AU2008230321A1 - Method for determination of presence of crossing with garden-species rose plant in wild-species rose plant - Google Patents

Method for determination of presence of crossing with garden-species rose plant in wild-species rose plant Download PDF

Info

Publication number
AU2008230321A1
AU2008230321A1 AU2008230321A AU2008230321A AU2008230321A1 AU 2008230321 A1 AU2008230321 A1 AU 2008230321A1 AU 2008230321 A AU2008230321 A AU 2008230321A AU 2008230321 A AU2008230321 A AU 2008230321A AU 2008230321 A1 AU2008230321 A1 AU 2008230321A1
Authority
AU
Australia
Prior art keywords
rose
gene
cultivated
wild
transposon
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
AU2008230321A
Other versions
AU2008230321A2 (en
AU2008230321B2 (en
Inventor
Masako Mizutani
Noriko Nakamura
Yoshikazu Tanaka
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suntory Holdings Ltd
Original Assignee
International Flower Developments Pty Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by International Flower Developments Pty Ltd filed Critical International Flower Developments Pty Ltd
Publication of AU2008230321A1 publication Critical patent/AU2008230321A1/en
Publication of AU2008230321A2 publication Critical patent/AU2008230321A2/en
Assigned to SUNTORY HOLDINGS LIMITED reassignment SUNTORY HOLDINGS LIMITED Request for Assignment Assignors: INTERNATIONAL FLOWER DEVELOPMENTS PROPRIETARY LIMITED
Application granted granted Critical
Publication of AU2008230321B2 publication Critical patent/AU2008230321B2/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Description

IFD(STY)-V567 DESCRIPTION METHOD FOR DETERMINATION OF PRESENCE OF CROSSING WITH CULTIVATED ROSE IN WILD ROSE 5 FIELD OF THE INVENTION The present invention relates to a method for determining the presence of crossing with a cultivated rose in a wild rose. 10 BACKGROUND ART Since flowers having new traits are always favored in the flower industry, the development of such flowering plants is industrially important. Breed improvement based 15 mainly on crossing has produced species with a variety of traits. However, in the crossing-based breed improvement, available gene resources are restricted to crossable closely-related plants, and thus colors arid traits that can be introduced are limited in most cases, and besides 20 it is rare that single plant species have various colors and traits. In terms of color for example, it was impossible to produce blue roses and carnations, yellow morning glories or geraniums by the crossing-based breed improvement. 25 However, the use of the gene recombinant technology can realize the development of a variety of traits by introducing various genes into any plants transcending the species barrier and by artificially altering plant metabolisms etc. For example, there is an example wherein 30 in roses and carnations that cannot produce delphinidin in the flower petal, the gene of the flavonoid 3',5' hydroxylase enzyme that is required to synthesize delphinidin was expressed to produce delphinidin, which enabled the creation of blue flowers that are not present 35 in nature (Tanaka 2006). However, in Japan, the research and development, cultivation, distribution etc. of such artificially- - 2 created gene recombinant plants are required to abide by the regulations set forth in "Law Concerning the Conservation and Sustainable Use of Biological Diversity through Regulations on the Use of Living Modified 5 Organisms " (Cartagena Protocol). In other countries as well, field cultivation etc. of gene recombinant plants have been regulated based on similar laws. Specifically, for plants whose pollens are fertile and for which a horde of crossable closely-related plants occur in Japan, 10 evaluation on crossability, or on the possibility of gene proliferation from a recombinant plant to a closely related wild species, is obligatory. In the case of roses for which a horde of closely related species occur in Japan and which are multiflorous 15 and fructiferous, quantities to be analyzed on the presence of crossing between cultivated and wild species become enormous, and thus the establishment of simple and accurate analytical technologies is being sought after. So far, the one that utilizes microsatellites as the 20 molecular marker has been reported (Debener 2003, 2006). Furthermore, analysis may also be carried out with an identification method based on ploidy determination using flow cytometry. However, any of the above methods had problems that they lacked accuracy, versatility and/or 25 simplicity. Furthermore, since cultivated roses today were created by artificially crossing about 8 wild species, it was not easy to obtain DNA markers that can distinguish cultivated species from wild species. In accordance with the present invention, the KSN 30 gene, a target gene, is a gene involved in the perpetual blooming of roses obtained from Rosa chinensis spontanea, and the gene was created by inserting an about 9 kb transposon into the KSN gene of a one season flowering rose. It is reported that the insertion of a transposon 35 serves to inhibit the expression of said gene, which led to the deregulation of anthogenesis control at the shoot apex promoting anthogenesis, which resulted in the - 3 perpetual blooming nature (Iwata et al., Japanese Unexamined Patent Publication (Kokai) No. 2006-149202). It is already elucidated that roses of the cultivated species contain, in the homologous 5 configuration, said gene having a transposon inserted therein. On the other hand, roses of the wild species have, in the homologous configuration, a KSN gene which, in principle, does not contain a transposon. As used herein, Rosa chinensis is one of the wild 10 species that became an ancestor of cultivated roses, and a one season flowering rose. R. chinensis spontanea is a mutant lineage thereof and a perpetual blooming rose. Patent document 1: Japanese Unexamined Patent Publication (Kokai) No. 2006-149202. 