhydric acid concentration in the bioreactor's effluent at the beginning of the operation as semi-continued produces an exponential increase reaching an approximate value of 1.3 mM on day 70. As of this day an important variability in the concentration of sulfhydric acid can be observed reaching values between 1.0 and 2.5 mM. Example 5 Removal of sulfate using a sulfate-reducing microbial consortium kept in a bioreactor with silica gravel as support material. Use a Teflon bioreactor with 4120 cm 3 useful volume (dimensions: 49 cm high x 3.3 cm wide). The bioreactor is filled with culture medium as described in Example 4 although it is further added 313 g silica gravel as support material. The bioreactor is inoculated with a culture that grew in contact with the silica gravel. Table 6: Modified parameters during the bioreactor operation with silica gravel as support material. Batch Semi-continuous Days 1-66 67-97 98-105 106-112 113-116 117-121 Re-circulation* --- 50 % 100 % 100 % 100 % 100 % Feeding* --- --- 10% 10% 20% 30% pH --- --- 7.5 8 9 9 *Percentage of the total volume of the bioreactor re-circulated and fed daily. Table 6 shows the re-circulation, feeding and pH modifications of the medium used to feed the bioreactor at different times. Figure 14 shows the sulfate and sulfhydric concentrations in the bioreactor's effluent with silica gravel once the feeding is started as semi-continuous system. Regarding the concentration of sulfate, it can be seen that when starting the feeding of the bioreactor the rule of sulfate is 6279465_1 (GHMatters) P99198.AU LYNT - 22 exceeded (rule 182637 Decree Supreme 90, Chile). By keeping the feeding volume at 10% no decrease in the concentration of sulfate is observed. As of day 106 a culture medium with pH 8 was used to feed the bioreactor. On day 107 a decrease in the sulfate levels is observed so the concentration decreases below the rule. A sustained decrease in the concentration of sulfate is observed with a feeding corresponding to 10% of the volume with pH8 until reaching on day 112 an approximate value of 5.5 mM. An increase in the feeding volume on day 113 from 10 to 20% of the volume generates a slight increase in the concentration of sulfate. On day 117 of operation the lower concentration of sulfate is reached which corresponds to approximately 4.8 mM. The increase in the feeding volume on day 117 from 20 to 30% of the volume produces a considerable increase in the concentration of sulfate, notwithstanding this is kept below the rule. Regarding the concentration of sulfhydric acid a gradual increase until day 113 is observed reaching an approximate concentration of 3.0 mM. From day 116 on the concentration varies between 2.8 and 5 mM sulfhydric acid. Example 6 Removal of sulfate using a sulfate-reducing microbial consortium kept in a bioreactor with Celite R-635 as support material. A bioreactor as the one described in Example 4 is used and further added 200 g Celite R-635 as support material. The bioreactor is inoculated with a culture grown in contact with Celite R-635. Table 7 shows the re-circulation, feeding and pH modifications of the medium used to feed the bioreactor at different times. Table 7: Modified parameters during the operation of the bioreactor with Celite R-635 as support. Batch Semi-continuous Days 1-66 67-97 98-109 110-112 113-116 117-121 Re-circulation* --- 50 % 100 % 100 % 100 % 100 % Feeding* --- --- 10% 20% 40% 30% pH --- --- 7,5 7,5 9 9 *Percentage of the total volume of the bioreactor re-circulated and fed daily. 6279465_1 (GHMatters) P99198.AU LYNT - 23 Figure 15 shows the concentrations of sulfate and sulfhydric acid in the bioreactor's effluent with silica gravel once the feeding is started as semi-continuous system. At the moment the feeding starts the concentration of sulfate is below the rule (rule 182637 Decree Supreme 90, Chile). This condition is kept until day 109 in which period it is fed with 10% of the volume. It can be observed that there is no increase in the concentration of sulfate as of day 110 when the feeding volume is increased from 10 to 20%. The volume feeding increase from 20 to 40% of the bioreactor's volume as of day 113 produces an increase in the concentration of sulfate so it reaches a 10 mM concentration on day 116. By decreasing the daily feeding volume up to 30% the concentration of sulfate decreases. The sulfhydric acid concentration increases until day 112 when a value of 4.8 mM is reached. On day 119 of operation a maximum value of 7 mM is reached. Example 7 Removal of sulfate present in a mine acid drainage (MAD) using a sulfate-reducing microbial consortium kept in a bioreactor with Celite R-635 as support material. A bioreactor like the one described in Example 6 is used to eliminate the sulfate present in a MAD previously treated. The pre-treatment consists of adding lime to increase the pH and precipitate the copper that is present. The amount of lime used is the necessary one to reach a pH equal to 6.3. The biosorption allows the decrease in the concentrations of metals present in the MAD. The treatment consists of putting the MAD in contact with a biomass obtained from a culture of the strain Bacillus sp VCHB-10 deposited as NRRL-B-30881 (US 7.951.578; US 7.479.220). Thereby, the metals present in the MAD are adsorbed by the biomass thus obtaining a MAD with a lower metal concentration. The obtaining of the biomass used in the biosorption is done as per the following protocol. Bacillus sp. VCHB-10 is cultured in solid TSA medium for 24 hours at 28 *C. From this culture a stripe is taken and inoculated in a fermenter (Multigen F-1000 Fermenter, 2 liters capacity, with aeration, temperature and agitation control, New Brunswick Scientific, U.S.A.) filled with sterile medium, the composition of the culture medium used can be seen in Table 8. The culture of Bacillus sp. VCHB-10 in a fermenter is done at 28* C during 16 hours with 200 rpm agitation and 0,75 vvm aeration. Once the culture time elapsed the biomass is left to decant and the supernatant is discarded. The biomass obtained is used for the biosorption of the metals 6279465_1 (GHMatters) P99198.AU LYNT - 24 present in the MAD. For this purpose 2 L of mine acid drainage are put in contact with the biomass in the bioreactor for 1 hour with agitation at 75 rpm. Once the biosorption is done the biomass is left to decant and the supernatant corresponding to the treated MAD with a low metal concentration is taken. Table 8: Composition of the culture medium for Bacillus sp. VCHB-10. Compound Concentration g/L Na 2

