AU2011205193B2 - Expression cassettes for regulation of expression in monocotyledonous plants - Google Patents
Expression cassettes for regulation of expression in monocotyledonous plants Download PDFInfo
- Publication number
- AU2011205193B2 AU2011205193B2 AU2011205193A AU2011205193A AU2011205193B2 AU 2011205193 B2 AU2011205193 B2 AU 2011205193B2 AU 2011205193 A AU2011205193 A AU 2011205193A AU 2011205193 A AU2011205193 A AU 2011205193A AU 2011205193 B2 AU2011205193 B2 AU 2011205193B2
- Authority
- AU
- Australia
- Prior art keywords
- sequence
- sequences
- expression
- genes
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Abstract
The present invention relates to expression cassettes comprising at least one transcription regulating nucleotide sequence obtainable from the group of genes of monocotyle-donous plants consisting of caffeoyl-CoA-O methyltransferase genes, C8,7-sterol isomerase genes, hydroxyproline-rich glycoprotein (HRGP) genes, lactate dehydrogenase genes, and chloroplast protein 12 like genes. More preferably the transcription regulating sequences are obtainable from Tea mays or Oryza sativa. The transcription regulating sequences are especially useful for root/kernel-preferential, leaf/endosperm preferential, root/silk/kernel-preferential or constitutive expression
Description
pool Section 29 Regulation 3.2(2) AUSTRALIA Patents Act 1990 COMPLETE SPECIFICATION STANDARD PATENT Application Number: Lodged: Invention Title: Expression cassettes for regulation of expression in monocotyledonous plants The following statement is a full description of this invention, including the best method of performing it known to us: 111AHAU/0710 Expression cassettes for regulation of expression in monocotyledonous plants FIELD OF THE INVENTION The present invention relates to expression cassettes comprising at least one transcrip tion regulating nucleotide sequence obtainable from the group of genes of monocotyle 5 donous plants consisting of caffeoyl-CoA-0-methyltransferase genes, C8,7-sterol isomerase genes, hydroxyproline-rich glycoprotein (HRGP) genes, lactate dehydro genase genes, and chloroplast protein 12 like genes. More preferably the transcription regulating sequences are obtainable from Zea mays or Oryza sativa. The transcription regulating sequences are especially useful for rot/kernel-preferential, leaf/endosperm 10 preferential, root/silk/kemel-preferential, or constitutive expression. BACKGROUND OF THE INVENTION Manipulation of plants to alter and/or improve phenotypic characteristics (such as pro ductivity or quality) requires the expression of heterologous genes in plant tissues. 15 Such genetic manipulation relies on the availability of a means to drive and to control gene expression as required. For example, genetic manipulation relies on the availabil ity and use of suitable promoters which are effective in plants and which regulate gene expression so as to give the desired effect(s) in the transgenic plant. 20 Constitutive promoters are favored in situations where expression in all (or most) tis sues during all (or most) times of the plant development is required. The number of constitutive promoters functional in monocotyledonous plants is limited and include the rice actin I (Wang 1992; US 5,641,876), CaMV 35S (Odell 1985), CaMV 19S (Lawton 1987), and the maize ubiquitin promoters (Christensen 1996). While several constitu 25 tive and tissue-specific promoters from dicotyledonous plants are described by se quence (e.g., the promoter from the caffeoyl-CoA-0-methyltransferase gene from pars ley (Grimmig 1997), poplar (Chen 1998) and pine (Li 1999)) only a very limited number has been characterized in heterogenous gene expression. In comparison with dicoty ledonous promoters, promoters from monocotyledonous plants are still very limited. It 30 is advantageous to have the choice of a variety of different promoters so that the most suitable promoter may be selected for a particular gene, construct, cell, tissue, plant, or environment. Moreover, the increasing interest in cotransforming plants with multiple plant transcription units (PTU) and the potential problems associated with using com mon regulatory sequences for these purposes merit having a variety of promoter se 35 quences available. Root-preferential or root-specific promoters are useful for alteration of the function of root tissue, modification of growth rate, improvement of resistance to root preferred pathogens, pests, herbicides or adverse weather conditions, for detoxification of soil as 40 well as for broadening the range of soils or environments in which said plant may grow. Root abundant or root specific gene expression would provide a mechanism according to which morphology and metabolism may be altered to improve the yield and to pro duce useful proteins in greater amounts. In particular, root specific promoters may be useful for expressing defense-related genes, including those conferring insectical resis 45 tance and stress tolerance, e.g. salt, cold or drought tolerance, and genes for altering nutrient uptake. The number of root preferential and root-specific promoters functional 2 in monocotyledonous plants is very limited. These include the MR7 promoter from Zea mays (U.S. Pat. No. 5,837,848), the ZRP2 promoter of Zee mays (U.S. Pat. No. 5,633,363), and the MTL promoter from Zea mays (U.S. Pat. Nos. 5,466,785 and 6,018,099). Many of these examples disclose promoters with expression patterns con 5 fined to a limited number of root tissues. Other fail to provide the root specificity needed for expression of selected genes. It is advantageous to have the choice of a variety of different promoters so that the most suitable promoter may be selected for a particular gene, construct, cell, tissue, plant, or environment. Moreover, the increasing interest in cotransforming plants with multiple plant transcription units (PTU) and the potential 10 problems associated with using common regulatory sequences for these purposes merit having a variety of promoter sequences available. There is, therefore, a great need in the art for the identification of novel sequences that can be used for expression of selected transgenes in the economically most important 15 monocotyledonous plants, especially in rice and maize. It is thus an objective of the present invention to provide new and alternative expression cassettes for expression of transgenes in monocotyledonous plants, more preferably with the opportunity to modu late the tissue specificity of expression 20 BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 Map of Os.CCoAMT1 promoter::Zm.ubiquitin intron::GUS (PIV2)::CCoAMT1 terminator chimeric construct (pBPSMM325). The plasmid comprises an expression construct containing an Os.CCoAMT1 promoter operably linked to Zm.ubiquitin intron, a s-glucuronidase gene (GUS 25 including the potato invertase [PIV]2 intron), and 3' untranslated region and transcriptional termination region of the Os.CCoAMT1. SM cassette is repre senting a selection marker (ahas) cassette. Fig. 2 GUS expression controlled by Oryza sativa (Os) CCoAMT1 promoter con 30 struct (pBPSMM325) in maize. The upper panel (1) represents the original photos with the GUS staining, while the lower panel (11) indicates areas dis tinctly stained blue by overlaid shaded areas. (A) Leaf + root at the 5 leaf stage (B) Leaf at flowering stage 35 (C) Kernel (prepollination) (D) Kernel 30 DAP Pictures represent reproducible expression patterns from 15 T 1 single copy lines. 40 Fig. 3 A: Map of Os.CCoAMT1 promoter::Zm.ubiquitin intron::GUS (PIV2)::NOS terminator fusion construct (pBPSMM271). The plasmid comprises an expression construct containing an Os.CCoAMT1 promoter operably linked to Zm.ubiquitin intron, a s-glucuronidase gene (GUS including the potato invertase [P1V]2 intron), and nopaline synthase (NOS) 45 terminator. The SM cassette is representing a selection marker (ahas) cas sette.
3 B: GUS expression controlled by Os.CCoAMT1 promoter construct (pBPSMM271) in maize. The upper panel (1) represents the original photos with the GUS staining, while the lower panel (II) indicates areas distinctly stained blue by overlaid shaded areas. 5 (A) Leaves and roots at the 5 leaf stage (B) Leaf at the flowering stage (C) Kernel (30 d after pollination: DAP) Pictures represent reproducible expression patterns from 15 T 1 single copy li nes. 10 Fig. 4 A: Map of Os.SI::Zm.ubiquitin intron::GUS (PIV2)::NOS terminator fusion con struct (pBPSMM331). The plasmid comprises an expression construct containing an Os.Sl promoter operably linked to Zm.ubiquitin intron, a -glucuronidase gene (GUS including 15 the potato invertase (PIV]2 intron), and NOS terminator. The SM cassette is representing a selection marker cassette. B: GUS expression controlled by Os.S promoter construct (pBPSMM331) in maize. The upper panel (I) represents the original photos with the GUS stain 20 ing, while the lower panel (II) indicates areas distinctly stained blue by over laid shaded areas. (A) Leaves and roots at the 5 leaf stage (B) Leaf at the 5 leaf stage Leaf at the flowering stage (C) Kernel (30 d after pollination: DAP) 25 Pictures represent reproducible expression patterns from 15 T single copy lines. Fig. 5 A:Map of Zm.HRGP::Zm.ubiquitin intron::GUS (PIV2)::Zm.HRGP terminator fusion construct (pBPSET003). 30 The plasmid comprises an expression construct containing a Zm.HRGP pro moter operably linked to Zm.ubiquitin intron, a p-glucuronidase gene (GUS in cluding the potato invertase [PIV]2 intron), and HRGP terminator. The SM cassette is representing a selection marker (ahas) cassette. 35 B: GUS expression controlled by maize Zm.HRGP promoter construct (pBPSET003) in maize. The upper panel (1) represents the original photos with the GUS staining, while the lower panel (1I) indicates areas distinctly stained blue by overlaid shaded areas. (A) Leaves and roots at the 5 leaf stage 40 (B) Leaf at the 5 leaf stage Leaf at the flowering stage (C) Kernel (30 d after pollination: DAP) Pictures represent reproducible expression patterns from 15 T 1 single copy li nes.
4 Fig. 6 A: Map of Zm.LDH::Zm.ubiquitin intron::GUS (PIV2)::NOS terminator fusion construct (pBPSMM272). The plasmid comprises an expression construct containing a Zm.LDH pro moter operably linked to Zm.ubiquitin intron, a p-glucuronidase gene (GUS in 5 cluding the potato invertase [PIV]2 intron), and NOS terminator. The SM cas sette is representing a selection marker (ahas) cassette. B: GUS expression controlled by maize Zm.LDH promoter construct (pBPSMM272) in maize. The upper panel (1) represents the original photos 10 with the GUS staining, while the lower panel (II) indicates areas distinctly stained blue by overlaid shaded areas. The transgenic plants containing ei ther pBPSMM272 or pBPSET007 showed the same expression patterns. (A) Leaves and roots at the 5 leaf stage (B) Leaf at the 5 leaf stage Leaf at the flowering stage 15 (C) Kernel (30 d after pollination: DAP) Pictures represent reproducible expression patterns from 8 T, single copy lines. Fig. 7 A: Map of Zm.LDH::Zm.ubiquitin intron::GUS (PIV2)::Zm.LDH terminator fu 20 sion construct (pBPSET007). The plasmid comprises an expression construct containing a Zm.LDH pro moter operably linked to Zm.ubiquitin intron, a p-glucuronidase gene (GUS in cluding the potato invertase [PIV]2 intron), and LDH terminator. The SM cas sette is representing a selection marker (ahas) cassette. 25 B: GUS expression controlled by maize Zm.LDH promoter construct (pBPSET007) in maize. The upper panel (1) represents the original photos with the GUS staining, while the lower panel (II) indicates areas distinctly stained blue by overlaid shaded areas. 30 (A) Leaves and roots at the 5 leaf stage (B) Leaf at the flowering stage (C) Kernel (30 d after pollination: DAP) Pictures represent reproducible expression patterns from 15 T 1 single copy li nes. 35 Fig. 8 A: Map of Os.CP12::Zm.ubiquitin intron::GUS (PIV2)::NOS terminator fusion construct (pBPSMM304). The plasmid comprises an expression construct containing a Os.CP12 pro moter operably linked to Zm.ubiquitin intron, a P-glucuronidase gene (GUS in 40 cluding the potato invertase [PIV]2 intron), and NOS terminator. SM cassette is representing a selection marker cassette. B: GUS expression controlled by maize Os.CP12 promoter construct (pBPSMM304) in maize. The upper panel (i) represents the original photos 45 with the GUS staining, while the lower panel (11) indicates areas distinctly stained blue by overlaid shaded areas.
5 (A) Leaves and roots at the 5 leaf stage (B) Leaf at the flowering stage (C) Kernel (30 d after pollination: DAP) Pictures represent reproducible expression patterns from 15 Ti single copy 5 lines. Fig. 9 Drought-stress-induced expression of Zm.LDH promoter construct (pBPSMM272) in maize. Transgenic plants at 5-leaf stage were drought stressed by withholding water. Samples were taken from leaves at the indi 10 cated time points. RNA was isolated from leaf samples and analyzed with quantitative RT-PCR. GUS expression was normalized against an internal control gene in each sample. Results are shown as fold increase of expres sion levels compared to the 0-timepoint, which is set as 1. 15 Fig.1OA-B Protein alignment of rice lactate dehydrogenase (LDH) protein with the LDH proteins from maize (1), rice (2), barley (3), rice (4), Arabidopsis (5, 6), to mato (7), potato (8). The sequences motifs distinguishing monocotyledonous LDH proteins from other dicotyledonous LDH proteins are boxed (relevant different amino ac 20 ids are marked with a "+"). Further such sequences motifs may be readily identified by the person skilled in the art based on the present alignment. Fig. 11. Protein alignment of rice C8,7 sterol isomerase (Sl) protein with the SI pro teins from Arabidopsis (1-3) and rice (4). 25 Fig. 12. Protein alignment of rice Caffeoyl CoA-O-methyltransferase 1 (CCoAMT1) with the CCoAMT1 proteins from tobacco (1), eucalyptus (2), popular (3), maize (4, 5, 6) and rice (7). The sequences motifs distinguishing monocotyledonous CCoAMT proteins 30 from other dicotyledonous CCoAMT proteins are boxed (relevant different amino acids are marked with a "+"). Further such sequences motifs may be readily identified by the person skilled in the art based on the present alignment. 35 SUMMARY OF THE INVENTION Accordingly, a first embodiment of the invention relates to expression cassettes for regulating expression in monocotyledonous plants comprising i) at least one transcription regulating nucleotide sequence of a monocotyledonous plant gene, said monocotyledonous plant gene selected from the group of genes 40 consisting of caffeoyl-CoA-O-methyltransferase genes, C8,7-sterol isomerase genes, hydroxyproline-rich glycoprotein (HRGP) genes, lactate dehydrogenase genes, and chloroplast protein like 12 genes, and functionally linked thereto ii) at least one nucleic acid sequence which is heterologous in relation to said tran 45 scription regulating sequence.
6 Preferably, the transcription regulating nucleotide sequence is obtainable from mono cotyledonous plant genomic DNA from a gene encoding a polypeptide which al) comprises at least one sequence motif of a monocotyledonous plant lactate dehy 5 drogenase protein selected from the group consisting of the amino acid se quences i) SLSELGFDA (SEQ ID NO: 76), ii) VIGAGNVGMA (SEQ ID NO: 77), iii) IVTAGARQl (SEQ ID NO: 78), 10 iv) L(F/Y)RKIVP (SEQ ID NO: 79), v) GFPASRV (SEQ ID NO: 80), vi) RF(L/I)AEHL (SEQ ID NO: 81), vii) QAYMVGEH (SEQ ID NO: 82), viii) ALEGIRRAV (SEQ ID NO: 83), and 15 ix) GYSVAS(L/I)A (SEQ ID NO: 84), or bi) is encoding a lactate dehydrogenase protein from a monocotyledonous plant hav ing an amino acid sequence identity of at least 90% to a polypeptide selected 20 from the group described by SEQ ID NO: 26, 60 and 65, or a2) comprises at least one sequence motif of a monocotyledonous plant caffeoyl CaA-O-methyltransferase protein selected from the group consisting of the amino acid sequences 25 x) EQKTRHSE (SEQ ID NO: 85), xi) L(1/L)KLIGAK (SEQ ID NO: 86), xii) KTMEIGVY (SEQ ID NO: 87), xiii) HERL(L/M)KLV (SEQ ID NO: 88), xiv) CQLPVGDG (SEQ ID NO: 89), and 30 xv) TLCRRVK (SEQ ID NO: 90), or b2) is encoding a caffeoyl-CaA-O-methyltransferase protein from a monocotyledon ous plant having an amino acid sequence identity of at least 90% to a polypeptide 35 selected from the group described by SEQ ID NO: 5, and 70, or b3) is encoding a hydroxyproline-rich glycoprotein from a monocotyledonous plant having an amino acid sequence identity of at least 90% to a polypeptide selected from the group described by SEQ ID NO: 18, and 75, or 40 b4) is encoding a C-8,7-stereol-isomerase protein from a monocotyledonous plant having an amino acid sequence identity of at least 90% to a polypeptide selected described by SEQ ID NO: 10, or 45 b5) is encoding a Chloroplast protein 12 like protein from a monocotyledonous plant having an amino acid sequence identity of at least 90% to a polypeptide described by SEQ ID NO: 31.
7 Preferably, the transcription regulating nucleotide sequence is from a corn (Zea mays) or rice (Oryza sativa) plant. Even more preferably the transcription regulating nucleo tide sequence is from a plant gene selected from the group of genes consisting of Oryza sativa caffeoyl-CoA-O-methyltransferase genes, Oryza sativa C8,7-sterol isom 5 erase genes, Zea may hydroxyproline-rich glycoprotein (HRGP) genes, Zea mays lac tate dehydrogenase genes, Oryza sativa chloroplast protein 12 like genes and func tional equivalents thereof. The functional equivalent gene is preferably encoding a polypeptide which has at least 90% amino acid sequence identity to a polypeptide se lected from the group described by SEQ ID NO: 5,10, 18, 26, 31, 60, 65, 70, and 75. 10 In a more preferred embodiment the transcription regulating nucleotide sequence is selected from the group of sequences consisting of i) the sequences described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, and 73, 15 and ii) a fragment of at least 50 consecutive bases of a sequence under i); and iii) a nucleotide sequence having substantial similarity (preferably with a sequence identity of at least 60%; more preferably measured by the BLASTN program with the default parameters wordlength (W) of 11, an expectation (E) of 10, a cutoff of 20 100, M=5, N=-4, and a comparison of both strands) to a transcription regulating nucleotide sequence described by SEQ ID NO: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73; and iv) a nucleotide sequence capable of hybridizing to a transcription regulating nucleo 25 tide sequence described by SEQ ID NO: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73 or the complement thereof; and v) a nucleotide sequence capable of hybridizing to a nucleic acid comprising 50 to 200 or more consecutive nucleotides of a transcription regulating nucleotide se 30 quence described by SEQ ID NO: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73 or the com plement thereof (preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50"C with washing in 2 X SSC, 0. 1% SDS at 50*C; more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50*C with 35 washing in 1 X SSC, 0.1% SDS at 50*C, still more preferably in 7% sodium dode cyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50"C with washing in 0.5 X SSC, 0.1% SDS at 50*C, even more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50"C with washing in 0.1 X SSC, 0.1% SDS at 50"C, most preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 40 50*C with washing in 0.1 X SSC, 0.1% SDS at 65 0 C); and vi) a nucleotide sequence which is the complement or reverse complement of any of the previously mentioned nucleotide sequences under i) to v). Another preferred embodiment relates to an expression cassette for regulating expres 45 sion in monocotyledonous plants comprising a a) at least one transcription regulating nucleotide sequence functional in a monocoty ledonous plant comprising at least one sequence selected from the group of se quences consisting of i) the sequences described by SEQ ID NOs: 1, 2, 3, 6, 7, 8,11, 12,13,14,15,16, 5 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, and 73, and ii) a fragment of at least 50 consecutive bases of a sequence under i); and iii) a nucleotide sequence having substantial similarity (preferably with a sequence identity of at least 60%; more preferably measured by the BLASTN program 10 with the default parameters wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands) to a transcription regulating nucleotide sequence described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73; and 15 iv) a nucleotide sequence capable of hybridizing to a transcription regulating nu cleotide sequence described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73 or the complement thereof (preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50"C with washing in 2 X SSC, 0. 1% SDS 20 at 50"C; more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 500C with washing in 1 X SSC, 0.1% SDS at 50 0 C, still more pref erably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50*C with washing in 0.5 X SSC, 0.1% SDS at 50"C, even more preferably in 7% so dium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50*C with washing in 25 0.1 X SSC, 0.1% SDS at 50"C, most preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50*C with washing in 0.1 X SSC, 0.1% SDS at 65*C); and v) a nucleotide sequence capable of hybridizing to a nucleic acid comprising 50 to 200 or more consecutive nucleotides of a transcription regulating nucleotide se 30 quence described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21,22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66,67, 68, 71, 72, or 73 or the complement thereof; and vi) a nucleotide sequence which is the complement or reverse complement of any of the previously mentioned nucleotide sequences under i) to v), 35 and b) at least one nucleic acid sequence which is heterologous in relation to said tran scription regulating sequence. Preferably, the sequences specified under ii), iii), iv) v) and vi) in the paragraphs above 40 are capable to modify transcription in a monocotyledonous plant cell or organism. More preferably said sequences specified under ii), iii), iv) v) and vi) have substantially the same transcription regulating activity as the transcription regulating nucleotide se quence described by SEQ ID NO: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16,19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73. 45 9 Also preferably the sequences specified under iii) above have a sequence identity of at least 60%, preferably 70% or 80%, more preferably 90% or 95% to a sequence described by SEQ ID NO: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73, wherein the identity is 5 preferably measured by the BLASTN program with the default parameters wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. Most preferably the invention relates to an expression cassette for regulating expression 10 in monocotyledonous plants comprising a) at least one transcription regulating nucleotide sequence of a monocotyle donous C8,7-sterol isomerase gene, functional in a monocotyledonous plant comprising at least one sequence selected from the group of sequences consisting of i) the sequences described by SEQ ID NOs: 6, 7 and 8 and 15 ii) a fragment of at least 200 consecutive bases of a sequence under i); and iii) a nucleotide sequence having substantial similarity with a sequence identity of at least 60% to a transcription regulating nucleotide sequence described by SEQ ID NOs: 6, 7 or 8; and iv) a nucleotide sequence capable of hybridizing to a transcription regulating 20 nucleotide sequence described by SEQ ID NOs: 6, 7 or 8 or the complement thereof in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 500C with washing in 2 X SSC, 0. 1% SDS at 500C; and v) a nucleotide sequence capable of hybridizing to a nucleic acid comprising 50 to 200 or more consecutive nucleotides of a transcription regulating nucleotide 25 sequence described by SEQ ID NOs: 6, 7 or 8 or the complement thereof; and vi) a nucleotide sequence which is the complement or reverse complement of any of the previously mentioned nucleotide sequences under i) to v), and b) at least one nucleic acid sequence which is heterologous in relation to said 30 transcription regulating sequence, wherein the at least one transcription regulating nucleotide sequence has a kernel and root preferential expression specificity. 35 Further preferably, the sequences specified under iv) or v) above are hybridizing under stringent conditions, preferably under medium stringent conditions, most preferably under high stringent conditions (such as in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 500C with washing in 0.1 X SSC, 0.1% SDS at 650C) with the specified target sequence. 40 In one preferred embodiment of the expression cassette of the invention, the expression of the nucleic acid sequence results in expression of a protein, or expression of an antisense RNA, sense or double-stranded RNA. 45 The expression profile of the expression cassettes of the invention may be modulated depending on the combination of the transcription regulating nucleotide sequence with expression enhancing introns and/or transcriptions termination sequences. This in a preferred embodiment the expression cassette of the inventions comprises at least one additional element selected from the group consisting of 50 9a a) 5'-untranslated regions, and b) intron encoding sequences, and c) transcription termination sequences. 5 The intron encoding sequences are preferably encoding an expression enhancing intron from a monocotyledonous plant. More preferably the intron sequence is an intron from an ubiquitin, actin or alcohol dehydrogenase gene. Preferably, this intron is inserted in the expression construct in the 5'-untranslated region of the nucleic acid sequence, which should be expressed (i.e., between the transcription regulating nucleotide sequence and 10 the protein coding sequence (open reading frame) or the nucleic acid sequence to be expressed). Preferably, the 5'-untranslated region is from the same gene as the transcription regulating sequences. 15 The transcription terminating sequence preferably also comprises a sequence inducing polyadenylation. The transcription terminating sequence may be heterologous with respect to the transcription regulating nucleotide sequence and/or the nucleic acid sequence to be expressed, but may also be the natural transcription regulating 20 nucleotide sequence of the gene of said transcription regulating nucleotide sequence and/or said nucleic acid sequence to be expressed. In one preferred embodiment of the invention the transcription regulating nucleotide sequence is the natural transcription regulating nucleotide sequence of the gene of the transcription regulating sequence. Preferably 10 the transcription termination sequence is selected from the group of sequences de scribed by SEQ ID NO: 32, 34, and 35. The transcription regulating sequences of the invention are especially useful for consti 5 tutive or root/kernel-preferential or root/kernel-specific expression in monocotyledonous plants. However, a use in other plants (e.g., dicotyledonous or gymnosperm plants) and other tissues cannot be ruled out. It has been shown that the tissue specificity of the transcription regulating sequences of the invention can be advantageously modu lated by the combination with introns and/or transcription termination sequences. 10 The expression cassette may be employed for numerous expression purposes such as for example expression of a protein, or expression of an antisense RNA, sense or dou ble-stranded RNA. Preferably, expression of the nucleic acid sequence confers to the plant an agronomically valuable trait. 15 Some of the transcription regulating sequences of the invention are novel even as such (i.e. as isolated nucleotide sequences). Accordingly another embodiment of the inven tion relates to an isolated nucleic acid sequence comprising at least one transcription regulating nucleotide sequence as described by SEQ ID NO: 6, 7, 8, 11, 12, 13, 19, 20, 20 or 21. Other embodiments of the invention relate to vectors comprising an expression cas sette of the invention, and transgenic host cell or non-human organism comprising an expression cassette or a vector of the invention. Preferably the organism is a plant, 25 more preferably a monocotyledonous plant, most preferably selected form the group consisting of Zee mays (corn), Oryza sativa (rice), Trifcum aestvum (wheat), Hordeum vu/gare (barley), and Avena sativa (oats). Another embodiment of the invention relates to a method for identifying and/or isolating 30 transcription regulating nucleotide sequence from a monocotyledonous plant character ized that said identification and/or isolation utilizes a nucleic acid sequence encoding an amino acid sequence as described by SEQ ID NOs: 5, 10, 18, 26, 31, 60, 65, 70, or 75, or a part of at least 15 bases of said nucleic acid sequence. Preferably the em ployed nucleic acid sequences is described by SEQ ID NOs: 4, 9, 17, 25, 30, 59, 64, 35 69, or 74 or a part of at least 15 bases of said nucleic acid sequence. Preferably said identification and/or isolation is realized by a method selected from polymerase chain reaction, hybridization, and database screening. Still another embodiment of the invention relates to a method for providing a transgenic 40 expression cassette for heterologous expression in monocotyledonous plants compris ing the steps of: I. isolating of a transcription regulating nucleotide sequence from a monocotyledonous plant utilizing at least one nucleic acid sequence or a part thereof, wherein said se quence is encoding a polypeptide described by SEQ ID NOs: 5, 10, 18, 26, 31, 60, 45 65, 70, or 75, or a part of at least 15 bases of said nucleic acid sequence, and 11 11. functionally linking said transcription regulating nucleotide sequence to another nu cleotide sequence of interest, which is heterologous in relation to said transcription regulating nucleotide sequence. 5 For both of the above mentioned methods preferably the nucleotide sequence utilized for isolation of said transcription regulating nucleotide sequence is encoding a polypep tide comprising al) at least one sequence motif of a monocotyledonous plant lactate dehydrogenase 10 protein selected from the group consisting of the amino acid sequences i) SLSELGFDA (SEQ ID NO: 76), ii) VIGAGNVGMA (SEQ ID NO: 77), iii) IVTAGARQI (SEQ ID NO: 78), iv) L(F/Y)RKIVP (SEQ ID NO: 79), 15 v) GFPASRV (SEQ ID NO: 80), vi) RF(L/I)AEHL (SEQ ID NO: 81), vii) QAYMVGEH (SEQ ID NO: 82), viii) ALEGIRRAV (SEQ ID NO: 83), and ix) GYSVAS(LI)A (SEQ ID NO: 84), 20 or a2) at least one sequence motif of a monocotyledonous plant caffeoyl-CaA-O methyltransferase protein selected from the group consisting of the amino acid sequences 25 x) EQKTRHSE (SEQ ID NO: 85), xi) L(I/L)KLIGAK (SEQ 10 NO: 86), xii) KTMEIGVY (SEQ ID NO: 87), xiii) HERL(L/M)KLV (SEQ ID NO: 88), xiv) CQLPVGDG (SEQ ID NO: 89), and 30 xv) TLCRRVK (SEQ ID NO: 90). DEFINITIONS It is to be understood that this invention is not limited to the particular methodology, protocols, cell lines, plant species or genera, constructs, and reagents described as 35 such. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which will be limited only by the appended claims. It must be noted that as used herein and in the appended claims, the singular forms "a," "and," and "the" include plural reference unless the context clearly dictates otherwise. Thus, for exam 40 ple, reference to "a vector" is a reference to one or more vectors and includes equiva lents thereof known to those skilled in the art, and so forth. The term "about" is used herein to mean approximately, roughly, around, or in the re gion of, When the term "about" is used in conjunction with a numerical range, it modi 45 fies that range by extending the boundaries above and below the numerical values set forth, In general, the term "about" is used herein to modify a numerical value above and 12 below the stated value by a variance of 20 percent, preferably 10 percent up or down (higher or lower). As used herein, the word "or" means any one member of a particular list and also in 5 cludes any combination of members of that list. The term "gene" is used broadly to refer to any segment of nucleic acid associated with a biological function. Thus, genes include coding sequences and/or the regulatory se quences required for their expression. For example, gene refers to a nucleic acid frag 10 ment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences. Genes also include non-expressed DNA seg ments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or syn thesizing from known or predicted sequence information, and may include sequences 15 designed to have desired parameters. The term "intron" refers to sections of DNA (intervening sequences) within a gene that do not encode part of the protein that the gene produces, and that is spliced out of the mRNA that is transcribed from the gene before it is exported from the cell nucleus. In 20 tron sequence refers to the nucleic acid sequence of an intron. Thus, introns are those regions of DNA sequences that are transcribed along with the coding sequence (ex ons) but are removed during the formation of mature mRNA. Introns can be positioned within the actual coding region or in either the 5' or 3' untranslated leaders of the pre mRNA (unspliced mRNA). Introns in the primary transcript are excised and the coding 25 sequences are simultaneously and precisely ligated to form the mature mRNA. The junctions of introns and exons form the splice site. The sequence of an intron begins with GU and ends with AG. Furthermore, in plants, two examples of AU-AC introns have been described: intron 14 of the RecA-like protein gene and intron 7 of the G5 gene from Arabidopsis thaliana are AT-AC introns, Pre-mRNAs containing introns have 30 three short sequences that are -beside other sequences- essential for the intron to be accurately spliced. These sequences are the 5' splice-site, the 3' splice-site, and the branchpoint. mRNA splicing is the removal of intervening sequences (introns) present in primary mRNA transcripts and joining or ligation of exon sequences. This is also known as cis-splicing which joins two exons on the same RNA with the removal of the 35 intervening sequence (intron). The functional elements of an intron comprising se quences that are recognized and bound by the specific protein components of the spli ceosome (e.g. splicing consensus sequences at the ends of introns). The interaction of the functional elements with the spliceosome results in the removal of the intron se quence from the premature mRNA and the rejoining of the exon sequences. Introns 40 have three short sequences that are essential -although not sufficient- for the intron to be accurately spliced. These sequences are the 5' splice site, the 3' splice site and the branchpoint The branchpoint sequence is important in splicing and splice-site selection in plants. The branchpoint sequence is usually located 10-60 nucleotides upstream of the 3' splice site. Plant sequences exhibit sequence deviations in the branchpoint, the 45 consensus sequences being CURAY or YURAY.
13 The term "native" or "wild type" gene refers to a gene that is present in the genome of an untransformed cell, i.e., a cell not having a known mutation. A "marker gene" encodes a selectable or screenable trait. 5 The term "chimeric gene" refers to any gene that contains 1) DNA sequences, including regulatory and coding sequences, that are not found to gether in nature, or 2) sequences encoding parts of proteins not naturally adjoined, or 10 3) parts of promoters that are not naturally adjoined. Accordingly, a chimeric gene may comprise regulatory sequences and coding se quences that are derived from different sources, or comprise regulatory sequences and coding sequences derived from the same source, but arranged in a manner different 15 from that found in nature. A "transgene" refers to a gene that has been introduced into the genome by transfor mation and is stably maintained. Transgenes may include, for example, genes that are either heterologous or homologous to the genes of a particular plant to be transformed. 20 Additionally, transgenes may comprise native genes inserted into a non-native organ ism, or chimeric genes. The term "endogenous gene" refers to a native gene in its natural location in the genome of an organism. A "foreign" gene refers to a gene not normally found in the host organism but that is introduced by gene transfer. 25 An "oligonucleotide" corresponding to a nucleotide sequence of the invention, e.g., for use in probing or amplification reactions, may be about 30 or fewer nucleotides in length (e.g., 9, 12, 15, 18, 20, 21 or 24, or any number between 9 and 30). Generally specific primers are upwards of 14 nucleotides in length. For optimum specificity and cost effectiveness, primers of 16 to 24 nucleotides in length may be preferred. Those 30 skilled in the art are well versed in the design of primers for use processes such as PCR. If required, probing can be done with entire restriction fragments of the gene dis closed herein which may be 100's or even 1,000's of nucleotides in length. The terms "protein," "peptide" and "polypeptide" are used interchangeably herein. 35 The nucleotide sequences of the invention can be introduced into any plant. The genes to be introduced can be conveniently used in expression cassettes for introduction and expression in any plant of interest. Such expression cassettes will comprise the tran scriptional initiation region of the invention linked to a nucleotide sequence of interest. 40 Preferred promoters include constitutive, tissue-specific, developmental-specific, induc ible and/or viral promoters. Such an expression cassette is provided with a plurality of restriction sites for insertion of the gene of interest to be under the transcriptional regu lation of the regulatory regions. The expression cassette may additionally contain se lectable marker genes. The cassette will include in the 5'-3' direction of transcription, a 45 transcriptional and translational initiation region, a DNA sequence of interest, and a transcriptional and translational termination region functional in plants. The termination region may be native with the transcriptional initiation region, may be native with the 14 DNA sequence of interest, or may be derived from another source. Convenient termi nation regions are available from the Ti-plasmid of Agrobacteium tumefaciens, such, as the octopine synthase and nopaline synthase termination regions (see also, Guer ineau 1991; Proudfoot 1991; Sanfacon 1991; Mogen 1990; Munroe 1990; Ballas 1989; 5 Joshi 1987). "Coding sequence" refers to a DNA or RNA sequence that codes for a specific amino acid sequence and excludes the non-coding sequences. It may constitute an "uninter rupted coding sequence", i.e., lacking an intron, such as in a cDNA or it may include 10 one or more introns bounded by appropriate splice junctions. An "intron" is a sequence of RNA which is contained in the primary transcript but which is removed through cleavage and re-ligation of the RNA within the cell to create the mature mRNA that can be translated into a protein. 15 The terms "open reading frame" and "ORF" refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence. The terms "initiation codon" and "termination codon" refer to a unit of three adjacent nucleotides ('codon') in a coding sequence that specifies initiation and chain termination, respec tively, of protein synthesis (mRNA translation). 20 A "functional RNA" refers to an antisense RNA, double-stranded-RNA, ribozyme, or other RNA that is not translated. The term "RNA transcript" refers to the product resulting from RNA polymerase cata 25 lyzed transcription of a DNA sequence. When the RNA transcript is a perfect comple mentary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from posttranscriptional processing of the primary tran script and is referred to as the mature RNA. "Messenger RNA" (mRNA) refers to the RNA that is without introns and that can be translated into protein by the cell. "cDNA" 30 refers to a single- or a double-stranded DNA that is complementary to and derived from mRNA. "Transcription regulating nucleotide sequence", "regulatory sequences", and "suitable regulatory sequences", each refer to nucleotide sequences influencing the transcrip 35 tion, RNA processing or stability, or translation of the associated (or functionally linked) nucleotide sequence to be transcribed. The transcription regulating nucleotide se quence may have various localizations with the respect to the nucleotide sequences to be transcribed. The transcription regulating nucleotide sequence may be located up stream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of 40 the sequence to be transcribed (e.g., a coding sequence). The transcription regulating sequences may be selected from the group comprising enhancers, promoters, transla tion leader sequences, introns, 5'-untranslated sequences, 3'-untranslated sequences, and polyadenylation signal sequences. They include natural and synthetic sequences as well as sequences, which may be a combination of synthetic and natural se 45 quences. As is noted above, the term "transcription regulating sequence" is not limited to promoters. However, preferably a transcription regulating nucleotide sequence of the invention comprises at least one promoter sequence (e.g., a sequence localized up- 15 stream of the transcription start of a gene capable to induce transcription of the down stream sequences). In one preferred embodiment the transcription regulating nucleo tide sequence of the invention comprises the promoter sequence of the corresponding gene and - optionally and preferably - the native 5'-untranslated region of said gene. 5 Furthermore, the 3'-untranslated region and/or the polyadenylation region of said gene may also be employed. "5' non-coding sequence" refers to a nucleotide sequence located 5' (upstream) to the coding sequence. It is present in the fully processed mRNA upstream of the initiation 10 codon and may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency (Turner 1995). "3' non-coding sequence" refers to nucleotide sequences located 3' (downstream) to a coding sequence and include polyadenylation signal sequences and other sequences 15 encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor. The use of different 3' non-coding sequences is exemplified by Ingelbrecht et al, 1989. 20 The term "translation leader sequence" refers to that DNA sequence portion of a gene between the promoter and coding sequence that is transcribed into RNA and is present in the fully processed mRNA upstream (5') of the translation start codon. The transla tion leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. 25 "Signal peptide" refers to the amino terminal extension of a polypeptide, which is trans lated in conjunction with the polypeptide forming a precursor peptide and which is re quired for its entrance into the secretory pathway. The term "signal sequence" refers to a nucleotide sequence that encodes the signal peptide. The term "transit peptide" as 30 used herein refers part of an expressed polypeptide (preferably to the amino terminal extension of a polypeptide), which is translated in conjunction with the polypeptide forming a precursor peptide and which is required for its entrance into a cell organelle (such as the plastids (e.g., chloroplasts) or mitochondria). The term "transit sequence" refers to a nucleotide sequence that encodes the transit peptide. 35 "Promoter' refers to a nucleotide sequence, usually upstream (5') to its coding se quence, which controls the expression of the coding sequence by providing the recog nition for RNA polymerase and other factors required for proper transcription. "Pro moter" includes a minimal promoter that is a short DNA sequence comprised of a TATA 40 box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression. "Promoter" also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream ele 45 ments, the latter elements often referred to as enhancers. Accordingly, an "enhancer is a DNA sequence, which can stimulate promoter activity and may be an innate ele ment of the promoter or a heterologous element inserted to enhance the level or tissue 16 specificity of a promoter. It is capable of operating in both orientations (normal or flipped), and is capable of functioning even when moved either upstream or down stream from the promoter. Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects. Promoters may be 5 derived in their entirety from a native gene, or be composed of different elements, de rived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter may also contain DNA sequences that are involved in the bind ing of protein factors, which control the effectiveness of transcription initiation in re sponse to physiological or developmental conditions. 10 The "initiation site" is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1. With respect to this site all other sequences of the gene and its controlling regions are numbered. Downstream sequences (i.e., further protein encoding sequences in the 3' direction) are denomi 15 nated positive, while upstream sequences (mostly of the controlling regions in the 5' direction) are denominated negative. Promoter elements, particularly a TATA element, that are inactive or that have greatly reduced promoter activity in the absence of upstream activation are referred to as 20 "minimal or core promoters." In the presence of a suitable transcription factor, the minimal promoter functions to permit transcription. A "minimal or core promoter" thus consists only of all basal elements needed for transcription initiation, e.g., a TATA box and/or an initiator. 25 "Constitutive expression" refers to expression using a constitutive or regulated pro moter. By "tissue-independent," "tissue-general," or "constitutive" is intended expression in the cells throughout a plant at most times and in most tissues. As with other promoters 30 classified as "constitutive" (e.g., ubiquitin), some variation in absolute levels of expres sion can exist among different tissues or stages. However, constitutive promoters gen erally are expressed at high or moderate levels in most, and preferably all, tissues and most, and preferably all, developmental stages. "Conditional" and "regulated expres sion" refer to expression controlled by a regulated promoter. 35 "Constitutive promoter" refers to a promoter that is able to express the open reading frame (ORF) that it controls in all or nearly all of the plant tissues during all or nearly all developmental stages of the plant. Each of the transcription-activating elements do not exhibit an absolute tissue-specificity, but mediate transcriptional activation in most plant 40 parts at a level of at least 1% of the level reached in the part of the plant in which tran scription is most active. "Regulated promoter" refers to promoters that direct gene expression not constitutively, but in a temporally- and/or spatially-regulated manner, and includes both tissue-spedfic 45 and inducible promoters. It includes natural and synthetic sequences as well as se quences which may be a combination of synthetic and natural sequences. Different promoters may direct the expression of a gene in different tissues or cell types, or at 17 different stages of development, or in response to different environmental conditions. New promoters of various types useful in plant cells are constantly being discovered, numerous examples may be found in the compilation by Okamuro et at. (1989). Typical regulated promoters useful in plants include but are not limited to safener-inducible 5 promoters, promoters derived from the tetracycline-inducible system, promoters de rived from salicylate-inducible systems, promoters derived from alcohol-inducible sys tems, promoters derived from glucocorticoid-inducible system, promoters derived from pathogen-inducible systems, and promoters derived from eadysone-inducible systems. 10 "Tissue-specific promoter" refers to regulated promoters that are not expressed in all plant cells but only in one or more cell types in specific organs (such as leaves or seeds), specific tissues (such as embryo or cotyledon), or specific cell types (such as leaf parenchyma or seed storage cells). These also include promoters that are tempo rally regulated, such as in early or late embryogenesis, during fruit ripening in develop 15 ing seeds or fruit, in fully differentiated leaf, or at the onset of senescence. The term "root" in the context of the inventions means the usually underground organ of a plant that lacks buds or leaves or nodes, absorbs water and mineral salts and usu ally it anchors the plant to the ground. The plant root consists of many cell types such 20 as epidermal, root cap, columella, cortex, pericycle, vascular and root hair forming trichoblasts, organized into tissues or regions of the root, for example, the root tip, root epidermis, meristematic zone, primary root, lateral root, root hair, and vascular tissue. Transcription regulating sequences isolated as root-specific or root-preferred may regu late expression in one or a few of these cell types. This cell-specific activity can be use 25 ful for specific applications such as regulating meristematic activity in only meristematic cell zone or expression of a nematicidal gene in only the cell type that are contacted by the nematode pest. The term "tissue-specific transcription" in the context of this invention in relation to a 30 certain tissue or a group of tissue (e.g., root and kernel) means the transcription of a nucleic acid sequence by a transcription regulating element in a way that transcription of said nucleic acid sequence in said tissue or group of tissues contribute to more than 90%, preferably more than 95%, more preferably more than 99% of the entire quantity of the RNA transcribed from said nucleic acid sequence in the entire plant during any of 35 its developmental stage. "Tissue-preferential transcription" in the context of this invention in relation to a certain tissue or a group of tissue (e.g., root and kernel) means the transcription of a nucleic acid sequence by a transcription regulating element in a way that transcription of said 40 nucleic acid sequence in said tissue or group of tissues contribute to more than 50%, preferably more than 70%, more preferably more than 80% of the entire quantity of the RNA transcribed from said nucleic acid sequence in the entire plant during any of its developmental stage. 45 "Inducible promoter" refers to those regulated promoters that can be turned on in one or more cell types by an external stimulus, such as a chemical, light, hormone, stress, or a pathogen.