15 DISCLOSURE OF THE INVENTION Methods of determining the presence of crossing with cultivated roses in wild roses have been reported, but they lacked versatility. Other methods may be 20 conceivable, but they lacked simplicity and accuracy. Thus, there is a need for a method that can resolve these problems and can determine whether wild roses are crossed with cultivated roses for plants which are fructiferous and for which a horde of closely-related wild species 25 occur. In cases where an enormous number of individual plants are to be determined for the presence of crossing in order to examine the possibility of gene proliferation of recombinant plants, a method that permits an easy 30 determination of whether a wild rose is crossed with a rose transformant as a pollen parent is specifically required. Thus, the present invention aims to provide a method that permits an easy determination of whether a wild rose of interest is crossed with the pollen of a 35 rose transformant. After intensive and extensive research in order to attain the above objective, the present inventors have -4 conceived the idea that in a wild rose, a KSN gene containing a transposon can only be detected when the wild rose crossed with a cultivated rose, and have found that using a KSN gene containing a transposon as the 5 indicator, the above objective can be attained, and thereby have completed the present invention. Thus, the present invention provides a method for determining whether or not a wild rose of interest is crossed with a cultivated rose, said method comprising 10 the steps of: examining whether or not a KSN gene containing a transposon (an indicator) is contained in the rose of interest; and determining that the rose of interest is crossed with a cultivated rose when the individual has the transposon-containing KSN gene. 15 Normally, in the crossing of a cultivated rose with a wild species in a study for evaluating the effect of transgenic plants on biological diversity, the scattering of pollens of cultivated species resulting in the crossing with wild species in the neighborhood poses 20 problems. Thus, in the method of the present invention, typically the seed parent is a wild rose and the pollen parent is a cultivated rose. Also, typically the above cultivated rose is a rose transformant having a gene introduced therein, in which the gene may be a gene 25 related to color such as the gene of the flavonoid 3',5' hycroxylase enzyme derived from pansy of the family Violaceae. BRIEF EXPLANATION OF THE DRAWINGS 30 Figure 1 shows the result of detection of the KSN gene by a PCR method. The position of the specific amplified products of the KSN gene containing introns and the GAPDH gene (internal control) are shown by arrows. 35 BEST MODE FOR CARRYING OUT THE INVENTION Cultivated-species and wild species Generally, cultivated roses are tetraploid (4x) and - 5 perpetual blooming. In contrast, wild roses are generally diploid (2x) and one-season blooming. Cultivated roses may be classified into hybrid tea, floribunda and miniature, and all contain, in the 5 homologous configuration, a KSN gene having a transposon inserted therein. Thus, cultivated roses as used herein denote roses that contain, in the homologous configuration, a KSN gene having a transposon inserted therein. 10 On the other hand, wild roses native to Japan include NOIBARA (R. multiflora Thunb. ex Murray), TERIHANOIBARA (R. wichuraiana Crep.), HAMANASU (R. rugosa Thunb. ex Murray), OOTAKANEBARA (R. acicularis Lindl.), KARAFUTOIBARA (R. marretii Lev.), OOFUJIIBARA, 15 AZUMAIBARA, YAMATERIHANOIBARA (R. luciae Franch. et Rochebr.), YAMAIBARA (R. sambucina Koidz.), KAKAYANBARA, YAEYAMANOIBARA (R. bracteata Wendl.), NANIWAIBARA (R. laevigata Michx.), SANSHOUBARA (R. roxburghii Tratt. var. hirtula (Regel) Rehd. et Wils.), TAKANEBARA (R. 20 acicularis var. nipponensis (Cr6p.) Koehne.), TSUKUSHIIBARA (R. multiflora var. adenochaeta (Koidz.) Makino), MORIIBARA (R. luciae var. hakonensis Franch. et Sav.), FUJIIBARA (R. luciae var. fujisanensis Makino), YABUIBARA, NIOIIBARA (R. luciae var. onoei (Makino) 25 Momiyama), MIYAKOIBARA (R. luciae var. paniculgera (Makino) Momiyama) and usually have, in the homologous configuration, a KSN gene having no transposon inserted therein. Thus, wild roses as used herein denote rose plants that have, in the homologous configuration, a KSN 30 gene having no transposon inserted therein. Indicator gene In accordance with the method of the present invention, preferably the indicator gene is such that: (1) the indicator gene is always present in 35 cultivated roses and not in native wild roses. (2) Cultivated roses are tetraploid (4x), and an indicator gene for crossing must be present in at least -6 three of the four homologous chromosomes, and may preferably be present in all of the four homologous chromosomes. Cultivated roses are tetraploid (4x), whereas native wild roses are diploid (2x). Thus, 5 gametoes produced from cultivated roses may usually be 2x, wild roses may be x, and hybrids produced from the crossing of them may become triploid (3x). Based on this, it is imperative that the indicator gene for crossing be present in at least three of the homologous genes of the 10 cultivated roses. Considering the possibility that a haploid (x) gameto may be produced by heterogenous meiosis from cultivated roses, however, it is preferred, for accurate determination, that the indicator gene is present in all of the four homologous chromosomes. 