HPO

4 -2H 2 O 1,3

KH

2

PO

4 0,3

K

2

SO

4 0,1 NaCl 0,1 MgSO 4 -7H 2 O 0,02 CaC12-2H 2 0 0,013 FeSO 4 -7H 2 O 0,0018 Yeast extract 1,0 Triptone 1,0 Glucose 10,0 With a biosorption treatment the concentration of copper present in the MAD already treated with lime is decreased. Both treatments allow decreasing the concentration of copper from 1400 mg/L to 1.8 mg/L. After the MAD's pre-treatment K 2

HPO

4 , NH 4 CI is added and yeast extract at the same concentration of the culture medium. Table 9: Modified parameters during the bioreactor operation with Celite R-635 as support fed with culture medium or MAD Semi-continuous Days 1-9 10-13 14-18 19-23 Feeding Culture medium MAD MAD MAD Re-circulation* 100% 100% 100% 100% Feeding* 30% 30% 20% 20% 6279465_1 (GHMatters) P99198.AU LYNT - 25 pH 9 9 10 11 *Percentage of the total volume of the bioreactor re-circulated and fed daily The treatment with lime allows decreasing the concentration of sulfate from 37.5 mM up to 18.75 mM and the concentration of copper from 1.4 g/L up to 20 mg/L. The treatment by biosorption decreased the copper concentration from 20 mg/I up to 1.8 mg/L. Table 9 shows the re-circulation, feeding and pH modification of the medium used to feed the sulfate-reducing anaerobic bioreactor at different times. Figure 16 shows the concentrations of sulfate and sulfhydric acid in the bioreactor's effluent with Celite R-635 used to remove the sulfate present in a MAD. At the beginning the bioreactor is fed daily with culture medium corresponding to a 30% of the bioreactor's volume. As of day 10 the operation is fed with MAD corresponding to 30% of the bioreactor's volume. As of day 10 an increase in the concentration of sulfate is produced. On day 13 of the operation the feeding volume is decreased to 20% of the bioreactor's volume. The concentration of sulfate continues to increase until it reaches a stable concentration. Thereby the concentration of sulfate is kept as of day 18 of the operation at approximately 11.5 mM. The concentration of sulfhydric acid is kept stable in time in the vicinity of 6 mM. Example 8 Process for the biological removal of sulfate and metals The process consists of treating waters contaminated with sulfate or with sulfate and metals coming from industries of different sectors, mining among them. The process is comprised by a pre-treatment of the physicochemical type and biological and later with a biological treatment to decrease the concentration of sulfate using a sulfate-reducing microbial consortium capable of using complex substrates. As shown in Figure 17, the process begins with a pre-treatment divided in two stages. The waters with a high concentration of sulfate and metals enter through conduit 1 to the reactor 3, to which, through conduit 2 quicklime is added, which allows to decrease the concentration of metal and sulfate. Through conduit 4 the precipitate produced in the reactor 3 is removed. Through conduit 5 the effluent of the reactor 3 is taken to the reactor 7 where the removal of the metals is done by biosorption with a bacterial biomass. For the biosorption process biomass of Bacillus sp. VCHB-10 6279465_1 (GHMatters) P99198.AU LYNT - 26 is used. Through conduit 6 an acid solution to do the metal desorption process is added from the bacterial biomass into the reactor. Later through conduit 8 an effluent with high concentration of metals is obtained. The biomass present inside the reactor 7 is active again and can