18 "Operably-linked" refers to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one is affected by the other. For example, a regu latory DNA sequence is said to be "operably linked to" or "associated with" a DNA se quence that codes for an RNA or a polypeptide if the two sequences are situated such 5 that the regulatory DNA sequence affects expression of the coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation. 10 "Expression" refers to the transcription and/or translation of an endogenous gene, ORF or portion thereof, or a transgene in plants. For example, in the case of antisense con structs, expression may refer to the transcription of the antisense DNA only. In addition, expression refers to the transcription and stable accumulation of sense (mRNA) or functional RNA. Expression may also refer to the production of protein. 15 "Specific expression" is the expression of gene products, which is limited to one or a few plant tissues (spatial limitation) and/or to one or a few plant developmental stages (temporal limitation). It is acknowledged that hardly a true specificity exists: promoters seem to be preferably switch on in some tissues, while in other tissues there can be no 20 or only little activity. This phenomenon is known as leaky expression. However, with specific expression in this invention is meant preferable expression in one or a few plant tissues. The "expression pattern" of a promoter (with or without enhancer) is the pattern of ex 25 pression levels, which shows where in the plant and in what developmental stage tran scription is initiated by said promoter. Expression patterns of a set of promoters are said to be complementary when the expression pattern of one promoter shows little overlap with the expression pattern of the other promoter. The level of expression of a promoter can be determined by measuring the 'steady state' concentration of a stan 30 dard transcribed reporter mRNA. This measurement is indirect since the concentration of the reporter mRNA is dependent not only on its synthesis rate, but also on the rate with which the mRNA is degraded. Therefore, the steady state level is the product of synthesis rates and degradation rates. 35 The rate of degradation can however be considered to proceed at a fixed rate when the transcribed sequences are identical, and thus this value can serve as a measure of synthesis rates. When promoters are compared in this way, techniques available to those skilled in the art are hybridization S1-RNAse analysis, Northern blots and com petitive RT-PCR. This list of techniques in no way represents all available techniques, 40 but rather describes commonly used procedures used to analyze transcription activity and expression levels of mRNA. The analysis of transcription start points in practically all promoters has revealed that there is usually no single base at which transcription starts, but rather a more or less 45 clustered set of initiation sites, each of which accounts for some start points of the mRNA. Since this distribution varies from promoter to promoter the sequences of the reporter mRNA in each of the populations would differ from each other. Since each 19 mRNA species is more or less prone to degradation, no single degradation rate can be expected for different reporter mRNAs. It has been shown for various eukaryotic pro moter sequences that the sequence surrounding the initiation site ('initiator') plays an important role in determining the level of RNA expression directed by that specific pro 5 moter. This includes also part of the transcribed sequences. The direct fusion of pro moter to reporter sequences would therefore lead to suboptimal levels of transcription. A commonly used procedure to analyze expression patterns and levels is through de termination of the 'steady state' level of protein accumulation in a cell. Commonly used 10 candidates for the reporter gene, known to those skilled in the art are beta glucuronidase (GUS), chloramphenicol acetyl transferase (CAT) and proteins with fluo rescent properties, such as green fluorescent protein (GFP) from Aequora victoria. In principle, however, many more proteins are suitable for this purpose, provided the pro tein does not interfere with essential plant functions. For quantification and determina 15 tion of localization a number of tools are suited. Detection systems can readily be cre ated or are available which are based on, e.g., immunochemical, enzymatic, fluores cent detection and quantification. Protein levels can be determined in plant tissue ex tracts or in intact tissue using in situ analysis of protein expression. 20 Generally, individual transformed lines with one chimeric promoter reporter construct will vary in their levels of expression of the reporter gene. Also frequently observed is the phenomenon that such transformants do not express any detectable product (RNA or protein). The variability in expression is commonly ascribed to 'position effects', al though the molecular mechanisms underlying this inactivity are usually not clear. 25 "Overexpression" refers to the level of expression in transgenic cells or organisms that exceeds levels of expression in normal or untransformed (non-transgenic) cells or or ganisms. 30 NAntisense inhibition" refers to the production of antisense RNA transcripts capable of suppressing the expression of protein from an endogenous gene or a transgene. "Gene silencing" refers to homology-dependent suppression of viral genes, transgenes, or endogenous nuclear genes. Gene silencing may be transcriptional, when the sup 35 pression is due to decreased transcription of the affected genes, or post-transcriptional, when the suppression is due to increased turnover (degradation) of RNA species ho mologous to the affected genes (English 1996). Gene silencing includes virus-induced gene silencing (Ruiz et at. 1998). 40 The terms "heterologous DNA sequence," "exogenous DNA segment" or "heterologous nucleic acid," as used herein, each refer to a sequence that originates from a source foreign to the particular host cell or, if from the same source, is modified from its origi nal form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell but has been modified through, for example, the use of DNA 45 shuffling. The terms also include non-naturally occurring multiple copies of a naturally occurring DNA sequence. Thus, the terms refer to a DNA segment that is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell 20 nucleic acid in which the element is not ordinarily found. Exogenous DNA segments are expressed to yield exogenous polypeptides. A "homologous" DNA sequence is a DNA sequence that is naturally associated with a host cell into which it is introduced. 5 "Homologous to" in the context of nucleotide sequence identity refers to the similarity between the nucleotide sequences of two nucleic acid molecules or between the amino acid sequences of two protein molecules. Estimates of such homology are provided by either DNA-DNA or DNA-RNA hybridization under conditions of stringency as is well understood by those skilled in the art (as described in Haines and Higgins (eds.), Nu 10 cleic Acid Hybridization, IRL Press, Oxford, U.K.), or by the comparison of sequence similarity between two nucleic acids or proteins. The term "substantially similar" refers to nucleotide and amino acid sequences that represent functional and/or structural equivalents of the transcription regulating se 15 quences from maize or rice specifically disclosed herein. In its broadest sense, the term "substantially similar" when used herein with respect to a nucleotide sequence means that the nucleotide sequence is part of a gene which encodes a polypeptide having substantially the same structure and function as a poly 20 peptide encoded by a gene for the reference nucleotide sequence, e.g., the nucleotide sequence comprises a promoter from a gene that is the ortholog of the gene corre sponding to the reference nucleotide sequence, as well as promoter sequences that are structurally related the promoter sequences particularly exemplified herein, i.e., the substantially similar promoter sequences hybridize to the complement of the promoter 25 sequences exemplified herein under high or very high stringency conditions. For ex ample, altered nucleotide sequences, which simply reflect the degeneracy of the ge netic code but nonetheless encode amino acid sequences that are identical to a par ticular amino acid sequence, are substantially similar to the particular sequences. The term "substantially similar also includes nucleotide sequences wherein the sequence 30 has been modified, for example, to optimize expression in particular cells, as well as nucleotide sequences encoding a variant polypeptide having one or more amino acid substitutions relative to the (unmodified) polypeptide encoded by the reference se quence, which substitution(s) does not alter the activity of the variant polypeptide rela tive to the unmodified polypeptide. 35 In its broadest sense, the term "substantially similar" when used herein with respect to polypeptide means that the polypeptide has substantially the same structure and func tion as the reference polypeptide. In addition, amino acid sequences that are substan tially similar to a particular sequence are those wherein overall amino acid identity is at 40 least 65% or greater to the instant sequences. Modifications that result in equivalent nucleotide or amino acid sequences are well within the routine skill in the art. The per centage of amino acid sequence identity between the substantially similar and the ref erence polypeptide is at least 65%, 66%, 67%, 68%, 69%, 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 45 89%, and even 90% or more, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, up to at least 99%, wherein the reference polypeptide is a polypeptide encoded by a gene with a promoter having any one of SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 21 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73, a nucleotide sequence comprising an open reading frame having any one of SEQ ID NOs: 4, 9, 17, 25, 30, 59, 64, 69, or 74, which encodes one of SEQ ID NOs: 5, 10, 18, 26, 31, 60, 65, 70, or 75. One indication that two polypeptides are substantially similar 5 to each other, besides having substantially the same function, is that an agent, e.g., an antibody, which specifically binds to one of the polypeptides, specifically binds to the other. Sequence comparisons maybe carried out using a Smith-Waterman sequence align 10 ment algorithm (see e.g., Waterman (1995) or http://www hto.usc.edu/software/seqaln/index.htm). The localS program, version 1.16, is prefera bly used with following parameters: match: 1, mismatch penalty: 0.33, open-gap pen alty: 2, extended-gap penalty: 2. 15 Moreover, a nucleotide sequence that is "substantially similar' to a reference nucleo tide sequence is said to be "equivalent" to the reference nucleotide sequence. The skilled artisan recognizes that equivalent nucleotide sequences encompassed by this invention can also be defined by their ability to hybridize, under low, moderate and/or stringent conditions (e.g., 0.1 X SSC, 0.1% SDS, 65 0 C), with the nucleotide sequences 20 that are within the literal scope of the instant claims. What is meant by "substantially the same activity" when used in reference to a polynu cleotide or polypeptide fragment is that the fragment has at least 65%, 66%, 67%, 68%, 69%, 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 25 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, and even 90% or more, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, up to at least 99% of the activity of the full length polynucleotide or full length polypeptide, "Target gene" refers to a gene on the replicon that expresses the desired target coding 30 sequence, functional RNA, or protein. The target gene is not essential for replicon rep lication. Additionally, target genes may comprise native non-viral genes inserted into a non-native organism, or chimeric genes, and will be under the control of suitable regu latory sequences. Thus, the regulatory sequences in the target gene may come from any source, including the virus. Target genes may include coding sequences that are 35 either heterologous or homologous to the genes of a particular plant to be transformed. However, target genes do not include native viral genes. Typical target genes include, but are not limited to genes encoding a structural protein, a seed storage protein, a protein that conveys herbicide resistance, and a protein that conveys insect resistance. Proteins encoded by target genes are known as "foreign proteins". The expression of a 40 target gene in a plant will typically produce an altered plant trait. The term "altered plant trait" means any phenotypic or genotypic change in a trans genic plant relative to the wild-type or non-transgenic plant host. 45 "Replication gene" refers to a gene encoding a viral replication protein. In addition to the ORF of the replication protein, the replication gene may also contain other overlap ping or non-overlapping ORF(s), as are found in viral sequences in nature. While not 22 essential for replication, these additional ORFs may enhance replication and/or viral DNA accumulation. Examples of such additional ORFs are AC3 and AL3 in ACMV and TGMV geminiviruses, respectively. 5 "Chimeric trans-acting replication gene" refers either to a replication gene in which the coding sequence of a replication protein is under the control of a regulated plant pro moter other than that in the native viral replication gene, or a modified native viral repli cation gene, for example, in which a site specific sequence(s) is inserted in the 5' tran scribed but untranslated region. Such chimeric genes also include insertion of the 10 known sites of replication protein binding between the promoter and the transcription start site that attenuate transcription of viral replication protein gene, "Chromosomally-integrated" refers to the integration of a foreign gene or DNA con struct into the host DNA by covalent bonds. Where genes are not "chromosomally inte 15 grated" they may be "transiently expressed." Transient expression of a gene refers to the expression of a gene that is not integrated into the host chromosome but functions independently, either as part of an autonomously replicating plasmid or expression cassette, for example, or as part of another biological system such as a virus. 20 The term "transformation" refers to the transfer of a nucleic acid fragment into the ge nome of a host cell, resulting in genetically stable inheritance. Host cells containing the transformed nucleic acid fragments are referred to as "transgenic" cells, and organisms comprising transgenic cells are referred to as "transgenic organisms". Examples of methods of transformation of plants and plant cells include Agrobacterium-mediated 25 transformation (De Blaere 1987) and particle bombardment technology (US 4,945,050), Whole plants may be regenerated from transgenic cells by methods well known to the skilled artisan (see, for example, Fromm 1990). "Transformed," "transgenic," and "recombinant" refer to a host organism such as a bac 30 terium or a plant into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule can be stably integrated into the genome generally known in the art and are disclosed (Sambrook 1989; Innis 1995; Gelfand 1995; Innis & Gelfand 1999. Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific 35 primers, vector-specific primers, partially mismatched primers, and the like. For exam pIe, "transformed," "transformant," and "transgenic" plants or calli have been through the transformation process and contain a foreign gene integrated into their chromo some. The term "untransformed" refers to normal plants that have not been through the transformation process. 40 "Transiently transformed" refers to cells in which transgenes and foreign DNA have been introduced (for example, by such methods as Agrobacterium-mediated transfor mation or biolistic bombardment), but not selected for stable maintenance. 45 "Stably transformed" refers to cells that have been selected and regenerated on a se lection media following transformation.
23 "Transient expression" refers to expression in cells in which a virus or a transgene is introduced by viral infection or by such methods as Agrobacterium-mediated transfor mation, electroporation, or biolistic bombardment, but not selected for its stable main tenance. 5 "Genetically stable" and "heritable" refer to chromosomally-integrated genetic elements that are stably maintained in the plant and stably inherited by progeny through succes sive generations. 10 "Primary transformant" and "TO generation" refer to transgenic plants that are of the same genetic generation as the tissue which was initially transformed (i9., not having gone through meiosis and fertilization since transformation). "Secondary transformants" and the "T1, T2, T3, etc. generations" refer to transgenic plants derived from primary transformants through one or more meiotic and fertilization 15 cycles. They may be derived by self-fertilization of primary or secondary transformants or crosses of primary or secondary transformants with other transformed or untrans formed plants. "Wild-type" refers to a virus or organism found in nature without any known mutation. 20 "Genome" refers to the complete genetic material of an organism. The term "nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, composed of monomers (nucleotides) 25 containing a sugar, phosphate and a base, which is either a purine or pyrimidine. Unless specifically limited, the term encompasses nucleic acids containing known ana logs of natural nucleotides, which have similar binding properties as the reference nu cleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encom 30 passes conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifi cally, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) coons is substituted with mixed-base and/or deoxyinosine residues (Batzer 1991; Ohtsuka 1985; Rossolini 35 1994). A "nucleic acid fragment" is a fraction of a given nucleic acid molecule. In higher plants, deoxyribonucleic acid (DNA) is the genetic material while ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins. The term "nucleotide sequence" refers to a polymer of DNA or RNA which can be single- or dou ble-stranded, optionally containing synthetic, non-natural or altered nucleotide bases 40 capable of incorporation into DNA or RNA polymers. The terms "nucleic acid" or "nu cleic acid sequence" may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene. The invention encompasses isolated or substantially purified nucleic acid or protein 45 compositions. In the context of the present invention, an "isolated" or "purified" DNA molecule or an "isolated" or "purified" polypeptide is a DNA molecule or polypeptide that, by the hand of man, exists apart from its native environment and is therefore not a 24 product of nature. An isolated DNA molecule or polypeptide may exist in a purified form or may exist in a non-native environment such as, for example, a transgenic host cell. For example, an "isolated" or "purified" nucleic acid molecule or protein, or biologically active portion thereof, is substantially free of other cellular material, or culture medium 5 when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. Preferably, an "isolated" nucleic acid is free of sequences (preferably protein encoding sequences) that naturally flank the nucleic acid (Le., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in 10 various embodiments, the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. A protein that is substantially free of cellular material includes preparations of protein or polypeptide having less than about 30%, 20%, 10%, 5%, (by dry weight) of 15 contaminating protein. When the protein of the invention, or biologically active portion thereof, is recombinantly produced, preferably culture medium represents less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or non-protein of interest chemicals. 20 The nucleotide sequences of the invention include both the naturally occurring se quences as well as mutant (variant) forms. Such variants will continue to possess the desired activity, i.e., either promoter activity or the activity of the product encoded by the open reading frame of the non-variant nucleotide sequence. 25 The term "variant" with respect to a sequence (e.g., a polypeptide or nucleic acid se quence such as - for example - a transcription regulating nucleotide sequence of the invention) is intended to mean substantially similar sequences. For nucleotide se quences comprising an open reading frame, variants include those sequences that, because of the degeneracy of the genetic code, encode the identical amino acid se 30 quence of the native protein. Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis and for open reading 35 frames, encode the native protein, as well as those that encode a polypeptide having amino acid substitutions relative to the native protein. Generally, nucleotide sequence variants of the invention will have at least 40, 50, 60, to 70%, e.g., preferably 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81% 84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 40 96%, 97%, to 98% and 99% nucleotide sequence identity to the native (wild type or endogenous) nucleotide sequence. "Conservatively modified variations" of a particular nucleic acid sequence refers to those nucleic acid sequences that encode identical or essentially identical amino acid 45 sequences, or where the nucleic acid sequence does not encode an amino acid se quence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given polypep- 25 tide. For instance the codons CGT, CGC, CGA, CGG, AGA, and AGG all encode the amino acid arginine. Thus, at every position where an arginine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded protein. Such nucleic acid variations are "silent variations" which are one 5 species of "conservatively modified variations." Every nucleic acid sequence described herein, which encodes a polypeptide, also describes every possible silent variation, except where otherwise noted. One of skill will recognize that each codon in a nucleic acid (except ATG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule by standard techniques. Accordingly, each "silent 10 variation" of a nucleic acid, which encodes a polypeptide, is implicit in each described sequence. The nucleic acid molecules of the invention can be "optimized" for enhanced expres sion in plants of interest (see, for example, WO 91/16432; Perlak 1991; Murray 1989). 15 In this manner, the open reading frames in genes or gene fragments can be synthe sized utilizing plant-preferred codons (see, for example, Campbell & Gowri, 1990 for a discussion of host-preferred codon usage). Thus, the nucleotide sequences can be optimized for expression in any plant. It is recognized that all or any part of the gene sequence may be optimized or synthetic. That is, synthetic or partially optimized se 20 quences may also be used. Variant nucleotide sequences and proteins also encom pass, sequences and protein derived from a mutagenic and recombinogenic procedure such as DNA shuffling. With such a procedure, one or more different coding sequences can be manipulated to create a new polypeptide possessing the desired properties. In this manner, libraries of recombinant polynucleotides are generated from a population 25 of related sequence polynucleotides comprising sequence regions that have substan tial sequence identity and can be homologously recombined in vitr or in vivo. Strate gies for such DNA shuffling are known in the art (see, for example, Stemmer 1994; Stemmer 1994; Crameri 1997; Moore 1997; Zhang 1997; Crameri 1998; and US 5,605,793 and 5,837,458). 30 By "variant" polypeptide is intended a polypeptide derived from the native protein by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the native protein; deletion or addition of one or more amino acids at one or more sites in the native protein; or substitution of one or more amino 35 acids at one or more sites in the native protein. Such variants may result from, for ex ample, genetic polymorphism or from human manipulation. Methods for such manipula tions are generally known in the art. Thus, the polypeptides may be altered in various ways including amino acid substitu 40 tions, deletions, truncations, and insertions. Methods for such manipulations are gen erally known in the art. For example, amino acid sequence variants of the polypeptides can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations are well known in the art (see, for example, Kunkel 1985; Kunkel 1987; US 4,873,192; Walker & Gaastra, 1983 and the references cited therein). Guid 45 ance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff et al. (1978). Conservative 26 substitutions, such as exchanging one amino acid with another having similar proper ties, are preferred. Individual substitutions deletions or additions that alter, add or delete a single amino 5 acid or a small percentage of amino acids (typically less than 5%, more typically less than 1%) in an encoded sequence are "conservatively modified variations" where the alterations result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. The following five groups each contain amino acids that are conserva 10 tive substitutions for one another: Aliphatic: Glycine (G), Alanine (A), Valine (V), Leu cine (L), Isoleucine (1); Aromatic: Phenylalanine (F), Tyrosine (Y), Tryptophan (W); Sul fur-containing: Methionine (M), Cysteine (C); Basic: Arginine (R), Lysine (K), Histidine (H); Acidic: Aspartic acid (D), Glutamic acid (E), Asparagine (N), Glutamine (Q). See also, Creighton, 1984. In addition, individual substitutions, deletions or additions which 15 alter, add or delete a single amino acid or a small percentage of amino acids in an en coded sequence are also "conservatively modified variations." "Expression cassette" as used herein means a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a 20 promoter operably linked to a nucleotide sequence of interest, which is - optionally operably linked to termination signals and/or other regulatory elements. An expression cassette may also comprise sequences required for proper translation of the nucleotide sequence. The coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a nontranslated RNA, in 25 the sense or antisense direction. The expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components. The expression cas sette may also be one, which is naturally occurring but has been obtained in a recom binant form useful for heterologous expression. An expression cassette may be as 30 sembled entirely extracellularly (e.g., by recombinant cloning techniques). However, an expression cassette may also be assembled using in part endogenous components. For example, an expression cassette may be obtained by placing (or inserting) a pro moter sequence upstream of an endogenous sequence, which thereby becomes func tionally linked and controlled by said promoter sequences. Likewise, a nucleic acid se 35 quence to be expressed may be placed (or inserted) downstream of an endogenous promoter sequence thereby forming an expression cassette. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitu tive promoter or of an inducible promoter which initiates transcription only when the host cell is exposed to some particular external stimulus. In the case of a multicellular 40 organism, the promoter can also be specific to a particular tissue or organ or stage of development (e.g., root/kernel specific or preferential). "Vector" is defined to include, inter alia, any plasmid, cosmid, phage or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not 45 be self transmissible or mobilizable, and which can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication), 27 Specifically included are shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be se lected from Actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells). 5 Preferably the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, e.g. bacterial, or plant cell. The vector may be a bi-functional ex pression vector which functions in multiple hosts. In the case of genomic DNA, this may 10 contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell. "Cloning vectors" typically contain one or a small number of restriction endonuclease 15 recognition sites at which foreign DNA sequences can be inserted in a determinable fashion without loss of essential biological function of the vector, as well as a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector. Marker genes typically include genes that provide tetracycline resis tance, hygromycin resistance or ampicillin resistance. 20 A "transgenic plant" is a plant having one or more plant cells that contain an expression vector. "Plant tissue" includes differentiated and undifferentiated tissues or plants, including 25 but not limited to roots, stems, shoots, leaves, pollen, seeds, tumor tissue and various forms of cells and culture such as single cells, protoplast, embryos, and callus tissue. The plant tissue may be in plants or in organ, tissue or cell culture. The following terms are used to describe the sequence relationships between two or 30 more nucleic acids or polynucleotides: (a) "reference sequence", (b) "comparison win dow", (c) "sequence identity", (d) "percentage of sequence identity", and (e) "substan tial identity" (a) As used herein, "reference sequence" is a defined sequence used as a basis for 35 sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene se quence, or the complete cDNA or gene sequence. (b) As used herein, "comparison window" makes reference to a contiguous and speci 40 fied segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) com pared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, 45 or longer, Those of skill in the art understand that to avoid a high similarity to a ref erence sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.
28 Methods of alignment of sequences for comparison are well known in the art. Thus, the determination of percent identity between any two sequences can be ac complished using a mathematical algorithm. Preferred, non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller, 1988; the lo 5 cal homology algorithm of Smith et al. 1981; the homology alignment algorithm of Needleman and Wunsch 1970; the search-for-similarity-method of Pearson and Lipman 1988; the algorithm of Karlin and Altschul, 1990, modified as in Karlin and Altschul, 1993. 10 Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software 15 Package, Version 8 (available from Genetics Computer Group (GCG), 575 Sci ence Drive, Madison, Wis., USA). Alignments using these programs can be per formed using the default parameters. The CLUSTAL program is well described (Higgins 1988, 1989; Corpet 1988; Huang 1992; Pearson 1994). The ALIGN pro gram is based on the algorithm of Myers and Miller, supra. The BLAST programs 20 of Altschul et al., 1990, are based on the algorithm of Karlin and Altschul supra. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short 25 words of length W in the query sequence, which either match or satisfy some posi tive-valued threshold score T when aligned with a word of the same length in a da tabase sequence. T is referred to as the neighborhood word score threshold (Alt schul 1990). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in 30 both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide se quences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension 35 of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached. 40 In addition to calculating percent sequence identity, the BLAST algorithm also per forms a statistical analysis of the similarity between two sequences (see, e.g., Kar lin & Altschul (1993). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probabil ity by which a match between two nucleotide or amino acid sequences would oc 45 cur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 29 0.1, more preferably less than about 0.01, and most preferably less than about 0.001. To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 5 2.0) can be utilized as described in Altschul et al 1997. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated search that detects distant rela tionships between molecules. See Altschul et al, supra. When utilizing BLAST, Gapped BLAST, PSI-BLAST, the default parameters of the respective programs (e.g. BLASTN for nucleotide sequences, BLASTX for proteins) can be used. The 10 BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, 1989). See http://www.ncbi.nim.nih.gov. Alignment may 15 also be performed manually by inspection. For purposes of the present invention, comparison of nucleotide sequences for de termination of percent sequence identity to the promoter sequences disclosed herein is preferably made using the BlastN program (version 1.4.7 or later) with its 20 default parameters or any equivalent program. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, gen erates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by the preferred program. 25 (c) As used herein, "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to 30 proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substi tuted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the mole cule. When sequences differ in conservative substitutions, the percent sequence 35 identity may be adjusted upwards to correct for the conservative nature of the sub stitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the per 40 centage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of con servative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif.). 45 (d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein 30 the portion of the polynucleotide sequence in the comparison window may com prise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions 5 at which the identical nucleic acid base or amino acid residue occurs in both se quences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multi plying the result by 100 to yield the percentage of sequence identity. 10 (e) (i) The term "substantial identity" of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, preferably at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more preferably at least 90%, 91%, 92%, 93%, or 94%, and most preferably at least 95%, 96%, 97%, 98%, or 99% se 15 quence identity, compared to a reference sequence using one of the alignment programs described using standard parameters. One of skill in the art will recog nize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like. 20 Substantial identity of amino acid sequences for these purposes normally means sequence identity of at least 70%, more preferably at least 80%, 90%, and most preferably at least 95%. Another indication that nucleotide sequences are substantially identical is if two 25 molecules hybridize to each other under stringent conditions (see below). Gener ally, stringent conditions are selected to be about 5 0 C lower than the thermal melt ing point (Tm) for the specific sequence at a defined ionic strength and pH. How ever, stringent conditions encompass temperatures in the range of about 1*C to about 20 0 C, depending upon the desired degree of stringency as otherwise quali 30 fied herein. Nucleic acids that do not hybridize to each other under stringent condi tions are still substantially identical if the polypeptides they encode are substan tially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. One indication that two nucleic acid sequences are substantially identical is when the polypeptide 35 encoded by the first nucleic acid is immunologically cross reactive with the poly peptide encoded by the second nucleic acid. (ii) The term "substantial identity" in the context of a peptide indicates that a pep tide comprises a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 40 77%, 78%, or 79%, preferably 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more preferably at least 90%, 91%, 92%, 93%, or 94%, or even more preferably, 95%, 96%, 97%, 98% or 99%, sequence identity to the reference se quence over a specified comparison window. Preferably, optimal alignment is con ducted using the homology alignment algorithm of Needleman and Wunsch 45 (1970). An indication that two peptide sequences are substantially identical is that one peptide is immunologically reactive with antibodies raised against the second 31 peptide. Thus, a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution. For sequence comparison, typically one sequence acts as a reference sequence to 5 which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated pro 10 gram parameters. As noted above, another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase "hybridizing specifically to" refers to the binding, duplexing, or hybridizing of 15 a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. "Bind(s) substantially" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommo dated by reducing the stringency of the hybridization media to achieve the desired de 20 tection of the target nucleic acid sequence. "Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and Northern hy bridization are sequence dependent, and are different under different environmental 25 parameters. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Specificity is typi cally the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, 1984: 30 Tm = 81.5"C + 16.6 (log 0 M)+0.41 (%GC) - 0.61 (% form) - 500 / L where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the 35 hybridization solution, and L is the length of the hybrid in base pairs. Tm is reduced by about 1 *C for each 1 % of mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if se quences with >90% identity are sought, the Tm can be decreased 10*C. Generally, stringent conditions are selected to be about 5*C lower than the thermal melting point I 40 for the specific sequence and its complement at a defined ionic strength and pH. How ever, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4*C lower than the thermal melting point 1; moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10*C lower than the thermal melting point l; low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, 45 or 20"C lower than the thermal melting point 1. Using the equation, hybridization and wash compositions, and desired T, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the 32 desired degree of mismatching results in a T of less than 45*C (aqueous solution) or 32 0 C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic ac ids is found in Tijssen, 1993. Generally, highly stringent hybridization and wash condi 5 tions are selected to be about 5*C lower than the thermal melting point Tm for the spe cific sequence at a defined ionic strength and pH. An example of highly stringent wash conditions is 0.15 M NaCl at 72"C for about 15 minutes. An example of stringent wash conditions is a 0.2 X SSC wash at 650C for 15 10 minutes (see, Sambrook, infra, for a description of SSC buffer). Often, a high strin gency wash is preceded by a low stringency wash to remove background probe signal. An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is 1 X SSC at 450C for 15 minutes. An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4 to 6 X SSC at 40"C for 15 minutes. For short 15 probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt con centrations of less than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion con centration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30*C and at least about 60*C for long robes (e.g., >50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as for 20 mamide. In general, a signal to noise ratio of 2 X (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent condi tions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maxi 25 mum codon degeneracy permitted by the genetic code. Very stringent conditions are selected to be equal to the Tm for a particular probe. An example of stringent conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or Northern blot 30 is 50% formamide, e.g., hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37*C, and a wash in 0.1 x SSC at 60 to 65*C. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (so dium dodecyl sulphate) at 37"C, and a wash in 1 X to 2 X SSC (20 X SSC=3.0 M NaCI/0.3 M trisodium citrate) at 50 to 55"C. Exemplary moderate stringency conditions 35 include hybridization in 40 to 45% formamide, 1.0 M NaCI, 1% SDS at 370C, and a wash in 0.5 X to 1 X SSC at 55 to 600C. The following are examples of sets of hybridization/wash conditions that may be used to clone orthologous nucleotide sequences that are substantially identical to reference 40 nucleotide sequences of the present invention: a reference nucleotide sequence pref erably hybridizes to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50"C with washing in 2 X SSC, 0. 1% SDS at 50*C, more desirably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50*C with washing in 1 X SSC, 0.1% SDS at 500C, more desirably still in 7% sodium 45 dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 500C with washing in 0.5 X SSC, 0.1% SDS at 500C, preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50C with washing in 0.1 X SSC, 0.1% SDS at 500C, more preferably in 33 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50*C with washing in 0.1 X SSC, 0.1% SDS at 65*C. "DNA shuffling" is a method to introduce mutations or rearrangements, preferably ran 5 domly, in a DNA molecule or to generate exchanges of DNA sequences between two or more DNA molecules, preferably randomly. The DNA molecule resulting from DNA shuffling is a shuffled DNA molecule that is a non-naturally occurring DNA molecule derived from at least one template DNA molecule. The shuffled DNA preferably en codes a variant polypeptide modified with respect to the polypeptide encoded by the 10 template DNA, and may have an altered biological activity with respect to the polypep tide encoded by the template DNA. "Recombinant DNA molecule' is a combination of DNA sequences that are joined to gether using recombinant DNA technology and procedures used to join together DNA 15 sequences as described, for example, in Sambrook etal., 1989. The word "plant" refers to any plant, particularly to agronomically useful plants (e.g., seed plants), and "plant cell" is a structural and physiological unit of the plant, which comprises a cell wall but may also refer to a protoplast. The plant cell may be in form of 20 an isolated single cell or a cultured cell, or as a part of higher organized unit such as, for example, a plant tissue, or a plant organ differentiated into a structure that is pre sent at any stage of a plant's development. Such structures include one or more plant organs including, but are not limited to, fruit, shoot, stem, leaf, flower petal, etc. Pref erably, the term "plant" includes whole plants, shoot vegetative organs/structures (e.g. 25 leaves, stems and tubers), roots, flowers and floral organs/structures (e.g. bracts, se pals, petals, stamens, carpels, anthers and ovules), seeds (including embryo, en dosperm, and seed coat) and fruits (the mature ovary), plant tissues (e.g. vascular tis sue, ground tissue, and the like) and cells (e.g. guard cells, egg cells, trichomes and the like), and progeny of same. 30 The class of plants that can be used in the method of the invention is generally as broad as the class of higher and lower plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. It includes plants of a variety of ploidy levels, including 35 aneuploid, polyploid, diploid, haploid and hemizygous, Included within the scope of the invention are all genera and species of higher and lower plants of the plant kingdom. Included are furthermore the mature plants, seed, shoots and seedlings, and parts, propagation material (for example seeds and fruit) and cultures, for example cell cul tures, derived therefrom. 40 Annual, perennial, monocotyledonous and dicotyledonous plants are preferred host organisms for the generation of transgenic plants. The use of the recombination sys tem, or method according to the invention is furthermore advantageous in all ornamen tal plants, forestry, fruit, or ornamental trees, flowers, cut flowers, shrubs or turf. Said 45 plant may include - but shall not be limited to - bryophytes such as, for example, Hepaticae (hepaticas) and Musci (mosses); pteridophytes such as ferns, horsetail and clubmosses; gymnosperms such as conifers, cycads, ginkgo and Gnetaeae; algae 34 such as Chlorophyceae, Phaeophpyceae, Rhodophyceae, Myxophyceae, Xanthophy ceae, Bacillariophyceae (diatoms) and Euglenophyceae. Plants for the purposes of the invention may comprise the families of the Rosaceae 5 such as rose, Ericaceae such as rhododendrons and azaleas, Euphorbiaceae such as poinsettias and croton, Caryophylaceae such as pinks, Solanaceae such as petunias, Gesneriaceae such as African violet, Balsaminaceae such as touch-me-not, Orchida ceae such as orchids, Ndaceae such as gladioli, iris, freesia and crocus, Compositee such as marigold, Geraniaceae such as geraniums, Liliaceae such as Drachaena, 10 Moraceae such as ficus, Araceae such as philodendron and many others. The transgenic plants according to the invention are furthermore selected from among dicotyledonous crop plants such as, for example, from the families of the Leguminosae such as pea, alfalfa and soybean; the family of the Umbelliferae, particularly the genus 15 Daucus (very particularly the species cara (carrot)) and Apium (very particularly the species graveolens var. dulce (celery)) and many others; the family of the Solanaceae, particularly the genus Lycopersicon, very particularly the species esculentum (tomato) and the genus Solanum, very particularly the species tuberosum (potato) and melon gene (aubergine), tobacco and many others; and the genus Capsicum, very particularly 20 the species annum (pepper) and many others; the family of the Leguminosae, particu larly the genus Glycine, very particularly the species max (soybean) and many others; and the family of the Cruciferae, particularly the genus Brassica, very particularly the species napus (oilseed rape), campestris (beet), oleracea cv Tastie (cabbage), ol eracea cv Snowball Y (cauliflower) and oleracea cv Emperor (broccoli); and the genus 25 Arabidopsis, very particularly the species thaliana and many others; the family of the Compositae, particularly the genus Lactuca, very particularly the species sativa (let tuce) and many others. Further preferred are trees such as apple, pear, quince, plum, cherry, peach, nectarine, apricot, papaya, mango, and other woody species including coniferous and deciduous trees such as poplar, pine, sequoia, cedar, oak, etc. 30 Most preferably, the transgenic plants according to the invention may be selected among monocotyledonous crop plants. The term "monocotyledonous plant" when refer ring to a transgenic plant according to the invention or to the source of the transcription regulating sequences of the invention is intended to comprise all genera, families and 35 species of monocotyledonous plants. Preferred are Gramineae plants such as, for ex ample, cereals such as maize, rice, wheat, barley, sorghum, millet, rye, triticale, or oats, and other non-cereal monocotyledonous plants such as sugarcane or banana. Especially preferred are corn (maize), rice, barley, wheat, rye, and oats. Most preferred are all varieties of the specie Zea mays and Oryza sativa. 40 "Significant increase" is an increase that is larger than the margin of error inherent in the measurement technique, preferably an increase by about 2-fold or greater. "Significantly less" means that the decrease is larger than the margin of error inherent 45 in the measurement technique, preferably a decrease by about 2-fold or greater.
35 DETAILED DESCRIPTION OF THE INVENTION The present invention provides for isolated nucleic acid molecules comprising a plant nucleotide sequence that directs transcription of an operably linked nucleic acid frag ment in a plant cell, preferably in monocotyledonous plants. Specifically, the present 5 invention provides expression cassettes for regulating expression in monocotyledonous plants comprising i) at least one transcription regulating nucleotide sequence of a monocotyledonous plant gene, said monocotyledonous plant gene selected from the group of genes consisting of caffeoyl-CoA-Q-methyltransferase genes, C8,7-sterol isomerase 10 genes, hydroxyproline-rich glycoprotein (HRGP) genes, lactate dehydrogenase genes, and chloroplast protein like 12 genes, and functionally linked thereto ii) at least one nucleic acid sequence which is heterologous in relation to said tran scription regulating sequence. 15 Preferably a transcription regulating nucleotide sequence of the invention comprises at least one promoter sequence of the respective gene (e.g., a sequence localized up stream of the transcription start of the respective gene capable to induce transcription of the downstream sequences). The transcription regulating nucleotide sequence of the 20 invention may comprise the promoter sequence of said genes but may further comprise other elements such as the 5'-untranslated sequence, enhancer, introns etc. Prefera bly, said promoter sequence directs transcription of an operably linked nucleic acid segment in a plant or plant cell e.g., a linked plant DNA comprising an open reading frame for a structural or regulatory gene. 25 The transcription regulating sequences of the inventions can be combined with various 5'-untranslated regions, intron (preferably expression enhancing introns), and transcrip tion terminations sequences (as described below in more detail). It has been shown that the tissue specificity of the transcription regulating sequences of the invention can 30 be advantageously modulated by the combination with introns and/or transcription ter mination sequences. In most combinations the resulting expression cassettes exhibit a preferential or specific expression in root and kernel. However other expression speci ficities (e.g., constitutive expression) can be achieved. The transcription regulating se quences with expression activity in roots may be useful for alteration of the function of 35 root tissue, modification of growth rate, improvement of resistance to root preferred pathogens, pests, herbicides or adverse weather conditions, for detoxification of soil as well as for broadening the range of soils or environments in which said plant may grow. Root abundant or root specific gene expression would provide a mechanism according to which morphology and metabolism may be altered to improve the yield and to pro 40 duce useful proteins in greater amounts. However, in some combinations, the transcriptions regulating sequence may exhibit a strong constitutive expression profile. Constitutive promoters are favored in situations where expression in all (or most) tissues during all (or most) times of the plant devel 45 opment is required. Other tissue specificities may be possible depending on the regula tory elements used in combination with the transcription regulating sequences of the invention.