15 (3) The same sequence as the partial sequence of the base sequence of the indicator gene is not present in the other regions of the chromosome. In order to determine the presence of an indicator gene in the plant of interest, said gene must usually be 20 amplified. For this purpose, it is convenient to use a PCR method using a pair of primers that are homologous to the region of the target gene. In this case, when a sequence that hybridizes with said primer is present in other than the target gene, a result that indicates the 25 presence of the gene may be obtained, even if the native target gene is absent. Thus, this requirement is important in connection with primer designing. Specific indicator gene As a gene that satisfies the above requirement, 30 there can be mentioned a KSN gene having a transposon inserted therein. The KSN gene that is reported as a gene related to the perpetual blooming property of roses (Japanese Unexamined Patent Publication (Kokai) No. 2006 149202) has been demonstrated that it exists as a 35 complete gene encoding 519 amino acids in the wild species whereas in the cultivated-species an about 9 kb - 7 transposon has been inserted in the intron segment. Thus, since this transposon is not present in the wild species but present in the cultivated-species, a KSN gene containing this transposon satisfies the requirement set 5 forth in the above (1). Also, the KSN gene containing this transposon is present in all the four genes of cultivated roses. Thus, this gene satisfies the requirement set forth in the above (2). 10 The KSN gene containing this transposon also satisfies the requirement set forth in the above (3) by primer selection. Primers and probes The base sequence of the KSN gene (SEQ ID NO: 1) and 15 that of a transposon (SEQ ID NO: 2) inserted therein are already known. The KSN gene having this transposon inserted therein is specifically present only in the cultivated roses. In order to detect the KSN gene having this transposon inserted therein by PCR, it is necessary 20 to use, as a pair, a primer having a sequence identical or substantially homologous to the sequence set forth in SEQ ID NO: 1 and a primer having a sequence identical or substantially homologous to the sequence set forth in SEQ ID NO: 2. Furthermore, general conditions as the primer 25 must be met, and any of the primers are an oligonucleotide with a size of 10 bases or more, preferably 15 bases or more, and 50 bases or less, preferably 30 bases or less. From the purpose of the present invention, it is not 30 preferred that both of the primer pair hybridize with region other than said transposon, though the region to be amplified in the transposon is not specifically limited. As an example of a primer pair that satisfies such requirements, there can be mentioned a forward 35 primer: CATATTATGGCATAGGGTGTGGC (SEQ ID NO: 3) and a reverse primer: TGTAATCTGTAGGAGATCCCATGC (SEQ ID NO: 4). Detection of the indicator gene -8 DNA extraction from roses, amplification by PCR etc., and the detection of amplified products may be carried out according to standard methods. 5 Examples Hereinbelow, details of the present invention will be explained with reference to examples. Unless otherwise specified, molecular biological methods used are based on Molecular Cloning (Cold Spring Harbor Laboratory Press, 10 2001), Plant Physiol. (2003) 132, 1652-1663. Reference Example 1. Acquisition of a gene specific to a cultivated rose by the Random Amplified Polymorphic DNA (RAPD) analysis 15 In order to determine the presence of crossing with a cultivated rose in a wild rose, the- detection of gene polymorphism by the RAPD analysis was used in an attempt to obtain a gene that is specifically present only in the cultivated rose. From each leaf of a wild species (R. 20 paniculigera) and a cultivated-species (lavande and WKS82), genomic DNA was extracted using the DNeasy Plant Mini Kit (QIAGEN) according to a method recommended by the manufacturer. A PCR reaction comprising 10 ng of the extracted genomic DNA, 2 ptM of any primer (BEX's Common's 25 primer set, CMN-AOO), 0.4 mM of a dNTP mixture, lx Ex Taq buffer, and 0.05 U of Takara Ex Taq was prepared. The reaction comprised, after reacting at 94 0 C for 5 minutes, 25 cycles of 94*C for 1 minute, 55*C for 1 minute and 72*C for 2 minutes, and finally reacted at 72 0 C for 7 30 minutes. The PCR product obtained was subjected to a 0.8% agarose gel electrophoresis to compare the electrophoretic pattern between the wild species and the cultivated-species. The bands that were specifically detected in the cultivated-species were excised from the 35 agarose gel, and purified by the GENECLEAN Turbo Kit (Funakoshi K.K.) according to a method recommended by the -9 manufacturer. Finally, they were subcloned by the pCR2.1 TOPO vector (INVITROGEN) according to a method recommended by the manufacturer, and were subjected to sequence analysis to determine the sequence. 5 The sequence of each amplified fragment was analyzed. Oligo primers of about 20mer containing a common primer sequence present on both ends of each fragment were created, and the combinations of oligo primers for which amplified products are specifically 10 detected only in the cultivated-species (lavande, WKS82) were examined. With 10 ng of each genomic DNA of R. paniculigera, lavande, and WKS82 as the template, a PCR reaction comprising 2 piM of each oligo primer, lx dNTP mixture, and 0.05 pM of Ex Taq buffer was prepared. The 15 reaction comprised, after reacting at 94*C for 5 minutes, 25 cycles of 94 0 C for 1 minute, 55 0 C for 1 minute and 72 0 C for 2 minutes, and finally reacted at 72 0 C for 7 minutes. The PCR products obtained were subjected to a 0.8% agarose gel electrophoresis to compare the combinations 20 of oligo primers for which amplified products are specifically detected only in the cultivated-species were examined. As a result, the combinations of oligo primers that are thought to provide bands only in the cultivated species were selected, and subjected to an experiment 25 shown in the following Reference Example 2. Reference Example 2. Determination of the presence of crossing in the progeny