be used in a new biosorption/desorption cycle. Alternatively two or more bioreactors may be used to do the biosorption process in an alternate way and make the process continuous, keeping one of the bioreactors in biosorption stage and the other one in desorption stage. Through conduit 9 the effluent from reactor 7 is taken to the anaerobic bioreactor 11, where the sulfate-reducing microbial consortium removes the sulfate present in the effluent of the reactor 2. The nutrients for the sulfate-reducing microbial consortium are entered directly into the anaerobic bioreactor 11 through conduit 10. The anaerobic bioreactor can maintain the biomass of the sulfate-reducing microbial consortium with and without the support material. In case of using support material this may correspond to Celite R-635, silica gravel, polyurethane, charcoal or polyethylene. A re circulating system inside the anaerobic bioreactor 11 allows the optimization of the sulfate reducing process. Thereby through conduit 12 an effluent with low concentration of metals and sulfate is obtained. 6279465_1 (GHMatters) P99198.AU LYNT

Claims

1. A method for the biological removal of sulfate and metals from mining effluents mine acid drainages and different industrial liquid residues comprising at least the steps of: a) subjecting the effluent to at least a first step of removing the metals in solution by biosorption with a bacterial biomass added on itself forming floccules of easy sedimentation and separation or a bacterial biomass attached to inert support materials forming a biofilm, and b) subjecting the liquid previously treated in the biosorption step to a second step of continuous sulfate removal in an anaerobic bioreactor by a halotolerant sulfate-reducing microbial consortium capable of using complex carbonaceous organic compounds as electrons donors.

2. A method as in claim 1 wherein said method comprises an additional step before the treatment by biosorption, the invention comprises subjecting the effluent to a pre treatment with lime to reduce the concentrations of sulfate and metals.

3. A method as in claims 1 and 2 wherein said bacterial biomass is comprised by a consortium of natural bacteria biofilm formers isolated from the environment.

4. A method as in claims 1 and 2 wherein said bacterial biomass is comprised by a population of bacteria selected from the Bacillus, Pseudomonas, Klebsiella, Enterobacter genders.

5. A method as in claims 1 and 2 wherein said bacterial biomass is comprised by the Bacillus sp. VCHB-10 strain deposited as NRRL-B-30881.

6. A method as in claims 1 - 5 wherein said first step of removing the metals in solution by biosorption with a bacterial biomass added on itself comprises at least the steps of: a) growing the bacteria forming aggregates in a bioreactor, b) sedimenting the aggregates and removing the culture medium from the bioreactor, 6279465_1 (GHMatters) P99198.AU LYNT - 28 c) contacting the water containing metal ions with the aggregates in the bioreactor to remove them by biosorption, sedimenting the aggregates, removing the treated water, contacting again the water containing the metal ions with the aggregates as many times as necessary until its biosorption capacity decreases due to the saturation, d) leaving the aggregates to sediment and remove the remaining water from the bioreactor, e) adding a diluted acid to elute the metal ions captured by the aggregates and f) repeating the process from step c.