36 The following Table I illustrates the genes from which the promoters of the invention are preferably isolated, the function of said genes, the cDNA encoded by said genes, and the protein (ORF) encoded by said genes. 5 Table 1: Genes from which the promoters of the invention are preferably isolated, puta tive function of s id genes, cDNA and the protein en oded by said genes. Gene Product Preferred Promotor mRNA locus ID Proteine ID Specie SEQ ID cDNA SEQ ID Protein SEQ ID Caffeoyl-CoA-O- Oryza sativa SEQ ID NO: 1,2,3 AB023482.2 BAA78733 methyltansferase SEQ ID NO: 4 SEQ ID NO: 5 Caffeoyl-CoA-0- Zea mays SEQ ID NO: 66,67,68 SEQ ID NO: 69 SEQ ID NO: 70 methyltransferase C-8,7-sterol- Oryza sativa SEQ ID NO: 6,7,8 NM_183458 NP_908347 isomerase SEQ ID NO: 9 SEQ ID NO: 10 Hydroxyproline- Zea mays SEQ ID NO: S45164 AAB23539 rich glycoprotein 11,12,13,14,15,16 SEQ ID NO: 17 SEQ ID NO: 18 Hydroxyproline- Zea diplop- SEQ ID NO: 71,72,73 SEQ ID NO: 74 SEQ ID NO: 75 rich glycoprotein erennis Lactate- Zea mays SEQ fD NO: Z1 1754 CAA77808 dehydrogenase 19,20,21,22,23,24 SEQ ID NO: 25 SEQ ID NO: 26 Lactate- Oryza sativa SEQ ID NO: 56, 57, Os06g01590 Os06g01590 dehydrogenase 58, 61,62, 63 SEQ ID NO: 59 SEQ ID NO: 60 Os02g01510 Os02g01510 SEQ ID NO: 64 SEQ ID NO: 65 Chloroplast pro- Oryza sativa SEQ ID NO: 27,28,29 AP002881 BAB19776 tein 12 lie protein I I SEQ ID NO: 30 SEQ ID NO: 31 Preferably, the transcription regulating nucleotide sequence is obtainable from mono cotyledonous plant genomic DNA from a gene encoding a polypeptide which 10 al) comprises at least one (preferably at least 2 or 3, more preferably at least 4 or 5, most preferably all) sequence motif of a monocotyledonous plant lactate dehydro genase protein selected from the group consisting of the amino acid sequences i) SLSELGFDA (SEQ ID NO: 76), ii) VIGAGNVGMA (SEQ ID NO: 77), 15 iii) IVTAGARQl (SEQ ID NO: 78), iv) L(F/Y)RKIVP (SEQ ID NO: 79), v) GFPASRV (SEQ ID NO: 80), vi) RF(L/I)AEHL (SEQ ID NO: 81), vii) QAYMVGEH (SEQ ID NO: 82), 20 viii) ALEGIRRAV (SEQ ID NO: 83), and ix) GYSVAS(L/1)A (SEQ ID NO: 84), or b1) is encoding a lactate dehydrogenase protein from a monocotyledonous plant hav 25 ing an amino acid sequence identity of at least 90%, preferably at least 95%, more preferably at least 98% to a polypeptide selected from the group described by SEQ ID NO: 26, 60 and 65, or a2) comprises at least one (preferably at least 2 or 3, more preferably at least 4 or 5, 30 most preferably all) sequence motif of a monocotyledonous plant caffeoyl-CaA-O- 37 methyltransferase protein selected from the group consisting of the amino acid sequences x) EQKTRHSE (SEQ ID NO: 85), xi) L(I/L)KLIGAK (SEQ ID NO: 86), 5 xii) KTMElGVY (SEQ ID NO: 87), xiii) HERL(L/M)KLV (SEQ 10 NO: 88), xiv) CQLPVGDG (SEQ ID NO: 89), and xv) TLCRRVK (SEQ ID NO: 90), or 10 b2) is encoding a caffeoyl-CaA-O-methyltransferase protein from a monocotyledon ous plant having an amino acid sequence identity of at least 90%, preferably at least 95%, more preferably at least 98% to a polypeptide selected from the group described by SEQ ID NOs: 5 and 70, or 15 b3) is encoding a hydroxyproline-rich glycoprotein from a monocotyledonous plant having an amino acid sequence identity of at least 90%, preferably at least 95%, more preferably at least 98% to a polypeptide selected from the group described by SEQ ID NOs: 18 and 75, or 20 b4) is encoding a C-8,7-stereol-isomerase protein from a monocotyledonous plant having an amino acid sequence identity of at least 90%, preferably at least 95%, more preferably at least 98% to a polypeptide selected described by SEQ ID NO: 10, or 25 b5) is encoding a Chloroplast protein 12 like protein from a monocotyledonous plant having an amino acid sequence identity of at least 90%, preferably at least 95%, more preferably at least 98% to a polypeptide described by SEQ ID NO: 31. 30 Preferably functional equivalent of the transcription regulating nucleotide sequence can be obtained or is obtainable from plant genomic DNA from a gene expressing a mRNA described by a cDNA which is substantially similar and preferably has at least 70%, preferably 80%, more preferably 90%, most preferably 95% sequence identity to a se quence described by any one of SEQ ID NOs: 4, 9, 17, 25, 30, 59, 64, 69, or 74, re 35 spectively, or a fragment of said transcription regulating nucleotide sequence which exhibits the same promoter activity (e.g., root/kernel-preferential or root/kemel-specific or constitutive expression activity). Preferably, the transcription regulating nucleotide sequence is from a corn (Zea mays) 40 or rice (Oryza saiva) plant. Even more preferably the transcription regulating nucleo tide sequence is from a plant gene selected from the group of genes consisting of Oryza sativa caffeoyl-CoA-O-methyltransferase genes, Oryza sativa C8,7-sterol isom erase genes, Zea may hydroxyproline-rich glycoprotein (HRGP) genes, Zea mays lac tate dehydrogenase genes, Oryza sativa chloroplast protein 12 like genes and func 45 tional equivalents thereof. The functional equivalent gene is preferably encoding a polypeptide which has at least 90% amino acid sequence identity, preferably at least 95% amino acid sequence identity, more preferably at least 98% amino acid sequence 38 identity to a polypeptide selected from the group described by SEQ ID NOs: 5, 10, 18, 26, 31, 60, 65, 70, and 75. Some of the transcription regulating sequences of the invention provided herein are 5 novel as such (ite. as isolated nucleotide sequences). Accordingly another embodiment of the invention relates to an isolated nucleic acid sequence comprising at least one transcription regulating nucleotide sequence as described by SEQ ID NOs: 6, 7, 8, 11, 12, 13, 19, 20, or 21. 10 In a more preferred embodiment the transcription regulating nucleotide sequence is selected from the group of sequences consisting of i) the sequences described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, and 73, and 15 ii) a fragment of at least 50 (preferably at least 70 or 100, more preferably at least 150 or 200, even more preferably at least 300 or 400, most preferably at least 500 or 700) consecutive bases of a sequence under i); and iii) a nucleotide sequence having substantial similarity (preferably with a sequence identity of at least 60%; more preferably measured by the BLASTN program with 20 the default parameters wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands) to a transcription regulating nucleotide sequence described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73; and 25 iv) a nucleotide sequence capable of hybridizing to a transcription regulating nucleo tide sequence described by SEQ ID NOs: 1, 2, 3, 6, 7, 8,11, 12, 13,14,15, 16,19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73 or the complement thereof (preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50*C with washing in 2 X SSC, 0. 1% SDS at 50*C; more prefera 30 bly in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50*C with washing in 1 X SSC, 0.1% SDS at 50*C, still more preferably in 7% sodium dode cyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50*C with washing in 0.5 X SSC, 0.1% SDS at 50"C, even more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , I mM EDTA at 50 0 C with washing in 0.1 X SSC, 0.1% SDS at 50*C, 35 most preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50 0 C with washing in 0.1 X SSC, 0.1% SDS at 65 0 C); and v) a nucleotide sequence capable of hybridizing to a nucleic acid comprising 50 to 200 or more ((preferably at least 70 or 100, more preferably at least 150 or 200, even more preferably at least 300 or 400, most preferably at least 500 or 700) con 40 secutive nucleotides of a transcription regulating nucleotide sequence described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73 or the complement thereof; and vii) a nucleotide sequence which is the complement or reverse complement of any of the previously mentioned nucleotide sequences under i) to v). 45 39 Another preferred embodiment relates to an expression cassette for regulating expres sion in monocotyledonous plants comprising a) at least one transcription regulating nucleotide sequence functional in a monocoty ledonous plant comprising at least one sequence selected from the group of se 5 quences consisting of i) the sequences described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, and 73, and ii) a fragment of at least 50 (preferably at least 70 or 100, more preferably at least 10 150 or 200, even more preferably at least 300 or 400, most preferably at least 500 or 700) consecutive bases of a sequence under i); and iii) a nucleotide sequence having substantial similarity (preferably with a sequence identity of at least 60%; more preferably measured by the BLASTN program with the default parameters wordlength (W) of 11, an expectation (E) of 10, a 15 cutoff of 100, M=5, N=-4, and a comparison of both strands) to a transcription regulating nucleotide sequence described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73; and iv) a nucleotide sequence capable of hybridizing to a transcription regulating nu 20 cleotide sequence described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12,13, 14, 15, 16, 19, 20, 21,22,23,24,27,28,29,56,57,58,61,62,63,66,67,68,71,72, or 73 or the complement thereof (preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50'C with washing in 2 X SSC, 0. 1% SDS at 50"C; more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 25 mM EDTA at 50 0 C with washing in 1 X SSC, 0.1% SDS at 500C, still more pref erably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50T with washing in 0.5 X SSC, 0.1% SDS at 50"C, even more preferably in 7% so dium dodecyl sulfate (SDS), 0.5 M NaPQ 4 , 1 mM EDTA at 50*C with washing in 0.1 X SSC, 0.1% SDS at 50"C, most preferably in 7% sodium dodecyl sulfate 30 (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50"C with washing in 0.1 X SSC, 0.1% SDS at 65"C); and v) a nucleotide sequence capable of hybridizing to a nucleic acid comprising 50 to 200 or more (preferably at least 70 or 100, more preferably at least 150 or 200, even more preferably at least 300 or 400, most preferably at least 500 or 700) 35 consecutive nucleotides of a transcription regulating nucleotide sequence de scribed by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73 or the com plement thereof; and vi) a nucleotide sequence which is the complement or reverse complement of any 40 of the previously mentioned nucleotide sequences under i) to v), and b) at least one nucleic acid sequence which is heterologous in relation to said tran scription regulating sequence. 45 Preferably, the sequences specified under ii), iii), iv) v) and vi) in the paragraphs above are capable to modify transcription in a monocotyledonous plant cell or organism. More 40 preferably said sequences specified under ii), iii), iv) v) and vi) have substantially the same transcription regulating activity as the transcription regulating nucleotide se quence described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73. 5 Also preferably the sequences specified under iii) above have a sequence identity of at least 60%, preferably 70% or 80%, more preferably 90% or 95% to a sequence de scribed by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73, wherein the identity is pref 10 erably measured by the BLASTN program with the default parameters wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands.. Further preferably, the sequences specified under iv) or v) above are hybridizing under 15 stringent conditions, preferably under medium stringent conditions, most preferably under high stringent conditions (such as in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50*C with washing in 0.1 X SSC, 0.1% SDS at 65"C) with the specified target sequence. 20 The activity of a specific transcription regulating nucleotide sequence is considered substantially the same or equivalent if transcription is initiated preferentially or specifi cally in the same tissue than the original promoter (e.g., in root and kernel or constitu tive in all or most tissues) under otherwise identical conditions (i.e. in combination with the set of additional regulatory elements (e.g., introns, transcription terminator se 25 quences and 5'-untranslated regions) and the same nucleic acid sequence to be ex pressed in the same plant expression system). Such expression profile is preferably demonstrated using reporter genes operably linked to said transcription regulating se quence. Preferred reporter genes (Schenbom 1999) in this context are green fluores cence protein (GFP) (Chui 1996; Leffel 1997), chloramphenicol transferase, luciferase 30 (Millar 1992), 8-glucuronidase or p-galactosidase. Especially preferred is B glucuronidase (Jefferson 1987). With respect to promoters with constitutive expression activity, the term "at most times" means a transcription regulating activity (as demon strated by an -glucuronidase assays as described in the examples below) preferably during at least 50%, preferably at least 70%, more preferably at least 90% of the de 35 velopment cycle of a plant comprising the respective expression cassette stably inte grated into its chromosomal DNA. With respect to a constitutive transcription regulating nucleotide sequence (e.g., a con stitutive promoter), the term ,in most tissues" means a transcription regulating activity 40 (as demonstrated by an s-glucuronidase assays as described in the examples below) in tissues which together account to preferably at least 50%, preferably at least 70%, more preferably at least 90% of the entire biomass of the a plant comprising the re spective expression cassette stably integrated into its chromosomal DNA. 45 Beside this the transcription regulating activity of a function equivalent may vary from the activity of its parent sequence, especially with respect to expression level. The ex pression level may be higher or lower than the expression level of the parent se- 41 quence. Both derivations may be advantageous depending on the nucleic acid se quence of interest to be expressed. Preferred are such functional equivalent se quences which - in comparison with its parent sequence - does not derivate from the expression level of said parent sequence by more than 50%, preferably 25%, more 5 preferably 10% (as to be preferably judged by either mRNA expression or protein (e.g., reporter gene) expression). Furthermore preferred are equivalent sequences which demonstrate an increased expression in comparison to its parent sequence, preferably an increase my at least 50%, more preferably by at least 100%, most preferably by at least 500%. 10 Such functional equivalent of the transcription regulating nucleotide sequence may be obtained from other monocotyledonous plant species by using the transcription regulat ing sequences described herein as probes to screen for homologous structural genes in other plants by hybridization under low, moderate or stringent hybridization condi 15 tions. Regions of the transcription regulating sequences of the present invention, which are conserved among species, can also be used as PCR primers to amplify a segment from a species other than rice or maize, and that segment used as a hybridization probe (the latter approach permitting higher stringency screening) or in a transcription assay to determine promoter activity. Moreover, the transcription regulating sequences 20 could be employed to identify structurally related sequences in a database using com puter algorithms. More specifically, based on the transcription regulating sequences of the present inven tion, orthologs may be identified or isolated from the genome of any desired organism, 25 preferably from another plant, according to well known techniques based on their se quence similarity to the transcription regulating sequences of the invention, e.g., hy bridization, PCR or computer generated sequence comparisons. For example, all or a portion of a particular transcription regulating nucleotide sequence of the invention is used as a probe that selectively hybridizes to other gene sequences present in a popu 30 lation of cloned genomic DNA fragments (i.e., genomic libraries) from a chosen source organism. Further, suitable genomic libraries may be prepared from any cell or tissue of an organism. Such techniques include hybridization screening of plated DNA librar ies (either plaques or colonies; see, e.g., Sambrook 1989) and amplification by PCR using oligonucleotide primers preferably corresponding to sequence domains con 35 served among related polypeptide or subsequences of the nucleotide sequences pro vided herein (see, e.g., Innis 1990). These methods are particularly well suited to the isolation of gene sequences from organisms closely related to the organism from which the probe sequence is derived. The application of these methods using the transcrip tion regulating sequences of the invention as probes is well suited for the isolation of 40 gene sequences from any source organism, preferably other plant species. In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any plant of interest. Methods for designing PCR primers and PCR cloning are generally known in the art. 45 In hybridization techniques, all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present 42 in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 3 2 P, or any other detectable marker. Thus, 5 for example, probes for hybridization can be made by labeling synthetic oligonucleo tides based on the sequence of the invention. Methods for preparation of probes for hybridization and for construction of cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook et at (1989). In general, sequences that hy bridize to the sequences disclosed herein will have at least 40% to 50%, about 60% to 10 70% and even about 80% 85%, 90%, 95% to 98% or more identity with the disclosed sequences. That is, the sequence similarity of sequences may range, sharing at least about 40% to 50%, about 60% to 70%, and even about 80%, 85%, 90%, 95% to 98% sequence similarity. 15 The nucleic acid molecules of the invention can also be identified by, for example, a search of known databases for genes encoding polypeptides having a specified amino acid sequence identity or DNA having a specified nucleotide sequence identity. Meth ods of alignment of sequences for comparison are well known in the art and are de scribed hereinabove. 20 Hence, the isolated nucleic acid molecules of the invention include the orthologs of the transcription regulating sequences disclosed herein, i.e., the corresponding nucleotide sequences in other (i.e. other than the host organism where the specific sequences disclosed herein are derived from) monocotyledonous plant organisms, preferably, e.g., 25 cereal plants such as corn, wheat, rye, barley, oats, turfgrass, sorghum, millet, or other monocotyledonous plants such as sugarcane or banana. An ortholog or orthologous gene is a gene from a different species that encodes a product having the same or similar function, e.g., catalyzing the same reaction as a product encoded by a gene from a reference organism. Thus, an ortholog includes polypeptides having less than, 30 e.g., 90% amino acid sequence identity, but which ortholog encodes a polypeptide hav ing the same or similar function. Databases such GenBank may be employed to iden tify sequences related to the maize or rice sequences disclosed herein, e.g., orthologs in other monocotyledonous plants such as wheat, barley, oats and others. Alternatively, recombinant DNA techniques such as hybridization or PCR may be employed to iden 35 tify sequences related to the maize and rice sequences or to clone the equivalent se quences from different maize or rice DNAs. The transcription regulating nucleotide sequences of the invention or their functional equivalents can be obtained or isolated from any plant or non-plant source, or pro 40 duced synthetically by purely chemical means. Preferred sources include, but are not limited to the plants defined in the DEFINITION section above. Thus, another embodiment of the invention relates to a method for identifying and/or isolating a transcription regulating nucleotide sequence from a monocotyledonous plant 45 characterized that said identification and/or isolation utilizes a nucleic acid sequence encoding an amino acid sequence as described by SEQ ID NOs: 5, 10, 18, 26, 31, 60, 65, 70, or 75, or a parts of said nucleic acid sequence. Preferred are nucleic acid se- 43 quences described by SEQ ID NOs: 4, 9, 17, 25, 30, 59, 64, 69, or 74 or parts thereof. "Part in this context means a nucleic acid sequence of at least 15 bases preferably at least 25 bases, more preferably at least 50 bases. The method can be based on (but is not limited to) the methods described above such as polymerase chain reaction, hy 5 bridization or database screening. Preferably, this method of the invention is based on a polymerase chain reaction, wherein said nucleic acid sequence or its part is utilized as oligonucleotide primer. The person skilled in the art is aware of several methods to amplify and isolate the promoter of a gene starting from part of its coding sequence (such as, for example, part of a cDNA). Such methods may include but are not limited 10 to method such as inverse PCR ("iPCR") or "thermal asymmetric interlaced PCR" ("TAIL PCR'). Still another embodiment of the invention relates to a method for providing a transgenic expression cassette for heterologous expression in monocotyledonous plants compris 15 ing the steps of: 1. isolating of a transcription regulating nucleotide sequence from a monocotyledonous plant utilizing at least one nucleic acid sequence or a part thereof, wherein said se quence is encoding a polypeptide described by SEQ ID NOs: 5, 10, 18, 26, 31, 60, 65, 70, or 75, or a part of at least 15 bases of said nucleic acid sequence, and 20 111. functionally linking said transcription regulating nucleotide sequence to another nu cleotide sequence of interest, which is heterologous in relation to said transcription regulating nucleotide sequence. Preferably, the nucleic acid sequence employed for the isolation comprises at least 15 25 base, preferably at least 25 bases, more preferably at least 50 bases of a sequence described by SEQ ID NOs: 4, 9, 17, 25, 30, 59, 64, 69, or 74 Preferably, the isolation of the transcription regulating nucleotide sequence is realized by a polymerase chain re action utilizing said nucleic acid sequence as a primer. The operable linkage can be realized by standard cloning method known in the art such as ligation-mediated cloning 30 or recombination-mediated cloning. For both of the above mentioned methods preferably the nucleotide sequence utilized for isolation of said transcription regulating nucleotide sequence is encoding a polypep tide comprising 35 al) at least one sequence motif of a monocotyledonous plant lactate dehydrogenase protein selected from the group consisting of the amino acid sequences i) SLSELGFDA (SEQ ID NO: 76), ii) VIGAGNVGMA (SEQ ID NO: 77), 40 iii) IVTAGARQI (SEQ ID NO: 78), iv) L(FIY)RKIVP (SEQ ID NO: 79), v) GFPASRV (SEQ ID NO: 80), vi) RF(LI)AEHL (SEQ ID NO: 81), vii) QAYMVGEH (SEQ ID NO: 82), 45 viii) ALEGIRRAV (SEQ ID NO: 83), and ix) GYSVAS(L/I)A (SEQ ID NO: 84), or 44 a2) at least one sequence motif of a monocotyledonous plant caffeoyl-CaA-O methyltransferase protein selected from the group consisting of the amino acid sequences 5 x) EQKTRHSE (SEQ ID NO: 85), xi) L(I/L)KLIGAK (SEQ ID NO: 86), xii) KTMEIGVY (SEQ ID NO: 87), xiii) HERL(L/M)KLV (SEQ ID NO: 88), xiv) CQLPVGDG (SEQ ID NO: 89), and 10 xv) TLCRRVK (SEQ ID NO: 90). Preferably, the transcription regulating nucleotide sequences and promoters of the in vention include a consecutive stretch of about 25 to 2,000, including 50 to 500 or 100 to 250, and up to 1,000 or 1,500, contiguous nucleotides, e.g., 40 to about 743, 60 to 15 about 743, 125 to about 743, 250 to about 743, 400 to about 743, 600 to about 743, of any one of SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, and 73, or the promoter orthologs thereof, which include the minimal promoter region. 20 In a particular embodiment of the invention said consecutive stretch of about 25 to 2,000, including 50 to 500 or 100 to 250, and up to 1,000 or 1,500, contiguous nucleo tides, e.g., 40 to about 743, 60 to about 743, 125 to about 743, 250 to about 743, 400 to about 743, 600 to about 743, has at least 75%, preferably 80%, more preferably 90% and most preferably 95%, nucleic acid sequence identity with a corresponding 25 consecutive stretch of about 25 to 2,000, including 50 to 500 or 100 to 250, and up to 1,000 or 1,500, contiguous nucleotides, e.g., 40 to about 743, 60 to about 743, 125 to about 743, 250 to about 743, 400 to about 743, 600 to about 743, of any one of SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, and 73, or the promoter orthologs thereof, which in 30 clude the minimal promoter region. The above defined stretch of contiguous nucleo tides preferably comprises one or more promoter motifs selected from the group con sisting of TATA box, GC-box, CAAT-box and a transcription start site. The transcription regulating nucleotide sequences of the invention or their functional 35 equivalents are capable of driving expression in monocotyledonous plants of a coding sequence in a target cell, particularly in a plant cell. The promoter sequences and methods disclosed herein are useful in regulating expression in monocotyledonous plants, respectively, of any heterologous nucleotide sequence in a host plant in order to vary the phenotype of that plant. These promoters can be used with combinations of 40 enhancer, upstream elements, and/or activating sequences from the 5 flanking regions of plant expressible structural genes. Similarly the upstream element can be used in combination with various plant promoter sequences. The transcription regulating nucleotide sequences and promoters of the invention are 45 useful to modify the phenotype of a plant. Various changes in the phenotype of a transgenic plant are desirable, i.e., modifying the fatty acid composition in a plant, alter ing the amino acid content of a plant, altering a plant's pathogen defense mechanism, 45 and the like. These results can be achieved by providing expression of heterologous products or increased expression of endogenous products in plants. Alternatively, the results can be achieved by providing for a reduction of expression of one or more en dogenous products, particularly enzymes or cofactors in the plant. These changes re 5 sult in an alteration in the phenotype of the transformed plant. Generally, the transcription regulating nucleotide sequences and promoters of the in vention may be employed to express a nucleic acid segment that is operably linked to said promoter such as, for example, an open reading frame, or a portion thereof, an 10 anti-sense sequence, a sequence encoding for a double-stranded RNA sequence, or a transgene in plants. An operable linkage may - for example - comprise an sequential arrangement of the transcription regulating nucleotide sequence of the invention (for example a sequence 15 as described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73) with a nucleic acid se quence to be expressed, and - optionally - additional regulatory elements such as for example polyadenylation or transcription termination elements, enhancers, introns etc, in a way that the transcription regulating nucleotide sequence can fulfill its function in 20 the process of expression the nucleic acid sequence of interest under the appropriate conditions. The term "appropriate conditions" mean preferably the presence of the ex pression cassette in a plant cell. Preferred are arrangements, in which the nucleic acid sequence of interest to be expressed is placed down-stream (i.e., in 3'-direction) of the transcription regulating nucleotide sequence of the invention in a way, that both se 25 quences are covalently linked. Optionally additional sequences may be inserted in between the two sequences. Such sequences may be for example linker or multiple cloning sites. Furthermore, sequences can be inserted coding for parts of fusion pro teins (in case a fusion protein of the protein encoded by the nucleic acid of interest is intended to be expressed). Preferably, the distance between the nucleic acid sequence 30 of interest to be expressed and the transcription regulating nucleotide sequence of the invention is not more than 200 base pairs, preferably not more than 100 base pairs, more preferably no more than 50 base pairs. An operable linkage in relation to any expression cassette or of the invention may be 35 realized by various methods known in the art, comprising both in vitro and in vivo pro cedure. Thus, an expression cassette of the invention or an vector comprising such expression cassette may by realized using standard recombination and cloning tech niques well known in the art (see e.g., Maniatis 1989; Silhavy 1984; Ausubel 1987). 40 An expression cassette may also be assembled by inserting a transcription regulating nucleotide sequence of the invention (for example a sequence as described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73) into the plant genome. Such insertion will re sult in an operable linkage to a nucleic acid sequence of interest which as such already 45 existed in the genome. By the insertion the nucleic acid of interest is expressed in the desired way (e.g., root/kernel-preferentially or root/kernel-specific or constitutive) due to the transcription regulating properties of the transcription regulating sequence. The 46 insertion may be directed or by chance. Preferably the insertion is directed and realized by for example homologous recombination. By this procedure a natural promoter may be exchanged against the transcription regulating nucleotide sequence of the invention, thereby modifying the expression profile of an endogenous gene. The transcription 5 regulating nucleotide sequence may also be inserted in a way, that antisense mRNA of an endogenous gene is expressed, thereby inducing gene silencing. Similar, a nucleic acid sequence of interest to be expressed may by inserted into a plant genome comprising the transcription regulating nucleotide sequence in its natural 10 genomic environment (ie, linked to its natural gene) in a way that the inserted se quence becomes operably linked to the transcription regulating sequence, thereby forming an expression cassette of the invention. The open reading frame to be linked to the transcription regulating nucleotide se 15 quence of the invention may be obtained from an insect resistance gene, a disease resistance gene such as, for example, a bacterial disease resistance gene, a fungal disease resistance gene, a viral disease resistance gene, a nematode disease resis tance gene, a herbicide resistance gene, a gene affecting grain composition or quality, a nutrient utilization gene, a mycotoxin reduction gene, a male sterility gene, a select 20 able marker gene, a screenable marker gene, a negative selectable marker, a positive selectable marker, a gene affecting plant agronomic characteristics, i.e., yield, stand ability, and the like, or an environment or stress resistance gene, i.e., one or more genes that confer herbicide resistance or tolerance, insect resistance or tolerance, dis ease resistance or tolerance (viral, bacterial, fungal, oomycete, or nematode), stress 25 tolerance or resistance (as exemplified by resistance or tolerance to drought, heat, chilling, freezing, excessive moisture, salt stress, or oxidative stress), increased yields, food content and makeup, physical appearance, male sterility, drydown, standability, prolificacy, starch properties or quantity, oil quantity and quality, amino acid or protein composition, and the like. By "resistant" is meant a plant which exhibits substantially no 30 phenotypic changes as a consequence of agent administration, infection with a patho gen, or exposure to stress. By "tolerant" is meant a plant which, although it may exhibit some phenotypic changes as a consequence of infection, does not have a substantially decreased reproductive capacity or substantially altered metabolism. 35 The transcription regulating sequences of the invention with a constitutive expression profile may be advantageously used for expressing a wide variety of genes including those which alter metabolic pathways, confer disease resistance, for protein produc tion, e.g., antibody production, or to improve nutrient uptake and the like. Constitutive promoters may be modified so as to be regulatable, e.g., inducible. The genes and 40 promoters described hereinabove can be used to identify orthologous genes and their promoters which are also likely expressed in a particular tissue and/or development manner. Moreover, the orthologous promoters are useful to express linked open read ing frames. In addition, by aligning the promoters of these orthologs, novel cis elements can be identified that are useful to generate synthetic promoters. 45 The expression regulating nucleotide sequences specified above may be optionally operably linked to other suitable regulatory sequences, e.g., a transcription terminator 47 sequence, operator, repressor binding site, transcription factor binding site and/or an enhancer. The present invention further provides a recombinant vector containing the expression 5 cassette of the invention, and host cells comprising the expression cassette or vector, e.g., comprising a plasmid. The expression cassette or vector may augment the ge nome of a transformed plant or may be maintained extra chromosomally. The expres sion cassette or vector of the invention may be present in the nucleus, chloroplast, mi tochondria and/or plastid of the cells of the plant. Preferably, the expression cassette or 10 vector of the invention is comprised in the chromosomal DNA of the plant nucleus. The present invention also provides a transgenic plant prepared by this method, a seed from such a plant and progeny plants from such a plant including hybrids and inbreds. The expression cassette may be operatively linked to a structural gene, the open read ing frame thereof, or a portion thereof. The expression cassette may further comprise a 15 Ti plasmid and be contained in an Agrmbacterium tumefaciens cell; it may be carried on a microparticle, wherein the microparticle is suitable for ballistic transformation of a plant cell; or it may be contained in a plant cell or protoplast. Further, the expression cassette or vector can be contained in a transformed plant or cells thereof, and the plant may be a dicot or a monocot. In particular, the plant may be a dicotyledonous 20 plant. Preferred transgenic plants are transgenic maize, soybean, barley, alfalfa, sun flower, canola, soybean, cotton, peanut, sorghum, tobacco, sugarbeet, rice, wheat, rye, turfgrass, millet, sugarcane, tomato, or potato. The invention also provides a method of plant breeding, e.g., to prepare a crossed fer 25 tile transgenic plant. The method comprises crossing a fertile transgenic plant compris ing a particular expression cassette of the invention with itself or with a second plant, e.g., one lacking the particular expression cassette, to prepare the seed of a crossed fertile transgenic plant comprising the particular expression cassette. The seed is then planted to obtain a crossed fertile transgenic plant. The plant may be a monocot or a 30 dicot. In a particular embodiment, the plant is a dicotyledonous plant. The crossed fer tile transgenic plant may have the particular expression cassette inherited through a female parent or through a male parent. The second plant may be an inbred plant. The crossed fertile transgenic may be a hybrid. Also included within the present invention are seeds of any of these crossed fertile transgenic plants. 35 The transcription regulating sequences of the invention further comprise sequences which are complementary to one (hereinafter "test' sequence) which hybridizes under stringent conditions with a nucleic acid molecule as described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 40 66, 67, 68, 71, 72, or 73 as well as RNA which is transcribed from the nucleic acid molecule. When the hybridization is performed under stringent conditions, either the test or nucleic acid molecule of invention is preferably supported, e.g., on a membrane or DNA chip. Thus, either a denatured test or nucleic acid molecule of the invention is preferably first bound to a support and hybridization is effected for a specified period of 45 time at a temperature of, e.g., between 55 and 70 0 C, in double strength citrate buffered saline (SC) containing 0.1% SDS followed by rinsing of the support at the same tem perature but with a buffer having a reduced SC concentration. Depending upon the 48 degree of stringency required such reduced concentration buffers are typically single strength SC containing 0.1% SDS, half strength SC containing 0.1% SDS and one tenth strength SC containing 0.1% SDS. More preferably hybridization is carried out under high stringency conditions (as defined above). 5 Virtually any DNA composition may be used for delivery to recipient plant cells, e.g., dicotyledonous cells, to ultimately produce fertile transgenic plants in accordance with the present invention. For example, DNA segments or fragments in the form of vectors and plasmids, or linear DNA segments or fragments, in some instances containing only 10 the DNA element to be expressed in the plant, and the like, may be employed. The construction of vectors which may be employed in conjunction with the present inven tion will be known to those of skill of the art in light of the present disclosure (see, e.g., Sambrook 1989; Gelvin 1990). 15 Vectors, plasmids, cosmids, YACs (yeast artificial chromosomes), BACs (bacterial arti ficial chromosomes) and DNA segments for use in transforming such cells will, of course, generally comprise the cDNA, gene or genes which one desires to introduce into the cells. These DNA constructs can further include structures such as promoters, enhancers, polylinkers, or even regulatory genes as desired. The DNA segment, frag 20 ment or gene chosen for cellular introduction will often encode a protein which will be expressed in the resultant recombinant cells, such as will result in a screenable or se lectable trait and/or which will impart an improved phenotype to the regenerated plant. However, this may not always be the case, and the present invention also encom passes transgenic plants incorporating non-expressed transgenes. 25 In certain embodiments, it is contemplated that one may wish to employ replication competent viral vectors in monocot transformation. Such vectors include, for example, wheat dwarf virus (WDV) "shuttle" vectors, such as pW1-11 and PW1-GUS (Ugaki 1991). These vectors are capable of autonomous replication in maize cells as well as 30 E. coli, and as such may provide increased sensitivity for detecting DNA delivered to transgenic cells. A replicating vector may also be useful for delivery of genes flanked by DNA sequences from transposable elements such as Ac, Ds, or Mu. It has been proposed (Laufs 1990) that transposition of these elements within the maize genome requires DNA replication. It is also contemplated that transposable elements would be 35 useful for introducing DNA segments or fragments lacking elements necessary for se lection and maintenance of the plasmid vector in bacteria, e.g., antibiotic resistance genes and origins of DNA replication. It is also proposed that use of a transposable element such as Ac, Ds, or Mu would actively promote integration of the desired DNA and hence increase the frequency of stably transformed cells. The use of a transpos 40 able element such as Ac, Ds, or Mu may actively promote integration of the DNA of interest and hence increase the frequency of stably transformed cells. Transposable elements may be useful to allow separation of genes of interest from elements neces sary for selection and maintenance of a plasmid vector in bacteria or selection of a transformant. By use of a transposable element, desirable and undesirable DNA se 45 quences may be transposed apart from each other in the genome, such that through genetic segregation in progeny, one may identify plants with either the desirable unde sirable DNA sequences.
49 The nucleotide sequence of interest linked to one or more of the transcription regulat ing sequences of the invention can, for example, code for a ribosomal RNA, an an tisense RNA or any other type of RNA that is not translated into protein. In another pre ferred embodiment of the invention, said nucleotide sequence of interest is translated 5 into a protein product. The transcription regulating nucleotide sequence and/or nucleo tide sequence of interest linked thereto may be of homologous or heterologous origin with respect to the plant to be transformed. A recombinant DNA molecule useful for introduction into plant cells includes that which has been derived or isolated from any source, that may be subsequently characterized as to structure, size and/or function, 10 chemically altered, and later introduced into plants. An example of a nucleotide se quence or segment of interest "derived" from a source, would be a nucleotide se quence or segment that is identified as a useful fragment within a given organism, and which is then chemically synthesized in essentially pure form. An example of such a nucleotide sequence or segment of interest "isolated" from a source, would be nucleo 15 tide sequence or segment that is excised or removed from said source by chemical means, e.g., by the use of restriction endonucleases, so that it can be further manipu lated, e.g., amplified, for use in the invention, by the methodology of genetic engineer ing. Such a nucleotide sequence or segment is commonly referred to as "recombinant." 20 Therefore a useful nucleotide sequence, segment or fragment of interest includes completely synthetic DNA, semi-synthetic DNA, DNA isolated from biological sources, and DNA derived from introduced RNA. Generally, the introduced DNA is not originally resident in the plant genotype which is the recipient of the DNA, but it is within the scope of the invention to isolate a gene from a given plant genotype, and to subse 25 quently introduce multiple copies of the gene into the same genotype, e.g., to enhance production of a given gene product such as a storage protein or a protein that confers tolerance or resistance to water deficit. The introduced recombinant DNA molecule includes but is not limited to, DNA from 30 plant genes, and non-plant genes such as those from bacteria, yeasts, animals or vi ruses. The introduced DNA can include modified genes, portions of genes, or chimeric genes, including genes from the same or different genotype. The term "chimeric gene" or "chimeric DNA" is defined as a gene or DNA sequence or segment comprising at least two DNA sequences or segments from species which do not combine DNA under 35 natural conditions, or which DNA sequences or segments are positioned or linked in a manner which does not normally occur in the native genome of untransformed plant. The introduced recombinant DNA molecule used for transformation herein may be cir cular or linear, double-stranded or single-stranded. Generally, the DNA is in the form of 40 chimeric DNA, such as plasmid DNA, that can also contain coding regions flanked by regulatory sequences which promote the expression of the recombinant DNA present in the resultant plant. Generally, the introduced recombinant DNA molecule will be rela tively small, i.e., less than about 30 kb to minimize any susceptibility to physical, chemical, or enzymatic degradation which is known to increase as the size of the nu 45 cleotide molecule increases. As noted above, the number of proteins, RNA transcripts or mixtures thereof which is introduced into the plant genome is preferably preselected 50 and defined, e.g., from one to about 5-10 such products of the introduced DNA may be formed. Two principal methods for the control of expression are known, viz.: overexpression 5 and underexpression. Overexpression can be achieved by insertion of one or more than one extra copy of the selected gene. It is, however, not unknown for plants or their progeny, originally transformed with one or more than one extra copy of a nucleotide sequence, to exhibit the effects of underexpression as well as overexpression. For un derexpression there are two principle methods which are commonly referred to in the 10 art as "antisense downregulation" and "sense downregulation" (sense downregulation is also referred to as "cosuppression"). Generically these processes are referred to as "gene silencing". Both of these methods lead to an inhibition of expression of the target gene. 15 Obtaining sufficient levels of transgene expression in the appropriate plant tissues is an important aspect in the production of genetically engineered crops. Expression of het erologous DNA sequences in a plant host is dependent upon the presence of an oper ably linked promoter that is functional within the plant host. Choice of the promoter se quence will determine when and where within the organism the heterologous DNA se 20 quence is expressed. It is specifically contemplated by the inventors that one could mutagenize a promoter to potentially improve the utility of the elements for the expression of transgenes in plants. The mutagenesis of these elements can be carried out at random and the mutagenized 25 promoter sequences screened for activity in a trial-by-error procedure. Alternatively, particular sequences which provide the promoter with desirable expression characteris tics, or the promoter with expression enhancement activity, could be identified and these or similar sequences introduced into the sequences via mutation. It is further contemplated that one could mutagenize these sequences in order to enhance their 30 expression of transgenes in a particular species. The means for mutagenizing a DNA segment encoding a promoter sequence of the current invention are well known to those of skill in the art. As indicated, modifications to promoter or other regulatory element may be made by random, or site-specific 35 mutagenesis procedures. The promoter and other regulatory element may be modified by altering their structure through the addition or deletion of one or more nucleotides from the sequence which encodes the corresponding unmodified sequences. Mutagenesis may be performed in accordance with any of the techniques known in the 40 art, such as, and not limited to, synthesizing an oligonucleotide having one or more mutations within the sequence of a particular regulatory region. In particular, site specific mutagenesis is a technique useful in the preparation of promoter mutants, through specific mutagenesis of the underlying DNA. The technique further provides a ready ability to prepare and test sequence variants, for example, incorporating one or 45 more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA. Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences which encode the DNA se- 51 quence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a sta ble duplex on both sides of the deletion junction being traversed. Typically, a primer of about 17 to about 75 nucleotides or more in length is preferred, with about 10 to about 5 25 or more residues on both sides of the junction of the sequence being altered. In general, the technique of site-specific mutagenesis is well known in the art, as ex emplified by various publications. As will be appreciated, the technique typically em ploys a phage vector which exists in both a single stranded and double stranded form. 10 Typical vectors useful in site-directed mutagenesis include vectors such as the M13 phage. These phages are readily commercially available and their use is generally well known to those skilled in the art. Double stranded plasmids also are routinely employed in site directed mutagenesis which eliminates the step of transferring the gene of inter est from a plasmid to a phage. 15 In general, site-directed mutagenesis in accordance herewith is performed by first ob taining a single-stranded vector or melting apart of two strands of a double stranded vector which includes within its sequence a DNA sequence which encodes the pro moter. An oligonucleotide primer bearing the desired mutated sequence is prepared, 20 generally synthetically. This primer is then annealed with the single-stranded vector, and subjected to DNA polymerizing enzymes such as E. coli polymerase I Klenow fragment, in order to complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is formed wherein one strand encodes the original non-mutated se quence and the second strand bears the desired mutation. This heteroduplex vector is 25 then used to transform or transfect appropriate cells, such as E coli cells, and cells are selected which include recombinant vectors bearing the mutated sequence arrange ment. Vector DNA can then be isolated from these cells and used for plant transforma tion. A genetic selection scheme was devised by Kunkel et al. (1987) to enrich for clones incorporating mutagenic oligonucleotides. Alternatively, the use of PCR with 30 commercially available thermostable enzymes such as Taq polymerase may be used to incorporate a mutagenic oligonucleotide primer into an amplified DNA fragment that can then be cloned into an appropriate cloning or expression vector. The PCR mediated mutagenesis procedures of Tomic et al. (1990) and Upender et al. (1995) provide two examples of such protocols. A PCR employing a thermostable ligase in 35 addition to a thermostable polymerase also may be used to incorporate a phosphory lated mutagenic oligonucleotide into an amplified DNA fragment that may then be cloned into an appropriate cloning or expression vector. The mutagenesis procedure described by Michael (1994) provides an example of one such protocol. 40 The preparation of sequence variants of the selected promoter-encoding DNA seg ments using site-directed mutagenesis is provided as a means of producing potentially useful species and is not meant to be limiting, as there are other ways in which se quence variants of DNA sequences may be obtained. For example, recombinant vec tors encoding the desired promoter sequence may be treated with mutagenic agents, 45 such as hydroxylamine, to obtain sequence variants.