with the detection of a specific gene as an indicator 30 For plants obtained by artificially pollinating the pollen of a cultivated rose to a wild rose, the presence of crossing was determined using as an indicator the detection of a gene specific to the combination of oligo primers thought to be cultivated-species specific 35 obtained in Reference Example 1. From the leaf of each progeny obtained, genomic DNA was extracted using the - 10 DNeasy Plant Mini Kit (QIAGEN) according to a method recommended by the manufacturer. Then using this as the template, 2 ptM of the primer, 0.4 mMi of a dNTP mixture, lx Ex Taq buffer and 0.05U of 5 Ex Taq were subjected to the reaction. The reaction comprised, after reacting at 940C for 5 minutes, 25 cycles of 94*C for 1 minute, 55*C for 1 minute and 72*C for 2 minutes, and finally reacted at 72 0 C for 7 minutes. The PCR product obtained was subjected to a 0.8% agarose gel 10 electrophoresis to confirm the detection of specific bands. However, though the individual plant morphology apparently exhibited an intermediate trait, no correlation with the presence of specific bands was obtained. This suggested that the RAPD marker obtained 15 here may not be the one contained in all of the four homologous chromosomes, but may be derived from a gene sequence present only on some of the four homologous chromosomes of the cultivated-species. Thus, it was determined to be inappropriate as an indicator for the 20 presence of crossing. Working Example 1. Determination of the presence of crossing in the progeny with the detection of the KSN gene as an indicator 25 The pollen of a cultivated rose was pollinated to a wild rose, and for the plant obtained, the presence of crossing was determined using as an indicator the detection of the KSN gene (W02004/070036) containing a transposon that is known to be specifically detected in 30 perpetual blooming roses. A plus strand primer on this gene and a reverse strand primer on the inserted transposon were designed and prepared so as to enable the determination of the presence of insertion of a transposon. 35 From the leaf of each progeny obtained by artificial crossing, genomic DNA was extracted using the DNeasy - 11 Plant Mini Kit (QIAGEN) according to a method recommended by the manufacturer. Using this as the template, a total of 2.5 ml of a reaction comprising 0.2 pM each of a forward primer KSN1F3: 5'-CAT ATT ATG GCA TAG GGT GTG GC 5 3' (SEQ ID NO: 3) and a reverse primer KSNlnsR3: 5'-TGT AAT CTG TAG GAG ATC CCA TGC-5' (SEQ ID NO: 4), 0.2 mM of a dNTP mixture, 1x Ex Taq buffer, and 0.625 U of Ex Taq was prepared and was subjected to reaction. The reaction comprised, after reacting at 94'C for 5 minutes, 25 cycles 10 of 940C for 1 minute, 55'C for 1 minute and 720C for 2 minutes, and finally reacted at 72*C for 7 minutes. The PCR product obtained was subjected to a 0.8% agarose gel electrophoresis to confirm the detection of a specific band of about 1.2 kb. Also, it was confirmed that the 15 morphology of the individual plant obtained exhibited an intermediate trait of those of the cultivated species and the wild species. Thus, for the involve plants that can be determined from the morphology to be a cross of the cultivated 20 species and the wild species, the presence of the transposon-containing KSN gene was confirmed. Based on this, it was determined that individual plants that have no transposon-containing KSN gene are not a cross of the cultivated-species and the wild species. Considering this 25 characteristic, it was indicated that when a species having no transposon-containing KSN gene was used as the distaff side, the identity of cross can be determined by confirming the presence of a transposon-containing KSN gene in the progeny individual plant. 30 Working Example 2. Determination of the presence of a KSN gene in wild roses For the purpose of determining whether a wild rose could be a subject for the determination method of the 35 present invention, the presence of a transposon containing KSN gene in each wild rose was evaluated. As - 12 wild roses, NOIBARA (R. multiflora Thunb. ex Murray), TERIHANOIBARA (R. wichuraiana Crep.), HAMANASU (R. rugosa Thunb. ex Murray), OOTAKANEBARA (R. acicularis Lindl.), KARAFUTOIBARA (R. marretii Lev.), OOFUJIIBARA, 5 AZUMAIBARA, YAMATERIHANOIBARA (R. luciae Franch. et Rochebr.), YAMAIBARA (R. sambucina Koidz.), YAEYAMANOIBARA (R. bracteata Wendl.), NANIWAIBARA (R. laevigata Michx.), SANSHOUBARA (R. roxburghii Tratt. var. hirtula (Regel) Rehd. et Wils.), TSUKUSHIIBARA (R. 10 multiflora var. adenochaeta (Koidz.) Makino), MORIIBARA (R. luciae var. hakonensis Franch. et Sav.), FUJIIBARA (R. luciae var. fujisanensis Makino), YABUIBARA (R. luciae var. onoei (Makino) Momiyama), MIYAKOIBARA (R. luciae var. paniculgera (Makino) Momiyama) were used to 15 determine the presence of a transposon-containing KSN gene (W02004/070036) according to a method described in Working Example 1. As a result, no specific amplified product (predicted amplified size: about 1.2 kb) of the 20 transposon-containing KSN gene was detected from any of wild roses. On the other hand, the amplified product of the GAPDH gene that served as the internal control was detected in all the wild species. Thus, in these wild roses, the presence of a transposon-containing KSN gene 25 was not recognized. From the foregoing, it was determined that the method of the present invention that uses a transposon containing KSN gene as the indicator can favorably use a wild rose as a test subject. 30 Working Example 3. Validation of the presence of crossing with a cultivated rose in the progeny obtained by artificial crossing For a progeny individual for which the seed parent 35 is a wild rose and the pollen parent is a cultivated rose, the presence of crossing was evaluated using the determination method of the present invention.