7. A method as in claims 1 - 5 wherein said first step of removing the metals in solution by biosorption with a bacterial biomass attached to inert support materials forming a biofilm comprises at least the steps of: a) growing bacteria forming a biofilm in a fixed-bed bioreactor, b) removing the culture medium from the bioreactor, c) contacting in a continuous or semi-continuous way the water containing metal ions with the biofilm from the fixed-bed bioreactor to remove them by biosorption until its biosorption capacity starts to decrease due to the saturation, d) adding a diluted acid to elute the metal ions captured by the biofilm, and e) repeating the process from step c.

8. A method as in claims 1- 7 wherein said second step of continuous removal of sulfate in a fixed-bed anaerobic bioreactor by halotolerant sulfate-reducing microbial consortium comprises at least the steps of: a) growing the sulfate-reducing microbial consortium in a fixed-bed bioreactor containing the support material of the bioreactor and a culture medium comprised by at least one or more complex carbonaceous organic compounds as electrons donors and sulfate, 6279465_1 (GHMatters) P99198.AU LYNT - 29 b) re-circulating the culture medium of the bioreactor until a sulfate-reducing consortium biofilm is formed on the support material of the bioreactor, c) contacting in a continuous or semi-continuous way the water previously treated by means of the step of metals biosorption with the biofilm of the sulfate-reducing consortium in the anaerobic bioreactor and simultaneously adding a suspension of one or more complex carbonaceous organic compounds as electrons donors, and d) removing the treated water from the anaerobic bioreactor.

9. A method as in claims 1 - 7 wherein said second continuous second step of continuous removal of sulfate in a fixed-bed anaerobic bioreactor by halotolerant sulfate-reducing microbial consortium comprises at least the steps of: a) growing the sulfate-reducing microbial consortium in a bioreactor containing a culture medium comprised by, at least one or more complex carbonaceous organic compounds in particulate form as electrons donor and sulfate, b) re-circulating the culture medium of the bioreactor until the sulfate-reducing consortium biofilm is formed on the complex carbonaceous organic compound(s) in particulate form, c) contacting in a continuous or semi-continuous way the water previously treated by the step of metals biosorption with the sulfate-reducing consortium biofilm in the anaerobic bioreactor and simultaneously adding a suspension of one or more particulate complex carbonaceous organic compounds as electrons donors, and d) removing the treated water from the anaerobic bioreactor.

10. A method as in claims 1 - 9 wherein said halotolerant sulfate-reducing microbial consortium is enriched from an environment sample.

11. A method as in claim 10 wherein said environment sample is anaerobic mud from a saline pond or a salt flat. 6279465_1 (GHMatters) P99198.AU LYNT -30

12. A method as in claims 1 - 11 wherein said halotolerant sulfate-reducing microbial consortium is comprised at least by hydrolytic, fermentative, acetogenic and sulfur reducing microorganisms.

13. A method as in claims 1 - 12 wherein said halotolerant sulfate-reducing microbial consortium is comprised by bacteria and arqueas.

14. A method as in claim 13 wherein said bacteria belong at least to the phylogenetic groups of proteobacteria a, @, V and 6 and bacteria of the Cytophaga-Flavobacterium group.

15. A method as in claims 1 - 14 wherein said halotolerant sulfate-reducing microbial consortium has the capacity of growing at sodium chloride concentrations between 0 and 100 g/L

16. A method as in claims 1 - 15 wherein said one or more complex organic compounds are products of natural origin rich in polymeric organic compounds.

17. A method as in claim 16 wherein said products of natural origin rich in polymeric organic compounds are selected from the cellulose group, the products or residues from lignocellulosic vegetables, the starch, the vegetable products or residues that are rich in starch, the sea algae, the microalgae and cyanobacteria.

18. A method as in claims 1 - 17 wherein said support materials are selected from the group of ceramic, siliceous rock, glass and the plastic. 6279465_1 (GHMatters) P99198.AU LYNT