52 As used herein; the term "oligonucleotide directed mutagenesis procedure" refers to template-dependent processes and vector-mediated propagation which result in an increase in the concentration of a specific nucleic acid molecule relative to its initial concentration, or in an increase in the concentration of a detectable signal, such as 5 amplification. As used herein, the term "oligonucleotide directed mutagenesis proce dure" also is intended to refer to a process that involves the template-dependent ex tension of a primer molecule. The term template-dependent process refers to nucleic acid synthesis of an RNA or a DNA molecule wherein the sequence of the newly syn thesized strand of nucleic acid is dictated by the well-known rules of complementary 10 base pairing (see, for example, Watson and Rarnstad, 1987). Typically, vector medi ated methodologies involve the introduction of the nucleic acid fragment into a DNA or RNA vector, the clonal amplification of the vector, and the recovery of the amplified nucleic acid fragment. Examples of such methodologies are provided by U.S. Pat. No. 4,237,224. A number of template dependent processes are available to amplify the 15 target sequences of interest present in a sample, such methods being well known in the art and specifically disclosed herein below. Where a done comprising a promoter has been isolated in accordance with the instant invention, one may wish to delimit the essential promoter regions within the clone. One 20 efficient, targeted means for preparing mutagenizing promoters relies upon the identifi cation of putative regulatory elements within the promoter sequence. This can be initi ated by comparison with promoter sequences known to be expressed in similar tissue specific or developmentally unique manner. Sequences which are shared among pro moters with similar expression patterns are likely candidates for the binding of tran 25 scription factors and are thus likely elements which confer expression patterns. Confir mation of these putative regulatory elements can be achieved by deletion analysis of each putative regulatory region followed by functional analysis of each deletion con struct by assay of a reporter gene which is functionally attached to each construct. As such, once a starting promoter sequence is provided, any of a number of different dele 30 tion mutants of the starting promoter could be readily prepared. Functionally equivalent fragments of a transcription regulating nucleotide sequence of the invention can also be obtained by removing or deleting non-essential sequences without deleting the essential one. Narrowing the transcription regulating nucleotide 35 sequence to its essential, transcription mediating elements can be realized in vitro by trial-and-arrow deletion mutations, or in silico using promoter element search routines. Regions essential for promoter activity often demonstrate clusters of certain, known promoter elements. Such analysis can be performed using available computer algo rithms such as PLACE ("Plant Cis-acting Regulatory DNA Elements; Higo 1999), the 40 BIOBASE database "Transfac" (Biologische Datenbanken GmbH, Braunschweig; Win gender 2001) or the database PlantCARE (Lescot 2002). Preferably, functional equivalent fragments of one of the transcription regulating se quences of the invention comprises at least 100 base pairs, preferably, at least 200 45 base pairs, more preferably at least 500 base pairs of a transcription regulating nudeo tide sequence as described by SEQ ID NOs: 1, 2, 3, 6, 7, 8, 11, 12, 13, 14, 15, 16, 19, 53 20, 21, 22, 23, 24, 27, 28, 29, 56, 57, 58, 61, 62, 63, 66, 67, 68, 71, 72, or 73. More preferably this fragment is starting from the 3'-end of the indicated sequences. Especially preferred are equivalent fragments of transcription regulating sequences, 5 which are obtained by deleting the region encoding the 5'-untranslated region of the mRNA, thus only providing the (untranscribed) promoter region. The 5'-untranslated region can be easily determined by methods known in the art (such as 5'-RACE analy sis). Accordingly, some of the transcription regulating sequences of the invention are equivalent fragments of other sequences (see Table 2 below). 10 Table 2: Relationship of transcription regulating sequences of the invention Transcription regulating se- Equivalent sequence Equivalent fragment quence SEQ ID NO: 1 (1034 bp) SEQ ID NO: 66 (997 bp) SEQ ID NO: 2 (992 bp) SEQ ID NO: 3 (301 bp) SEQ ID NO: 67 (900 bp) SEQ ID NO: 68 (301 bp) SEQ ID NO: 6 (797 bp) SEQ ID NO: 7 (766 bp) SEQ ID NO: 8 (301 bp) SEQ ID NO: 11 (1182 bp) SEQ ID NO: 14 (1270 bp) SEQ ID NO: 12 (1111 bp) SEQ ID NO: 71 (1028 bp) SEQ ID NO: 13 (301 bp) SEQ ID NO: 15 (1191 bp) SEQ ID NO: 16 (301 bp) SEQ ID NO: 72 (954 bp) SEQ 1D NO: 73 (301 bp) SEQ ID NO: 19 (1060 bp) SEQ ID NO: 22 (1093 bp) SEQ ID NO: 20 (946 bp) SEQ ID NO: 56 (1000 bp) SEQ ID NO: 21 (301 bp) SEQ ID NO: 61 (1000 bp) SEQ ID NO: 23 (948 bp) SEQ ID NO: 24 (301 bp) SEQ ID NO: 57 (945 bp) SEQ ID NO: 58 (301 bp) SEQ ID NO: 62 (719 bp) SEQ ID NO: 63 (301 bp) SEQ ID NO: 27 (998 bp) SEQ ID NO: 28 (948 bp) SEQ ID NO: 29 (301 bp) As indicated above, deletion mutants, deletion mutants of the promoter of the invention also could be randomly prepared and then assayed. With this strategy, a series of con 15 structs are prepared, each containing a different portion of the clone (a subclone), and these constructs are then screened for activity, A suitable means for screening for ac tivity is to attach a deleted promoter or intron construct, which contains a deleted seg ment to a selectable or screenable marker, and to isolate only those cells expressing the marker gene. In this way, a number of different, deleted promoter constructs are 20 identified which still retain the desired, or even enhanced, activity. The smallest seg ment which is required for activity is thereby identified through comparison of the se lected constructs. This segment may then be used for the construction of vectors for the expression of exogenous genes. 25 An expression cassette of the invention may comprise further regulatory elements. The term in this context is to be understood in the broad meaning comprising all sequences which may influence construction or function of the expression cassette. Regulatory 54 elements may for example modify transcription and/or translation in prokaryotic or eu karyotic organism. In an preferred embodiment the expression cassette of the invention comprised downstream (in 3'-direction) of the nucleic acid sequence to be expressed a transcription termination sequence and - optionally additional regulatory elements 5 each operably liked to the nucleic acid sequence to be expressed (or the transcription regulating sequence). The expression profile of the expression cassettes of the invention may be modulated depending on the combination of the transcription regulating nucleotide sequence with 10 expression enhancing introns and/or transcriptions termination sequences. This in a preferred embodiment the expression cassette of the inventions comprises at least one additional element selected from the group consisting of a) 5'-untranslated regions, and b) intron encoding sequences, and 15 c) transcription termination sequences. The intron encoding sequences are preferably encoding an expression enhancing in tron from a monocotyledonous plant. More preferably the intron sequence is an intron from an ubiquitin, actin or alcohol dehydrogenase gene. Preferably, this intron is in 20 sorted in the expression construct in the 5'-untranslated region of the nucleic acid se quence, which should be expressed (i.e., between the transcription regulating nucleo tide sequence and the protein coding sequence (open reading frame) or the nucleic acid sequence to be expressed). 25 Preferably, the 5'-untranslated region is from the same gene as the transcription regu lating sequences. The transcription terminating sequence preferably also comprises a sequence inducing polyadenylation. The transcription terminating sequence may be heterologous with 30 respect to the transcription regulating nucleotide sequence and/or the nucleic acid se quence to be expressed, but may also be the natural transcription regulating nucleotide sequence of the gene of said transcription regulating nucleotide sequence and/or said nucleic acid sequence to be expressed. In one preferred embodiment of the invention the transcription regulating nucleotide sequence is the natural transcription regulating 35 nucleotide sequence of the gene of the transcription regulating sequence. Preferably the transcription termination sequence is selected from the group of sequences de scribed by SEQ ID NOs: 32, 34, and 35. 40 Additional regulatory elements may comprise additional promoter, minimal promoters, or promoter elements, which may modify the expression regulating properties. For ex ample the expression may be made depending on certain stress factors such water stress, abscisin (Lam 1991) or heat stress (Schoffl 1989). Furthermore additional pro moters or promoter elements may be employed, which may realized expression in 45 other organisms (such as E.coli or Agrobacterium). Such regulatory elements can be find in the promoter sequences or bacteria such as amy and SPO2 or in the promoter 55 sequences of yeast or fungal promoters (such as ADC1, MFa, AC, P-60, CYCI, GAPDH, TEF, rp28, and ADH). Furthermore, it is contemplated that promoters combining elements from more than 5 one promoter may be useful. For example, US 5,491,288 discloses combining a Cauli flower Mosaic Virus promoter with a histone promoter. Thus, the elements from the promoters disclosed herein may be combined with elements from other promoters. Promoters which are useful for plant transgene expression include those that are in ducible, viral, synthetic, constitutive (Odell 1985), temporally regulated, spatially regu 10 lated, tissue-specific, and spatial-temporally regulated. Where expression in specific tissues or organs is desired, tissue-specific promoters may be used. In contrast, where gene expression in response to a stimulus is desired, inducible promoters are the regulatory elements of choice. Where continuous expres 15 sion is desired throughout the cells of a plant, constitutive promoters are utilized. Addi tional regulatory sequences upstream and/or downstream from the core promoter se quence may be included in expression constructs of transformation vectors to bring about varying levels of expression of heterologous nucleotide sequences in a trans genic plant. 20 A variety of 5' and 3' transcriptional regulatory sequences are available for use in the present invention. Transcriptional terminators are responsible for the termination of transcription and correct mRNA polyadenylation. The 3' nontranslated regulatory DNA sequence preferably includes from about 50 to about 1,000, more preferably about 100 25 to about 1,000, nucleotide base pairs and contains plant transcriptional and transla tional termination sequences. Appropriate transcriptional terminators and those which are known to function in plants include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator, the pea rbcS E9 terminator, the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens, and the 3' 30 end of the protease inhibitor I or II genes from potato or tomato, although other 3' ele ments known to those of skill in the art can also be employed. Alternatively, one also could use a gamma coixin, oleosin 3 or other terminator from the genus Coix. Preferred 3' elements include those from the nopaline synthase gene of Agrobacterium 35 tumefaciens (Bevan 1983), the terminator for the T7 transcript from the octopine syn thase gene of Agrobacterium tumefaciens, and the 3' end of the protease inhibitor I or II genes from potato or tomato. As the DNA sequence between the transcription initiation site and the start of the cod 40 ing sequence, i.e., the untranslated leader sequence, can influence gene expression, one may also wish to employ a particular leader sequence. Preferred leader sequences are contemplated to include those which include sequences predicted to direct opti mum expression of the attached gene, i.e., to include a preferred consensus leader sequence which may increase or maintain mRNA stability and prevent inappropriate 45 initiation of translation. The choice of such sequences will be known to those of skill in the art in light of the present disclosure. Sequences that are derived from genes that are highly expressed in plants will be most preferred.
56 Preferred regulatory elements also include the 5'-untranslated region, introns and the 3'-untranslated region of genes. Such sequences that have been found to enhance gene expression in transgenic plants include intron sequences (e.g., from Adhi, bronze, acting, actin 2 (WO 00/760067), or the sucrose synthase intron; see: The 5 Maize Handbook, Chapter 116, Freeling and Walbot, Eds., Springer, New York (1994)) and viral leader sequences (e.g., from TMV, MCMV and AMV; Gallie 1987). For exam ple, a number of non-translated leader sequences derived from viruses are known to enhance expression. Specifically, leader sequences from Tobacco Mosaic Virus (TMV), Maize Chlorotic Mottle Virus (MCMV), and Alfalfa Mosaic Virus (AMV) have 10 been shown to be effective in enhancing expression (e.g., Gallie 1987; Skuzeski 1990). Other leaders known in the art include but are not limited to: Picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein 1989); Potyvirus leaders, for example, TEV leader (Tobacco Etch Virus); MDMV leader (Maize Dwarf Mosaic Virus); Human immunoglobulin heavy-chain binding protein (BiP) leader, 15 (Macejak 1991); Untranslated leader from the coat protein mRNA of alfalfa mosaic vi rus (AMV RNA 4), (Jobling 1987; Tobacco mosaic virus leader (TMV), (Gallie 1989; and Maize Chiorotic Mottle Virus leader (MCMV) (Lommel 1991. See also, Della Cioppa 1987. Regulatory elements such as Adh intron 1 (Callis 1987), sucrose syn thase intron (Vasil 1989) or TMV omega element (Gallie 1989), may further be included 20 where desired. Especially preferred are the 5'-untranslated region, introns and the 3'-untranslated re gion from genes selected from the group of genes consisting of caffeoyl-CoA-O methyltransferase genes, C8,7-sterol isomerase genes, hydroxyproline-rich glycopro 25 tein (HRGP) genes, lactate dehydrogenase genes, chloroplast protein 12 like genes. More preferably, the 5'-untranslated region, introns and the 3T-untranslated region util ized in an expression cassette of the invention is from a plant gene selected from the group of genes consisting of Oryza sativa caffeoyl-CoA-O-methyltransferase genes, Oryza sativa C8,7-sterol isomerase genes, Zea may hydroxyproline-rich glycoprotein 30 (HRGP) genes, Zea mays lactate dehydrogenase genes, Oryza sativa chloroplast pro tein 12 like genes and functional equivalents thereof. Most preferred are the 5'-untranslated regions comprised at the 3'-end of the se quences described by SEQ ID NOs: 1, 6, 11, 14, 19, 22, and 27. Especially preferred 35 are the sequences described by nucleotide 993 to 1034 of SEQ ID NO: 1, nucleotide 767 to 797 of SEQ ID NO: 6, nucleotide 1112 to 1182 of SEQ ID NO 11, nucleotide 1192 to 1270 of SEQ ID NO 14, nucleotide 947 to 1060 of SEQ ID NO: 19, nucleotide 949 to 1093 of SEQ ID NO: 22, and nucleotide 949 to 998 of SEQ ID NO: 27. 40 The intron encoding sequences is preferably encoding an expression enhancing intron from a monocotyledonous plant. Preferably, this intron is inserted in the expression construct in the 5'-untranslated region of the nucleic acid sequence, which should be expressed (i.e., between the transcription regulating nucleotide sequence and the pro tein coding sequence (open reading frame) or the nucleic acid sequence to be ex 45 pressed). Most preferred as intron sequences are: 57 a) the introns of the Zea mays ubiquitin gene, preferably intron I thereof, most prefera bly the intron sequence as described by nucleotide 1,082 to 2,091 of SEQ ID NO: 36, b) the introns of the rice actin gene, preferably intron I thereof, most preferably the in 5 tron sequence as described by nucleotide 121 to 568 of the sequence described by GenBank Acc.-No.: X63830, c) the introns of the Zea mays alcohol dehydrogenase (adh) gene, preferably intron 6 thereof, most preferably the intron sequence as described by nucleotide 3,135 to 3,476 of the sequence described by GenBank Acc.-No.: X04049, 10 The transcription terminating sequence preferably also comprises a sequence inducing polyadenylation. The transcription terminating sequence may be heterologous with respect to the transcription regulating nucleotide sequence and/or the nucleic acid se quence to be expressed, but may also be the natural transcription regulating nucleotide 15 sequence of the gene of said transcription regulating nucleotide sequence and/or said nucleic acid sequence to be expressed. In one preferred embodiment of the invention the transcription regulating nucleotide sequence is the natural transcription regulating nucleotide sequence of the gene of the transcription regulating sequence. Preferred as transcription termination sequences are the transcription termination sequences from a 20 plant gene selected from the group of genes consisting of Oryza sativa caffeoyl-CoA 0-methyltransferase genes, Oryza sativa C8,7-sterol isomerase genes, Zee may hy droxyproline-rich glycoprotein (HRGP) genes, Zee mays lactate dehydrogenase genes, Oryza sativa chloroplast protein 12 like genes and functional equivalents thereof. Most preferred are the transcription termination sequence of the Zea mays lactate dehydro 25 genase gene as described by SEQ ID NO: 32, of the Oryza sativa caffeoyl-CoA-0 methyltransferase gene as described by SEQ ID NO: 34, and of the Zea may hy droxyproline-rich glycoprotein (HRGP) gene as described by SEQ ID NO: 35. By the combination of the transcription regulating sequences with specific 5'-untranslated re gions, introns, and/or transcription termination sequences it is possible to modulate the 30 expression specificity, especially tissue specificity. Promoter 5'-UTR Intron Terminator Tissue Specificity Oryza sativa own Zoe mays Own all (constitutive) Caffeoyl-CoA-O- Ubiquitin methyltransferase Oryza sativa own Ze mays NOS root (kernel, pollen) Caffeoyl-CoA-0- Ubiquitin methyltransferase Oryza sativa own Zee mays NOS root, kernel C-8,7-sterol- Ubiquitin isomerase Zea maize Hy- own Ze mays Own root, silk droxyproline-rich Ubiquitin (kernel: embryo) glycoprotein (HRGP) Zea maize Lactate- awn Zea mays NOS or own root, kernel dehydrogenase Ubiquitin Chloroplast protein own Ze mays NOS Leaf, endosperm 12 lie protein Ubiquitin own: element of the same gene to which the promoter naturally belongs; NOS: nopaline syn thase.
58 Additional preferred regulatory elements are enhancer sequences or polyadenylation sequences. Preferred polyadenylation sequences are those from plant genes or Agm bacterium T-DNA genes (such as for example the terminator sequences of the OCS (octopine synthase) or NOS (nopaline synthase) genes). 5 Examples of enhancers include elements from the CaMV 35S promoter, octopine syn thase genes (Ellis e/ al., 1987), the rice actin I gene, the maize alcohol dehydrogenase gene (Callis 1987), the maize shrunken I gene (Vasil 1989), TMV Omega element (Gal lie 1989) and promoters from non-plant eukaryotes (e.g. yeast; Ma 1988). Vectors for 10 use in accordance with the present invention may be constructed to include the ocs enhancer element. This element was first identified as a 16 bp palindromic enhancer from the octopine synthase (ocs) gene of ultilane (Ellis 1987), and is present in at least 10 other promoters (Bouchez 1989). The use of an enhancer element, such as the ocs elements and particularly multiple copies of the element, will act to increase the level of 15 transcription from adjacent promoters when applied in the context of plant transforma tion. An expression cassette of the invention (or a vector derived therefrom) may comprise additional functional elements, which are to be understood in the broad sense as all 20 elements which influence construction, propagation, or function of an expression cas sette or a vector or a transgenic organism comprising them. Such functional elements may include origin of replications (to allow replication in bacteria; for the ORI of pBR322 or the P15A ori; Sambrook 1989), or elements required for Agrobacteium T DNA transfer (such as for example the left and/or rights border of the T-DNA). 25 Ultimately, the most desirable DNA segments for introduction into, for example, a monocotyledonous genome, may be homologous genes or gene families which encode a desired trait (e.g., increased yield per acre) and which are introduced under the con trol of novel promoters or enhancers, etc., or perhaps even homologous or tissue spe 30 cific (e.g., root-, collar/sheath-, whorl-, stalk-, earshank-, kernel- or leaf-specific) pro moters or control elements. Indeed, it is envisioned that a particular use of the present invention will be the expression of a gene in a constitutive manner or a root/kernel preferential or root/kernel-specific manner. 35 Additionally, vectors may be constructed and employed in the intracellular targeting of a specific gene product within the cells of a transgenic plant or in directing a protein to the extracellular environment. This will generally be achieved by joining a DNA se quence encoding a transit or signal peptide sequence to the coding sequence of a par ticular gene. The resultant transit or signal peptide will transport the protein to a particu 40 lar intracellular or extracellular destination, respectively, and will then be post translationally removed. Transit or signal peptides act by facilitating the transport of proteins through intracellular membranes, e.g., vacuole, vesicle, plastid and mitochon drial membranes, whereas signal peptides direct proteins through the extracellular membrane. 45 A particular example of such a use concerns the direction of a herbicide resistance gene, such as the EPSPS gene, to a particular organelle such as the chloroplast rather 59 than to the cytoplasm. This is exemplified by the use of the rbcs transit peptide which confers plastid-specific targeting of proteins. In addition, it is proposed that it may be desirable to target certain genes responsible for male sterility to the mitochondria, or to target certain genes for resistance to phytopathogenic organisms to the extracellular 5 spaces, or to target proteins to the vacuole. By facilitating the transport of the protein into compartments inside and outside the cell, these sequences may increase the accumulation of gene product protecting them from proteolytic degradation. These sequences also allow for additional mRNA sequences 10 from highly expressed genes to be attached to the coding sequence of the genes. Since mRNA being translated by ribosomes is more stable than naked mRNA, the presence of translatable mRNA in front of the gene may increase the overall stability of the mRNA transcript from the gene and thereby increase synthesis of the gene prod uct. Since transit and signal sequences are usually post-translationally removed from 15 the initial translation product, the use of these sequences allows for the addition of ex tra translated sequences that may not appear on the final polypeptide. Targeting of certain proteins may be desirable in order to enhance the stability of the protein (US 5,545,818). 20 It may be useful to target DNA itself within a cell. For example, it may be useful to tar get introduced DNA to the nucleus as this may increase the frequency of transforma tion. Within the nucleus itself it would be useful to target a gene in order to achieve site specific integration. For example, it would be useful to have a gene introduced through transformation replace an existing gene in the cell. Other elements include those that 25 can be regulated by endogenous or exogenous agents, e.g., by zinc finger proteins, including naturally occurring zinc finger proteins or chimeric zinc finger proteins (see, e.g., US 5,789,538, WO 99/48909; WO 99/45132; WO 98/53060; WO 98/53057; WO 98/53058; WO 00/23464; WO 95/19431; and WO 98/54311) or myb-like transcription factors. For example, a chimeric zinc finger protein may include amino acid sequences 30 which bind to a specific DNA sequence (the zinc finger) and amino acid sequences that activate (e.g., GAL 4 sequences) or repress the transcription of the sequences linked to the specific DNA sequence. It is one of the objects of the present invention to provide recombinant DNA molecules 35 comprising a nucleotide sequence according to the invention operably linked to a nu cleotide segment of interest. A nucleotide segment of interest is reflective of the commercial markets and interests of those involved in the development of the crop. Crops and markets of interest 40 changes, and as developing nations open up world markets, new crops and technolo gies will also emerge. In addition, as the understanding of agronomic traits and charac teristics such as yield and heterosis increase, the choice of genes for transformation will change accordingly. General categories of nucleotides of interest include, for ex ample, genes involved in information, such as zinc fingers, those involved in communi 45 cation, such as kinases, and those involved in housekeeping, such as heat shock pro teins. More specific categories of transgenes, for example, include genes encoding important traits for agronomics, insect resistance, disease resistance, herbicide resis- 60 tance, sterility, grain characteristics, and commercial products. Genes of interest in clude, generally, those involved in starch, oil, carbohydrate, or nutrient metabolism, as well as those affecting kernel size, sucrose loading, zinc finger proteins, see, e.g., US 5,789,538, WO 99/48909; WO 99/45132; WO 98/53060; WO 98153057; WO 98/53058; 5 WO 00/23464; WO 95/19431; and WO 98/54311, and the like. One skilled in the art recognizes that the expression level and regulation of a transgene in a plant can vary significantly from line to line. Thus, one has to test several lines to find one with the desired expression level and regulation. Once a line is identified with 10 the desired regulation specificity of a chimeric Cre transgene, it can be crossed with lines carrying different inactive replicons or inactive transgene for activation. Other sequences which may be linked to the gene of interest, which encodes a poly peptide, are those which can target to a specific organelle, e.g., to the mitochondria, 15 nucleus, or plastid, within the plant cell. Targeting can be achieved by providing the polypeptide with an appropriate targeting peptide sequence, such as a secretory signal peptide (for secretion or cell wall or membrane targeting, a plastid transit peptide, a chloroplast transit peptide, e.g., the chlorophyll a/b binding protein, a mitochondrial target peptide, a vacuole targeting peptide, or a nuclear targeting peptide, and the like. 20 For example, the small subunit of ribulose bisphosphate carboxylase transit peptide, the EPSPS transit peptide or the dihydrodipicolinic acid synthase transit peptide may be used. For examples of plastid organelle targeting sequences (see WO 00/12732). Plastids are a class of plant organelles derived from proplastids and include chloro plasts, leucoplasts, amyloplasts, and chromoplasts. The plastids are major sites of bio 25 synthesis in plants. In addition to photosynthesis in the chloroplast, plastids are also sites of lipid biosynthesis, nitrate reduction to ammonium, and starch storage. And while plastids contain their own circular, genome, most of the proteins localized to the plastids are encoded by the nuclear genome and are imported into the organelle from the cytoplasm. 30 Transgenes used with the present invention will often be genes that direct the expres sion of a particular protein or polypeptide product, but they may also be non expressible DNA segments, e.g., transposons such as Ds that do no direct their own transposition. As used herein, an "expressible gene" is any gene that is capable of be 35 ing transcribed into RNA (e.g., mRNA, antisense RNA, etc.) or translated into a protein, expressed as a trait of interest, or the like, etc., and is not limited to selectable, screenable or non-selectable marker genes. The invention also contemplates that, where both an expressible gene that is not necessarily a marker gene is employed in combination with a marker gene, one may employ the separate genes on either the 40 same or different DNA segments for transformation. In the latter case, the different vec tors are delivered concurrently to recipient cells to maximize cotransformation. The choice of the particular DNA segments to be delivered to the recipient cells will often depend on the purpose of the transformation. One of the major purposes of trans 45 formation of crop plants is to add some commercially desirable, agronomically impor tant traits to the plant. Such traits include, but are not limited to, herbicide resistance or tolerance; insect resistance or tolerance; disease resistance or tolerance (viral, bacte- 61 rial, fungal, nematode); stress tolerance and/or resistance, as exemplified by resistance or tolerance to drought, heat, chilling, freezing, excessive moisture, salt stress; oxida tive stress; increased yields; food content and makeup; physical appearance; male sterility; drydown; standability; prolificacy; starch properties; oil quantity and quality; 5 and the like. One may desire to incorporate one or more genes conferring any such desirable trait or traits, such as, for example, a gene or genes encoding pathogen re sistance. In certain embodiments, the present invention contemplates the transformation of a 10 recipient cell with more than one advantageous transgene. Two or more transgenes can be supplied in a single transformation event using either distinct transgene encoding vectors, or using a single vector incorporating two or more gene coding se quences. For example, plasmids bearing the bar and aroA expression units in either convergent, divergent, or colinear orientation, are considered to be particularly useful. 15 Further preferred combinations are those of an insect resistance gene, such as a Bt gene, along with a protease inhibitor gene such as pinll, or the use of bar in combina tion with either of the above genes. Of course, any two or more transgenes of any de scription, such as those conferring herbicide, insect, disease (viral, bacterial, fungal, nematode) or drought resistance, male sterility, drydown, standability, prolificacy, 20 starch properties, oil quantity and quality, or those increasing yield or nutritional quality may be employed as desired. 1. Exemplary Transgenes The transcription regulating sequences of the invention are especially useful for ex 25 pression (preferably constitutive or root/kernel-preferential or root/kernel-specific ex pression) in monocotyledonous plants (as defined above in the DEFINITION section), especially in cereal plants such as corn, rice, wheat, rye, barley and oats. However, a use in other plants (e.g., dicotyledonous or gymnosperm plants) and other tissues can not be ruled out. 30 The transcription regulating nucleotide sequences and expression cassettes of the in vention may be employed for numerous expression purposes such as for example ex pression of a protein, or expression of an antisense RNA, sense or double-stranded RNA. Preferably, expression of the nucleic acid sequence confers to the plant an 35 agronomically valuable trait. 1.1. Herbicide Resistance The genes encoding phosphinothricin acetyltransferase (bar and pat), glyphosate tol erant EPSP synthase genes, the glyphosate degradative enzyme gene gox encoding 40 glyphosate oxidoreductase, deh (encoding a dehalogenase enzyme that inactivates dalapon), herbicide resistant (e.g., sulfonylurea and imidazolinone) acetolactate syn thase, and bxn genes (encoding a nitrilase enzyme that degrades bromoxynil) are good examples of herbicide resistant genes for use in transformation. The bar and pat genes code for an enzyme, phosphinothricin acetyltransferase (PAT), which inactivates the 45 herbicide phosphinothricin and prevents this compound from inhibiting glutamine syn thetase enzymes. The enzyme 5-enolpyruvyishikimate 3-phosphate synthase (EPSP Synthase), is normally inhibited by the herbicide N-(phosphonomethyl)glycine (gly- 62 phosate). However, genes are known that encode glyphosate-resistant EPSP Syn thase enzymes. The deh gene encodes the enzyme dalapon dehalogenase and con fers resistance to the herbicide dalapon. The bxn gene codes for a specific nitrilase enzyme that converts bromoxynil to a non-herbicidal degradation product. 5 1.2 Insect Resistance An important aspect of the present invention concerns the introduction of insect resis tance-conferring genes into plants. Potential insect resistance genes which can be in troduced include Bacillus thuringiensis crystal toxin genes or Bt genes (Watrud 1985). 10 Bt genes may provide resistance to lepidopteran or coleopteran pests such as Euro pean Corn Borer (ECB) and corn rootworm (CRW). Preferred Bt toxin genes for use in such embodiments include the CrylA(b) and CrylA(c) genes. Endotoxin genes from other species of B. thuringiensis which affect insect growth or development may also be employed in this regard. Protease inhibitors may also provide insect resistance 15 (Johnson 1989), and will thus have utility in plant transformation. The use of a protease inhibitor Il gene, pinl, from tomato or potato is envisioned to be particularly useful. Even more advantageous is the use of a pinil gene in combination with a Bt toxin gene, the combined effect of which has been discovered by the present inventors to produce synergistic insecticidal activity. Other genes which encode inhibitors of the insects' di 20 gestive system, or those that encode enzymes or co-factors that facilitate the produc tion of inhibitors, may also be useful. This group may be exemplified by cystatin and amylase inhibitors, such as those from wheat and barley. Also, genes encoding lectins may confer additional or alternative insecticide properties. 25 Lectins (originally termed phytohemagglutinins) are multivalent carbohydrate-binding proteins which have the ability to agglutinate red blood cells from a range of species. Lectins have been identified recently as insecticidal agents with activity against wee vils, ECB and rootworm (Murdock 1990; Czapla & Lang, 1990). Lectin genes contem plated to be useful include, for example, barley and wheat germ agglutinin (WGA) and 30 rice lectins (Gatehouse 1984), with WGA being preferred. Genes controlling the production of large or small polypeptides active against insects when introduced into the insect pests, such as, e.g., lytic peptides, peptide hormones and toxins and venoms, form another aspect of the invention. For example, it is con 35 templated, that the expression of juvenile hormone esterase, directed towards specific insect pests, may also result in insecticidal activity, or perhaps cause cessation of metamorphosis (Hammock 1990). Transgenic plants expressing genes which encode enzymes that affect the integrity of 40 the insect cuticle form yet another aspect of the invention. Such genes include those encoding, e.g., chitinase, proteases, lipases and also genes for the production of nik komycin, a compound that inhibits chitin synthesis, the introduction of any of which is contemplated to produce insect resistant maize plants. Genes that code for activities that affect insect molting, such those affecting the production of ecdysteroid UDP 45 glucosyl transferase, also fall within the scope of the useful transgenes of the present invention.
63 Genes that code for enzymes that facilitate the production of compounds that reduce the nutritional quality of the host plant to insect pests are also encompassed by the present invention. It may be possible, for instance, to confer insecticidal activity on a plant by altering its sterol composition. Sterols are obtained by insects from their diet 5 and are used for hormone synthesis and membrane stability. Therefore alterations in plant sterol composition by expression of novel genes, e.g., those that directly promote the production of undesirable sterols or those that convert desirable sterols into unde sirable forms, could have a negative effect on insect growth and/or development and hence endow the plant with insecticidal activity, Lipoxygenases are naturally occurring 10 plant enzymes that have been shown to exhibit anti-nutritional effects on insects and to reduce the nutritional quality of their diet. Therefore, further embodiments of the inven tion concern transgenic plants with enhanced lipoxygenase activity which may be resis tant to insect feeding. 15 The present invention also provides methods and compositions by which to achieve qualitative or quantitative changes in plant secondary metabolites. One example con cerns transforming plants to produce DIMBOA which, it is contemplated, will confer resistance to European corn borer, rootworm and several other maize insect pests, Candidate genes that are particularly considered for use in this regard include those 20 genes at the bx locus known to be involved in the synthetic DIMBOA pathway (Dunn 1981). The introduction of genes that can regulate the production of maysin, and genes involved in the production of dhurrin in sorghum, is also contemplated to be of use in facilitating resistance to earworm and rootworm, respectively. 25 Tripsacum dactyloides is a species of grass that is resistant to certain insects, including com root worm. It is anticipated that genes encoding proteins that are toxic to insects or are involved in the biosynthesis of compounds toxic to insects will be isolated from Tripsacum and that these novel genes will be useful in conferring resistance to insects. It is known that the basis of insect resistance in Tripsacum is genetic, because said 30 resistance has been transferred to Zea mays via sexual crosses (Branson & Guss, 1972). Further genes encoding proteins characterized as having potential insecticidal activity may also be used as transgenes in accordance herewith. Such genes include, for ex 35 ample, the cowpea trypsin inhibitor (CpTI; Hilder 1987) which may be used as a root worm deterrent; genes encoding avermectin (Campbell 1989; Ikeda 1987) which may prove particularly useful as a corn rootworm deterrent; ribosome inactivating protein genes; and even genes that regulate plant structures. Transgenic maize including anti insect antibody genes and genes that code for enzymes that can covert a non-toxic 40 insecticide (pro-insecticide) applied to the outside of the plant into an insecticide inside the plant are also contemplated. 1.3 Environment or Stress Resistance Improvement of a plant's ability to tolerate various environmental stresses such as, but 45 not limited to, drought, excess moisture, chilling, freezing, high temperature, salt, and oxidative stress, can also be effected through expression of heterologous, or overex pression of homologous genes. Benefits may be realized in terms of increased resis- 64 tance to freezing temperatures through the introduction of an "antifreeze" protein such as that of the Winter Flounder (Cutler 1989) or synthetic gene derivatives thereof. Im proved chilling tolerance may also be conferred through increased expression of glyc erol-3-phosphate acetyliransferase in chloroplasts (Murata 1992; Wolter 1992). Resis 5 tance to oxidative stress (often exacerbated by conditions such as chilling tempera tures in combination with high light intensities) can be conferred by expression of su peroxide dismutase (Gupta 1993), and may be improved by glutathione reductase (Bowler 1992). Such strategies may allow for tolerance to freezing in newly emerged fields as well as extending later maturity higher yielding varieties to earlier relative ma 10 turity zones. Expression of novel genes that favorably effect plant water content, total water poten tial, osmotic potential, and turgor can enhance the ability of the plant to tolerate drought. As used herein, the terms "drought resistance" and "drought tolerance" are 15 used to refer to a plants increased resistance or tolerance to stress induced by a reduc tion in water availability, as compared to normal circumstances, and the ability of the plant to function and survive in lower-water environments, and perform in a relatively superior manner. In this aspect of the invention it is proposed, for example, that the expression of a gene encoding the biosynthesis of osmotically-active solutes can im 20 part protection against drought. Within this class of genes are DNAs encoding mannitol dehydrogenase (Lee and Saier, 1982) and trehalose-6-phosphate synthase (Kaasen 1992). Through the subsequent action of native phosphatases in the cell or by the in troduction and coexpression of a specific phosphatase, these introduced genes will result in the accumulation of either mannitol or trehalose, respectively, both of which 25 have been well documented as protective compounds able to mitigate the effects of stress. Mannitol accumulation in transgenic tobacco has been verified and preliminary results indicate that plants expressing high levels of this metabolite are able to tolerate an applied osmotic stress (Tarczynski 1992). 30 Similarly, the efficacy of other metabolites in protecting either enzyme function (e.g. alanopine or propionic acid) or membrane integrity (e.g., alanopine) has been docu mented (Loomis 1989), and therefore expression of gene encoding the biosynthesis of these compounds can confer drought resistance in a manner similar to or complimen tary to mannitol, Other examples of naturally occurring metabolites that are osmotically 35 active and/or provide some direct protective effect during drought and/or desiccation include sugars and sugar derivatives such as fructose, erythritol (Coxson 1992), sorbi to], dulcitol (Karsten 1992), glucosylglycerol (Reed 1984; Erdmann 1992), sucrose, stachyose (Koster & Leopold 1988; Blackman 1992), ononitol and pinitol (Vernon & Bohnert 1992), and raffinose (Bernal-Lugo & Leopold 1992). Other osmotically active 40 solutes which are not sugars include, but are not limited to, proline and glycine-betaine (Wyn-Jones and Storey, 1981). Continued canopy growth and increased reproductive fitness during times of stress can be augmented by introduction and expression of genes such as those controlling the osmotically active compounds discussed above and other such compounds, as represented in one exemplary embodiment by the en 45 zyme myoinositol-O-methyltransferase.