- 13 According to a standard method, immediately before flowering of a wild species,- emasculation and bagging were carried out, and when the stamen reached full maturity, the pollens of the host (WKS82) and a 5 transformant (WKS82/130-4-1 and WKS82/130-9-1) were attached in the morning of a fine day. Then, bagging was carried out again to prevent the attachment of other pollens, and the presence of seed formation was examined. The pollen used was obtained by recovering the anther 10 before cleavage, which was allowed to stand in a desiccator having silica gel, and then to obtain the fresh pollen from the anther that cleaved the next day. As the mother plant for crossing, the wild species used were R. multiflora Thunb. ex Murray, R. wichuraiana 15 Crep., and R. rugosa Thunb. ex Murray. The presence of seed formation was confirmed for the fruit for which no physiological fruit drop was noted but fruit set was noted at the time point of more than 2 months after crossing. Furthermore, the seeds obtained 20 were recovered, and after a chilling treatment at 40C for 3 months, they were sown. In order to confirm the presence of crossing with the host or the transformant and the presence of transmission of the transgene in them, a PCR method was performed according to a method 25 described in Working Example 1 for analysis. When the seeds were subjected to a chilling treatment, budding, which is usually observed in about one month, was not observed even after the passage of 3 months. Thus, a portion of the sown seeds that did not 30 bud was recovered again, and was sown for a similar analysis. From the seeds recovered again, genomic DNA was extracted using the Nucleon PHYTOPURE for PLANT DNA EXTRACTION KIT (Amersham Biosciences) according to a method recommended by the manufacturer. Furthermore, 35 after amplifying this by the REPLI-g Midi Kit (QIAGEN), the presence of crossing with the host or the transformant and the presence of transmission of the - 14 introduced gene in them was analyzed by a PCR method using as the indicator the presence of a KSN gene having a transposon inserted therein. As the internal control, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was 5 used. GAPDH gene-specific primer Rh GAPDH-237F: 5'-TGT CAT CTC TGC CCC AAG TAA GG-3' (SEQ ID NO: 5) Rh GAPDH-724R: 5'-CAA CAT CCT CAT CGG TGT AAC CC-3' 10 (SEQ ID NO: 6) The results are shown in Table 1 and Table 2. The rate of fruit set was very low even when either of the host and the recombinant was used as the pollen parent. The seedling obtained was analyzed by a PCR method, in 15 which a transposon-containing KSN gene was detected and crossing of the wild species with the host or the transformant was recognized, but the transgene derived from the transformant was not detected. Furthermore, when the sown seeds that did not bud were recovered again and 20 observed whether they were sound or not, most of them were "empty (no content of seed)" and normal embryos were confirmed only for a fraction of plants. For these, a similar analysis was performed by the PCR method, in which a transposon-containing KSN gene was detected and 25 crossing of the wild species with the host or the transformant was recognized, but the transgene derived from the transformant was not detected. It was thought from this that the transgene was not transmitted to the progeny, because, for example, the transgene was not 30 contained in the pollen cell of the transformant. Thus, it was thought that even if the transformant was crossed with the wild species (R. multiflora, R. wichuraiana, and R. rugosa), there is no possibility of the transgene being transmitted to the progeny, because, 35 for example, the transgene was not contained in the pollen cell of the transformant. For R. wichuraiana, no normal embryos were confirmed - 15 in any seed. Thus, by using the determination method of the present invention, the presence of crossing between a wild rose and a cultivated rose can be very easily 5 evaluated. Also when the transgene cannot be transmitted to the progeny, because, for example, the transgene is not contained in the pollen cell of the transformant, generally the analysis of crossing is often difficult. However, by using the determination method of the present 10 invention, the presence of crossing can be easily determined. Thus, first the presence of crossing is determined using the determination method of the present invention and when it is determined to have been crossed, it is possible to estimate whether the transgene is 15 present in the germ cell of the crossing parent by investigating the presence of the transmission of the transgene.
- 16 C a) C a) o r. 0 a -4 " ) C) CD * 4-4 w C> -o In 0 o 0 C 0 n 0 -I 0 0 o 0 zo -o C o o to (.-I a a) a) a) '0 # -, -, 0 > 3 In 0~ 0> 3 I - a-- -H 10H 1~) 0 (1)-) H o p*0 )W M U)4-1 . 0 C 0 .) 4 MW 44 0r0C o t a) 4-4 Z -A 4- 4J -J 3: o 0 ON Z -1 44 o- oJ '-) 4-H-4.C 01 0 _ __ - -D -C 4 4 'O m o o o 0 ->0 C 0 - -3 C f). a ) .. . 4 0 C0 a 1 0 -14 D o : -zo -H In 0 'n~) I -HC oo - 4-) C C) om CD 0 o -4 U) 0()()V 0 *0 -0 r- m-~- C) m 4a -14 C o -0 > 0-a 0 In > 0 H-- to0 0 In -H 0 0 Vn- .1 44 4-4 . '0 - *0 44 O 0 -'0 O 0 4 r- 0 : M O4r :3 C z - z .n r- 7. -- 1 z. (0 f o -L 0H -) EOH ) 0144 (a o Uo o, I- El ra 4- ) (N N 2 0 o) oD 0 00) 0 0 () Z4- ~ Z4-~ 0 0 1_4 0 01 -a o .O ) )-H0 U) 4 1 43 :54-) 42-) )! 3 a) o1 $4 do)e2 o o to Z m a4-4IV ) C eI Un Ln 0) 0 0-Z Ia) 1 T Dm4-4 0 (1) 4 -flko S--- I ---- - Cl )4J H 0H 00u Ln)1j4- I4 0 0 W H U 0 1) 4In 1 0W()4-4 Z14-4In0m14 ' -U V 0 U -W -0 0) a,-4 4- H - 4 0-H - C 00 - -0 o -4 U) t o4- 0' - ) o) -1 O0' - 'O C (0 (a - .
4o- o-o o o -H O o 0 4 to 4-0I 0- H V) V o (N In- 0l (N InH0 yZ -H-fo 0 -HZ0 o O H 1 4 C 144 W S M 0 Uo > 0 -10U)>0 N V )l NH~ O Hn 0)- 0 0 D - 0 U -f) 0 w r 0:sC)00wc0) : X- zU Q 4z z 0 d4) 0 r-I U)(Y 4- o 4- m o a -o E- U) 0 0 C)0 0 oo - o -H 44 0H -p 0I HO0 H M -- '-J 4- ) r o r r 4- 4 (0- 0L -) 44 )- (l0n 41 n .3 - - ) -' In (av. o4 .C oa * 0 -H 00- D - -00 01-)4-4 4-4 m( 0 a) - 0 1) 1-4 H( -, I- U .1 .- .1 - . .
E- t -1 : : a) c4 V):C (0 4- 4) (-4( 41 0-4O m N o to0-' 0 -04-J4(0 44-( ~-4 0 H ~-H .- Q U~U r: to i4 -17 r-4-) ( 0) 0 r 1 4 4-4 () 0 ~ 4-)O0 0 -II (a) 4
-
4 ) 4- ) n w 0 44 - S 0 U) 0 (l 4-1 Q) U) 0 V~~ -0~0) -I44 -,- .9 0) 4 ' o0 0 -o o4 l Ml 0 > U) C) I 4 *f CO ( ) N -H i 0(4 ~0 0 C 4 M ) 44 ZH -1 ZH4- 444-) 1 0 - - - rH Cf) Q) CR ~a)c*4-4 C) m (a .- 4 44 a) CD0- 0D U) 0 4- 4- 0 0)N ) I) l 4 u ) C; * D4 a) 00) r_ C'j M 04w >10) IOC- WdP 0 4J4J0Q 4J0 4: U1 (V 4-) 0 0 <D ) Cl) 0 04 ~ a) a) - 0 0) ~44 4J) -U) aF aV o ) C - 0))0 -H 4 ( 4-r. 1-40 0 0 x u Q) Q) 1 ) C) 0 U) >0 -4 44 4-Jd0 UR 4-J (VN '- '- 44~ U)'- .,A C C)ID 0 4 U) u a)>5,0 C)ClC) U . 0- a 4- 0C p))~ r_-4 0 :J: 0l Cl c 4 0' WJa C 4: 4: 04 C 0 O -H > coc V)- V t) Cl) CO 0 t64 0 0 04 0 7- 4Z cn 04-J 0 U) 04 1 W- 0 )) 0 ul 4J~U* 0: 04-) U0 M~- 4 Q) ~Z 04 Cl 0l 00)4 J Q ) -4 0) 4- 44 Z~ 44 04 a)) 4 0 U a)Z cm) 0 i 01 z- 0)a o o 1~-4 (D mU,) )3 - a Cl) 4-: 0) 0U > 0 4 0-4 0 0 cUc 44p E-) o o0 w04N Z 4U0U440 44: U- )0 U) (l) 0 W 4-4C: 44 (D 4 - u0(01c0 4i 0 4-4 4i 0I -; U- 0~t 0 lH 004 f w~ cZ0 -IZ a4) 040 OD~ -111 014 U ) 0 Q (4 4 -H: ) >11 al 4:1 H 0 00 0 (1 -H) l z- a) Q) 4-4C) ZJ U)U ' (DH 04i 0- :) L 0 0 -H 1-)U -1( 0 .4-4 0 0)__>_0_-1 0 0u QU) 00)DU)0 r a) ) r Q4J U 4-4 0 -4 )0a 0 u 1-i 04 -4 Z04J rf -H-r- 04 ( 4 Z 0 0 N~)-~ -4 C-:-H 4 :3 Z 4 -U0C)- -H a~) 4: .4. 4-4 0 o U H0 Cl) 6 0 - 4C )0 P.A 4 4 0~~~*0 a)~ 0 )1 4 D * C H 0- _) 04z ()r L , 4- 'H 0-)4) Z44) 0 (f 04 4-J -0 J .. ) -HU 44~U C)l 0 (4) -H 4-) 0 W C 0 ( U) -4 0 4--40 0 () Cl) : 040 0 F M4~ __ _ __ _ _ Z )0 U4+4N - 4: 4l) Cl - 18 0 0 0 4-)C) 0-P Qu 0 0'0 44 ) a)Q 0 44j~ 0 H0) 00a u~ ) u a c ) 0) o 0)) w U r0- 4 4 4J -4 U) C: 44 -4 (0 M0ou1 '0 00 0 M o 0 01m C)C 04 4J * 4- CU4J V * -J0 0 z_ Z H> _Z '0 -~4> -0- 0.0 0-H1 00C 4 D U) C C I a) v C 3 I 4JO--0 4jQ 0 0 (0 4 m 4- U) U U) a 44 a ~ ) 44 a) u ) ) I m 0)CC ~ '0 0)o U) .1 (0C'NCtJ 4 InI.Ui - o lo - 1 0 Ii-r.0 V)~ ~ ~0- 0 0 -- 1V )oo 4 in z) ZOO0-HA a) ~0 zc0 -,1> -o 0 - w 0 0 U) 4J 44C) -1440 W fVC 1 U)I -1:O 4 U)-i :) 0C E U -H 0 o 00 I0 - 0-H0 00 0 -- 0O H -- 0 Z( -A 00 U)(1 -i (0 44 -I N 0)r H44 -1O 144 4.0 1(0 >1 (N 40 J>1 O 0 r.. r- 0 r_ -,-I r1 z -4H>(0 z -H4 >_( '-I ~ U) -4 U) I. (o -0 00 m a PO 0 4-4 a) 0- 0 04)( F. z 0 E- ZO0U) ~H 4- 41J 0 -H1 0oJ -H )C 34-) ~ 4J :14- ~ 41 0C -0 L4-4 ) 0_ 1 4a ~ El Z '0 44U)[IZ 0 44 1 (0 0 04J 0-0 00 4-i 00 U) ON.-,- 0') 0-4 C)C)0 C 10H 00) 0H0 U) U 0- 0)~ 0 o0 D u a)0 E 00c *0 U) r 0 U) 4-0) 4-'0 0)w r -4i 0) U -0 0)w -1 00 I )- O 0 0 I c 0 H > -~~~ ~~ u 0)- >O''m ~ 0- 0 0 0 44 a) u 440O- ) 4 0H a U()OU-H a))Z0OU- (o 0 -0 6) 0~ '0 U ~. 0 'a 0 $4 0 r - -1i U) -) U) a) - V) a) o 4-4 HN 0 C 4 HiN C) U) -HV- , ~ 4) -H,I 3- ()4 0 0 *'0a0co 0 1010 fu -4 0 -Hr- ~0 r H f 0-1 U) -- 4 U) 00 m 0 -40 O -4 W) o n 1 ) 4) E- zO0 En E-'zO0U) M(4 -4 4-) (U) (o -H 1.0 f LO -HAko L 0 04W 00) (1-4 0 0 444. WW E- Z 04-4 U) E- Z 044 V) 0 ~ U) 10 U) 10 Q -H J44 ) t-4 0)( 4- '0 30 "o-x0 w 0 MY 4 E- Z 44. -- -Z4- .0 w) a ) EH (0 (a U) ul E-~ 4 C0 - 19 Working Example 4. Validation of the presence of crossing between a wild rose and a cultivated rose under natural conditions Using the determination method of the present 5 invention, the presence of crossing between a wild rose and a cultivated rose under natural conditions was evaluated. In the open air, the wild species (R. multiflora) was placed at a distance of 1m and 5m from the host or 10 the transformant to investigate crossing with the wild species under natural conditions. This study was carried out under a condition in which the host and the transformant and R. multiflora were flowering simultaneously. The flowers of R. multiflora that were 15 flowering before the start of this study were all removed at the start of this study, and then placed at a predetermined position. The presence of seed formation was confirmed for the fruit for which no physiological fruit drop was noted but 