65 It is contemplated that the expression of specific proteins may also increase drought tolerance. Three classes of Late Embryogenic Proteins have been assigned based on structural similarities (see Dure 1989). All three classes of these proteins have been demonstrated in maturing (i.e., desiccating) seeds. Within these 3 types of proteins, the 5 Type-Il (dehydrin-type) have generally been implicated in drought and/or desiccation tolerance in vegetative plant parts (e.g.. Mundy and Chua, 1988; Piatkowski 1990; Ya maguchi-Shinozaki 1992). Recently, expression of a Type-Ill LEA (HVA-1) in tobacco was found to influence plant height, maturity and drought tolerance (Fitzpatrick, 1993). Expression of structural genes from all three groups may therefore confer drought tol 10 erance. Other types of proteins induced during water stress include thiol proteases, aldolases and transmembrane transporters (Guerrero 1990), which may confer various protective and/or repair-type functions during drought stress. The expression of a gene that effects lipid biosynthesis and hence membrane composition can also be useful in conferring drought resistance on the plant. 15 Many genes that improve drought resistance have complementary modes of action. Thus, combinations of these genes might have additive and/or synergistic effects in improving drought resistance in maize. Many of these genes also improve freezing tolerance (or resistance); the physical stresses incurred during freezing and drought 20 are similar in nature and may be mitigated in similar fashion. Benefit may be conferred via constitutive expression or root/kernel-preferential or root/kernel -specific expression of these genes, but the preferred means of expressing these novel genes may be through the use of a turgor-induced promoter (such as the promoters for the turgor induced genes described in Guerrero et al. 1990 and Shagan 1993). Spatial and tem 25 poral expression patterns of these genes may enable maize to better withstand stress. Expression of genes that are involved with specific morphological traits that allow for increased water extractions from drying soil would be of benefit. For example, introduc tion and expression of genes that alter root characteristics may enhance water uptake. 30 Expression of genes that enhance reproductive fitness during times of stress would be of significant value. For example, expression of DNAs that improve the synchrony of pollen shed and receptiveness of the female flower parts, i.e., silks, would be of benefit. In addition, expression of genes that minimize kernel abortion during times of stress would increase the amount of grain to be harvested and hence be of value. Regulation 35 of cytokinin levels in monocots, such as maize, by introduction and expression of an isopentenyl transferase gene with appropriate regulatory sequences can improve monocot stress resistance and yield (Gan 1995). Given the overall role of water in determining yield, it is contemplated that enabling 40 plants to utilize water more efficiently, through the introduction and expression of novel genes, will improve overall performance even when soil water availability is not limiting. By introducing genes that improve the ability of plants to maximize water usage across a full range of stresses relating to water availability, yield stability or consistency of yield performance may be realized. 45 Improved protection of the plant to abiotic stress factors such as drought, heat or chill, can also be achieved - for example - by overexpressing antifreeze polypeptides from 66 Myoxocephalus Scorpius (WO 00/00512), Myoxocephalus octodecemspinosus, the Arabidopsis thaliana transcription activator CBF1, glutamate dehydrogenases (WO 97/12983, WO 98/11240), calcium-dependent protein kinase genes (WO 98/26045), calcineurins (WO 99/05902), casein kinase from yeast (WO 021052012), famesyltrans 5 ferases (WO 99/06580; Pei ZM et al. (1998) Science 282:287-290), ferritin (Deak M et al. (1999) Nature Biotechnology 17:192-196), oxalate oxidase (WO 99/04013; Dunwell JM (1998) Biotechn Genet Eng Rev 15:1-32), DREB1A factor ("dehydration response element B 1A"; Kasuga M et al. (1999) Nature Biotech 17:276-286), genes of mannitol or trehalose synthesis such as trehalose-phosprhate synthase or trehalose-phosphate 10 phosphatase (WO 97/42326) or by inhibiting genes such as trehalase (WO 97/50561). 1.4 Disease Resistance It is proposed that increased resistance to diseases may be realized through introduc tion of genes into plants period. It is possible to produce resistance to diseases caused, 15 by viruses, bacteria, fungi, root pathogens, insects and nematodes. It is also contem plated that control of mycotoxin producing organisms may be realized through expres sion of introduced genes. Resistance to viruses may be produced through expression of novel genes. For exam 20 ple, it has been demonstrated that expression of a viral coat protein in a transgenic plant can impart resistance to infection of the plant by that virus and perhaps other closely related viruses (Cuozzo 1988, Hemenway 1988, Abel 1986). It is contemplated that expression of antisense genes targeted at essential viral functions may impart re sistance to said virus. For example, an antisense gene targeted at the gene responsi 25 ble for replication of viral nucleic acid may inhibit said replication and lead to resistance to the virus. It is believed that interference with other viral functions through the use of antisense genes may also increase resistance to viruses. Further it is proposed that it may be possible to achieve resistance to viruses through other approaches, including, but not limited to the use of satellite viruses. 30 It is proposed that increased resistance to diseases caused by bacteria and fungi may be realized through introduction of novel genes. It is contemplated that genes encoding so-called "peptide antibiotics," pathogenesis related (PR) proteins, toxin resistance, and proteins affecting host-pathogen interactions such as morphological characteristics 35 will be useful. Peptide antibiotics are polypeptide sequences which are inhibitory to growth of bacteria and other microorganisms. For example, the classes of peptides referred to as cecropins and magainins inhibit growth of many species of bacteria and fungi. It is proposed that expression of PR proteins in plants may be useful in confer ring resistance to bacterial disease. These genes are induced following pathogen at 40 tack on a host plant and have been divided into at least five classes of proteins (Bol 1990). Included amongst the PR proteins are beta- 1,3-glucanases, chitinases, and osmotin and other proteins that are believed to function in plant resistance to disease organisms. Other genes have been identified that have antifungal properties, e.g., UDA (stinging nettle lectin) and hevein (Broakgert 1989; Barkai-Golan 1978). It is known that 45 certain plant diseases are caused by the production of phytotoxins. Resistance to these diseases could be achieved through expression of a novel gene that encodes an en zyme capable of degrading or otherwise inactivating the phytotoxin. Expression novel 67 genes that alter the interactions between the host plant and pathogen may be useful in reducing the ability the disease organism to invade the tissues of the host plant, e.g., an increase in the waxiness of the leaf cuticle or other morphological characteristics. 5 Plant parasitic nematodes are a cause of disease in many plants. It is proposed that it would be possible to make the plant resistant to these organisms through the expres sion of novel genes. It is anticipated that control of nematode infestations would be accomplished by altering the ability of the nematode to recognize or attach to a host plant and/or enabling the plant to produce nematicidal compounds, including but not 10 limited to proteins. Furthermore, a resistance to fungi, insects, nematodes and diseases, can be achieved by targeted accumulation of certain metabolites or proteins. Such proteins include but are not limited to glucosinolates (defense against herbivores), chitinases or glucanases 15 and other enzymes which destroy the cell wall of parasites, ribosome-inactivating pro teins (RIPs) and other proteins of the plant resistance and stress reaction as are in duced when plants are wounded or attacked by microbes, or chemically, by, for exam ple, salicylic acid, jasmonic acid or ethylene, or lysozymes from nonplant sources such as, for example, T4-lysozyme or lysozyme from a variety of mammals, insecticidal pro 20 teins such as Bacillus thuingiensis endotoxin, a-amylase inhibitor or protease inhibitors (cowpea trypsin inhibitor), lectins such as wheatgerm agglutinin, RNAses or ribozymes. Further examples are nucleic acids which encode the Trichoderma harzianum chit42 endochitinase (GenBank Acc. No.: S78423) or the N-hydroxylating, multi-functional cytochrome P-450 (CYP79) protein from Sorghum bicolor (GenBank Acc. No.: 25 U32624), or functional equivalents of these. The accumulation of glucosinolates as protection from pests (Rask L et a. (2000) Plant Mol Biol 42:93-113; Menard R et at. (1999) Phytochemistry 52:29-35), the expression of Bacillus thuringiensis endotoxins (Vaeck et al (1987) Nature 328:33-37) or the protection against attack by fungi, by expression of chitinases, for example from beans (Broglie et at. (1991) Science 30 254:1194-1197), is advantageous. Resistance to pests such as, for example, the rice pest Nilaparvata lugens in rice plants can be achieved by expressing the snowdrop (Galanthus nivalis) lectin agglutinin (Rao et a. (1998) Plant J 15(4):469-77).The ex pression of synthetic crylA(b) and crylA(c) genes, which encode lepidoptera-specific Bacillus thuringiensis D-endotoxins can bring about a resistance to insect pests in vari 35 ous plants (Goyal RK at al. (2000) Crop Protection 19(5):307-312). Further target genes which are suitable for pathogen defense comprise "polygalacturonase-inhibiting protein" (PGIP), thaumatine, invertase and antimicrobial peptides such as lactoferrin (Lee TJ et al. (2002) J Amer Soc Horticult Sci 127(2):158-164). 40 1.5 Mycotoxin Reduction/Elimination Production of mycotoxins, including aflatoxin and fumonisin, by fungi associated with plants is a significant factor in rendering the grain not useful. These fungal organisms do not cause disease symptoms and/or interfere with the growth of the plant, but they produce chemicals (mycotoxins) that are toxic to animals. Inhibition of the growth of 45 these fungi would reduce the synthesis of these toxic substances and, therefore, re duce grain losses due to mycotoxin contamination. Novel genes may be introduced into plants that would inhibit synthesis of the mycotoxin without interfering with fungal 68 growth. Expression of a novel gene which encodes an enzyme capable of rendering the mycotoxin nontoxic would be useful in order to achieve reduced mycotoxin con tamination of grain. The result of any of the above mechanisms would be a reduced presence of mycotoxins on grain. 5 1.6 Grain Composition or Quality Genes may be introduced into plants, particularly commercially important cereals such as maize, wheat or rice, to improve the grain for which the cereal is primarily grown. A wide range of novel transgenic plants produced in this manner may be envisioned de 10 pending on the particular end use of the grain, For example, the largest use of maize grain is for feed or food. Introduction of genes that alter the composition of the grain may greatly enhance the feed or food value. The primary components of maize grain are starch, protein, and oil. Each of these primary 15 components of maize grain may be improved by altering its level or composition. Sev eral examples may be mentioned for illustrative purposes but in no way provide an ex haustive list of possibilities. The protein of many cereal grains is suboptimal for feed and food purposes especially 20 when fed to pigs, poultry, and humans. The protein is deficient in several amino acids that are essential in the diet of these species, requiring the addition of supplements to the grain. Limiting essential amino acids may include lysine, methionine, tryptophan, threonine, valine, arginine, and histidine. Some amino acids become limiting only after the grain is supplemented with other inputs for feed formulations. For example, when 25 the grain is supplemented with soybean meal to meet lysine requirements, methionine becomes limiting. The levels of these essential amino acids in seeds and grain may be elevated by mechanisms which include, but are not limited to, the introduction of genes to increase the biosynthesis of the amino acids, decrease the degradation of the amino acids, increase the storage of the amino acids in proteins, or increase transport of the 30 amino acids to the seeds or grain. One mechanism for increasing the biosynthesis of the amino acids is to introduce genes that deregulate the amino acid biosynthetic pathways such that the plant can no longer adequately control the levels that are produced. This may be done by deregulat 35 ing or bypassing steps in the amino acid biosynthetic pathway which are normally regu lated by levels of the amino acid end product of the pathway. Examples include the introduction of genes that encode deregulated versions of the enzymes aspartokinase or dahydrodipicolinic acid (DHDP)-synthase for increasing lysine and threonine produc tion, and anthranilate synthase for increasing tryptophan production. Reduction of the 40 catabolism of the amino acids may be accomplished by introduction of DNA sequences that reduce or eliminate the expression of genes encoding enzymes that catalyse steps in the catabolic pathways such as the enzyme lysine-ketoglutarate reductase. The protein composition of the grain may be altered to improve the balance of amino 45 acids in a variety of ways including elevating expression of native proteins, decreasing expression of those with poor composition, changing the composition of native pro teins, or introducing genes encoding entirely new proteins possessing superior compo- 69 sition. DNA may be introduced that decreases the expression of members of the zein family of storage proteins. This DNA may encode ribozymes or antisense sequences directed to impairing expression of zein proteins or expression of regulators of zein expression such as the opaque-2 gene product. The protein composition of the grain 5 may be modified through the phenomenon of cosuppression, i.e., inhibition of expres sion of an endogenous gene through the expression of an identical structural gene or gene fragment introduced through transformation (Goring 1991). Additionally, the intro duced DNA may encode enzymes which degrade zeins, The decreases in zein expres sion that are achieved may be accompanied by increases in proteins with more desir 10 able amino acid composition or increases in other major seed constituents such as starch. Alternatively, a chimeric gene may be introduced that comprises a coding se quence for a native protein of adequate amino acid composition such as for one of the globulin proteins or 10 kD zein of maize and a promoter or other regulatory sequence designed to elevate expression of said protein. The coding sequence of said gene may 15 include additional or replacement codons for essential amino acids. Further, a coding sequence obtained from another species, or, a partially or completely synthetic se quence encoding a completely unique peptide sequence designed to enhance the amino acid composition of the seed may be employed. 20 The introduction of genes that alter the oi content of the grain may be of value, In creases in oil content may result in increases in metabolizable energy content and density of the seeds for uses in feed and food. The introduced genes may encode en zymes that remove or reduce rate-limitations or regulated steps in fatty acid or lipid biosynthesis. Such genes may include, but are not limited to, those that encode acetyl 25 CoA carboxylase, ACP-acyltransferase, beta-ketoacyl-ACP synthase, plus other well known fatty acid biosynthetic activities. Other possibilities are genes that encode pro teins that do not possess enzymatic activity such as acyl carrier protein. Additional ex amples include 2-acetyltransferase, oleosin pyruvate dehydrogenase complex, acetyl CoA synthetase, ATP citrate lyase, ADP-glucose pyrophosphorylase and genes of the 30 carnitine-CoA-acetyl-CoA shuttles. It is anticipated that expression of genes related to oil biosynthesis will be targeted to the plastid, using a plastid transit peptide sequence and preferably expressed in the seed embryo. Genes may be introduced that alter the balance of fatty acids present in the oil providing a more healthful or nutritive feedstuff. The introduced DNA may also encode sequences that block expression of enzymes 35 involved in fatty acid biosynthesis, altering the proportions of fatty acids present in the grain such as described below. Genes may be introduced that enhance the nutritive value of the starch component of the grain, for example by increasing the degree of branching, resulting in improved 40 utilization of the starch in cows by delaying its metabolism. Besides affecting the major constituents of the grain, genes may be introduced that affect a variety of other nutritive, processing, or other quality aspects of the grain as used for feed or food. For example, pigmentation of the grain may be increased or de 45 creased. Enhancement and stability of yellow pigmentation is desirable in some animal feeds and may be achieved by introduction of genes that result in enhanced production of xanthophylls and carotenes by eliminating rate-limiting steps in their production, 70 Such genes may encode altered forms of the enzymes phytoene synthase, phytoene desaturase, or lycopene synthase. Alternatively, unpigmented white corn is desirable for production of many food products and may be produced by the introduction of DNA which blocks or eliminates steps in pigment production pathways. 5 Feed or food comprising some cereal grains possesses insufficient quantities of vita mins and must be supplemented to provide adequate nutritive value. Introduction of genes that enhance vitamin biosynthesis in seeds may be envisioned including, for example, vitamins A, E, B.sub.12, choline, and the like. For example, maize grain also 10 does not possess sufficient mineral content for optimal nutritive value. Genes that af fect the accumulation or availability of compounds containing phosphorus, sulfur, cal cium, manganese, zinc, and iron among others would be valuable. An example may be the introduction of a gene that reduced phytic acid production or encoded the enzyme phytase which enhances phytic acid breakdown. These genes would increase levels of 15 available phosphate in the diet, reducing the need for supplementation with mineral phosphate. Numerous other examples of improvement of cereals for feed and food purposes might be described. The improvements may not even necessarily involve the grain, but may, 20 for example, improve the value of the grain for silage. Introduction of DNA to accom plish this might include sequences that alter lignin production such as those that result in the "brown midrib" phenotype associated with superior feed value for cattle. In addition to direct improvements in feed or food value, genes may also be introduced 25 which improve the processing of grain and improve the value of the products resulting from the processing. The primary method of processing certain grains such as maize is via wetmilling. Maize may be improved though the expression of novel genes that in crease the efficiency and reduce the cost of processing such as by decreasing steep ing time. 30 Improving the value of wetmilling products may include altering the quantity or quality of starch, oil, corn gluten meal, or the components of corn gluten feed. Elevation of starch may be achieved through the identification and elimination of rate limiting steps in starch biosynthesis or by decreasing levels of the other components of the grain re 35 suiting in proportional increases in starch. An example of the former may be the intro duction of genes encoding ADP-glucose pyrophosphorylase enzymes with altered regulatory activity or which are expressed at higher level. Examples of the latter may include selective inhibitors of, for example, protein or oil biosynthesis expressed during later stages of kernel development. 40 The properties of starch may be beneficially altered by changing the ratio of amylose to amylopectin, the size of the starch molecules, or their branching pattern. Through these changes a broad range of properties may be modified which include, but are not limited to, changes in gelatinization temperature, heat of gelatinization, clarity of films and 45 pastes, Theological properties, and the like. To accomplish these changes in proper ties, genes that encode granule-bound or soluble starch synthase activity or branching enzyme activity may be introduced alone or combination. DNA such as antisense con- 71 struts may also be used to decrease levels of endogenous activity of these enzymes. The introduced genes or constructs may possess regulatory sequences that time their expression to specific intervals in starch biosynthesis and starch granule development. Furthermore, it may be advisable to introduce and express genes that result in the in 5 vivo derivatization, or other modification, of the glucose moieties of the starch mole cule. The covalent attachment of any molecule may be envisioned, limited only by the existence of enzymes that catalyze the derivatizations and the accessibility of appro priate substrates in the starch granule. Examples of important derivations may include the addition of functional groups such as amines, carboxyls, or phosphate groups 10 which provide sites for subsequent in vitro derivatizations or affect starch properties through the introduction of ionic charges. Examples of other modifications may include direct changes of the glucose units such as loss of hydroxyl groups or their oxidation to aldehyde or carboxyl groups. 15 Oil is another product of wetmilling of corn and other grains, the value of which may be improved by introduction and expression of genes. The quantity of oil that can be ex tracted by wetmilling may be elevated by approaches as described for feed and food above. Oil properties may also be altered to improve its performance in the production and use of cooking oil, shortenings, lubricants or other oil-derived products or im 20 provement of its health attributes when used in the food-related applications. Novel fatty acids may also be synthesized which upon extraction can serve as starting mate rials for chemical syntheses. The changes in oil properties may be achieved by altering the type, level, or lipid arrangement of the fatty acids present in the oil. This in turn may be accomplished by the addition of genes that encode enzymes that catalyze the syn 25 thesis of novel fatty acids and the lipids possessing them or by increasing levels of na tive fatty acids while possibly reducing levels of precursors. Alternatively DNA se quences may be introduced which slow or block steps in fatty acid biosynthesis result ing in the increase in precursor fatty acid intermediates. Genes that might be added include desaturases, epoxidases, hydratases, dehydratases, and other enzymes that 30 catalyze reactions involving fatty acid intermediates, Representative examples of cata lytic steps that might be blocked include the desaturations from stearic to oleic acid and oleic to linolenic acid resulting in the respective accumulations of stearic and oleic ac ids. 35 Improvements in the other major cereal wetmilling products, gluten meal and gluten feed, may also be achieved by the introduction of genes to obtain novel plants. Repre sentative possibilities include but are not limited to those described above for improve ment of food and feed value. 40 In addition it may further be considered that the plant be used for the production or manufacturing of useful biological compounds that were either not produced at all, or not produced at the same level, in the plant previously. The novel plants producing these compounds are made possible by the introduction and expression of genes by transformation methods. The possibilities include, but are not limited to, any biological 45 compound which is presently produced by any organism such as proteins, nucleic ac ids, primary and intermediary metabolites, carbohydrate polymers, etc. The compounds may be produced by the plant, extracted upon harvest and/or processing, and used for 72 any presently recognized useful purpose such as pharmaceuticals, fragrances, indus trial enzymes to name a few. Further possibilities to exemplify the range of grain traits or properties potentially en 5 coded by introduced genes in transgenic plants include grain with less breakage sus ceptibility for export purposes or larger grit size when processed by dry milling through introduction of genes that enhance gamma-zein synthesis, popcorn with improved popping, quality and expansion volume through genes that increase pericarp thickness, corn with whiter grain for food uses though introduction of genes that effectively block 10 expression of enzymes involved in pigment production pathways, and improved quality of alcoholic beverages or sweet corn through introduction of genes which affect flavor such as the shrunken gene (encoding sucrose synthase) for sweet corn. 15 1.7 Tuber or Seed Composition or Quality Various traits can be advantageously expressed especially in seeds or tubers to im prove composition or quality. Such traits include but are not limited to: - Expression of metabolic enzymes for use in the food-and-feed sector, for ex ample of phytases and cellulases. Especially preferred are nucleic acids such as the 20 artificial cONA which encodes a microbial phytase (GenBank Acc. No.: A19451) or functional equivalents thereof. - Expression of genes which bring about an accumulation of fine chemicals such as of tocopherols, tocotrienols or carotenoids. An example which may be mentioned is phytoene desaturase. Preferred are nucleic acids which encode the Narcissus 25 pseudonarcissus photoene desaturase (GenBank Acc. No.: X78815) or functional equivalents thereof. - Production of nutraceuticals such as, for example, polyunsaturated fatty acids (for example arachidonic acid, eicosapentaenoic acid or docosahexaenoic acid) by expression of fatty acid elongases and/or desaturases, or production of proteins with 30 improved nutritional value such as, for example, with a high content of essential ami no acids (for example the high-methionine 2S albumin gene of the brazil nut). Pre ferred are nucleic acids which encode the Bertholletia excelsa high-methionine 2S albumin (GenBank Acc. No.: AB044391), the Physcomitrella patens A6-acyl-lipid de saturase (GenBank Acc. No.: AJ222980; Girke et al. (1998) Plant J 15:39-48), the 35 Mortierella alpine A6-desaturase (Sakuradani et a/. 1999 Gene 238:445-453), the Caenorhabditis elegans A5-desaturase (Michaelson et a/. 1998, FEBS Letters 439:215-218), the Caenorhabditis elegans AS-fatty acid desaturase (des-5) (Gen Bank Acc. No.: AF078796), the Mortierella alpina AS-desaturase (Michaelson et al. JBC 273:19055-19059), the Caenorhabditis elegans A6-elongase (Beaudoin et al. 40 2000, PNAS 97:6421-6426), the Physcomitrella patens A6-elongase (Zank et al. 2000, Biochemical Society Transactions 28:654-657), or functional equivalents of these. - Production of high-quality proteins and enzymes for industrial purposes (for example enzymes, such as lipases) or as pharmaceuticals (such as, for example, an 45 tibodies, blood clotting factors, interferons, lymphokins, colony stimulation factor, plasminogen activators, hormones or vaccines, as described by Hood EE, Jilka JM 73 (1999) Curr Opin Biotechnol 10(4):382-6; Ma JK, Vine ND (1999) Curr Top Microbiol Immunol 236:275-92). For example, it has been possible to produce recombinant avidin from chicken albumen and bacterial [-glucuronidase (GUS) on a large scale in transgenic maize plants (Hood et al (1999) Adv Exp Med Biol 464:127-47. Review). 5 - Obtaining an increased storability in cells which normally comprise fewer storage proteins or storage lipids, with the purpose of increasing the yield of these sub stances, for example by expression of acetyl-CoA carboxylase. Preferred nucleic ac ids are those which encode the Medicago sativa acetyl-CoA carboxylase (ACCase) (GenBank Acc. No.: L25042), or functional equivalents thereof. 10 - Reducing levels of a-glucan L-type tuber phosphorylase (GLTP) or ac-glucan H-type tuber phosphorylase (GHTP) enzyme activity preferably within the potato tuber (see US 5,998,701). The conversion of starches to sugars in potato tubers, particularly when stored at temperatures below 7"C., is reduced in tubers exhibiting reduced GLTP or GHTP enzyme activity. Reducing cold-sweetening in potatoes allows for po 15 tato storage at cooler temperatures, resulting in prolonged dormancy, reduced inci dence of disease, and increased storage life. Reduction of GLTP or GHTP activity within the potato tuber may be accomplished by such techniques as suppression of gene expression using homologous antisense or double-stranded RNA, the use of co-suppression, regulatory silencing sequences. A potato plant having improved 20 cold-storage characteristics, comprising a potato plant transformed with an expres sion cassette having a TPT promoter sequence operably linked to a DNA sequence comprising at least 20 nucleotides of a gene encoding an a-glucan phosphorylase selected from the group consisting of a-glucan L-type tuber phosphorylase (GLTP) and a-glucan H-type phosphorylase (GHTP). 25 Further examples of advantageous genes are mentioned for example in Dunwell JM, Transgenic approaches to crop improvement, J Exp Bot. 2000; 51 Spec No; pages 487-96. 1.7 Plant Agronomic Characteristics 30 Two of the factors determining where plants can be grown are the average daily tem perature during the growing season and the length of time between frosts. Within the areas where it is possible to grow a particular plant, there are varying limitations on the maximal time it is allowed to grow to maturity and be harvested. The plant to be grown in a particular area is selected for its ability to mature and dry down to harvestable 35 moisture content within the required period of time with maximum possible yield. There fore, plants of varying maturities are developed for different growing locations. Apart from the need to dry down sufficiently to permit harvest is the desirability of having maximal drying take place in the field to minimize the amount of energy required for additional drying post-harvest. Also the more readily the grain can dry down, the more 40 time there is available for growth and kernel fill. Genes that influence maturity and/or dry down can be identified and introduced into plant lines using transformation tech niques to create new varieties adapted to different growing locations or the same grow ing location but having improved yield to moisture ratio at harvest. Expression of genes that are involved in regulation of plant development may be especially useful, e.g., the 45 liguleless and rough sheath genes that have been identified in plants.
74 Genes may be introduced into plants that would improve standability and other plant growth characteristics. For example, expression of novel genes which confer stronger stalks, improved root systems, or prevent or reduce ear droppage would be of great value to the corn farmer. Introduction and expression of genes that increase the total 5 amount of photoassimilate available by, for example, increasing light distribution and/or interception would be advantageous, In addition the expression of genes that increase the efficiency of photosynthesis and/or the leaf canopy would further increase gains in productivity. Such approaches would allow for increased plant populations in the field. 10 Delay of late season vegetative senescence would increase the flow of assimilate into the grain and thus increase yield. Overexpression of genes within plants that are asso ciated with "stay green" or the expression of any gene that delays senescence would be advantageous. For example, a non-yellowing mutant has been identified in Festuca pratensis (Davies 1990). Expression of this gene as well as others may prevent prema 15 ture breakdown of chlorophyll and thus maintain canopy function. 1.8 Nutrient Utilization The ability to utilize available nutrients and minerals may be a limiting factor in growth of many plants. It is proposed that it would be possible to alter nutrient uptake, tolerate 20 pH extremes, mobilization through the plant, storage pools, and availability for meta bolic activities by the introduction of novel genes. These modifications would allow a plant to more efficiently utilize available nutrients. It is contemplated that an increase in the activity of, for example, an enzyme that is normally present in the plant and in volved in nutrient utilization would increase the availability of a nutrient. An example of 25 such an enzyme would be phytase. It is also contemplated that expression of a novel gene may make a nutrient source available that was previously not accessible, e.g., an enzyme that releases a component of nutrient value from a more complex molecule, perhaps a macromolecule. 30 1.9 Male Sterility Male sterility is useful in the production of hybrid seed. It is proposed that male sterility may be produced through expression of novel genes. For example, it has been shown that expression of genes that encode proteins that interfere with development of the male inflorescence and/or gametophyte result in male sterility. Chimeric ribonuclease 35 genes that express in the anthers of transgenic tobacco and oilseed rape have been demonstrated to lead to male sterility (Mariani 1990). For example, a number of muta tions were discovered in maize that confer cytoplasmic male sterility. One mutation in particular, referred to as T cytoplasm, also correlates with sensitivity to Southern corn leaf blight. A DNA sequence, designated TURF-13 (Levings 1990), was identified that 40 correlates with T cytoplasm. It would be possible through the introduction of TURF-13 via transformation to separate male sterility from disease sensitivity. As it is necessary to be able to restore male fertility for breeding purposes and for grain production, it is proposed that genes encoding restoration of male fertility may also be introduced. 45 75 1.10. Non-Protein-Expressing Sequences 1.10.1 RNA-Expressing DNA may be introduced into plants for the purpose of expressing RNA transcripts that function to affect plant phenotype yet are not translated into protein. Two examples are 5 antisense RNA and RNA with ribozyme activity. Both may serve possible functions in reducing or eliminating expression of native or introduced plant genes. Genes may be constructed or isolated, which when transcribed, produce antisense RNA or double-stranded RNA that is complementary to all or part(s) of a targeted mes 10 senger RNA(s). The antisense RNA reduces production of the polypeptide product of the messenger RNA. The polypeptide product may be any protein encoded by the plant genome. The aforementioned genes will be referred to as antisense genes. An an tisense gene may thus be introduced into a plant by transformation methods to produce a novel transgenic plant with reduced expression of a selected protein of interest. For 15 example, the protein may be an enzyme that catalyzes a reaction in the plant. Reduc tion of the enzyme activity may reduce or eliminate products of the reaction which in clude any enzymatically synthesized compound in the plant such as fatty acids, amino acids, carbohydrates, nucleic acids and the like. Alternatively, the protein may be a storage protein, such as a zein, or a structural protein, the decreased expression of 20 which may lead to changes in seed amino acid composition or plant morphological changes respectively. The possibilities cited above are provided only by way of exam ple and do not represent the full range of applications. Expression of antisense-RNA or double-stranded RNA by one of the expression cas 25 settes of the invention is especially preferred. Also expression of sense RNA can be employed for gene silencing (co-suppression). This RNA is preferably a non translatable RNA. Gene regulation by double-stranded RNA ("double-stranded RNA interference"; dsRNAi) is well known in the arte and described for various organism including plants (e.g., Matzke 2000; Fire A et al 1998; WO 99/32619; WO 99/53050; 30 WO 00/68374; WO 00/44914; WO 00/44895; WO 00/49035; WO 00/63364). Genes may also be constructed or isolated, which when transcribed produce RNA en zymes, or ribozymes, which can act as endoribonucleases and catalyze the cleavage of RNA molecules with selected sequences. The cleavage of selected messenger 35 RNA's can result in the reduced production of their encoded polypeptide products. These genes may be used to prepare novel transgenic plants which possess them. The transgenic plants may possess reduced levels of polypeptides including but not limited to the polypeptides cited above that may be affected by antisense RNA. 40 It is also possible that genes may be introduced to produce novel transgenic plants which have reduced expression of a native gene product by a mechanism of cosup pression. It has been demonstrated in tobacco, tomato, and petunia (Goring 1991; Smith 1990; Napoli 1990; van der Krol 1990) that expression of the sense transcript of a native gene will reduce or eliminate expression of the native gene in a manner similar 45 to that observed for antisense genes. The introduced gene may encode all or part of the targeted native protein but its translation may not be required for reduction of levels of that native protein.
76 1.10.2 Non-RNA-Expressing For example, DNA elements including those of transposable elements such as Ds, Ac, or Mu, may be, inserted into a gene and cause mutations. These DNA elements may be inserted in order to inactivate (or activate) a gene and thereby "tag" a particular trait. 5 In this instance the transposable element does not cause instability of the tagged muta tion, because the utility of the element does not depend on its ability to move in the genome. Once a desired trait is tagged, the introduced DNA sequence may be used to clone the corresponding gene, e.g., using the introduced DNA sequence as a PCR primer together with PCR gene cloning techniques (Shapiro, 1983; Dellaporta 1988). 10 Once identified, the entire gene(s) for the particular trait, including control or regulatory regions where desired may be isolated, cloned and manipulated as desired. The utility of DNA elements introduced into an organism for purposed of gene tagging is inde pendent of the DNA sequence and does not depend on any biological activity of the DNA sequence, i.e., transcription into RNA or translation into protein. The sole function 15 of the DNA element is to disrupt the DNA sequence of a gene. It is contemplated that unexpressed DNA sequences, including novel synthetic se quences could be introduced into cells as proprietary "labels" of those cells and plants and seeds thereof. It would not be necessary for a label DNA element to disrupt the 20 function of a gene endogenous to the host organism, as the sole function of this DNA would be to identify the origin of the organism. For example, one could introduce a unique DNA sequence into a plant and this DNA element would identify all cells, plants, and progeny of these cells as having arisen from that labeled source. It is proposed that inclusion of label DNAs would enable one to distinguish proprietary germplasm or 25 germplasm derived from such, from unlabelled germplasm. Another possible element which may be introduced is a matrix attachment region ele ment (MAR), such as the chicken lysozyme A element (Stief 1989), which can be posi tioned around an expressible gene of interest to effect an increase in overall expres 30 sion of the gene and diminish position dependant effects upon incorporation into the plant genome (Stief 1989; Phi-Van 1990). Further nucleotide sequences of interest that may be contemplated for use within the scope of the present invention in operable linkage with the promoter sequences ac 35 cording to the invention are isolated nucleic acid molecules, e.g., DNA or RNA, com prising a plant nucleotide sequence according to the invention comprising an open reading frame that is preferentially expressed in a specific tissue, i.e., seed-, root, green tissue (leaf and stem), panicle-, or pollen, or is expressed constitutively. 40 2. Marker Genes In order to improve the ability to identify transformants, one may desire to employ a selectable or screenable marker gene as, or in addition to, the expressible gene of in terest. "Marker genes" are genes that impart a distinct phenotype to cells expressing the marker gene and thus allow such transformed cells to be distinguished from cells 45 that do not have the marker. Such genes may encode either a selectable or screenable marker, depending on whether the marker confers a trait which one can 'select' for by chemical means, i.e., through the use of a selective agent (e.g., a herbicide, antibiotic, 77 or the like), or whether it is simply a trait that one can identify through observation or testing, i.e., by 'screening' (e.g., the R-locus trait, the green fluorescent protein (GFP)). Of course, many examples of suitable marker genes are known to the art and can be employed in the practice of the invention. 5 Included within the terms selectable or screenable marker genes are also genes which encode a "secretable marker" whose secretion can be detected as a means of identify ing or selecting for transformed cells, Examples include markers which encode a secre table antigen that can be identified by antibody interaction, or even secretable enzymes 10 which can be detected by their catalytic activity. Secretable proteins fall into a number of classes, including small, diffusible proteins detectable, e.g., by ELISA; small active enzymes detectable in extracellular solution (e.g., alpha-amylase, beta-lactamase, phosphinothricin acetyltransferase); and proteins that are inserted or trapped in the cell wall (e.g., proteins that include a leader sequence such as that found in the expression 15 unit of extensin or tobacco PR-S). With regard to selectable secretable markers, the use of a gene that encodes a protein that becomes sequestered in the cell wall, and which protein includes a unique epitope is considered to be particularly advantageous. Such a secreted antigen marker would 20 ideally employ an epitope sequence that would provide low background in plant tissue, a promoter-leader sequence that would impart efficient expression and targeting across the plasma membrane, and would produce protein that is bound in the cell wall and yet accessible to antibodies. A normally secreted wall protein modified to include a unique epitope would satisfy all such requirements. 25 One example of a protein suitable for modification in this manner is extensin, or hy droxyproline-rich glycoprotein (HPRG), For example, the maize HPRG (Steifel 1990) molecule is well characterized in terms of molecular biology, expression and protein structure. However, any one of a variety of ultilane and/or glycine-rich wall proteins 30 (Keller 1989) could be modified by the addition of an antigenic site to create a screenable marker. One exemplary embodiment of a secretable screenable marker concerns the use of a maize sequence encoding the wall protein HPRG, modified to include a 15 residue 35 epitope from the pro-region of murine interleukin, however, virtually any detectable epi tope may be employed in such embodiments, as selected from the extremely wide va riety of antigen-antibody combinations known to those of skill in the art. The unique extracellular epitope can then be straightforwardly detected using antibody labeling in conjunction with chromogenic or fluorescent adjuncts. 40 Elements of the present disclosure may be exemplified in detail through the use of the bar and/or GUS genes, and also through the use of various other markers. Of course, in light of this disclosure, numerous other possible selectable and/or screenable marker genes will be apparent to those of skill in the art in addition to the one set forth herein 45 below. Therefore, it will be understood that the following discussion is exemplary rather than exhaustive, In light of the techniques disclosed herein and the general recombi nant techniques which are known in the art, the present invention renders possible the 78 introduction of any gene, including marker genes, into a recipient cell to generate a transformed plant. 2.1 Selectable Markers 5 Various selectable markers are known in the art suitable for plant transformation. Such markers may include but are not limited to: 2.1.1 Negative selection markers Negative selection markers confer a resistance to a biocidal compound such as a 10 metabolic inhibitor (e.g., 2-deoxyglucose-6-phosphate, WO 98/45456), antibiotics (e.g., kanamycin, G 418, bleomycin or hygromycin) or herbicides (e.g., phosphinothricin or glyphosate). Transformed plant material (e.g., cells, tissues or plantlets), which express marker genes, are capable of developing in the presence of concentrations of a corre sponding selection compound (e.g., antibiotic or herbicide) which suppresses growth of 15 an untransformed wild type tissue. Especially preferred negative selection markers are those which confer resistance to herbicides. Examples which may be mentioned are: - Phosphinothricin acetyltransferases (PAT; also named Bialophos *resistance; bar; de Block 1987; Vasil 1992, 1993; Weeks 1993; Becker 1994; Nehra 1994; Wan & Lemaux 1994; EP 0 333 033; US 4,975,374). Preferred are the bar gene from 20 Streptomyces hygroscopicus or the pat gene from Streptomyces viridochro mogenes. PAT inactivates the active ingredient in the herbicide bialaphos, phosphinothricin (PPT). PPT inhibits glutamine synthetase, (Murakami 1986; Twell 1989) causing rapid accumulation of ammonia and cell death. - altered 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) conferring resis 25 tance to Glyphosate* (N-(phosphonomethyl)glycine) (Hinchee 1988; Shah 1986; Della-Cioppa 1987). Where a mutant EPSP synthase gene is employed, additional benefit may be realized through the incorporation of a suitable chloroplast transit peptide, CTP (EP-AI 0 218 571). - Glyphosate* degrading enzymes (Glyphosate* oxidoreductase; gox), 30 - Dalapon* inactivating dehalogenases (deh) - sulfonylurea- and/or imidazolinone-inactivating acetolactate syntheses (ahas or ALS; for example mutated ahas/ALS variants with, for example, the S4, X112, XA17, and/or Hra mutation (EP-AI 154 204) - Bromoxynil* degrading nitrilases (bxn; Stalker 1988) 35 - Kanamycin- or. geneticin (G418) resistance genes (NPTII; NPT or neo; Potrykus 1985) coding e.g., for neomycin phosphotransferases (Fraley 1983; Nehra 1994)
-
2 -Desoxyglucose-6-phosphate phosphatase (DOGR1-Gene product; WO 98/45456; EP 0 807 836) conferring resistance against 2-desoxyglucose (Randez Gil 1995). 40 - hygromycin phosphotransferase (HPT), which mediates resistance to hygromycin (Vanden Elzen 1985). - altered dihydrofolate reductase (Eichholtz 1987) conferring resistance against methotrexat (Thillet 1988); - mutated anthranilate synthase genes that confers resistance to 5-methyl trypto 45 phan. Additional negative selectable marker genes of bacterial origin that confer resistance to 79 antibiotics include the aadA gene, which confers resistance to the antibiotic spectino mycin, gentamycin acetyl transferase, streptomycin phosphotransferase (SPT), ami nOglycoside.3-adenyj transferase and the bleomycin resistance determinant (H-ayford 1988; Jones 1987; Svab 1990; Hile 1986). 5 Especially preferred are negative selection markers that confer resistance against the toxic effects imposed by E-amino acids like e.g., D-alanine and D-serine (WO 03/060133; Erikson 2004). Especially preferred as negative selection marker in this contest are the deol gene (EC: 1.4. 3.3: GenBank Acc.-No.: U60066) from the yeast 10 Rhootowira gracifts (Rhodospone drum toruloides) and the N. coi gene dsdA (D-serine dehydratase (D-serine deaminase) [EC: 4.3. 1.18; GenBank Acc.-No.: J01603). Transformed plant material (e.g., cells, embryos, tissues or plantlets) which express such marker genes are capable of developing in the presence of concentrations of a 15 corresponding selection compound (e.g., antibiotic or herbicide) which suppresses growth of an untransformed wild type tissue. The resulting plants can be bred and hy bridized in the customary fashion. Two or more generations should be grown in order to ensure that the genomic integration is stable and hereditary. Corresponding methods are described (Jenes 1993; Potrykus 1991). 20 Furthermore, reporter genes can be employed to allow visual screening, which may or may not (depending on the type of reporter gene) require supplementation with a sub strate as a selection compound. 25 Various time schemes can be employed for the various negative selection marker genes. In case of resistance genes (e.g., against herbicides or D-amino acids) selec tion is preferably applied throughout callus induction phase for about 4 weeks and be yond at least 4 weeks into regeneration. Such a selection scheme can be applied for all selection regimes. It is furthermore possible (although not explicitly preferred) to remain 30 the selection also throughout the entire regeneration scheme including rooting. For example, with the phosphinotricin resistance gene (bar) as the selective marker, phosphinotricin at a concentration of from about 1 to 50 mg/L may be included in the medium. For example, with the dao1 gene as the selective marker, D-serine or D 35 alanine at a concentration of from about 3 to 100 mg/L may be included in the medium. Typical concentrations for selection are 20 to 40 mg/L. For example, with the mutated ahas genes as the selective marker, PURSUIT at a concentration of from about 3 to 100 mgAL may be included in the medium. Typical concentrations for selection are 20 to 40 mg/L. 40 2.1.2 Positive selection marker Furthermore, positive selection marker can be employed. Genes like isopentenyltrans ferase from Agrobacterium tumefaciens (strain:P022; Genbank Acc.-No.: AB025109) may - as a key enzyme of the cytokinin biosynthesis - facilitate regeneration of trans 45 formed plants (e.g., by selection on cytokinin-free medium). Corresponding selection methods are described (Ebinuma 2000a,b). Additional positive selection markers, which confer a growth advantage to a transformed plant in comparison with a non- 80 transformed one, are described e.g., in EP-A 0 601 092. Growth stimulation selection markers may include (but shall not be limited to) p-Glucuronidase (in combination with e.g., a cytokinin glucuronide), mannose-6-phosphate isomerase (in combination with mannose), UDP-galactose-4-epimerase (in combination with e.g., galactose), wherein 5 mannose-6-phosphate isomerase in combination with mannose is especially preferred. 2.1.3 Counter-selection marker Counter-selection markers are especially suitable to select organisms with defined de leted sequences comprising said marker (Koprek 1999). Examples for counter- selec 10 tion marker comprise thymidin kinases (TK), cytosine deaminases (Gleave 1999; Per era 1993; Stougaard 1993), cytochrom P450 proteins (Koprek 1999), haloalkan deha logenases (Naested 1999), iaaH gene products (Sundaresan 1995), cytosine deami nase codA (Schlaman & Hooykaas 1997), tms2 gene products (Fedoroff & Smith 1993), or a-naphthalene acetamide (NAM; Depicker 1988). Counter selection markers 15 may be useful in the construction of transposon tagging lines. For example, by marking an autonomous transposable element such as Ac, Master Mu, or En/Spn with a counter selection marker, one could select for transformants in which the autonomous element is not stably integrated into the genome. This would be desirable, for example, when transient expression of the autonomous element is desired to activate in trans the 20 transposition of a defective transposable element, such as Ds, but stable integration of the autonomous element is not desired. The presence of the autonomous element may not be desired in order to stabilize the defective element, i.e., prevent it from further transposing. However, it is proposed that if stable integration of an autonomous trans posable element is desired in a plant the presence of a negative selectable marker may 25 make it possible to eliminate the autonomous element during the breeding process. 2.2. Screenable Markers Screenable markers that may be employed include, but are not limited to, a beta glucuronidase (GUS) or uidA gene which encodes an enzyme for which various chro 30 mogenic substrates are known; an R-locus gene, which encodes a product that regu lates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta 1988); a beta-lactamase gene (Sutcliffe 1978), which encodes an enzyme for which various chromogenic substrates are known (e.g., PADAC, a chromogenic cepha losporin); a xylE gene (Zukowsky 1983) which encodes a catechol dioxygenase that 35 can convert chromogenic catechols; an a-amylase gene (Ikuta 1990); a tyrosinase gene (Katz 1983) which encodes an enzyme capable of oxidizing tyrosine to DOPA and dopaquinone which in turn condenses to form the easily detectable compound melanin; P-galactosidase gene, which encodes an enzyme for which there are chro mogenic substrates; a luciferase (lux) gene (Ow 1986), which allows for biolumines 40 cence detection; or even an aequorin gene (Prasher 1985), which may be employed in calcium-sensitive bioluminescence detection, or a green fluorescent protein gene (Niedz 1995). Genes from the maize R gene complex are contemplated to be particularly useful as 45 screenable markers. The R gene complex in maize encodes a protein that acts to regu late the production of anthocyanin pigments in most seed and plant tissue. A gene from the R gene complex was applied to maize transformation, because the expression of 81 this gene in transformed cells does not harm the cells. Thus, an R gene introduced into such cells will cause the expression of a red pigment and, if stably incorporated, can be visually scored as a red sector. If a maize line is carries dominant -quadrature.ultila for genes encoding the enzymatic intermediates in the anthocyanin biosynthetic pathway 5 (C2, A1, A2, Bz1 and Bz2), but carries a recessive allele at the R locus, transformation of any cell from that line with R will result in red pigment formation. Exemplary lines include Wisconsin 22 which contains the rg-Stadler allele and TRI 12, a K55 derivative which is r-g, b, P1. Alternatively any genotype of maize can be utilized if the C1 and R alleles are introduced together. 10 It is further proposed that R gene regulatory regions may be employed in chimeric con structs in order to provide mechanisms for controlling the expression of chimeric genes. More diversity of phenotypic expression is known at the R locus than at any other locus (Coe 1988). It is contemplated that regulatory regions obtained from regions 5' to the 15 structural R gene would be valuable in directing the expression of genes, e.g., insect resistance, drought resistance, herbicide tolerance or other protein coding regions. For the purposes of the present invention, it is believed that any of the various R gene fam ily members may be successfully employed (e.g., P, S, Lc, etc.). However, the most preferred will generally be Sn (particularly Sn:bol3). Sn is a dominant member of the R 20 gene complex and is functionally similar to the R and B loci in that Sn controls the is sue specific deposition of anthocyanin pigments in certain seedling and plant cells, therefore, its phenotype is similar to R. A further screenable marker contemplated for use in the present invention is firefly 25 luciferase, encoded by the lux gene. The presence of the lux gene in transformed cells may be detected using, for example, X-ray film, scintillation counting, fluorescent spec trophotometry, low-light video cameras, photon counting cameras or multiwell lumi nometry. It is also envisioned that this system may be developed for populational screening for bioluminescence, such as on tissue culture plates, or even for whole 30 plant screening. Where use of a screenable marker gene such as lux or GFP is de sired, benefit may be realized by creating a gene fusion between the screenable marker gene and a selectable marker gene, for example, a GFP-NPTI I gene fusion. This could allow, for example, selection of transformed cells followed by screening of transgenic plants or seeds. 35 3. Exemplary DNA Molecules The invention provides an isolated nucleic acid molecule, e.g., DNA or RNA, compris ing a plant nucleotide sequence comprising an open reading frame that is preferentially expressed in a specific plant tissue (e.g., roots and kernel) or is expressed constitu 40 tively, or a promoter thereof. These promoters include, but are not limited to, constitutive, inducible, temporally regu lated, developmentally regulated, spatially-regulated, chemically regulated, stress responsive, tissue-specific, viral and synthetic promoters. Promoter sequences are 45 known to be strong or weak. A strong promoter provides for a high level of gene ex pression, whereas a weak promoter provides for a very low level of gene expression. An inducible promoter is a promoter that provides for the turning on and off of gene 82 expression in response to an exogenously added agent, or to an environmental or de velopmental stimulus. A bacterial promoter such as the Pt, promoter can be induced to varying levels of gene expression depending on the level of isothiopropylgalactoside added to the transformed bacterial cells. An isolated promoter sequence that is a 5 strong promoter for heterologous nucleic acid is advantageous because it provides for a sufficient level of gene expression to allow for easy detection and selection of trans formed oells and provides for a high level of gene expression when desired. Within a plant promoter region there are several domains that are necessary for full 10 function of the promoter. The first of these domains lies immediately upstream of the structural gene and forms the "core promoter region" containing consensus sequences, normally 70 base pairs immediately upstream of the gene. The core promoter region contains the characteristic CAAT and TATA boxes plus surrounding sequences, and represents a transcription initiation sequence that defines the transcription start point 15 for the structural gene. The presence of the core promoter region defines a sequence as being a promoter: if the region is absent, the promoter is non-functional. Furthermore, the core promoter region is insufficient to provide full promoter activity. A series of regulatory sequences 20 upstream of the core constitute the remainder of the promoter. The regulatory se quences determine expression level, the spatial and temporal pattern of expression and, for an important subset of promoters, expression under inductive conditions (regu lation by external factors such as light, temperature, chemicals, hormones). 25 Regulated expression of the chimeric transacting viral replication protein can be further regulated by other genetic strategies. For example, Cre-mediated gene activation as described by Odell et at. 1990. Thus, a DNA fragment containing 3' regulatory se quence bound by lox sites between the promoter and the replication protein coding sequence that blocks the expression of a chimeric replication gene from the promoter 30 can be removed by Cre-mediated excision and result in the expression of the trans acting replication gene. In this case, the chimeric Cre gene, the chimeric trans-acting replication gene, or both can be under the control of tissue- and developmental-specific or inducible promoters. An alternate genetic strategy is the use of tRNA suppressor gene. For example, the regulated expression of a tRNA suppressor gene can condi 35 tionally control expression of a trans-acting replication protein coding sequence con taining an appropriate termination codon as described by Ulmasov et al. 1997. Again,either the chimeric tRNA suppressor gene, the chimeric transacting replication gene, or both can be under the control of tissue- and developmental-specific or induc ible promoters. 40 Frequently it is desirable to have continuous or inducible expression of a DNA se quence throughout the cells of an organism in a tissue-independent manner. For ex ample, increased resistance of a plant t6 infection by soil- and airborne-pathogens might be accomplished by genetic manipulation of the plant's genome to comprise a 45 continuous promoter operably linked to a heterologous pathogen-resistance gene such that pathogen-resistance proteins are continuously expressed throughout the plants tissues.