20 fruit set was noted at the time point of more than 3 months after the completion of the study. Furthermore, the seeds obtained were recovered, and after a chilling treatment at 4*C for 3 months, they were sown. In order to confirm the presence of crossing with the host or the 25 transformant and the presence of transmission of the transgene in them, a PCR method was carried out according to a method described in Working Example 1 for analysis. The result is shown in Table 3. For the seedlings obtained from the seeds harvested from any position, no 30 transposon-containing KSN gene was detected or no crossing of the host or the transformant with R. multiflora was noted. This suggested no or very low possibility of crossing of the present transformant with the wild 35 species (R. multiflora) under natural conditions. Thus, by using the determination method of the present invention, the presence of crossing between a - 20 wild rose and a cultivated rose could be very easily evaluated. Also when the transgene cannot transmitted to the progeny, because, for example, the transgene is not contained in the pollen cell of the transformant, 5 generally the analysis of crossing is often difficult. However, by using the determination method of the present invention, the presence of crossing can be easily determined, and thus, the presence of transmission of the crossing-transgene could also be easily analyzed.
-21 (1 (!I 4-j o o o o o o oo a) U)4 H- 00 0 00 0 00 0 0 U ( 4-i> 4-i)(I 0~ Co - 0 0) ~ U)0 U 4- (- )ciIDC r N (3) 00( - O0 1 0~ Uf) >- 0- -- N mO I I o10U)O U) 0 0 0 w Q) 04 1 aH 0 U) Q)''H 4-) ( U) W)* X- a4U 1 ) 4-4 0 0 d)1 0) ~ I U4 a) J V) 0~ 4-) U) U) x 0 ) > 4-4 >0 0 W ml 0 rQ 00 >)~' -H a,,-, U -C- ' E- M 0 r_ J i 0 4J~'1 4-1 )~ 04 0 ) 0 0 M 4-4 0 ~ U >. ) )C),. - f L O ) i CC) (Ii r- N fl N -4 0V-'aHr- -4 -IN LOODr-NH C. C~l( M, D 0 ) O OD 44 '0'- U)~ wIj m- -1 U s- 1 0_ _ Uf) M U)4- : r O D ( 0- U) U -1i 0N 4-4 (-i 0 U) z) 0 ) a) 01- U) >)U U) -H -1 4-4 U) (0D(0 ) N ) -) 0 ) U1 L N N r - 11- D Cl r - ) - 4 4J U) 0 r- U U)4- E U)N~0 V)4 N -4 0 ) H m w 0 U) '-I *- 0 04 -. 0 CAN 4J 0 L N "0N -IT r (D0 (a a) 4:.) 4-)~I-I N.- 4J. ~ 4 w~ 0 C U 4J 0 Z 44~ 4J 0* U) Q) :? 0 U) '4- 0 0 0)0 C)C 0C ) 4) 4 4- J >1 0 4-3 () C) 0 0 D C) 000 C: 00CD0 CD 0 t- *, - 0 U m 0 tr)4-4 a) ra 0H' -1H- >1 mr 4- (n U)) U M-H-H-o -H0 -0 (a-H 0H aH-z -H H H-H 0H-H 0)~ !HHHH-----IHHHH- 5-- 4-i :30 U) S 1) 0 Q) U)U IY4~~~ U) . U) . . .(1 L, W r 0 )( ) or *-4 U) 0:: ,Q al U) 040 mU) Z)SE E- ~-N 5- -H- U1) - 22 Working Example 5. Validation of the presence of crossing with a cultivated rose in the seeds harvested from a native wild rose Using the determination method of the present 5 invention, the presence of crossing between a native wild rose with a cultivated rose under normal conditions was evaluated. According to a method described in Working Example 3, from the seed harvested from a native wild rose, a PCR 10 analysis was conducted using the presence of a KSN gene having transposon inserted therein as the indicator to validate the presence of crossing with a cultivated rose. As the internal control, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used. 15 Result and Discussion The results are shown in Fig. 1 and Table 4. In the analysis on about 1800 seeds harvested from a total of 17 sites, no specific amplified products 20 (predicted amplified size: about 1.2 kb) of a transposon containing KSN gene were detected from any of the seeds. On the other hand, the GAPDH gene that served as the internal control was detected in all the individuals. From the foregoing, it was determined that there is 25 no crossing with a cultivated-species in all the seeds harvested from the native wild roses. Thus, by using the determination method of the present invention, the presence of crossing between a wild rose and a cultivated rose could be very easily 30 evaluated.