83 Alternatively, it might be desirable to inhibit expression of a native DNA sequence within a plant's tissues to achieve a desired phenotype. In this case, such inhibition might be accomplished with transformation of the plant to comprise a constitutive, tis sue-independent promoter operably linked to an antisense nucleotide sequence, such 5 that constitutive expression of the antisense sequence produces an RNA transcript that interferes with translation of the mRNA of the native DNA sequence. To define a minimal promoter region, a DNA segment representing the promoter region is removed from the 5' region of the gene of interest and operably linked to the coding 10 sequence of a marker (reporter) gene by recombinant DNA techniques well known to the art. The reporter gene is operably linked downstream of the promoter, so that tran scripts initiating at the promoter proceed through the reporter gene. Reporter genes generally encode proteins which are easily measured, including, but not limited to, chloramphenicol acetyl transferase (CAT), p-glucuronidase (GUS), green fluorescent 15 protein (GFP), p-galactosidase (p-GAL), and luciferase. The construct containing the reporter gene under the control of the promoter is then introduced into an appropriate cell type by transfection techniques well known to the art. To assay for the reporter protein, cell lysates are prepared and appropriate assays, 20 which are well known in the art, for the reporter protein are performed. For example, if CAT were the reporter gene of choice, the lysates from cells transfected with con structs containing CAT under the control of a promoter under study are mixed with iso topically labeled chloramphenicol and acetyl-coenzyme A (acetyl-CoA). The CAT en zyme transfers the acetyl group from acetyl-CoA to the 2- or 3-position of chloram 25 phenicol. The reaction is monitored by thin-layer chromatography, which separates acetylated chloramphenicol from unreacted material. The reaction products are then visualized by autoradiography. The level of enzyme activity corresponds to the amount of enzyme that was made, 30 which in turn reveals the level of expression from the promoter of interest. This level of expression can be compared to other promoters to determine the relative strength of the promoter under study. In order to be sure that the level of expression is determined by the promoter, rather than by the stability of the mRNA, the level of the reporter mRNA can be measured directly, such as by Northern blot analysis. 35 Once activity is detected, mutational and/or deletion analyses may be employed to de termine the minimal region and/or sequences required to initiate transcription. Thus, sequences can be deleted at the 5' end of the promoter region and/or at the 3' end of the promoter region, and nucleotide substitutions introduced. These constructs are 40 then introduced to cells and their activity determined. In one embodiment, the promoter may be a gamma zein promoter, an oleosin ole16 promoter, a globulins promoter, an actin I promoter, an actin cl promoter, a sucrose synthetase promoter, an INOPS promoter, an EXM5 promoter, a globulin2 promoter, a 45 b-32, ADPG-pyrophosphorylase promoter, an Ltpl promoter, an Ltp2 promoter, an oleosin ole17 promoter, an oleosin ole18 promoter, an actin 2 promoter, a pollen specific protein promoter, a pollen-specific pectate lyase promoter, an anther-specific 84 protein promoter, an anther-specific gene RTS2 promoter, a pollen-specific gene pro moter, a tapetum-specific gene promoter, tapetum-specific gene RAB24 promoter, an a nthranilate synthase alpha subunit promoter, an alpha zein promoter, an anthranilate synthase beta subunit promoter, a dihydrodipicolinate synthase promoter, a Thil pro 5 mother, an alcohol dehydrogenase promoter, a cab binding protein promoter, an H3C4 promoter, a RUBISCO SS starch branching enzyme promoter, an ACCase promoter, an acting promoter, an acting promoter, a regulatory protein GF14-12 promoter, a ribo somal protein L9 promoter, a cellulose biosynthetic enzyme promoter, an S-adenosyl L-homocysteine hydrolase promoter, a superoxide dismutase promoter, a C-kinase 10 receptor promoter, a phosphoglycerate mutase promoter, a root-specific RCc3 mRNA promoter, a glucose-6 phosphate isomerase promoter, a pyrophosphate-fructose 6 phosphatelphosphotransferase promoter, an ubiquitin promoter, a beta-ketoacyl-ACP synthase promoter, a 33 kDa photosystem 11 promoter, an oxygen evolving protein promoter, a 69 kDa vacuolar ATPase subunit promoter, a metallothionein-like protein 15 promoter, a glyceraldehyde-3-phosphate dehydrogenase promoter, an ABA- and ripen ing-inducible-like protein promoter, a phenylalanine ammonia lyase promoter, an adenosine triphosphatase S-adenosyl-L-homocysteine hydrolase promoter, an a tubulin promoter, a cab promoter, a PEPCase promoter, an R gene promoter, a lectin promoter, a light harvesting complex promoter, a heat shock protein promoter, a chal 20 cone synthase promoter, a zein promoter, a globulin-1 promoter, an ABA promoter, an auxin-binding protein promoter, a UDP glucose flavonoid glycosyl-transferase gene promoter, an NTI promoter, an actin promoter, an opaque 2 promoter, a b70 promoter, an oleosin promoter, a CaMV 35S promoter, a CaMV 34S promoter, a CaMV 19S pro moter, a histone promoter, a turgor-inducible promoter, a pea small subunit RuBP car 25 boxylase promoter, a Ti plasmid mannopine synthase promoter, Ti plasmid nopaline synthase promoter, a petunia chalcone isomerase promoter, a bean glycine rich protein I promoter, a CaMV 35S transcript promoter, a potato patatin promoter, or a S-E9 small subunit RuBP carboxylase promoter. 30 4. Transformed (Transgenic) Plants of the Invention and Methods of Preparation Plant species may be transformed with the DNA construct of the present invention by the DNA-mediated transformation of plant cell protoplasts and subsequent regenera tion of the plant from the transformed protoplasts in accordance with procedures well known in the art. 35 Any plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, may be transformed with a vector of the present invention. The term "organogenesis," as used herein, means a process by which shoots and roots are de veloped sequentially from meristematic centers; the term "embryogenesis," as used 40 herein, means a process by which shoots and roots develop together in a concerted fashion (not sequentially), whether from somatic cells or gametes. The particular tissue chosen will vary depending on the clonal propagation systems available for, and best suited to, the particular species being transformed. Exemplary tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, 45 existing meristematic tissue (e.g., apical meristems, axillary buds, and root meristems), and induced meristem tissue (e.g., cotyledon meristem and ultilane meristem).
85 Plants of the present invention may take a variety of forms. The plants may be chime ras of transformed cells and non-transformed cells; the plants may be clonal transfor mants (e.g., all cells transformed to contain the expression cassette); the plants may comprise grafts of transformed and untransformed tissues (e.g., a transformed root 5 stock grafted to an untransformed scion in citrus species). The transformed plants may be propagated by a variety of means, such as by clonal propagation or classical breed ing techniques. For example, first generation (or T1) transformed plants may be selfed to give homozygous second generation (or T2) transformed plants, and the T2 plants further propagated through classical breeding techniques. A dominant selectable 10 marker (such as nptil) can be associated with the expression cassette to assist in breeding. Thus, the present invention provides a transformed (transgenic) plant cell, in plante or ex plant, including a transformed plastid or other organelle, e.g., nucleus, mitochon 15 dria or chloroplast. The present invention may be used for transformation of any plant species, including, but not limited to, cells from the plant species specified above in the DEFINITION section. Preferably, transgenic plants of the present invention are crop plants and in particular cereals (for example, corn, alfalfa, sunflower, rice, Brassica, canola, soybean, barley, soybean, sugarbeet, cotton, safflower, peanut, sorghum, 20 wheat, millet, tobacco, etc.), and even more preferably corn, rice and soybean. Other embodiments of the invention are related to cells, cell cultures, tissues, parts (such as plants organs, leaves, roots, etc.) and propagation material (such as seeds) of such plants. 25 The transgenic expression cassette of the invention may not only be comprised in plants or plant cells but may advantageously also be containing in other organisms such for example bacteria. Thus, another embodiment of the invention relates to trans genic cells or non-human, transgenic organisms comprising an expression cassette of the invention. Preferred are prokaryotic and eukaryotic organism. Both microorganism 30 and higher organisms are comprised. Preferred microorganisms are bacteria, yeast, algae, and fungi. Preferred bacteria are those of the genus Escherichia, Erwinia, Agro bacterium, Flavobacterium, Alcaligenes, Pseudomones, Bacillus or Cyanobacterim such as - for example - Synechocystis and other bacteria described in Brock Biology of Microorganisms Eighth Edition (pages A-8, A-9, A10 and Al1). 35 Especially preferred are microorganisms capable to infect plants and to transfer DNA into their genome, especially bacteria of the genus Agrobacterium, preferably Agrobac terium tumefaciens and rhizogenes. Preferred yeasts are Candida, Saccharomyces, Hansenula and Pichia. Preferred Fungi are Aspergillus, Trichoderma, Ashbya, Neuro 40 spore, Fusarium, and Beauveria. Most preferred are plant organisms as defined above. Transformation of plants can be undertaken with a single DNA molecule or multiple DNA molecules (ie., co-transformation), and both these techniques are suitable for use with the expression cassettes of the present invention. Numerous transformation vec 45 tors are available for plant transformation, and the expression cassettes of this inven tion can be used in conjunction with any such vectors. The selection of vector will de- 86 pend upon the preferred transformation technique and the target species for transfor mation. A variety of techniques are available and known to those skilled in the art for introduc 5 tion of constructs into a plant cell host. These techniques generally include transforma tion with DNA employing A. tumefaciens or A. rhizogenes as the transforming agent, liposomes, PEG precipitation, electroporation, DNA injection, direct DNA uptake, mi croprojectile bombardment, particle acceleration, and the like (See, for example, EP 295959 and EP 138341) (see below). However, cells other than plant cells may be 10 transformed with the expression cassettes of the invention. The general descriptions of plant expression vectors and reporter genes, and Agrobacterium and Agrobacterium mediated gene transfer, can be found in Gruber et at. (1993). Expression vectors containing genomic or synthetic fragments can be introduced into 15 protoplasts or into intact tissues or isolated cells. Preferably expression vectors are introduced into intact tissue. General methods of culturing plant tissues are provided for example by Maki et at., (1993); and by Phillips et at. (1988). Preferably, expression vectors are introduced into maize or other plant tissues using a direct gene transfer method such as microprojectile-mediated delivery, DNA injection, electroporation and 20 the like. More preferably expression vectors are introduced into plant tissues using the microprojectile media delivery with the biolistic device. See, for example, Tomes et al. (1995). The vectors of the invention can not only be used for expression of structural genes but may also be used in exon-trap cloning, or promoter trap procedures to detect differential gene expression in varieties of tissues (Lindsey 1993; Auch & Reth 1990). 25 It is particularly preferred to use the binary type vectors of Ti and Ri plasmids of Agro bacterium spp. Ti-derived vectors transform a wide variety of higher plants, including monocotyledonous and dicotyledonous plants, such as soybean, cotton, rape, tobacco, and rice (Pacciotti 1985: Byrne 1987; Sukhapinda 1987; Lorz 1985; Potrykus, 1985; 30 Park 1985: Hiei 1994). The use of T-DNA to transform plant cells has received exten sive study and is amply described (EP 120516; Hoekema, 1985; Knauf, 1983; and An 1985). For introduction into plants, the chimeric genes of the invention can be inserted into binary vectors as described in the examples. 35 Other transformation methods are available to those skilled in the art, such as direct uptake of foreign DNA constructs (see EP 295959), techniques of electroporation (Fromm 1986) or high velocity ballistic bombardment with metal particles coated with the nucleic acid constructs (Kline 1987, and US 4,945,050). Once transformed, the cells can be regenerated by those skilled in the art. Of particular relevance are the re 40 cently described methods to transform foreign genes into commercially important crops, such as rapeseed (De Block 1989), sunflower (Everett 1987), soybean (McCabe 1988; Hinchee 1988; Chee 1989; Christou 1989; EP 301749), rice (Hiei 1994), and corn (Gordon-Kamm 1990; Fromm 1990). 45 Those skilled in the art will appreciate that the choice of method might depend on the type of plant, i.e., monocotyledonous or dicotyledonous, targeted for transformation. Suitable methods of transforming plant cells include, but are not limited to, microinjec- 87 tion (Crossway 1986), electroporation (Riggs 1986), Agrobacterium-mediated transfor mation (Hinchee 1988), direct gene transfer (Paszkowski 1984), and ballistic particle acceleration using devices available from Agracetus, Inc., Madison, Wis. And BioRad, Hercules, Calif. (see, for example, US 4,945,050; and McCabe 1988). Also see, 5 Weissinger 1988; Sanford 1987 (onion); Christou 1988 (soybean); McCabe 1988 (soy bean); Datta 1990 (rice); Klein 1988 (maize); Klein 1988 (maize); Klein 1988 (maize); Fromm 1990 (maize); and Gordon-Kamm 1990 (maize); Svab 1990 (tobacco chloro plast); Koziel 1993 (maize); Shimamoto 1989 (rice); Christou 1991 (rice); European Patent Application EP 0 332 581 (orchardgrass and other Pooideae); Vasil 1993 10 (wheat); Weeks 1993 (wheat). In another embodiment, a nucleotide sequence of the present invention is directly transformed into the plastid genome. Plastid transformation technology is extensively described in US 5,451,513, 5,545,817, and 5,545,818, in PCT application no. WO 15 95/16783, and in McBride et aL, 1994. The basic technique for chloroplast transforma tion involves introducing regions of cloned plastid DNA flanking a selectable marker together with the gene of interest into a suitable target tissue, e.g., using biolistics or protoplast transformation (e.g., calcium chloride or PEG mediated transformation). The 1 to 1.5 kb flanking regions, termed targeting sequences, facilitate orthologous recom 20 bination with the plastid genome and thus allow the replacement or modification of specific regions of the plastome. Initially, point mutations in the chloroplast 16S rRNA and rps12 genes conferring resistance to spectinomycin and/or streptomycin are util ized as selectable markers for transformation (Svab 1990; Staub 1992). This resulted in stable homoplasmic transformants at a frequency of approximately one per 100 25 bombardments of target leaves. The presence of cloning sites between these markers allowed creation of a plastid targeting vector for introduction of foreign genes (Staub 1993). Substantial increases in transformation frequency are obtained by replacement of the recessive rRNA or r-protein antibiotic resistance genes with a dominant select able marker, the bacterial aadA gene encoding the spectinomycin-detoxifying enzyme 30 aminoglycoside-3N-adenyltransferase (Svab 1993). Other selectable markers useful for plastid transformation are known in the art and encompassed within the scope of the invention. Typically, approximately 15-20 cell division cycles following transformation are required to reach a homoplastidic state. Plastid expression, in which genes are inserted by orthologous recombination into all of the several thousand copies of the 35 circular plastid genome present in each plant cell, takes advantage of the enormous copy number advantage over nuclear-expressed genes to permit expression levels that can readily exceed 10% of the total soluble plant protein, In a preferred embodiment, a nucleotide sequence of the present invention is inserted into a plastid targeting vector and transformed into the plastid genome of a desired plant host. Plants homoplastic for 40 plastid genomes containing a nucleotide sequence of the present invention are ob tained, and are preferentially capable of high expression of the nucleotide sequence. Agrobacterium tumefaciens cells containing a vector comprising an expression cas sette of the present invention, wherein the vector comprises a Ti plasmid, are useful in 45 methods of making transformed plants. Plant cells are infected with an Agrobacterium tumetaciens as described above to produce a transformed plant cell, and then a plant 88 is regenerated from the transformed plant cell. Numerous Agrobacterium vector sys tems useful in carrying out the present invention are known. Various Agrobactedum strains can be employed, preferably disarmed Agrobactedfum 5 tumefaciens or rhizogenes strains. In a preferred embodiment, Agrobacterium strains for use in the practice of the invention include octopine strains, e.g., LBA4404 or ag ropine strains, e.g., EHA101 or EHA105. Suitable strains of A. tumefaciens for DNA transfer are for example EHA101[pEHA101] (Hood 1986), EHA105[pEHA105] (Li 1992), LBA4404[pAL4404] (Hoekema 1983), C58C1[pMP90] (Koncz & Schell 1986), 10 and C58C1[pGV2260] (Deblaere 1985). Other suitable strains are Agrobacterium tu mefaciens C58, a nopaline strain. Other suitable strains are A. tumefaciens C58C1 (Van Larebeke 1974), A136 (Watson 1975) or LBA4011 (Klapwijk 1980). In another preferred embodiment the soil-borne bacterium is a disarmed variant of Agrobacterum rhizogenes strain K599 (NCPPB 2659). Preferably, these strains are comprising a dis 15 armed plasmid variant of a Ti- or Ri-plasmid providing the functions required for T-DNA transfer into plant cells (e.g., the vir genes). In a preferred embodiment, the Agrobacte rium strain used to transform the plant tissue pre-cultured with the plant phenolic com pound contains a L,L-succinamopine type Ti-plasmid, preferably disarmed, such as pEHA101, In another preferred embodiment, the Agrobacterium strain used to trans 20 form the plant tissue pre-cultured with the plant phenolic compound contains an oc topine-type Ti-plasmid, preferably disarmed, such as pAL4404. Generally, when using octopine-type Ti-plasmids or helper plasmids, it is preferred that the virF gene be de leted or inactivated (Jarschow 1991). 25 The method of the invention can also be used in combination with particular Agrobacte rium strains, to further increase the transformation efficiency, such as Agrobacterium strains wherein the vir gene expression and/or induction thereof is altered due to the presence of mutant or chimeric virA or virG genes (e.g. Hansen 1994; Chen and Wi nans 1991; Scheeren-Groot, 1994). Preferred are further combinations of Agrobacte 30 rium tumefaciens strain LBA4404 (Hiei 1994) with super-virulent plasmids. These are preferably pTOK246-based vectors (Ishida 1996). A binary vector or any other vector can be modified by common DNA recombination techniques, multiplied in E. coli, and introduced into Agrobacterium by e.g., electropo 35 ration or other transformation techniques (Mozo & Hooykaas 1991). Agrobactedum is grown and used in a manner similar to that described in Ishida (1996). The vector comprising Agrobacterium strain may, for example, be grown for 3 days on YP medium (5 g/L yeast extract, 10 g/L peptone, 5 g/L NaCl, 15 g/L agar, pH 40 6.8) supplemented with the appropriate antibiotic (e.g., 50 mg/L spectinomycin). Bacte ria are collected with a loop from the solid medium and resuspended. In a preferred embodiment of the invention, Agrobacterium cultures are started by use of aliquots frozen at -0*C. The concentration of Agrobacterium used for infection and co cultivation may need to be varied. For example, a cell suspension of the Agrobacterium 45 having a population density of approximately from 106 to 101, preferably 106 to 1010, more preferably about 108 cells or cfu/mL is prepared and the target tissue is immersed in this suspension for about 3 to 10 minutes. The bacteria are resuspended in a plant 89 compatible co-cultivation medium, Supplementation of the co-culture medium with anti oxidants (e.g., silver nitrate), phenol-absorbing compounds (like polyvinylpyrrolidone, Perl 1996) or thiol compounds (e.g., dithiothreitol, L-cysteine, Olhoft 2001) which can decrease tissue necrosis due to plant defense responses (like phenolic oxidation) may 5 further improve the efficiency of Agrobacterium-mediated transformation. In another preferred embodiment, the co-cultivation medium of comprises least one thiol com pound, preferably selected from the group consisting of sodium thiolsulfate, dithiotrietol (DTT) and cysteine. Preferably the concentration is between about 1 mM and 10 mM of L-Cysteine, 0.1 mM to 5 mM DTT, and/or 0.1 mM to 5 mM sodium thiolsulfate. Prefera 10 bly, the medium employed during co-cultivation comprises from about 1 pM to about 10 pM of silver nitrate and from about 50 mg/L to about 1,000 mg/L of L-Cystein. This re sults in a highly reduced vulnerability of the target tissue against Agrobacterium mediated damage (such as induced necrosis) and highly improves overall transforma tion efficiency. 15 Various vector systems can be used in combination with Agrobacteria. Preferred are binary vector systems. Common binary vectors are based on "broad host range" plasmids like pRK252 (Bevan 1984) or pTJS75 (Watson 1985) derived from the P-type plasmid RK2. Most of these vectors are derivatives of pBIN19 (Bevan 1984). Various 20 binary vectors are known, some of which are commercially available such as, for ex ample, pB1101.2 or pBIN19 (Clontech Laboratories, Inc. USA). Additional vectors were improved with regard to size and handling (e.g. pPZP; Hajdukiewicz 1994), Improved vector systems are described also in WO 02/00900. 25 Methods using either a form of direct gene transfer or Agrobacterium-mediated transfer usually, but not necessarily, are undertaken with a selectable marker which may pro vide resistance to an antibiotic (e.g., kanamycin, hygromycin or methotrexate) or a her bicide (e.g., phosphinothricin). The choice of selectable marker for plant transformation is not, however, critical to the invention. 30 For certain plant species, different antibiotic or herbicide selection markers may be preferred. Selection markers used routinely in transformation include the nptll gene which confers resistance to kanamycin and related antibiotics (Messing & Vierra, 1982; Bevan 1983), the bar gene which confers resistance to the herbicide phosphinothricin 35 (White 1990, Spencer 1990), the hph gene which confers resistance to the antibiotic hygromycin (Blochlinger & Diggelmann), and the dhfr gene, which confers resistance to methotrexate (Bourouis 1983). 5. Production and Characterization of Stably Transformed Plants 40 Transgenic plant cells are then placed in an appropriate selective medium for selection of transgenic cells which are then grown to callus. Shoots are grown from callus and plantlets generated from the shoot by growing in rooting medium. The various con structs normally will be joined to a marker for selection in plant cells. Conveniently, the marker may be resistance to a biocide (particularly an antibiotic, such as kanamycin, 45 G418, bleomycin, hygromycin, chloramphenicol, herbicide, or the like). The particular marker used will allow for selection of transformed cells as compared to cells lacking the DNA which has been introduced. Components of DNA constructs including tran- 90 scription cassettes of this invention may be prepared from sequences, which are native (endogenous) or foreign (exogenous) to the host. By "foreign" it is meant that the se quence is not found in the wild-type host into which the construct is introduced. Het erologous constructs will contain at least one region which is not native to the gene 5 from which the transcription-initiation-region is derived. To confirm the presence of the transgenes in transgenic cells and plants, a variety of assays may be performed. Such assays include, for example, "molecular biological" assays well known to those of skill in the art, such as Southern and Northern blotting, in 10 situ hybridization and nucleic acid-based amplification methods such as PCR or RT PCR; "biochemical" assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as seed assays; and also, by analyzing the phenotype of the whole regenerated plant, e.g., for disease or pest resistance. 15 DNA may be isolated from cell lines or any plant parts to determine the presence of the preselected nucleic acid segment through the use of techniques well known to those skilled in the art. Note that intact sequences will not always be present, presumably due to rearrangement or deletion of sequences in the cell. 20 The presence of nucleic acid elements introduced through the methods of this inven tion may be determined by polymerase chain reaction (PCR). Using this technique dis creet fragments of nucleic acid are amplified and detected by gel electrophoresis. This type of analysis permits one to determine whether a preselected nucleic acid segment 25 is present in a stable transformant, but does not prove integration of the introduced preselected nucleic acid segment into the host cell genome. In addition, it is not possi ble using PCR techniques to determine whether transformants have exogenous genes introduced into different sites in the, genome, i.e., whether transformants are of inde pendent origin, It is contemplated that using PCR techniques it would be possible to 30 clone fragments of the host genomic DNA adjacent to an introduced preselected DNA segment. Positive proof of DNA integration into the host genome and the independent identities of transformants may be determined using the technique of Southem hybridization. 35 Using this technique specific DNA sequences that were introduced into the host ge nome and flanking host DNA sequences can be identified. Hence the Southern hybridi zation pattern of a given transformant serves as an identifying characteristic of that transformant. In addition it is possible through Southern hybridization to demonstrate the presence of introduced preselected DNA segments in high molecular weight DNA, 40 i.e., confirm that the introduced preselected, DNA segment has been integrated into the host cell genome. The technique of Southern hybridization provides information that is obtained using PCR, e.g., the presence of a preselected DNA segment, but also dem onstrates integration into the genome and characterizes each individual transformant. 45 It is contemplated that using the techniques of dot or slot blot hybridization which are modifications of Southern hybridization techniques one could obtain the same informa tion that is derived from PCR, e.g., the presence of a preselected DNA segment.
91 Both PCR and Southern hybridization techniques can be used to demonstrate trans mission of a preselected DNA segment to progeny. In most instances the characteristic Southern hybridization pattern for a given transformant will segregate in progeny as one or more Mendelian genes (Spencer 1992); Laursen 1994) indicating stable inheri 5 tance of the gene. The non-chimeric nature of the callus and the parental transformants (R.sub.0) was suggested by germline transmission and the identical Southern blot hy bridization patterns and intensities of the transforming DNA in callus, R.sub.0 plants and R,sub. 1 progeny that segregated for the transformed gene. 10 Whereas DNA analysis techniques may be conducted using DNA isolated from any part of a plant, RNA may only be expressed in particular cells or tissue types and hence it will be necessary to prepare RNA for analysis from these tissues. PCR tech niques may also be used for detection and quantification of RNA produced from intro duced preselected DNA segments, In this application of PCR it is first necessary to 15 reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA. In most in stances PCR techniques, while useful, will not demonstrate integrity of the RNA prod uct. Further information about the nature of the RNA product may be obtained by Northern blotting. This technique will demonstrate the presence of an RNA species and 20 give information about the integrity of that RNA. The presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and will only demonstrate the pres ence or absence of an RNA species. 25 While Southern blotting and PCR may be used to detect the preselected DNA segment in question, they do not provide information as to whether the preselected DNA seg ment is being expressed. Expression may be evaluated by specifically identifying the protein products of the introduced preselected DNA segments or evaluating the pheno typic changes brought about by their expression. 30 Assays for the production and identification of specific proteins may make use of physi cal-chemical, structural, functional, or other properties of the proteins. Unique physical chemical or structural properties allow the proteins to be separated and identified by electrophoretic procedures, such as native or denaturing gel electrophoresis or isoelec 35 tric focusing, or by chromatographic techniques such as ion exchange or gel exclusion chromatography. The unique structures of individual proteins offer opportunities for use of specific antibodies to detect their presence in formats such as an ELISA assay. Combinations of approaches may be employed with even greater specificity such as Western blotting in which antibodies are used to locate individual gene products that 40 have been separated by electrophoretic techniques. Additional techniques may be em ployed to absolutely confirm the identity of the product of interest such as evaluation by amino acid sequencing following purification. Although these are among the most commonly employed, other procedures may be additionally used. 45 Assay procedures may also be used to identify the expression of proteins by their func tionality, especially the ability of enzymes to catalyze specific chemical reactions involv ing specific substrates and products. These reactions may be followed by providing 92 and quantifying the loss of substrates or the generation of products of the reactions by physical or chemical procedures. Examples are as varied as the enzyme to be ana lyzed. 5 Very frequently the expression of a gene product is determined by evaluating the phe notypic results of its expression. These assays also may take many forms including but not limited to analyzing changes in the chemical composition, morphology, or physio logical properties of the plant. Morphological changes may include greater stature or thicker stalks. Most often changes in response of plants or plant parts to imposed 10 treatments are evaluated under carefully controlled conditions termed bioassays. 6. Uses of Transgenic Plants Once an expression cassette of the invention has been transformed into a particular plant species, it may be propagated in that species or moved into other varieties of the 15 same species, particularly including commercial varieties, using traditional breeding techniques. Particularly preferred plants of the invention include the agronomically im portant crops listed above. The genetic properties engineered into the transgenic seeds and plants described above are passed on by sexual reproduction and can thus be maintained and propagated in progeny plants. The present invention also relates to a 20 transgenic plant cell, tissue, organ, seed or plant part obtained from the transgenic plant. Also included within the invention are transgenic descendants of the plant as well as transgenic plant cells, tissues, organs, seeds and plant parts obtained from the de scendants. 25 Preferably, the expression cassette in the transgenic plant is sexually transmitted. In one preferred embodiment, the coding sequence is sexually transmitted through a complete normal sexual cycle of the RO plant to the R1 generation. Additionally pre ferred, the expression cassette is expressed in the cells, tissues, seeds or plant of a transgenic plant in an amount that is different than the amount in the cells, tissues, 30 seeds or plant of a plant which only differs in that the expression cassette is absent. The transgenic plants produced herein are thus expected to be useful for a variety of commercial and research purposes. Transgenic plants can be created for use in tradi tional agriculture to possess traits beneficial to the grower (e.g., agronomic traits such 35 as resistance to water deficit, pest resistance, herbicide resistance or increased yield), beneficial to the consumer of the grain harvested from the plant (e.g., improved nutri tive content in human food or animal feed; increased vitamin, amino acid, and antioxi dant content; the production of antibodies (passive immunization) and nutriceuticals), or beneficial to the food processor (e.g., improved processing traits). In such uses, the 40 plants are generally grown for the use of their grain in human or animal foods. Addi tionally, the use of root-specific promoters in transgenic plants can provide beneficial traits that are localized in the consumable (by animals and humans) roots of plants such as carrots, parsnips, and beets. However, other parts of the plants, including stalks, husks, vegetative parts, and the like, may also have utility, including use as part 45 of animal silage or for ornamental purposes. Often, chemical constituents (e.g., oils or starches) of maize and other crops are extracted for foods or industrial use and trans- 93 genic plants may be created which have enhanced or modified levels of such compo nents. Transgenic plants may also find use in the commercial manufacture of proteins or other 5 molecules, where the molecule of interest is extracted or purified from plant parts, seeds, and the like. Cells or tissue from the plants may also be cultured, grown in vitro, or fermented to manufacture such molecules. The transgenic plants may also be used in commercial breeding programs, or may be crossed or bred to plants of related crop species. Improvements encoded by the expression cassette may be transferred, e.g., 10 from maize cells to cells of other species, e.g., by protoplast fusion. The transgenic plants may have many uses in research or breeding, including creation of new mutant plants through insertional mutagenesis, in order to identify beneficial mutants that might later be created by traditional mutation and selection. An example 15 would be the introduction of a recombinant DNA sequence encoding a transposable element that may be used for generating genetic variation. The methods of the inven tion may also be used to create plants having unique "signature sequences" or other marker sequences which can be used to identify proprietary lines or varieties. 20 Thus, the transgenic plants and seeds according to the invention can be used in plant breeding, which aims at the development of plants with improved properties conferred by the expression cassette, such as tolerance of drought, disease, or other stresses. The various breeding steps are characterized by well-defined human intervention such as selecting the lines to be crossed, directing pollination of the parental lines, or select 25 ing appropriate descendant plants. Depending on the desired properties different breeding measures are taken. The relevant techniques are well known in the art and include but are not limited to hybridization, inbreeding, backcross breeding, multilane breeding, variety blend, interspecific hybridization, aneuploid techniques, etc. Hybridi zation techniques also include the sterilization of plants to yield male or female sterile 30 plants by mechanical, chemical or biochemical means. Cross pollination of a male ster ile plant with pollen of a different line assures that the genome of the male sterile but female fertile plant will uniformly obtain properties of both parental lines. Thus, the transgenic seeds and plants according to the invention can be used for the breeding of improved plant lines which for example increase the effectiveness of conventional 35 methods such as herbicide or pesticide treatment or allow to dispense with said meth ods due to their modified genetic properties. Alternatively new crops with improved stress tolerance can be obtained which, due to their optimized genetic "equipment", yield harvested product of better quality than products, which were not able to tolerate comparable adverse developmental conditions. 40 94 Sequences 1. SEQ ID NO: 1 Nucleic acid sequence encoding the transcription regulating nu cleotide sequence of Oryza sativa (rice) caffeoyl CoA-O 5 methyltransferase (Os.CCoAMTI) gene including 5-untranslated region 2. SEQ ID NO: 2 Nucleic acid sequence encoding the transcription regulating nu cleotide sequence of Oryza saliva (rice) caffeoyl CoA-0 10 methyltransferase (Os.CCoAMT1) gene 3. SEQ ID NO: 3 Nucleic acid sequence encoding the core promoter region of the transcription regulating nucleotide sequence of Oryza sativa (rice) caffecyl CoA-O-methyltransferase (Os.CCoAMTI) gene compris 15 ing clusters of promoter elements. 4. SEQ ID NO: 4 Nucleic acid sequence encoding Oryza saliva (rice) caffeoyl CoA 0-methyltransferase (Os.CCoAMT1) 20 5. SEQ ID NO: 5 Amino acid sequence encoding Oryza sativa (rice) caffeoyl CoA 0-methyltransferase (Os.CCoAMT1) 6. SEQ ID NO: 6 Nucleic acid sequence encoding a transcription regulating nucleo tide sequence from the Oryza saliva (rice) C8,7-sterol isomerase 25 gene (Os.SI) including the 5' untranslated region of the gene. 7. SEQ ID NO: 7 Nucleic acid sequence encoding a transcription regulating nucleo tide sequence from the Oryza sativa (rice) C8,7-sterol isomerase gene (Os.SI). 30 8. SEQ ID NO: 8 Nucleic acid sequence encoding the core promoter region of the transcription regulating nucleotide sequence from the Oryza saliva (rice) C8,7-sterol isomerase gene (Os.S) comprising dusters of promoter elements. 35 9. SEQ ID NO: 9 Nucleic acid sequence encoding Oryza saliva (rice) C8,7-sterol isomerase gene (Os.SI) 10. SEQ ID NO: 10 Amino acid sequence encoding Oryza saliva (rice) C8,7-sterol 40 isomerase gene (Os.SI) 11. SEQ ID NO: 11 Nucleic acid sequence encoding a transcription regulating nucleo tide sequence from a Zea mays hydroxyproline-rich glycoprotein (HRGP) (Zm.HRGP) including the 5' untranslated region of the 45 gone.
95 12. SEQ ID NO: 12 Nucleic acid sequence encoding a transcription regulating nucleo tide sequence from a Zea mays hydroxyproline-rich glycoprotein (HRGP) (Zm.HRGP). 5 13. SEQ ID NO: 13 Nucleic acid sequence encoding the core promoter region of the transcription regulating nucleotide sequence from a Zee mays hy droxyproline-rich glycoprotein (HRGP) (Zm.HRGP) comprising clusters of promoter elements. 10 14. SEQ ID NO: 14 Nucleic acid sequence encoding a function equivalent of the tran scription regulating nucleotide sequence from a Zea mays hy droxyproline-rich glycoprotein (HRGP) (Zm.HRGP) including the 5' untranslated region of the gene. 15 15. SEQ ID NO: 15 Nucleic acid sequence encoding a function equivalent of the tran scription regulating nucleotide sequence from a Zea mays hy droxyproline-rich glycoprotein (HRGP) (Zm.HRGP). 16. SEQ ID NO: 16 Nucleic acid sequence encoding the core promoter region of a 20 function equivalent of the transcription regulating nucleotide se quence from a Zee mays hydroxyproline-rich glycoprotein (HRGP) (ZmHRGP) comprising clusters of promoter elements. 17. SEQ ID NO: 17 Nucleic acid sequence encoding the Zea mays hydroxyproline-rich 25 glycoprotein (HRGP) 18. SEQ ID NO: 18 Amino acid sequence encoding the Zea mays hydroxyproline-rich glycoprotein (HRGP) 30 19. SEQ ID NO: 19 Nucleic acid sequence encoding a transcription regulating nucleo tide sequence from a Zee mays lactate dehydrogenase (Zm.LDH) including the 5' untranslated region of the gene. 20. SEQ ID NO: 20 Nucleic acid sequence encoding a transcription regulating nucleo 35 tide sequence from a Zea mays lactate dehydrogenase (Zm.LDH). 21. SEQ ID NO: 21 Nucleic acid sequence encoding the core promoter region of the transcription regulating nucleotide sequence from a Zee mays lac tate dehydrogenase (Zm.LDH) comprising clusters of promoter 40 elements. 22. SEQ ID NO: 22 Nucleic acid sequence encoding a function equivalent of the tran scription regulating nucleotide sequence from a Zea mays lactate dehydrogenase (Zm.LDH) including the 5' untranslated region of 45 the gene.
96 23. SEQ ID NO: 23 Nucleic acid sequence encoding a function equivalent of the tran scription regulating nucleotide sequence from a Zee mays lactate dehydrogenase (Zm.LDH). 5 24. SEQ ID NO: 24 Nucleic acid sequence encoding the core promoter region of a function equivalent of the transcription regulating nucleotide se quence from a Zee mays lactate dehydrogenase (Zm.LDH) com prising clusters of promoter elements. 10 25. SEQ ID NO: 25 Nucleic acid sequence encoding the Zee mays lactate dehydro genase (Zm.LDH) 26. SEQ ID NO: 26 Amino acid sequence encoding the Zee mays lactate dehydro genase (Zm.LDH) 15 27. SEQ ID NO: 27 Nucleic acid sequence encoding a function equivalent of the tran scription regulating nucleotide sequence from an Oryza sativa (rice) choroplast 12 (CP12) protein including the 5' untranslated region of the gene. 20 28. SEQ ID NO: 28 Nucleic acid sequence encoding a function equivalent of the tran scription regulating nucleotide sequence from an Oryza sativa (rice) choroplast 12 (CP12) protein. 25 29. SEQ ID NO: 29 Nucleic acid sequence encoding the core promoter region of a function equivalent of the transcription regulating nucleotide se quence from an Oryza sativa (rice) choroplast 12 (CP12) protein comprising clusters of promoter elements. 30 30. SEQ ID NO: 30 Nucleic acid sequence encoding the Oryza sativa (rice) choroplast 12 (CP12) protein. 31. SEQ ID NO: 31 Amino acid sequence encoding the Oryza sativa (rice) choroplast 12 (CP12) protein. 35 32. SEQ ID NO: 32 Nucleic acid sequence encoding the intergenic sequence compris ing 3-untranslated region of Zea mays lactate dehydrogenase gene with the transcription termination and polyadenylation se quence. 40 33. SEQ ID NO: 33 Nucleic acid sequence encoding construct pBPSMM304 [Os.CP12 promoter:Zm.ubiquitin intron::GUS (PIV2)::NOS terminator] 34. SEQ ID NO: 34 Nucleic acid sequence encoding the intergenic sequence including 45 the 3' untranslated region of caffeoyl CoA-O-methyltransferase with the transcription termination and polyadenylation sequence.
97 35. SEQ ID NO: 35 Nucleic acid sequence encoding the intergenic sequence including the 3' untranslated region of hydroxyproline-rich glyco-protein gene with the transcription termination and polyadenylation sequence. 5 36. SEQ ID NO: 36 Nucleic acid sequence encoding construct pBPS325 [Os.CCoAMT1 promoter::Zm.ubiquitin intron::GUS (PIV2)::Os.CCoAMT1 terminator] 37. SEQ ID NO: 37 Nucleic acid sequence encoding construct pBPS331 [Os.Sl pro 10 moter::Zm.ubiquitin intron::GUS (PIV2)::NOS terminator] 38. SEQ ID NO: 38 Nucleic acid sequence encoding construct pBPSET003 [Zm.HRGP promoter::Zm.ubiquitin intron::GUS (PIV2)::Zm.HRGP terminator] 15 39. SEQ ID NO: 39 Nucleic acid sequence encoding construct pBPSET007 [Zm.LDH promoter::Zm.ubiquitin intron::GUS (PIV2)::Zm.LDH terminator] 40. SEQ ID NO: 40 Forward Primer Os.CCoAMT1 promoter-5' 20 5'-CAACTACTGCACGGTAAAAGTGATAGG -3' 41. SEQ ID NO: 41 Reverse primer Os.CCoAMTI promoter-3' 5'-GCAGCTTGCTTCGATCTCTCGCTCGCC-3' 25 42. SEQ ID NO: 42 Forward Primer Os.CCoAMT1 3'UTR-5' 5'-GCCGATGCCCAAGAACTAGTCATTTTAA-3' 43 SEQ ID NO: 43 Reverse primer Os.CCoAMT1 3'UTR-3' 5'-ATTAACACGTCAACCAAACCGCCGTCC-3' 30 44 SEQ ID NO: 44 Forward Primer OsSI promoter-5' 5'-TGCCTCGATTCGACCGTGTAATGGAAT-3' 45. SEQ ID NO: 45 Reverse primer Os.Sl promoter-3' 35 5'-ACTCCTGGCTTCCTTCCGATCTGGACT-3' 46. SEQ ID NO: 46 Forward Primer Zm.HRGP promoter-5' 5'-CCGGTGACCTTCTTGCTTCTTCGATCG-3' 40 47. SEQ ID NO: 47 Reverse primer Zm.HRGP promoter-3' 5'-CCTCTCTCTCACACACACTCTCAGTAA-3' 48. SEQ ID NO: 48 Forward primer ZmLDH promoter-5' 5'-AACAAATGGCGTACTTATATAACCACA -3' 45 49. SEQ ID NO: 49 Reverse primer ZmLDH promoter-3' 5'-CGGGCGGAATGGGATGGGATTACGTGT-3' 98 50. SEQ ID NO: 50 Forward primer Zm.HRGP 3'UTR-5' 5'-AAAGCGATGCCTACCATACCACACTGC-3' 51. SEQ ID NO: 51 Reverse primer Zm.HRGP 3'UTR-3' 5 5'-TGCCCACATTrA1TATGGTrTACACCC-3' 52. SEQ ID NO: 52 Forward Primer Zm.LDH 3'UTR-5' 5'-TGATCACATCACCGTCTCTC1TCATTAA-3' 10 53. SEQ ID NO: 53 Reverse primer Zm.LDH 3'UTR-3' 5'-TATCCCAGTCTCGATA1TGTCATCCGCT-3' 54. SEQ ID NO: 54 Forward primer Os.CP12-p FP 5'- TTTGTATTTAGGTCCCTAACGCCCTC -3' 15 55. SEQ ID NO: 55 Reverse primer Os.CP12-p RP 5'-TG1TGATGCGGATTTCTGCGTGTGAT-3' 56. SEQ ID NO: 56 Nucleic acid sequence encoding a transcription regulating nucleo 20 tide sequence from a Oryza sativa lactate dehydrogenase (Os.LDH) including the 5' untranslated region of the gene. 57. SEQ ID NO: 57 Nucleic acid sequence encoding a transcription regulating nucleo tide sequence from a Oryza sativa lactate dehydrogenase 25 (Os.LDH). 58. SEQ ID NO: 58 Nucleic acid sequence encoding the core promoter region of the transcription regulating nucleotide sequence from a Oryza sativa lactate dehydrogenase (Os.LDH) comprising clusters of promoter 30 elements. 59. SEQ ID NO: 59 Nucleic acid sequence encoding a Oryza sativa lactate dehydro genase (Os.LDH) 35 60. SEQ ID NO: 61 Amino acid sequence encoding a Oryza sativa lactate dehydro genase (Os.LDH) 61. SEQ ID NO: 61 Nucleic acid sequence encoding a transcription regulating nucleo tide sequence from a Oryza sativa lactate dehydrogenase 40 (Os.LDH) including the 5' untranslated region of the gene. 62. SEQ ID NO: 62 Nucleic acid sequence encoding a transcription regulating nucleo tide sequence from a Oryza sativa lactate dehydrogenase (Os.LDH). 45 63. SEQ ID NO: 63 Nucleic acid sequence encoding the core promoter region of the transcription regulating nucleotide sequence from a Oryza sativa 99 lactate dehydrogenase (Os.LDH) comprising clusters of promoter elements. 64. SEQ ID NO: 64 Nucleic acid sequence encoding a Oryza sativa lactate dehydro 5 genase (Os.LDH) 65. SEQ ID NO: 65 Amino acid sequence encoding a Oryza sativa lactate dehydro genase (Os.LDH) 10 66. SEQ ID NO: 66 Nucleic acid sequence encoding the transcription regulating nu cleotide sequence of Zea mays caffeoyl CoA-O-methyltransferase (Zm.CCoAMT1) gene including 5'-untranslated region 67. SEQ ID NO: 67 Nucleic acid sequence encoding the transcription regulating nu 15 cleotide sequence of Zea mays caffecyl CoA-O-methyltransferase (Zm.CCoAMTI) gene 68. SEQ ID NO: 68 Nucleic acid sequence encoding the core promoter region of the transcription regulating nucleotide sequence of Zea mays caffeoyl 20 CoA--methyltransferase (Zm.CCoAMT1) gene comprising clus ters of promoter elements. 69. SEQ ID NO: 69 Nucleic acid sequence encoding Zea mays caffeoyl CoA-O methyltransferase (Zm.CCoAMT1) 25 70. SEQ ID NO: 70 Amino acid sequence encoding Zea mays caffeoyl CoA-O methyltransferase (Zm.CCoAMT1) 71. SEQ ID NO: 71 Nucleic acid sequence encoding a function equivalent of the tran 30 scription regulating nucleotide sequence from a Zea diploperennis hydroxyproline-rich glycoprotein (HRGP) including the 5' untrans lated region of the gene. 72. SEQ ID NO: 72 Nucleic acid sequence encoding a function equivalent of the tran 35 scription regulating nucleotide sequence from a Zea diploperennis hydroxyproline-rich glycoprotein (HRGP). 73. SEQ ID NO: 73 Nucleic acid sequence encoding the core promoter region of a function equivalent of the transcription regulating nucleotide se 40 quence from a Zea diploperennis hydroxyproline-rich glycoprotein (H RGP) comprising clusters of promoter elements. 74. SEQ ID NO: 74 Nucleic acid sequence encoding the Zea diploperennis hy droxyproline-rich glycoprotein (HRGP) 45 75. SEQ ID NO: 75 Amino acid sequence encoding the Zea diploperennis hy droxyproline-rich glycoprotein (HRGP) 100 76. SEQ ID NO: 76-84 Amino acid sequence motif of a monocotyledonous plant lac tate dehydrogenase protein 77. SEQ ID NO: 85-90 Amino acid sequence motif of a monocotyledonous plant caffe 5 oyl-CaA-O-methyltransferase protein 78. SEQ ID NO: 91 Oligonucleotide primer GUS-forward: 5'-ttacgtggcaaaggattcgat-3' 10 79. SEQ ID NO: 92 Oligonucleotide primer GUS-reverse: 5'-gccccaatccagtocattaa-3 80. SEQ ID NO: 93 Oligonucleotide primer Control gene forward 5'-tctgccttgcccttgctt-3' 15 81. SEQ ID NO: 94 Oligonucleotide primer Control gene reverse 5'-caattgcttggcaggtcttattt-3' EXAMPLES 20 Materials and General Methods Unless indicated otherwise, chemicals and reagents in the Examples were obtained from Sigma Chemical Company (St. Louis, MO), restriction endonucleases were from New England Biolabs (Beverly, MA) or Roche (Indianapolis, IN), oligonucleotides were synthesized by MWG Biotech Inc. (High Point, NC), and other modifying enzymes or 25 kits regarding biochemicals and molecular biological assays were from Clontech (Palo Alto, CA), Pharmacia Biotech (Piscataway, NJ), Promega Corporation (Madison, WI), or Stratagene (La Jolla, CA). Materials for cell culture media were obtained from Gibco/BRL (Gaithersburg, MD) or DIFCO (Detroit, MI). The cloning steps carried out for the purposes of the present invention, such as, for example, restriction cleavages, aga 30 rose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to ni trocellulose and nylon membranes, linking DNA fragments, transformation of E. cofl cells, growing bacteria, multiplying phages and sequence analysis of recombinant DNA, are carried out as described by Sambrook (1989). The sequencing of recombi nant DNA molecules is carried out using ABI laser fluorescence DNA sequencer follow 35 ing the method of Sanger (Sanger 1977). For generating transgenic plants Agrobacteium tumefaciens (strain C58C1[pMP90]) is transformed with the various promoter::GUS vector constructs (see below). Resulting Agrobacterium strains are subsequently employed to obtain transgenic plants. For this 40 purpose a isolated transformed Agrobactefium colony is incubated in 4 mL culture (Medium: YEB medium with 50 pg/mL Kanamycin and 25 pg/mL Rifampicin) over night at 28'C. With this culture a 400 ml culture of the same medium is inoculated and incu bated over night (28 "C, 220 rpm). The bacteria a precipitated by centrifugation (GSA Rotor, 8,000 U/min, 20 min) and the pellet is resuspended in infiltration medium (1/2 45 MS-Medium; 0,5 g/L MES, pH 5,8; 50 g/L sucrose). The suspension is placed in a plant box (Duchefa) and 100 mL SILVET L-77 (Osi Special-ties Inc., Cat. P030196) are added to a final concentration of 0.02%. The plant box with 8 to 12 Plants is placed into 101 a desiccator for 10 to 15 min. under vacuum with subsequent, spontaneous ventilation (expansion). This process is repeated 2-3 times. Thereafter all plants are transferred into pods with wet-soil and grown under long daytime conditions (16 h light; day tem perature 22-24 0 C, night temperature 19 0 C; 65% rel. humidity). Seeds are harvested 5 after 6 weeks. EXAMPLE 1. Isolation of promoters Genomic DNA from maize and rice is extracted using the Qiagen DNAeasy Plant Mini Kit (Qiagen). The promoter regions were isolated from genomic DNA using conven 10 tional PCR. Approximately 0.1 pg of digested genomic DNA was uses for the regular PCR reaction (see below). The primers were designed based on the maize or rice ge nomic DNA sequences upstream of the EST candidates, maize genomic sequences, or promoter sequences disclosed in the public database (e.g. rice caffeoyl CoA-O- me thyltransferase [CCoAMT1], GenBank accession number AB023482; rice unknown 15 protein, GenBank accession number AP002818; maize hydroxyproline-rich glycopro tein [HRGP], GenBank accession number AJ131535; maize lactate dehydrogenase [LDH], GenBank accession number ZI 1754). One gL of the diluted digested genomic DNA was used as the DNA template in the primary PCR reaction. The reaction com prised forward (5') and reverse (3') primers in a mixture containing Buffer 3 following 20 the protocol outlined by an Expand Long PCR kit (Cat #1681-842, Roche-Boehringer Mannheim). The isolated DNA is employed as template DNA in a PCR amplification reaction using the following primers: Table 3. Primer sequences for isolation of the promoter or terminator region Promoter or Ter- Size (bp) Primer Sequences minator* Forward Primer (F) & Reverse Primer (R) Oryza sativa 1,035 F: 5'-CAACTACTGCACGGTAAAAGTGATAGG-3' Caffeoyl-CoA-O- (SEQ ID NO: 40) methyltransferase Promoter R: 5'-GCAGCTTGCTTCGATCTCTCGCTCGCC-3' (Os.CCoAMT1-p) (SEQ ID NO: 41) Oryza sativa 1,092 FP: 5'-GCCGATGCCCAAGAACTAGTCATTTTA-3' Caffeoyl-CoA-0- (SEQ ID NO: 42) methyltransferase Terminator RP: 5'ATTAACACGTCAACCAAACCGCCGTCC-3' (Os.CCoAMT1-t) (SEQ ID NO: 43) Oryza sativa 813 FP: 5'-TGCCTCGATTCGACCGTGTAATGGAAT-3' C-8,7-sterol- (SEQ ID NO: 44) isomerase Promoter RP: 5'-ACTCCTGGCTTCCTTCCGATCTGGACT-3' (Os.SI-p) (SEQ ID NO: 45) Zea maize 1,263 FP: 5'-CCGGTGACCTTCTTGCTTCTTCGATCG-3' Hydroxyproline-rich (SEQ ID NO: 46) glycoprotein Pro moter RP: 5'-CCTCTCTCTCACACACACTCTCAGTAA-3' (Zm.HRGP-p) (SEQ ID NO: 47) Zea maize 541 FP: 5'-AAAGCGATGCCTACCATACCACACTGC-3' Hydroxyproline-rich (SEQ ID NO: 50) glycoprotein Ter- RP: 5'-TGCCCACATTTATTATGGTTTrACACCC-3' (Zm.HRGP-t) (SEQ ID NO: 51) 102 Promoter or Ter- Size (bp) Primer Sequences minator* Forward Primer (F) & Reverse Primer (R) Zea maize 1,061 FP: 5'-AACAAATGGCGTACTTATATAACCACA-3' Lactate- (SEQ ID NO: 48) dehydrogenase promoter RP: 5'-CGGGCGGAATGGGATGGGATTACGTGT-3' (Zm.LDH-p) (SEQ ID NO: 49) Zea maize 475 FP: 5'-TGATCACATCACCGTCTCTCTTCATTAA-3' Lactate- (SEQ ID NO: 52) dehydrogenase terminator RP: 5'-TATCCCAGTCTCGATATTGTCATCCGCT-3' (Zm.LDH-t) (SEQ ID NO: 53) Oryza sativa 998 FP: 5'- TTGTATTTAGGTCCCTAACGCCCTC -3' Chloroplast protein (SEQ ID NO:) 12 Promoter (Os.CP12-p) RP: 5'-TGTTGATGCGGATTTCTGCGTGTGAT-3' (SEQ ID NO:) terminator including 3'UTR The promoter regions are amplified in the reaction solution [1 x PCR reaction buffer (Roche Diagnostics), 5 gL genomic DNA (corresponds to approximately 80 ng, 2.5 mM 5 of each dATP, dCTP, dGTP and dTTP (Invitrogen: dNTP mix), 1 RL 5' primer (100 [tM) 1 [iL 3' primer (100 IM), 1 pL Taq DNA polymerase 5 U/pL (Roche Diagnostics), in a final volume of 100 pLL] under the optimized PCR thermocycler program (T3 Thermocy cler Biometra; I cycle with 180 sec at 95"C, 30 cycles with 40 sec at 95*C, 60 sec at 53"C and 2 min at 720C, and I cycle with 5 min at 72"C before stop the reaction at 10 4"C). The PCR product was applied to a 1% (w/v) agarose gel and separated at 80V fol lowed by excising from the gel and purified with the aid of the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany). If appropriate, the eluate of 50 pL can be evaporated. The 15 PCR product was cloned directly into vector pCR4-TOPO (Invitrogen) following the manufacturer's instructions, ie. the PCR product obtained is inserted into a vector hav ing T overhangs with its A overhangs and a topoisomerase. 20 EXAMPLE 2. Isolation of terminator of interest including the 3' untranslated region Rice genomic DNA fragment (1,092 bp) containing the 3' untranslated region of caffe oyl CoA-O-methyltransferase (Os.CCoAMT1) was isolated using sequence specific 25 primers based on the sequences that disclosed in the public database (GenBank ac cession number AB023482). The protocols for plant genomic DNA isolation and con ventional PCR amplification was described in the Example 1. Forward Primer OsCCoAMTI 3'UTR-5': 30 5'-GCCGATGCCCAAGAACTAGTCATTTTA-3' (SEQ ID NO: 42) Reverse primer OsCCoAMT1 3'UTR-3' 5'-ATTAACACGTCAACCAAACCGCCGTCC-3' (SEQ ID NO: 43) 103 Sad for the forward primer and Pmel for the reverse primer were added to the se quence-specific primers for the further cloning purpose. (The illustrated primer se quences do not include restriction enzyme sites.) 5 Rice genomic DNA fragement, 519 bp or 473 bp, containing the 3' untranslated region of HRGP or LDH gene was isolated, respectively using sequence specific primers based on the sequences that disclosed in the public database (GenBank accession number AJ131535; Z11754). The protocols for plant genomic DNA isolation and con ventional PCR amplification using sequence specific primers was described in the Ex 10 ample 1. Sad for the forward primer and Pmel for the reverse primer were added to the se quence-specific primers for the further cloning purpose. (The illustrated primer se quences do not include restriction enzyme sites.) 15 EXAMPLE 3. Vector construction 3.1 pUC based vector (promoter of interest::intron (IME)::GUS::NOS or termi 20 nator of interest) The base vector to which the intron candidates were cloned in was pBPSMM270 at Bgi and Xmal. This vector comprises multiple cloning sites (MCS) followed by Zm.ubiquitin intron, the GUSint ORF (including the potato invertase [PIV]2 intron to prevent bacterial expression), and nopaline synthase (NOS) terminator in order (5' to 25 3'). Maize ubiquitin intron can be replaced with an intron of interest that functions in intron-mediated enhancement. The PCR fragment containing terminator of interest (e.g. 1,092 bp rice genomic DNA including CCoAMT1 terminator; 558 bp maize genomic DNA including HRGP termina 30 tor, 477 bp maize genomic DNA including LDH terminator) was digested with Sad and Pmel enzymes. Nopaline synthase terminator region in pBPSMM270 was replaced with the CCoAMT1 terminator, HRGP terminator or LDH terminator resulting in pBPSMM270a, pBPSMM270-HRGP3' or pBPSMM270-LDH3', respectively. 35 The genomic DNA fragment containing Os.CCoAMT1 or Os.Sl promoter in the Topo vector (Invitrogen) was digested with Pa and Asdi followed by subcloned upstream of the Zm.ubiquitin intron in pBPSMM270, respectively. The genomic DNA fragment containing CCoAMT1 promoter in the Topo vector (Invitro 40 gen) was digested with Pacl and AscI followed by subcloned upstream of the Zm.ubiquitin intron in pBPSMM270-CCoAMT1 3', respectively. The genomic DNA fragment containing Zm.HRGP or Zm.LDH promoter in the Topo vector (Invitrogen) was digested with Pecl and Ascl followed by subcloned upstream of 45 the Zm.ubiquitin intron in pBPSMM270-HRGP3' or pBPSMM270-LDH3', respectively.
104 3.2 Transformation binary vector (promoter of interest::intron (IME)::GUS::NOS or terminator of interest) The GUS chimeric cassette (Os.CCoAMT1 promoter::Zm.ubiquitin intron::GUS (PIV2)::CCoAMT1 terminator, Zm.CCoAMT1 promoter::Zm.ubiquitin intron::GUS 5 (PIV2)::NOS, Os.SI promoter::Zm.ubiquitin intron::GUS (PIV2)::NOS, Zm.HRGP pro moter::Zm.ubiquitin intron::GUS (PIV2)::Zm.HRGP terminator, or Zm.LDH pro moter::Zm.ubiquitin intron::GUS (PIV2)::Zm.LDH terminator ) in pUC-based vector were digested with Ascl or Pacl (5') and Pmel (3') and subcloned into a monocot binary vector containing a plant selectable marker cassette (pBPSMM344) at AscI or Pacl (5') 10 and PmlI (3') sites to generate pBPSMM325, pBPSMM271, pBPSMM331, pBPSET003, or pBPSET007, respectively. EXAMPLE 4. Agrobacterium-mediated transformation in monocotyledonous plants 15 The Agrobactendum-mediated plant transformation using standard transformation and regeneration techniques may also be carried out for the purposes of transforming crop plants (Gelvin 1995; Glick 1993). The transformation of maize or other monocotyledonous plants can be carried out us 20 ing, for example, a technique described in US 5,591,616. The transformation of plants using particle bombardment, polyethylene glycol-mediated DNA uptake or via the silicon carbonate fiber technique is described, for example, by Freeling & Walbot (1993) "The maize handbook" ISBN 3-540-97826-7, Springer Verlag 25 New York). EXAMPLE 5. Detection of reporter gene expression To identify the characteristics of the promoter and the essential elements of the latter, which bring about its tissue specificity, it is necessary to place the promoter itself and 30 various fragments thereof before what is known as a reporter gene, which allows the determination of the expression activity. An example, which may be mentioned, is the bacterial P-glucuronidase (Jefferson 1987a). The p-glucuronidase activity can be de tected in-planta by means of a chromogenic substrate such as 5-bromo-4-chloro-3 indolyl-p-D-glucuronic acid in an activity staining (Jefferson 1987b). To study the tissue 35 specificity, the plant tissue is cut, embedded, stained and analyzed as described (for example Bdumlein 1991b). A second assay permits the quantitative determination of the GUS activity in the tissue studied. For the quantitative activity determination, MUG (4-methylumbeliferyl-p-D 40 glucuronide) is used as substrate for f-glucuronidase, and the MUG is cleaved into MU (methylu mbell iferone) and glucuronic acid. To do this, a protein extract of the desired tissue is first prepared and the substrate of GUS is then added to the extract. The substrate can be measured fluorimetrically only 45 after the GUS has been reacted. Samples which are subsequently measured in a fluorimeter are taken at various points in time. This assay may be carried out for exam- 105 pie with linseed embryos at various developmental stages (21, 24 or 30 days after flowering). To this end, in each case one embryo is ground into a powder in a 2 mL reaction vessel in liquid nitrogen with the aid of a vibration grinding mill (Type: Retsch MM 2000). After addition of 100 pL of EGL buffer (0.1 M KPO 4 , pH 7.8; 1 mM EDTA; 5 5% glycerol; I M DTT), the mixture is centrifuged for 10 minutes at 25"C and 14,000 x g. The supernatant is removed and recentrifuged. Again, the supernatant is transferred to a new reaction vessel and kept on ice until further use. 25 pL of this protein extract are treated with 65 pL of EGL buffer (without DTT) and employed in the GUS assay. 10 jL of the substrate MUG (10 mM 4-methylumbelliferyl-p-D-glucuronide) are now 10 added, the mixture is vortexed, and 30 gL are removed immediately as zero value and treated with 470 gL of Stop buffer (0.2 M Na 2
CO
3 ). This procedure is repeated for all of the samples at an interval of 30 seconds. The samples taken were stored in the refrig erator until measured. Further readings were taken after 1 h and after 2 h. A calibration series which contained concentrations from 0.1 mM to 10 mM MU (4 15 methylumbelliferone) was established for the fluorimetric measurement. If the sample values were outside these concentrations, less protein extract was employed (10 gL, 1 gL, 1 tiL from a 1:10 dilution), and shorter intervals were measured (0 h, 30 min, I h). The measurement was carried out at an excitation of 365 nm and an emission of 445 nm in a Fluoroscan 1i apparatus (Labsystem). As an alternative, the substrate cleavage 20 can be monitored fluorimetrically under alkaline conditions (excitation at 365 nm, measurement of the emission at 455 nm; Spectro Fluorimeter BMG Polarstar+) as de scribed in Bustos (1989). All the samples were subjected to a protein concentration determination by the method of Bradford (1976), thus allowing an identification of the promoter activity and promoter strength in various tissues and plants. 25 EXAMPLE 6. Constitutive expression in maize 6.1 Rice CCoAMTI-promoter::Zmubiquitin-intron::GUS::CCoAMTI terminator (pBPSMM325) CCoAMT1 promoter in combination with CCoAMT1 terminator shows strong constitu 30 tive and ubiquitous expression in all tissues and organs at different developmental stages. Strong ubiquitous expression can also be detected in in vitro plants. Table 4. GUS expression controlled by monocot constitutive promoter candidates Tissues/Developmental Promoter (GUS expression levels) stages pBPSMM232* pBPSMM247* pBPSMM272 pBPSMM325 3 days after co-cultivation +++ +++ ++ ++ Leaves at 5-leaf stage ++++. .+++++ ++++ ++++ Roots at 5-leaf stage +++++u ... +++++ ++ + Leaves at flowering stage .. + .++ ++++ ++ Stem +++ +++ ++ +++ Pre-pollination ++++ +++++ +++ ++ 5 days after pollination [DAP] +++..++ + (7 DAP) ++++ (7 DAP) ND 30 DAP +++++ +++ .++++ ++ Dry seeds ND +++ ND ++ Imbibition/germination +++++ -++++.. +++ ND *Posiive controls as a constitutive promoter (pBPSMM232=Zm.ubiquitin promoter::Zm.ubiquitin intron::GUS (PIV2)::NOS terminator; pBPSMM247=sugarcane bacilliform virus promoter:GUS 35 (PIV2) ::NOS terminator); a range of GUS expression levels measured by histochemical assay (- to +++++-), ND: not determined yet 106 EXAMPLE 7. Root and kernel preferable expression in maize 7.1 Rice Os.CCoAMT1 promoter::Zm.ubiquitin intron::GUS (PIV2)::NOS terminator Caffeoyl-CoA-O-methyltransferase (CCoAMT1) promoter::ubiquitin-intron::NOS termi nator (pBPSMM271) showed low expression in leaves and stem of T1 plants but strong 5 expression in roots. GUS stain was also detected in kernel and pollen. 7.2 Rice SI promoter::Zm.ubiquitin intron::GUS (PIV2)::NOS terminator OsC-8,7-sterol-isomerase promoter::Zm.ubiqu itini ntron:: NOS terminator (pBPSMM331) showed weak expression in most parts of the plants but good expression in roots and 10 kernels. 7.3 Maize HRGP promoter::Zm.ubiquitin intron::GUS (PIV2)::HRGP terminator HRGP promoter containing the ubiquitin intron and the HRGP termiantor (pBPSET003) showed no expression in leaves but strong expression in roots and silk. In kernels ex 15 pression is predominantly in the embryo and only weak in the endosperm. 7.4 Maize LDH promoter::Zm.ubiquitin intron::GUS (PIV2)::NOS or LDH terminator Lactate-dehydrogenase (LDH) promoter::Zm. ubiquitinintron::NOS or LDH terminator (pBPSMM272 or pBPSET007, respectively) showed weak expression in leaves but 20 good expression in roots and kernels. Table 5. GUS expression controlled by monocot root and kernel-preferable promoter candidates Tissues & Devel- Promoter (GUS expression levels) opmental stages pBPSMM232 T pBPSMM271 pBPSMM331 pBPSET003 pBPSMM272 or pBPSET007 3 days after co- ++ + ND ND +++ cultivation Leaves at 5-leaf +++++ + + ++ stage Roots at 5-leaf ++++. ++++*++ +++ stage Leaves at flowering + ++++ + ++ - ++ stage Stem +++ + ND ND + Pre-pollination +++++ +++ ++++ ND +++ 5 days after pollina- +++++ ++ ND ND +++ tion [DAP] 30 DAP ++++ +++ ++ ++ ++ Dry seeds ND ND ND ND ND Imbibi- +++++ +++ ND ND + tion/germination t_ 2 _ *positive control as a constitutive promoter (pBPSMM232=Zm.ubiquitn promoter::Zm.ubiquitin 25 intron::GUS (PIV2)::NOS terminator); a range of GUS expression levels measured by histo chemical assay (- to ++++), ND: not determined yet 107 EXAMPLE 8. Leaf and endosperm preferable expression in maize Os.CP12 promoter::Zm. ubiquitin intron::GUS (PIV2)::NOS terminator (pBPSMM304) showed strong expression in leaves and endosperm, but not in roots or embryo. Table 6. GUS expression controlled by leaf and endosperm-preferable monocot promoter Tissues/Developmental stages Promoter (GUS expression levels) pBPSMM232* pBPSMM304 3 days after co-cultivation ++++ + In vitro leaves ++++ ++ In vitro roots +++++ Leaves +++++ ++ Roots +++++ Kemel pro-pollination +++++ + Kernel 30 DAP - Endosperm +++++ ++ Kernel 30 DAP - Embryo +++ Dry seeds ++ ND 5 *positive control as a constitutive promoter (pBPSMM232=Zm.ubiquitin pro moter::Zm.ubiquitin intron::GUS (PIV2)::NOS terminator); a range of GUS expression levels measured by histochemical assay (- to +++++), ND: not determined yet EXAMPLE 9. Analysis of drought-inducible expression using real time RT 10 PCR analysis Young maize plants were grown from seeds in the greenhouse under standard condi tions. When plants had five true leaves (5-leaf stage) water was withheld from the drought-stress plants while watering continued for the water control plants. The 0 timepoint is taken at the last watering day. After that the first time point is taken when 15 the soil is dry but plants don't show symptoms of drought yet (approximately 3 days), the second time point is taken when at least one leaf of every plant shows "rolling" (mild symptoms, approximately 5 days) and the last time point is taken when all leaves show "rolling" (severe symptoms, approximately 7 days). 20 Expression levels of the reporter gene was measured at the mRNA levels using a Ge neAmp 5700 Sequence Detection System (Applied Biosystems). Total nucleic acids were extracted from maize leaf samples taken at various time points during the drought stress experiments using the Wizard Magnetic 96 DNA plant System kit (Promega, FF3661). Subsequently, DNA was removed from the samples using the DNA-free kit 25 (Ambion, #1906). The resulting DNA-free RNA solution was used in subsequent PCR reactions. The one-batch RT/quantitative PCR reactions for expression analysis con tained: 10 pL RNA solution 30 15 pL SYBR Green master Mix (2X; Eurogentec #RTSNRT032X-1) 0.15 pL reverse transcriptase + inhibitors mix (Eurogentec #RTSNRT032X-1) 0.6 pL forward primer (10 pmol/pL) 0.6 RL reverse primer (10 pmol/pL) 3.65 pL sterile water 108 The PCR program was: 1 cycle 48 0 C for 30 min (RT reaction) 40 cycles 90*C for 10 min; 954C for 15 sec and 60"C for 1 min 5 The amplification was followed by a dissociation protocol: 95 0 C for 15 sec, 60 0 C for 20 sec 20 min slow ramp from 60 C to 95 0 C. Table 7. Primer sequences of the GUS gene and control gene encoding microtubule 10 associated protein light chain 3 Gene Primers SEQ ID Fwd: 5'-ttacgtggcaaaggattcgat SEQ ID NO: 91 GUS Rev: 5'-gccccaatccagtccattaa SEQ ID NO: 92 Fwd: 5'-tctgccttgcccttgctt SEQ ID NO: 93 Control gene Rev: 5'-caattgcttggcaggtcttattt SEQ ID NO: 94 For each timepoint of the drought-stress experiment RNA solution of each sample was used in two qPCR reactions that were run at the same time on the same plate. One reaction contained the GUS primers the second reaction contained primers for an en 15 dogenous control gene from maize. This endogenous control gene shows stable ex pression under stress conditions in a variety of tissues. The preset baseline and threshold of the GeneAmp 5700 software were used in all experiments to generate raw data (cycle numbers). In order to normalize the values 20 obtained with the GeneAmp 5700 Sequence Detection System the values of the en dogenous primer reactions were subtracted from the values of the GUS primer reac tions. The difference in cycle numbers was then used to calculate the change of ex pression levels. As templates are exponentially amplified during PCR one cycle differ ence equals a two-fold difference in template levels. Results are shown as an x-fold 25 induction compared to the 0-timepoint that is set to 1. 9.1 Drought-inducible expression controlled by maize LDH promoter In T1 plants containing a single copy shows strong constitutive expression in roots and in kernels. Expression in leaves and stem at different developmental stages was weak. 30 Upon drought-stress expression in leaves was induced two-fold compared to well watered control. EXAMPLE 10. Utilization of transgenic crops A reporter gene in pBPSMM325 can be replaced with gene of interest to express in a 35 constitutive and ubiquitous manner, a reporter gene in pBPSMM271, pBPSMM331, pBPSET003, and pBPSET007 can be replaced with gene of interest to express mostly in roots and kernel, a reporter gene in pBPSMM304 can be replaced with gene of in terest to express mostly in leaves and endosperm (e.g., by antisense or double stranded RNA), thereby improving - for example - biomass and/or yield, or tolerant to 40 biotic and abiotic environmental stresses. The chimeric constructs are transformed into monocotyledonous plants. Standard methods for transformation in the art can be used if required. Transformed plants are regenerated using known methods. Various pheno- 109 types are measured to determine improvement of biomass, yield, fatty acid composi tion, high oil, disease tolerance, or any other phenotypes that link yield enhancement or stability. Gene expression levels are determined at different stages of development and at different generations (To to T 2 plants or further generations). Results of the evalua 5 tion in plants lead to determine appropriate genes in combination with this promoter to increase yield, improve disease tolerance, and/or improve abiotic stress tolerance. EXAMPLE 11. Expression of selectable marker gene in monocotyledonous plants 10 A reporter gene in pBPSMM325 can be replaced with a selectable marker gene and transformed into monocotyledonous plants such as rice, barley, maize, wheat, or rye grass but is not restricted to these plant species. Any methods for improving expres sion in monocotyledonous plants are applicable such as addition of intron or exon with intron in 5'UTR either non-spliced or spliced. Standard methods for transformation in 15 the art can be used if required. Transformed plants are selected under the selection agent of interest and regenerated using known methods. Selection scheme is exam ined at early developmental stages of tissues or tissue culture cells. Gene expression levels can be determined at different stages of development and at different genera tions (To to T 2 plants or further generations). Results of the evaluation in plants lead to 20 determine appropriate genes in combination with this promoter. EXAMPLE 12. Expression of transgene for root vigor in monocotyledonous plants A reporter gene in pBPSMM271, pBPSMM331, pBPSET003, pBPSMM272, and 25 pBPSET007 can be replaced with gene of interest to express mostly in roots, which affects root architecture and transformed into monocotyledonous plants such as rice, barley, maize, wheat, or ryegrass but is not restricted to these plant species. Any methods for improving expression in monocotyledonous plants are applicable such as addition of intron or exon with intron in 5'UTR either non-spliced or spliced. Standard 30 methods for transformation in the art can be used if required. Transformed plants are selected under the selection agent of interest and regenerated using known methods. Selection scheme is examined at early developmental stages of tissues or tissue cul ture cells. Gene expression levels can be determined at different stages of develop ment and at different generations (To to T 2 plants or further generations). Results of the 35 evaluation in plants lead to determine appropriate genes in combination with this pro moter. EXAMPLE 13. Expression of transgene for feed and food in monocotyledonous plants 40 A reporter gene in pBPSMM271, pBPSMM331, pBPSET003, pBPSMM272, pBPSET007, and pBPSMM304 can be replaced with gene of interest to express mostly in kernel, which improve nutrition in embryo and endosperm and transformed into monocotyledonous plants such as rice, barley, maize, wheat, or ryegrass but is not restricted to these plant species. Any methods for improving expression in monocotyle 45 donous plants are applicable such as addition of intron or exon with intron in 5'UTR either non-spliced or spliced. Standard methods for transformation in the art can be 110 used if required. Transformed plants are selected under the selection agent of interest and regenerated using known methods. Selection scheme is examined at early devel opmental stages of tissues or tissue culture cells. Gene expression levels can be de termined at different stages of development and at different generations (To to T 2 plants 5 or further generations). Results of the evaluation in plants lead to determine appropri ate genes in combination with this promoter. EXAMPLE 14. Deletion analysis The cloning method is described by Rouster (1997) and Sambrook (1989). Detailed 10 mapping of these promoters (i.e., narrowing down of the nucleic acid segments rele vant for its specificity) is performed by generating various reporter gene expression vectors which firstly contain the entire promoter region and secondly various fragments thereof. Firstly, the entire promoter region or fragments thereof are cloned into a binary vector containing GUS or other reporter gene. To this end, fragments are employed 15 firstly, which are obtained by using restriction enzymes for the internal restriction cleav age sites in the full-length promoter sequence. Secondly, PCR fragments are employed which are provided with cleavage sites introduced by primers. The chimeric GUS con structs containing various deleted promoters are transformed into Zea mays, Arabidop sis and other plant species using transformation methods in the current art. Promoter 20 activity is analyzed by using GUS histochemical assays or other appropriate methods in various tissues and organs at the different developmental stages. Modification of the promoter sequences can eliminate leakiness based on our needs. EXAMPLE 15. In vivo mutagenesis 25 The skilled worker is familiar with a variety of methods for the modification of the pro moter activity or identification of important promoter elements. One of these methods is based on random mutation followed by testing with reporter genes as described above. The in vivo mutagenesis of microorganisms can be achieved by passage of the plas mid (or of another vector) DNA through E. coli or other microorganisms (for example 30 Bacillus spp. or yeasts such as Saccharomyces cerevisiae) in which the ability of main taining the integrity of the genetic information is disrupted. Conventional mutator strains have mutations in the genes for the DNA repair system (for example mutHLS, mutD, mutT and the like; for reference, see Rupp 1996). The skilled worker is familiar with these strains. The use of these strains is illustrated for example by Greener (1994). 35 The transfer of mutated DNA molecules into plants is preferably effected after selection and testing of the microoganisms. Transgenic plants are generated and analyzed as described above. EXAMPLE 16. PLACE Analysis for Os.CCoAMT1 Promoter (SEQ ID NO: 1) 40 Based on the below given PLACE results are potential TATA box is localized at base pair 952 to base pair 958 of SEQ ID NO: 1. In consequence the 5' untranslated region starts at about base pair 993 and extends to base pair 1,035 of SEQ ID NO: 1. The sequence described by SEQ ID NO: 2 ends 17 base pairs before the ATG start codon. 45 The following clusters of promoter elements were identified in the Os.CCoAMT1 pro moter as described by SEQ ID NO: 1: 111 IUPAC fomito Sty. Sequence LTRECOREATCOR15 33-39 (-) TCCGACC TATABOX3 45-51 (+) TATTAAT CCAATBOXI 86-90 (-) CCAAT SEFIMOTIF 99-107 (+) ATATTTATA TATAPVTRNALEU 101 - 113 (+) TTTATATATTAA TATABOX2 10 1-107 ) TATAAAT TATABOX4 103-109 ) TATATAA WBOXATNPR1 132 - 146 ) ATTGACGTCGAATTG HEXMOTIFTAH3H4 135 - 147 () TTCGACGTCAATA TGACGTVMAMY 137-149 ) TCTATTGACGTCG CGACGOSAMY3 137-141 (+) CGACG ACGTCBOX 138-143 (+) GACGTC ACGIClBX 138-143 ()GACGTC BOXIINTPATPB 145-150 (+) ATAGAA SP8BFIBSP8AIB 169- 176 (-) ACTGTGTA CIACADIANLELHC 190 - 199 (-) CAATAATATC S1FBOXSORPSIL21 221 -226 (+) TGGTA ABRELATERDI 226 - 238 (+) ATCAACGTGATCG CIACADIANLELHC 228 - 237 (+) CAACGTGATC BPSOSWX 228 - 234 (+) CAACGTG MYBSTJ 267 - 273 (+) GGGATAT ABRELATERD1 307-319 (-) TAAAACGTGTGCT QARBNEXTA 310-316 ) AACGTGT CCAATBOX1 325 - 329 (I) CCAAT SEF3MOTIFGM 333-338 (+) AACCCA rATABOXOSPAL 360-366 (+) TATTTAA TAAIX2 366 - 372 (-) TATAAAT QELEMENTZMZM13 375 - 389 () CAGGTCACGAATTCA WBOXHVISO1 386 - 400 (+) CCTGACTCACTCACA GCN40SGLUBI 387 - 395 () GTGAGTCAG WBOXHVISO1 413-427 (-) GGTGACTGAGACAAA SEBFCONSSTPR10A 414 - 420 (+) TTGTCTC ARFAT 415-420 (+) TGTCTC IBOXCORENT 449 - 455 (+) GATAAGG IBOXCORE 456 - 462 (-) GATAAAC MY.|BSTJ 458 - 464 (-) AGGATAA CGACGOSAMY3 471 - 475 (+) CGACG HEXAMERATH4 471 - 476 () CCGTCG IBOXCORE 475 - 481 () GATAACC IBOXCORE 527-533 (+) GATAAAG rAAGSTKST1 527-533 (+)GATAAAG NTBBF1ARROLB 528 - 534 () CTTTAT MYB2AT 543 - 553 (+) GTTTTAACTGC PALBOXLPC 576 - 586 (+) CCTCACCAACC MYBPLANT 579 - 589 (+) CACCAACCTTC MYBPZM 581 -586 (+) CCAACC 112 IUPAC P to Str. Sequence A8EAT 608-613 (+) TGTCTC AGCBOXNPGLB 623 - 629 (+) AGCCGCC RAV1BAT 653 - 665 (+) ACGCACCTGGCGG ABRELATERDI 689 -701 (+) GAAGACGTGGAGG CCAATBOX1 730 -734 (+) CCAAT PALBOXAPC 737 - 742 (+) CCGTCC MY1AI 768-773 () AAACCA PALBOXLPC 774 - 784 (+) CCTCACCAACC MYlPLAT 777 - 787 (I) CACCAACCCAA MY BZM 779 - 784 () CCAACC SEF3MOTIFGM 781 -786 (+) AACOCA CAREOSREP1 785 -790 (+) CAACTC BOXCPSASI 816-822 (+) CTCCCAC GCBP2ZMGAPC4 831 - 839 (-) GTGGGCCCG RAV1BAT 834 - 846 (+) GCCCACCTGTCGG DRECRTCOREAT 841 - 847 (-) GCCGACA CCA1ATLHCB1 880 -887 (-) AAAAATCT PYRIMIDINEBOXHVEPB 883 - 890 () TTTTTTCC MYCATERD1 920 - 926 (-) CATGTGA MYCATRD22 921 - 927 (+) CACATGC BOXCPSASI 932 -938 (+) CTCCCAC TATAPVTRNALEU 948 -960 (-) GTTTATATAGCGC TATABOX4 952 - 958 (+) TATATAA CGACGOSAMY3 970 -974 (-) CGACG DRECRTCOREAT 981 - 987 (-) GCCGACG CGACGOSAMY3 981 - 985 (-) CGACG WBOXATNPR1 982 -996 (- ATGACTTCGCCGAC Example 17. PLACE Analysis for Os.Sl Promoter (SEQ ID NO: 6) Based on the below given PLACE results, no conventional TATA box has been found in this promoter region (797 bp). The following clusters of promoter elements were identified in the Zm.Sl promoter as described by SEQ ID NO: 6: 5 IUPAC Fomito Str. Sequence TBOXATGAPB 66-71 (+) ACTTTG RAV1AAT 96-100 (+) CAACA CATATGGMSAUR 113- 118 (+) CATATG CATATGGMSAUR 113-118 (-) CATATG -300ELEMENT 127- 135 (+) TGCAAAATC POLLEN2LELAT52 159- 167 (-) TCCACCATA CGACGOSAMY3 259 - 263 (+) CGACG HEXAMERATH4 259 - 264 (-) CCGTCG CGACGOSAMY3 288 - 292 (+) CGACG HEXAMERATH4 288 - 293 (- CCGTCG 113 IUPAC FPositio Str. Sequence GCCCORE 384 - 390 (-) CGCCGCC GCCCORE 387 - 393 (-) CGCCGCC GCCCORE 390 - 396 (-) TGCCGCC GRAZMRAB28 390 - 398 (-) CATGCCGCC DRECRTCOREAT 397 - 403 (-) GCCGACA GCCCORE 401 - 407 (-) CGCCGCC BS1EGCCR 422 - 427 (+) AGCGGG CGACGOSAMY3 434 - 438 (+) CGACG HEXAMERATH4 434 - 439 (-) CCGTCG GCCORE 450 - 456 (-) CGCCGCC DRECRTCOREAT 456 - 462 (-) GCCGACC MYBPZM 552 - 557 (-) CCAACC CGACGOSAMY3 559 - 563 (+) CGACG SEF3MOTIFGM 593 - 598 (-) AACCCA LRENPCABE 607-619 (-) GCCGACGTGGCAT ABREOSRAB21 608 - 620 (i) TGCCACGTCGGCC DRECRTCOREAT 613 - 619 (-) GCCGACG CGACGOSAMY3 613-617 (-) CGACG TAAAGSTKSTI 634 - 640 (-) GTTAAAG MYBGAHV 637 - 643 (+) TAACAAA QELEMENTZMZM13 672 - 686 (-) TAGGTCAATGCCTCA ELRECOREPCRPI 678 - 692 (+) ATTGACCTACCTTGG MYBPZM 683 - 688 (+) CCTACC LTRECOREATCOR15 733 - 739 (+) CCCGACG CGACGOSAMY3 735-739 (+) CGACG CCAATBOXI 756 - 760 (+) CCAAT EXAMPLE 18. PLACE Analysis for Zm.HRGP Promoter (SEQ ID NO: 11) Based on the below given PLACE results are potential TATA box is localized at base pair 1,071 to base pair 1,077 of SEQ ID NO: 11. In consequence the 5' untranslated 5 region starts at about base pair 1,112 and extends to base pair 1,182 of SEQ ID NO: 11. The sequence described by SEQ ID NO: 11 end just before the ATG start codon. The following clusters of promoter elements were identified in the Zm.HRGP promoter as described by SEQ ID NO: 11: 10 IUPAC Position Str. Sequence _______ _______ _______ ______ from - toSe uec ACGTCBOX 30-35 (+) GACGTC ACGTCBOX 30-35 (-) GACGTC CGACGOSAMY3 32-36 (-) CGACG BOXIINTPATPB 95- 100 A) TAGAA CGACGOSAMY3 138- 142 (+) CGACG HEXAMERATH4 138- 143 (-) CCGTCG MYBPZM 146-151 (+)CCAACC 114 IUPAC Positio Str. Sequence GTICORE 167-177 (+) CGGTTAAATAG TATABOXOSPAL 170 - 176 (-) TATTTAA CGACGOSAMY3 179 - 183 (+) CGACG HEXAMERATH4 179-184 (-)CCGTCG MYCATERD1 223 - 229 (-) CATGTGC MYCATRD22 224 - 230 (+) CACATGC NTBBF1ARROLB 238 - 244 () ACTTTAT TAAAGSTKSTI 239 - 245 ) TATAAAG TATABOX2 242 - 248 (+) TATAAAT IBOXCORE 276 - 282 () GATAATA REBETALGLHCB21 291 - 297 (+) CGGATAG IOXCORE_ 296 - 302 (-) GATAACT IBOXCORE 325 - 331 (+) GATAACT NTBBFIARROLB 329 - 335 (+) ACTTTAT TAAAGSTKST1 330 - 336 ) TATAAAG TATABOX2 333-339 () TATAAAT GCCCORE 358-364 ) TGCCGCC ABRELATERD1 366-378 (-) GCAGACGTGTGCG BOXIINTPATPB 409 - 414 () ATAGAA LTRECOREATCOR15 429-435 (+) TCCGACC ASF1MOTIFCAMV 447 -459 (+) GACATTGACGGAT WBOXATNPR1 450 - 464 (+) ATTGACGGATCCAGA ELRECOREPCRP1 466 - 480 (-) [TGACCOGATCGCC CGACGOSAMY3 485 - 489 (+) CGACG RAVAAT 537 - 541 -) CCA TATABOX2 560-566 (+) TATAAAT IBOXCORE 595 - 601 (-) GATAATA IBOXCORE 615-621 (-) GATAACG SV40COREENHAN 643 - 650 (-) GTGGATCG ABRELATERD1 644 - 656 ) AACGACGTGGATC CGACGOSAMY3 650 - 654 F) CGACG MYCATERDI 672 - 678 (-) CATGTGC MYCATRD22 673 -679 (+) CACATGG AGCBOXNPGLB 678-684 (-) AGCCGCC DPBFCOREDCDC3 688 - 694 (-) ACACAAG ABRELATERD1 744 -756 (+) AATAACGTGAGTA RAV1 BAT 791 -803 (+) ATCCACCTGCTCC MYBST1 823 - 829 () GGATAG AMYBOX2 824 - 830 (+) ATCCAT TATCCAOSAMY 824 - 830 (T) ATCCAT WBOXATNPR1 829 - 843 (-) GTTGACGAATGGAAT ASF1MOTIFCAMV 834- 846 () CATGTTGACGAAT RAVMAT 840 - 844 (+) CMCA RYREPEATBNNAPA 841 - 851 (+) AACATGCAGGT INTRONLOWER 845 - 850 (+) TGCAGG CCAATBOX1 895 - 899 (+) CCAAT 115 IUPAC frsoto Str. Sequence MYCATERD1 944 - 950 (-) CATGTGG MYCATRD22 945 -951 (+) CACATGG HEXAMERATH4 1006 - 1011 (+) CCGTCG CGACGOSAMY3 1007 - 1011 (-) CGACG ASF1MOTIFCAMV 1014- 1026 (-) TCTCGTGACGCCC TATABOX4 1071 - 1077 (+) TATATAA CCAATBOXI 1121 - 1125 (-) CCAAT MYBPZM 1136 - 1141 (+)CCAACC MYB2AT 1152-11621(-) TCAGTAACTGC EXAMPLE 19. PLACE Analysis for Zm.LDH Promoter (SEQ ID NO: 19) Based on the below given PLACE results are potential TATA box is localized at base pair 906 to base pair 912 of SEQ ID NO: 19. In consequence the 5' untranslated region 5 starts at bout base pair 947 and extends to base pair 1,060 of SEQ ID NO: 19. The sequence described by SEQ ID NO: 19 ends 31 base pairs before the ATG start codon. The following clusters of promoter elements were identified in the Zm.LDH promoter as 10 described by SEQ ID NO: 19. IUPAC fPo ti Str. Sequence TATABOX4 15-21 (-) TATATAA 5256BOXLELAT5256 16-27 (-) TGTGGTTATATA TATABOX4 16-22 (+) TATATAA MYB1AT 20-25 (+) TAACCA ASFIMOTIFCAMV 39-51 (-) AATAATGACGCAG MYBIAT 93-98 (+) AAACCA AACACOREOSGLUB1 114- 120 (-) AACAAAC LTRE1HVBLT49 119-124 (-) CCGAAA REALPHALGLHCB21 144 - 154 ) AACCAACGATA WBOXHVISO1 172-186 (-) GATGACTCGTACGGC IBOXCORE 201 - 207 (-) GATAAAA DRE2COREZMRAB17 208-214 (+) ACCGACT RAV1AAT 238 - 242 (+) CCA ASF1MOTIFCAMV 254 - 266 (-) GTTCGTGACGC-T TAAAGSTKST1 339 - 345 (+) ATTAAAG NTBBF1ARROLB 340 - 346 (-) ACTTTAA RAVIAAT 361 - 365 (+) CAACA CATATGGMSAUR 378 - 383 (+) CATATG CATATGGMSAUR 378 - 383 (-) CATATG -10PE HVPSBD 397-402 -) TATTCT TAAAGSTKSTi 419-425 (+) GTTAAAG RAV1AAT 435 -439 (-) CAACA CAREOSREP1 448-453 (-) CAACTC 116 IUPAC Position Str. Sequence from -to . euec CGACGOSAMY3 456 - 460 (+) CGACG IBOXCORE 476-482 (+)GATAAAA TBOXATGAPB 489 - 494 (-) ACTTTG IBOXCORE 561 - 567 (+) GATAAAA TATABOXOSPAL 574 - 580 (T) ATTTAA TATABOXOSPAL 583 - 589 (-) TATTTAA GTICORE 597 - 607 (-) AGGTTAAAACT S1FBOXSORPSIL21 667-672 +) ATGGTA PROLAMINBOXOSGLUB1 678 - 686 (+) TGCAAAGAG MYB2AT 732 - 742 (+) TGGGTAACTGT WBOXATNPRI 735 - 749 (-) GTTGACGACAGTTAC ASF1MOTIFCAMV 740 - 752 (-) CCGGTTGACGACA CCA1ATLHCB1 810 - 817 (-) AAAAATCT GT1 ORE 831 - 841 (-) TGGTTAAAATT MYB1AT 836-841 (+) TAACCA SV40COREENHAN 861 - 868 (+) GTGGTTTG MYB1AT 862 - 867 (-) AAACCA TATABOX3 890 - 896 (+) TATTAAT WUSATAg 892 - 898 (+) TTAATGG TATAPVTRNALEU 902 - 914 (-) CTTTATATATTCA TATABOX4 906 - 912 (+) TATATAA TAAAGSTKST1 908 - 914 (+) TATAAAG BOXCPSASI 937 - 943 (+) CTCCCAC OCTAMERMOTIFTAH3H4 998 - 1005 (-) CGCGGATC ELRECOREPCRP1 1010 - 1024 () TTGACCCAACCAGA MYBPZM 1016-1021 (+)CCAACC CIACADIANLELHC 1017- 1026 (+) CAACCAGATC ABRELATERD1 1031 -1043 (-) GATTACGTGTGTG DPBFCOREDCDC3 1032 - 1038 () ACACACG EXAMPLE 20. PLACE Analysis for Os.Cp12 Promoter (SEQ ID NO: 27) Based on the below given PLACE results are potential TATA box is localized at base pair 908 to base pair 914 of SEQ ID NO:27. In consequence the 5' untranslated region 5 starts at about base pair 960 and extends to base pair 998 of SEQ ID N0:27. The following clusters of promoter elements were identified in the Os.Cp12 promoter as described by SEQ ID NO:27: IUPAC fromton Str. Sequence AMMORESIIUDCRNIA1 28-35 (+) GGAAGGGT ABRELATERD1 57-69 (+)GAGGACGTGAGGC LTRE1HVBLT49 88- 93 (-)gCCGAAA 117 IUPACPosition Str. Sequence ILJPACfrom -to -300ELEMENT 96- 104 (+) TGAAAAATT SEF1MOTIF 108-116 (-) ATATTTAAA TATABOXOSPAL 109- 115 (-) TATTTAA WBOXATNPR1 173- 187 (-) GTTGACTGGGCCTTA MYB2AT 213-223 (+) GCTGTAACTGG RAVIAAT 244-248 (-) CCA CIACADIANLELHC 286 - 295 (+) CAAGGCCATC MYB1AT 296 - 301 (-) ACCA SV40COREENHAN 310 - 317 (-) GTGGTAAG CCAATBOX1 352 - 356 (+) CCAAT -300ELEMENT 362 - 370 (-) TGTAAAGTT NTBBF1ARROLB 363 - 369 (+) ACTTTAC -300CORE 364 - 370 (-) TGTAAAG TAAAGSTKSTI 364 - 370 (-) TGTAAAG CCAATBOXI 392 - 396 (-) CCAAT -300ELEMENT 403-411 (+) TGAAAAATA RA31|AT 443-455 (+) CTGCACCTGTACA MYBPLANT 519-529 (+) CACCAAACTTT EVENINGAT 543 - 551 (-) AAAATATCT LTRE1 HVBLT49 557 - 562 (+) CCGAAA RAVIAAT 620 - 624 ( CMCA MYBST1 645 - 651 (-) TGGATAC TATCCAOSAMY 646- 652 (+) TATCCAA MYBPZM 649-654 (+) CCAACC WBOXHVISO1 676 - 690 (-) GATGACTGTGGGTGT ELRECOREPCRP1 698 - 712 (-) TTTGACCGTGAAAAC ABREAZMRAB28 807 - 819 (-) TGCCACGTGGGCT GBOXLERBCS 808- 820 (+) GCCCACGTGGCAC UPRMOTIFIIAT 813 - 831 (-) CCAATCGTCGTGTGCCACG CGACGOSAMY3 822 - 826 (+) CGACG CCAATBOXI 827 - 831 (-) CCAAT IBOXCORENT 842 - 848 (+) GATAAGA ABRELATERD1 853 - 865 (-) GACGACGTGCACT CGACGOSAMY3 859 - 863 (-) CGACG CGACGOSAMY3 862 - 866 (-) CGACG UPRMOTIFIIAT 879 - 897 (+) CCTTCTCCCCCACCCCACG TATAPVTRNALEU 904-916 (-) GT17ATATATATA TATABOX4 908 - 914 (+) TATATAA CGACGOSAMY3 948 - 952 (-) CGACG RALAAT 953- 957 (+) CAACA RAV1AT 994 - 998 (+) CAACA 118 EXAMPLE 21 Vector Construction for Overexpression and Gene "Knockout" Ex. periments 21.1 Overexpression Vectors used for expression of full-length "candidate genes" of interest in plants (over 5 expression) are designed to overexpress the protein of interest and are of two general types, biolistic and binary, depending on the plant transformation method to be used. For biolistic transformation (biolistic vectors), the requirements are as follows: 1. a backbone with a bacterial selectable marker (typically, an antibiotic resistance 10 gene) and origin of replication functional in Escherichia coli (E. coli ; e.g., ColE1), and 2. a plant-specific portion consisting of: a. a gene expression cassette consisting of a promoter (e.g. ZmUBlint MOD), the gene of interest (typically, a full-length cDNA) and a transcriptional terminator 15 (e.g., Agrobacterium tumetaciens nos terminator); b. a plant selectable marker cassette, consisting of a suitable promoter, selectable marker gene (e.g., D-amino acid oxidase; daol) and transcriptional terminator (eg. nos terminator). 20 Vectors designed for transformation by Agrobacterium tumefaciens (A. tumefaciens; binary vectors) consist of: 1. a backbone with a bacterial selectable marker functional in both E. coli and A, tume faciens (e.g., spectinomycin resistance mediated by the sadA gene) and two origins of replication, functional in each of aforementioned bacterial hosts, plus the A. turne 25 faciens vrG gene; 2. a plant-specific portion as described for biolistic vectors above, except in this in stance this portion is flanked by A. tumefaciens right and left border sequences which mediate transfer of the DNA flanked by these two sequences to the plant. 30 21.2 Gene Silencing Vectors Vectors designed for reducing or abolishing expression of a single gene or of a family or related genes (gene silencing vectors) are also of two general types corresponding to the methodology used to downregulate gene expression: antisense or double stranded RNA interference (dsRNAi). 35 (a) Anti-sense For antisense vectors, a full-length or partial gene fragment (typically, a portion of the cDNA) can be used in the same vectors described for full-length expression, as part of the gene expression cassette. For antisense-mediated down-regulation of gene ex 40 pression, the coding region of the gene or gene fragment will be in the opposite orien tation relative to the promoter; thus, mRNA will be made from the non-coding (an tisense) strand in plant.
119 (b) dsRNAi For dsRNAi vectors, a partial gene fragment (typically, 300 to 500 base pairs long) is used in the gene expression cassette, and is expressed in both the sense and antisense orientations, separated by a spacer region (typically, a plant intron, e.g. the OsSH1 5 intron 1, or a selectable marker, e.g. conferring kanamycin resistance). Vectors of this type are designed to form a double-stranded mRNA stem, resulting from the basepairing of the two complementary gene fragments in planta. Biolistic or binary vectors designed for overexpression or knockout can vary in a number 10 of different ways, including e.g. the selectable markers used in plant and bacteria, the transcriptional terminators used in the gene expression and plant selectable marker cassettes, and the methodologies used for cloning in gene or gene fragments of interest (typically, conventional restriction enzyme-mediated or GatewayTM recombinase-based cloning). 15 Comprises/comprising and grammatical variations thereof when used in this specification are to be taken to specify the presence of stated features, integers, steps or components or groups thereof, but do not preclude the presence or addition of one or more other features, integers, steps, components or groups thereof. 20 120 References 1. Abel et at, Science, 232:738 (1986). 2. Altschul et at., Nucleic Acids Res., 25:3389 (1997). 3. Altschul et at, J. Mol, Biol., 215:403 (1990). 5 4. An st al., EMBO J., 4:277 (1985). 5. Auch & Reth, Nucleic Acids Research, 18:6743 (1990). 6. Ausubel et al (1987) Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience 7. Ballas et al., Nucleic Acids Res., 17:7891 (1989). 10 8. Barkai-Golan st al, Arch. Microbiol., 116:119 (1978). 9. Batzer st al, Nucleic Acid Res., 19:5081 (1991). 10. Baumlein et a. Mol Gen Genet 225:121-128 (1991) 11. Becker ot al. (1994) Plant J., 5:299-307, 12. Bemal-Lugo and Leopold, Plant Physiol., 98:1207 (1992). 15 13. Bevan et at, Nature, 304:184 (1983). 14. Bevan et al., Nucl. Acids Res., 11:369 (1983). 15. Bevan, Nucl, Acids Res., 12:8711 (1984). 16. Blackman et at, Plant Physiol., 100:225 (1992). 17. Blochlinger & Diggelmann, Mol Cell Biol, 4:2929 (1984). 20 18. Bol et al., Ann. Rev. Phytopath., 28:113 (1990). 19. Bouchez at at, EMBO J., 8:4197 (1989). 20. Bourouls ot al., EMBO J., 2:1099 (1983). 21. Bowler at al, Ann. Rev. Plant Physiol., 43:83 (1992). 22. Branson and Guss, Proc. North Central Branch Entomological Society of America (1972). 25 23. Broakgert et al., Science, 245:110 (1989). 24. Bustos at al. (1989) Plant Gell 1:839-853 25. Byme et al Plant Cell Tissue and Organ Culture, 8:3 (1987). 26. Callis t al., Genes and Develop., 1:1183 (1987). 27. Campbell and Gowri, Plant Physiol., 92:1 (1990). 30 28. Campbell, W. C., ed. Ivermectin and Abamectin, Springer-Verlag, New York, 1989. 29. Chee et at Plant Physiol., 91:1212 (1989). 30. Chen and Winans (1991) J. Bacteriol. 173:1139-1144 31. Christensen AH, Quail PH (1996) Transgenic Res 5: 213-218. 32. Christou et at Proc. NatL Acad. Sci USA, 86:7500 (1989). 35 33. Christou et al, Biotechnology, 9:957 (1991). 34. Christou et at, Plant Physiol., 87:671 (1988). 35. Chui ot al. (1996) Curr Biol 6:325-330 36. Coe et al., In: Corn and Corn Improvement, Sprague et al. (eds.) pp. 81-258 (1988). 37. Corpet st at Nucleic Acids Res., 16:10881 (1988). 40 38. Coxson et al, Biotropica, 24:121 (1992). 39. Crameri t at, Nature Biotech., 15:436 (1997). 40. Crameri st at, Nature, 391:288 (1998). 41. Crossway st al, BioTechniques, 4:320 (1986). 42. Cuozzo ot al., Bio/Technology, 6:549 (1988). 45 43. Cutler st al, J. Plant Physiol., 135:351 (1989). 44. Czapla and Lang, J. Econ. Entomol,, 83:2480 (1990). 45. Datta st at, Bio/Technology, 8:736 (1990). 46. Davies et al, Plant Physiol., 93:588 (1990). 47. Dayhoff ot al, Atlas of Protein Sequence and Structure, Natl. Biomed. Res. Found., ash 50 ington, C. D. (1978). 48. De Blaere at at, Meth. Enzymol., 143:277 (1987). 49. De Block st at Plant Physiol., 91:694 (1989). 50. De Block st at, EMBO Journal, 6:2513 (1987). 51. Deblaere et al. Nucl Acids Res 13:4777-4788 (1985) 55 52. Della-Cioppa t at. Bio/Technology 5:579-584 (1987) 53. Della-Cioppa st aL, Plant Physiology, 84:965-968 (1987). 54. Dellaporta et al, in Chromosome Structure and Function, Plenum Press, 263-282 (1988). 55. Depicker t at., Plant Cell Reports, 7:63 (1988).
121 56. Dunn et at, Can. J. Plant Sci., 61:583 (1981). 57. Dure st al, Plant Mol. Biot, 12:475 (1989). 58. Ebinuma etal. Proc NaU Acad Sci USA 94:2117-2121 (2000a) 59. Ebinuma et al. Selection of Marker-free transgenic plants using the oncogenes (ipt, tol A, 5 B, C) of Agrobacterium as selectable markers, In Molecular Biology of Woody Plants. Klu wer Academic Publishers (2000b) 60. Eichholtz eta. Somatic Cell and Molecular Genetics 13, 67-76 (1987) 61. Ellis st al, EMBO Journal, 6:3203 (1987). 62. Elroy-Stein at al, Proc. NatI. Acad. Sci. U.S.A., 86:6126 (1989). 10 63. English et al., Plant Cell, 8:179 (1996). 64. Erdmann et aL, J. Gen. Mlcrobiol., 138:363 (1992). 65. Erikson et al. Nat Biotechnol. 22(4):455-8 (2004) 66. Everett etat, Bio/Technology, 5:1201(1987). 67. Fedoroff & Smith Plant J 3:273- 289 (1993) 15 68. Fire et at, Nature 391:806-811 (1998) 69. Fitzpatrick, Gen. Engineering News, 22:7 (1993). 70. Fraley stat Proc Nat Acad Sci USA 80:4803 (1983) 71. Fromm at at, Bio/Technology, 8:833 (1990). 72. Fromm et aL, Nature (London), 319:791 (1986). 20 73. Galbiati at at Funct. Inlegr Genozides 2000, 20 1:25-34 74. Gallie at at Nucl Acids Res 15:8693-8711 (1987) 75. Gallie st at, Nucleic Acids Res., 15:3257 (1987). 76. Gallie at aL, The Plant Cell, 1:301 (1989). 77. Gan at at, Science, 270:1986 (1995). 25 78. Gatehouse st at, J. Sci. Food Agric., 35:373 (1984). 79. Gelfand, eds., PCR Strategies Academic Press, New York (1995). 80. Gelvin st at, Plant Molecular Biology Manual, (1990). 81. Gleave at at Plant Mol Biol. 40(2):223-35 (1999) 82. Gordon-Kamm et at, Plant Cell, 2:603 (1990). 30 83. Goring et a/, PNAS, 88:1770 (1991). 84. Gruber et al, Vectors for Plant Transformation, in: Methods in Plant Molecular Biology & Biotechnology" in Glich et al, (Eds. pp. 89-119, CRC Press, 1993). 85. Guerineau et at, Mol. Gen. Genet., 262:141 (1991). 86. Guerrero at aL, Plant Mo. Bio., 15:11 (1990). 35 87. Gupta st al, PNAS, 90:1629 (1993). 88. Haines and Higgins (eds.), Nucleic Acid Hybridization, IRL Press, Oxford, U.K. 89. Hajdukiewicz st al Plant Mol Biol 25:989-994 (1994) 90. Hammock at al, Nature, 344:458 (1990). 91. Hansen st al., Proc. Nat. Acad. Sci. USA 91:7603-7607 (1994) 40 92. Hayford st al, Plant Physiol. 86:1216 (1988) 93. Hemenway et at, EMBO Joumal, 7:1273 (1988). 94. Henikoff & Henikoff, Proc. Nati. Acad. Sci. USA, 89:10915 (1989). 95. Hiei at at, Plant J 6: 271-282 (1994) 96. Higgins at at, Gene, 73:237 (1988). 45 97. Higo at al, Nucl Acids Res 27(1): 297-300 (1999). 98. Hilder st at, Nature, 330:160 (1987). 99. Hille etat, Plant Mol. Biol. 7:171 (1986) 100. Hinchee etat, Bio/Technology 6:915 (1988). 101. Hoekema st at, Nature 303:179-181 (1983). 50 102. Hoekema, In: The Binary Plant Vector System. Offset-drukkerij Kanters B. V.; Alblasser dam (1985). 103. Hood st al J Bacteriol 168:1291-1301 (1986) 104. Huang st at, CABIOS, 8:155 (1992). 105. Ikeda st at, J. Bacteriol., 169:5612 (1987). 55 106. Ikuta et al, Biotech., 8:241 (1990). 107. Ingelbrecht at al, Plant Cell, 1:671 (1989). 108. Innis and Gelfand, eds., PCR Methods Manual (Academic Press, New York) (1999).
122 109. Innis ot aL, eds., PCR Protocols: A Guide to Methods and Applications (Academic Press, New York (1995). 110. Innis at a., PCR Protocols: A Guide to Methods and Applications, Academic Press, Inc., San Diego, Calif. (1990). 5 111. Ishida at at, Nature Biotech 745-750 (1996). 112. Jefferson at at, EMBO J 6:3901-3907 (1987). 113. Jefferson at al, Plant Mol Biol Rep 5:387-405 (1987). 114. Jenes et aL, Techniques for Gene Transfer, in: Recombinant Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R Wu, Academic Press, pp. 128-143 (1993). 10 115. Jobling at al, Nature, 325:622 (1987). 116. Johnson at al., PNAS USA, 86:9871 (1989). 117. Jones at at, Mol. Gen. Genet., 210:86 (1987). 118. Joshi at al, Nucleic Acid Res., 15:9627 (1987). 119. Kaasen et a., J. Bacteriol., 174:889 (1992). 15 120. Karlin and Altschul, Proc. Natl. Acad Sci. USA, 87:2264 (1990). 121. Karlin and Altschul, Proc. Natl. Acad. Sc. USA, 90:5873 (1993). 122. Karsten at at, Botanica Marina, 35:11 (1992). 123. Katz ot aL, J. Gen. Microbiol., 129:2703 (1983). 124. Keller st al., EMBO Journal, 8:1309 (1989). 20 125. Keller at al, Genes Dev., 3:1639 (1989). 126. Klapwijk at al., J. Bacteriol., 141,128-136 (1980.) 127. Klein at at, Bio/Technoloy, 6:559 (1988). 128. Klein et at, Plant Physiol., 91:440 (1988). 129. Klein et at, Proc. Nat. Acad. Sc. USA, 85:4305 (1988). 25 130. Knauf at al, Genetic Analysis of Host Range Expression by Agrobacterium In: Molecular Genetics of the Bacteria-Plant Interaction, Puhler, A. ed., Springer-Verlag, New York, 1983. 131. Koncz & Schell Mol Gen Genet 204:383-396 (1986) 132. Koprek at at, Plant J 19(6): 719-726 (1999) 133. Koster and Leopold, Plant Physiol., 88:829 (1988). 30 134. Koziel et al, Biotechnology, 11:194 (1993). 135. Kunkel at al, Methods in Enzymol., 154:367 (1987). 136. Kunkel, Proc. Nal. Acad. Sci. USA, 82:488 (1985). 137. Lam and Chua, J Biol Chem; 266(26):17131-17135 (1991) 138. Laufs st at, PNAS, 87:7752 (1990). 35 139. Lawton at at, Mol. Cell Biol., 7:335 (1987). 140. Lee and Saier, J. Bacteriol., 153 (1982). 141. Leffel t at. Biotechniques 23(5):912-8 (1997) 142. Lescot et al, Nucleic Acids Res 30(1):325-7 (2002) 143. Levings, Science, 250:942 (1990). 40 144. Li st at Plant Mol Biol 20:1037-1048 (1992) 145. Lindsey et aL, Transgenic Research, 2:3347 (1993). 146. Liu et al,. Plant J. 8, 457-463 (1995) 147. Lommel st al., Virology, 181:382 (1991). 148. Loomis et aL, J. Expt. Zool., 252:9 (1989). 45 149. Lorz st al, Mol. Gen. Genet., 199:178 (1985). 150. Ma at at, Nature, 334 :631 (1988). 151. Macejak et at, Nature, 353:90 (1991). 152. Maki st al, Methods in Plant Mol. Biol & Biotechn., Glich et al., 67-88 CRC Press, (1993). 153. Maniatis at al,Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, 50 Cold Spring Harbor (NY), (1989) 154. Mariani at al, Nature, 347:737 (1990). 155. Matzke st at Plant Mol Biol 43:401-415 (2000). 156. McBride at al, PNAS USA, 91:7301 (1994). 157. McCabe at at, Bio/Technology, 6:923 (1988). 55 158. Meinkoth and Wahl, Anal. Biochem., 138:267 (1984). 159. Messing and Vierra, Gene, 19:259 (1982). 160. Michael t al., J. Mol. Biol., 26 :585 (1990). (in Text staht: Michael et al. 1994) 161. Millar t a., Plant Mol Biol Rep 10:324-414 (1992) 123 162. Mogen et at, Plant Cell, 2:1261 (1990). 163. Moore et at, J. Mol. Biol., 272:336 (1997). 164. Mozo & Hooykaas Plant Mol. Biol. 16:917-918 (1991). 165. Mundy and Chua, EMBO J., 7:2279 (1988). 5 166. Munroe et a., Gene, 91:151 (1990). 167, Murakami at al, Mol. Gen. Genet., 205:42 (1986). 168. Murata at at, FEBS Lett., 296:187 (1992). 169. Murdock et al., Phytochemistry, 29:85 (1990). 170. Murray at al., Nucleic Acids Res., 17:477 (1989). 10 171. Myers and Miller, CABIOS, 4:11 (1988). 172. Naested, Plant J 18:571-576 (1999). 173. Napoli et a., Plant Cell, 2:279 (1990). 174. Needleman and Wunsch, J. Mol. Biol., 48:443-453 (1970). 175. Nehra st al. Plant J. 5:285-297 (1994) 15 176. Niedz st al, Plant Cell Reports, 14:403 (1995). 177. Odell et al, Mol. Gen. Genet., 113:369 (1990). 178. Odell at al., Nature, 313:810 (1985). 179. Ohtsuka at al, J. Biol. Chem., 260:2605 (1985) 180. Olhoft et at Plant Cell Rep 20: 706-711 (2001) 20 181. Ow st at, Science, 234:856 (1986). 182. Pacciotti at a., Bio/Technology, 3:241 (1985). 183. Park et aL, J. Plant Biol., 38:365 (1985). 184. Paszkowski et aL, EMBO J., 3:2717 (1984). 185. Pearson and Lipman, Proc. Natl. Acad. Sci., 85:2444 (1988). 25 186. Pearson t a., Math. Mol. Biol., 24:307 (1994). 187. Perera etat Plant Mo. Biol 23(4): 793-799 (1993). 188. Perlak et at, Proc. NatI. Acad. Sci. USA, 88:3324 (1991). 189. Phillips et at, In Corn & Corn Improvement, 3rd Edition 10 Sprague et al. (Eds. pp. 345 387)(1988). 30 190. Phi-Van at at, Mol. Cell. Biol., 10:2302 (1990). 191. Piatkowski at al, Plant Physiol., 94:1682 (1990). 192. Potrykus st al, Mol. Gen. Genet., 199:183 (1985). 193. Potrykus, Trends Biotech., 7:269 (1989). 194. Prasher st al, Biochem. Biophys. Res. Comm., 126:1259 (1985). 35 195. Proudfoot, Cell, 64:671 (1991). 196. Reed at al., J. Gen. Microbiol., 130:1 (1984). 197T Riggs at aL, Proc. Nal. Acad. Sci. USA, 83:5602 (1986). 198. Rossolini etat, Mol. Cell. Probes, 8:91 (1994). 199. Ruiz, Plant Cell, 10:937 (1998). 40 200. Sambrook at at, Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.) (1989). 201. Sanfacon et al, Genes Dev., 5:141 (1991). 202. Sanford st al, Particulate Science and Technology, 5:27 (1987). 203. Scheeren-Groot et al. J. Bacteriol 176: 6418-6426 (1994). 45 204. Schenbom and Groskreutz Mol Biotechnol 13(1): 29-44 (1999). 205. Schlaman and Hooykaas Plant J 11:1377-1385 (1997). 206. Schoffi et al. Mol Gen Genetics 217(2-3):246-53 (1989). 207. Shagan st at, Plant Physiol., 101:1397 (1993). 208. Shah at at, Science 233: 478 (1986). 50 209. Shapiro, Mobile Genetic Elements, Academic Press, N.Y. (1983). 210. Shimamoto at at, Nature, 338:274 (1989). 211. Silhavy at al, Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (NY), (1984). 212. Skuzeski at al, Plant Molec. Biol. 15: 65-79 (1990). 55 213. Smith st aL, Ady. AppL. Math., 2:482.(1981). 214. Smith st at, Mol. Gen. Genet., 224:447 (1990). 215. Spencer et at, Theor. App. Genet, 79:625 (1990). Spencer 1992 Referenz fehlt 216. Stalker etat, Science, 242:419 (1988).
124 217. Staub et al, EMBO J., 12:601 (1993). 218. Staub et at, Plant Cell, 4:39 (1992). 219. Steifel et al, The Plant Cell, 2:785 (1990). 220. Stemmer, Nature, 370:389 (1994). 5 221. Stemmer, Proc. Nati, Acad. Sci. USA, 91:10747 (1994). 222. Stief st at, Nature, 341:343 (1989). 223. Stougaard, Plant J 3:755-761 (1993) 224. Sukhapinda et al., Plant Mo. Biol., 8:209 (1987). 225. Sundaresan et al. Gene Develop 9: 1797-1810 (1995) 10 226. Sutcliffe, PNAS USA, 75:3737 (1978). 227. Svab et al., Plant Mol. Biol. 14:197 (1990) 228. Svab at al., Proc. Natl. Acad. Sci. USA, 87:8526 (1990). 229. Svab at al., Proc. Natil. Acad. Sci. USA, 90:913 (1993). 230. Tarczynski st at., PNAS USA, 89:2600 (1992). 15 231. Thillet st al., J. Biol. Chem., 263:12500 (1988). 232. Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Elsevier, N.Y. (1993). 233. Tomes et at, Plant Cell, Tissue and Organ Culture: Fundamental Methods, Springer Ver lag, Berlin (1995). 20 234. Tomic st al., NAR, 12:1656 (1990). 235. Turner st al., Molecular Biotechnology, 3:225 (1995). 236. Twell st al, Plant Physiol., 91:1270 (1989). 237. Ugaki st al, Nuc. Acids Res., 19:371 (1991). 238. Ulmasov t al., Plant Mol. Bio., 35:417 (1997). 25 239. Upender st at, Biotechniques, 18:29 (1995). 240. van der Krol et at., Plant Cell, 2:291 (1990). 241. Vanden Elzen st at, Plant Mol Biol. 5:299 (1985) 242. Vasil et at Bio/Technology, 10:667-674 (1992) 243. Vasil et at, Bio/Technology, 11:1153-1158 (1993) 30 244. Vasil et al, Mol. Microbiol., 3:371 (1989). 245. Vasil etat, Plant PhysioL, 91:1575 (1989). 246. Vernon and Bohnert, EMBO J., 11:2077 (1992). 247. Walker and Gaastra, eds., Techniques in Molecular Biology, MacMillan Publishing Com pany, New York (1983). 35 248. Wan & Lemaux, Plant Physiol., 104:3748 (1994). 249. Wang st al, Mol. Cell. Biol., 12:3399 (1992). 250. Waterman, Introduction to Computational Biology: Maps, sequences and genomes. Chap man & Hall. London (1995). 251. Watrud et a., in Engineered Organisms and the Environment (1985). 40 252. Watson stat J. Bacteriol 123, 255-264 (1975) 253. Watson st al., Corn: Chemistry and Technology (1987). 254. Weeks st al Plant Physiol 102:1077-1084 (1993) 255. Weissinger st al, Annual Rev. Genet., 22:421 (1988). 256. White et al, Nucl Acids Res, 18, 1062 (1990). 45 257. Wingender et al, Nucleic Acids Res 29(1):281-3 (2001) 258. Wolter st al, EMBO Journal, 11:4685 (1992). 259. Wyn-Jones and Storey, Physiology and Biochemistry of Drought Resistance in Plants, Paleg et al. (eds.), pp. 171-204 (1981). 260. Yamaguchi-Shinozaki st al, Plant Cell Physiol., 33:217 (1992). 50 261. Zhang et al, Proc. Natl. Acad. Sci. USA, 94:4504 (1997). 262. Zukowsky st at, PNAS USA, 80:1101 (1983). All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain preferred em 55 bodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled In the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.
Claims (15)
1. An expression cassette for regulating expression in monocotyledonous plants comprising a) at least one transcription regulating nucleotide sequence of a monocotyle 5 donous C8,7-sterol isomerase gene, functional in a monocotyledonous plant comprising at least one sequence selected from the group of sequences consisting of i) the sequences described by SEQ ID NOs: 6, 7 and 8 and ii) a fragment of at least 200 consecutive bases of a sequence under i); and iii) a nucleotide sequence having substantial similarity with a sequence 10 identity of at least 60% to a transcription regulating nucleotide sequence described by SEQ ID NOs: 6, 7 or 8; and iv) a nucleotide sequence capable of hybridizing to a transcription regulating nucleotide sequence described by SEQ ID NOs: 6, 7 or 8 or the complement thereof in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 500C with washing in 2 15 X SSC, 0. 1% SDS at 500C; and v) a nucleotide sequence capable of hybridizing to a nucleic acid comprising 50 to 200 or more consecutive nucleotides of a transcription regulating nucleotide sequence described by SEQ ID NOs: 6, 7 or 8 or the complement thereof; and vi) a nucleotide sequence which is the complement or reverse complement of 20 any of the previously mentioned nucleotide sequences under i) to v), and b) at least one nucleic acid sequence which is heterologous in relation to said transcription regulating sequence, wherein said at least one transcription regulating nucleotide sequence has a kernel and 25 root preferential expression specificity.
2. The expression cassette of Claim 1, wherein the sequences specified under ii), iii), iv) v) and vi) have substantially the same transcription regulating activity as the transcription regulating nucleotide sequence described by SEQ ID NOs: 6, 7 or 8.
3. The expression cassette of claim 1, wherein the sequences specified under iv) or 30 v) are hybridizing under stringent conditions in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 1 mM EDTA at 500C with washing in 0.1 X SSC, 0.1% SDS at 650C with the specified target sequence. 126
4. The expression cassette of any one of Claims 1 to 3 wherein the expression cassette further comprises at least one element selected from the group of a) 5'-untranslated region of plant expressed genes, and b) intron sequences from plant expressed genes, and 5 c) transcription termination sequences from plant expressed genes.
5. The expression cassette of Claim 4, wherein the transcription termination sequence is selected from the group of sequences described by SEQ ID NOs: 32, 34, and 35.
6. The expression cassette of Claim 4, wherein the 5'-untranslated region is from the 10 same gene as the transcription regulating sequences.
7. The expression cassette of Claim 4, wherein the intron sequence has expression enhancing properties.
8. The expression cassette of claim 4 or claim 7, wherein the intron sequence is an intron from an ubiquitin, actin or alcohol dehydrogenase gene. 15
9. An isolated nucleic acid sequence comprising at least one transcription regulating nucleotide sequence as described by SEQ ID NO: 6, 7 or 8.
10. A vector comprising an expression cassette of any one of Claims 1 to 8.
11. A transgenic host cell or non-human organism comprising an expression cassette of any one of claims 1 to 8, or a vector of claim 10. 20
12. A transgenic plant comprising the expression cassette of any one of claims 1 to 8, or a vector of claim 10.
13. A method for identifying and/or isolating a transcription regulating nucleotide sequence from a monocotyledonous plant characterized that said identification and/or isolation utilizes a nucleic acid sequence encoding an amino acid sequence as described 25 by SEQ ID NO: 10 or a part of at least 15 bases of said nucleic acid sequence, and wherein said transcription regulating nucleotide sequence has a kernel and root preferential expression specificity. 127
14. The method of Claim 13, wherein the nucleic acid sequence is described by SEQ ID NO: 9 or a part of at least 15 bases thereof.
15. A method for providing a transgenic expression cassette for heterologous expression in monocotyledonous plants comprising the steps of: 5 i) isolating of a transcription regulating nucleotide sequence from a monocotyledonous plant utilizing at least one nucleic acid sequence or a part thereof, wherein said sequence is encoding a polypeptide described by SEQ ID NOs: 10 or a part of at least 15 bases of said nucleic acid sequence, and ii) functionally linking said transcription regulating nucleotide sequence to 10 another nucleotide sequence of interest, which is heterologous in relation to said transcription regulating nucleotide sequence, and wherein said transcription regulating nucleotide sequence has a kernel and root preferential expression specificity. 15 BASF PLANT SCIENCE GMBH WATERMARK PATENT & TRADE MARK ATTORNEYS P29062AU01
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2011205193A AU2011205193B2 (en) | 2005-02-09 | 2011-08-08 | Expression cassettes for regulation of expression in monocotyledonous plants |
AU2013200913A AU2013200913A1 (en) | 2005-02-09 | 2013-02-19 | Expression cassettes for regulation of expression in monocotyledonous plants |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US60/651,268 | 2005-02-09 | ||
AU2006212223A AU2006212223B2 (en) | 2005-02-09 | 2006-02-08 | Expression cassettes for regulation of expression in monocotyledonous plants |
AU2011205193A AU2011205193B2 (en) | 2005-02-09 | 2011-08-08 | Expression cassettes for regulation of expression in monocotyledonous plants |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2006212223A Division AU2006212223B2 (en) | 2005-02-09 | 2006-02-08 | Expression cassettes for regulation of expression in monocotyledonous plants |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2013200913A Division AU2013200913A1 (en) | 2005-02-09 | 2013-02-19 | Expression cassettes for regulation of expression in monocotyledonous plants |
Publications (2)
Publication Number | Publication Date |
---|---|
AU2011205193A1 AU2011205193A1 (en) | 2011-08-25 |
AU2011205193B2 true AU2011205193B2 (en) | 2012-11-22 |
Family
ID=45420331
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2011205193A Ceased AU2011205193B2 (en) | 2005-02-09 | 2011-08-08 | Expression cassettes for regulation of expression in monocotyledonous plants |
AU2013200913A Abandoned AU2013200913A1 (en) | 2005-02-09 | 2013-02-19 | Expression cassettes for regulation of expression in monocotyledonous plants |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2013200913A Abandoned AU2013200913A1 (en) | 2005-02-09 | 2013-02-19 | Expression cassettes for regulation of expression in monocotyledonous plants |
Country Status (1)
Country | Link |
---|---|
AU (2) | AU2011205193B2 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003000898A1 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Plant genes involved in defense against pathogens |
US20040123343A1 (en) * | 2000-04-19 | 2004-06-24 | La Rosa Thomas J. | Rice nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement |
-
2011
- 2011-08-08 AU AU2011205193A patent/AU2011205193B2/en not_active Ceased
-
2013
- 2013-02-19 AU AU2013200913A patent/AU2013200913A1/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040123343A1 (en) * | 2000-04-19 | 2004-06-24 | La Rosa Thomas J. | Rice nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement |
WO2003000898A1 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Plant genes involved in defense against pathogens |
Non-Patent Citations (2)
Title |
---|
Genbank Accession no. AK102848, 24 July 2003 * |
Genbank Accession no. AP002969, 03 December 2000 * |
Also Published As
Publication number | Publication date |
---|---|
AU2011205193A1 (en) | 2011-08-25 |
AU2013200913A1 (en) | 2013-03-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2006212223B2 (en) | Expression cassettes for regulation of expression in monocotyledonous plants | |
AU2006217847B2 (en) | Expression cassettes for seed-preferential expression in plants | |
AU2006237346B2 (en) | Expression cassettes for seed-preferential expression in plants | |
AU2005242196B2 (en) | Expression cassettes for meristem-preferential expression in plants | |
AU2005222518B2 (en) | Constitutive expression cassettes for regulation of plant expression | |
AU2006245701B2 (en) | Expression cassettes for seed-preferential expression in plants | |
AU2005237151B2 (en) | Expression cassettes for guard cell-preferential expression in plants | |
AU2006210283A1 (en) | Transcription regulating nucleotide sequence from Solanaceae triose-phosphate translocator genes and their use in plant expression cassettes | |
AU2011202732B2 (en) | Constitutive expression cassettes for regulation of plant expression | |
AU2011200431B2 (en) | Expression cassettes for root-preferential expression in plants | |
AU2011205193B2 (en) | Expression cassettes for regulation of expression in monocotyledonous plants | |
US20090064374A1 (en) | Expression cassettes for seed-preferential expression in plants | |
AU2011200965A1 (en) | Expression cassettes for vascular tissue-preferential expression in plants |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
NA | Applications received for extensions of time, section 223 |
Free format text: AN APPLICATION TO EXTEND THE TIME FROM 25 FEB 2010 TO 25 AUG 2011 IN WHICH TO MAKE A FURTHER APPLICATION FOR A DIVISIONAL PATENT HAS BEEN FILED . |
|
NB | Applications allowed - extensions of time section 223(2) |
Free format text: THE TIME IN WHICH TO MAKE A FURTHER APPLICATION FOR A DIVISIONAL PATENT HAS BEEN EXTENDED TO 25 AUG2011. |
|
FGA | Letters patent sealed or granted (standard patent) | ||
MK14 | Patent ceased section 143(a) (annual fees not paid) or expired |