Claims (16)

1. A method of determining whether or not a wild rose of interest is crossed with a cultivated rose, which comprises investigating the presence of a KSN gene 5 containing an indicator transposon.
2. The method according to claim 1 wherein the wild rose of interest is determined not to be crossed with a cultivated rose when a KSN gene containing an indicator transposon is not present in said wild rose of 10 interest..
3. The method according to claim 1 wherein the wild rose of interest is determined to be crossed with a cultivated rose when a KSN gene containing an indicator transposon is present in said wild rose of interest. 15
4. The method according to any one of claims 1 to 3 wherein the seed parent is a wild rose and the pollen parent is a cultivated rose.
5. The method according to any one of claims 1 to 4 wherein said cultivated rose is a rose having a gene 20 inserted therein.
6. The method according to any one of claims 1 to 5 wherein said gene is a gene related to flower color.
7. The method according to claim 6 wherein the gene related to flower color is the gene of the flavonoid 25 3',5'-hycroxylase enzyme derived from pansy of the family Violaceae.
8. The method according to any one of claims 1 to 7 wherein the detection of said indicator gene is carried out via hybridization of nucleic acids of said gene. 30
9. The method according to any one of claims 1 to 7 wherein said detection is carried out via specific amplification by PCR.
10. The method according to claim 9 wherein said PCR is carried out via a forward primer: 35 CATATTATGGCATAGGGTGTGGC (SEQ ID NO: 3) and a reverse primer: TGTAATCTGTAGGAGATCCCATGC (SEQ ID NO: 4).
11. The method according to any one of claims 1 to - 24 10 wherein said wild rose is a rose plant that has, in the homologous configuration, a KSN gene not-containing a transposon.
12. The method according to any one of claims 1 to 5 11 wherein said wild rose is NOIBARA (R. multiflora Thunb. ex Murray), TERIHANOIBARA (R. wichuraiana Crep.), HAMANASU (R. rugosa Thunb. ex Murray), OOTAKANEBARA (R. acicularis Lindl.), KARAFUTOIBARA (R. marretii Lev.), OOFUJIIBARA, AZUMAIBARA, YAMATERIHANOIBARA (R. luciae 10 Franch. et Rochebr.), YAMAIBARA (R. sambucina Koidz.), KAKAYANBARA, YAEYAMANOIBARA (R. bracteata Wendl.), NANIWAIBARA (R. laevigata Michx.), SANSHOUBARA (R. roxburghii Tratt. var. hirt'ula (Regel) Rehd. et Wils.), TAKANEBARA (R. acicularis var. nipponensis-(Cr6p.) 15 Koehne.), TSUKUSHIIBARA (R. multiflora var. adenochaeta (Koidz.) Makino), MORIIBARA (R. luciae var. hakonensis Franch. et Sav.), FUJIIBARA (R. luciae var. fujisanensis Makino), YABUIBARA, NIOIIBARA (R. luciae var. onoei (Makino) Momiyama), MIYAKOIBARA (R. luciae var. 20 paniculgera (Makino) Momiyama).
13. The method according to any one of claims 1 to 12 wherein said cultivated rose is a rose plant that has, in the homologous configuration, a KSN gene having a transposon inserted therein. 25
14. The method according to any one of claims 1 to 13 wherein said cultivated rose is hybrid tea, floribunda or miniature.
15. A primer pair for amplifying a KSN gene containing an indicator transposon in a method of 30 determining whether or not a wild rose of interest is crossed with a cultivated rose, said pair comprising a primer having a base sequence identical or substantially homologous to the region of the base sequence set forth in SEQ ID NO: 1 and a primer having a base sequence 35 identical or substantially homologous to the region of the base sequence set forth in SEQ ID NO: 2.
16. The primer pair according to claim 15 - 25 comprising a forward primer: CATATTATGGCATAGGGTGTGGC (SEQ ID NO: 3) and a reverse primer: TGTAATCTGTAGGAGATCCCATGC (SEQ ID NO: 4).
AU2008230321A 2007-03-23 2008-03-21 Method for determination of presence of crossing with garden-species rose plant in wild-species rose plant Expired - Fee Related AU2008230321B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
JP2007-077882 2007-03-23
JP2007077882 2007-03-23
PCT/JP2008/056000 WO2008117860A1 (en) 2007-03-23 2008-03-21 Method for determination of presence of crossing with garden-species rose plant in wild-species rose plant

Publications (3)

Publication Number Publication Date
AU2008230321A1 true AU2008230321A1 (en) 2008-10-02
AU2008230321A2 AU2008230321A2 (en) 2009-10-15
AU2008230321B2 AU2008230321B2 (en) 2013-04-04

Family

ID=39788591

Family Applications (1)

Application Number Title Priority Date Filing Date
AU2008230321A Expired - Fee Related AU2008230321B2 (en) 2007-03-23 2008-03-21 Method for determination of presence of crossing with garden-species rose plant in wild-species rose plant

Country Status (12)

Country Link
US (1) US8206928B2 (en)
EP (1) EP2128274B1 (en)
JP (1) JPWO2008117860A1 (en)
KR (1) KR20090125086A (en)
CN (1) CN101617058A (en)
AU (1) AU2008230321B2 (en)
CA (1) CA2681297A1 (en)
CO (1) CO6141480A2 (en)
EC (1) ECSP099647A (en)
ES (1) ES2462944T3 (en)
TW (1) TW200846476A (en)
WO (1) WO2008117860A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108841992A (en) * 2018-07-26 2018-11-20 安徽中医药大学 Identify the molecular specificity labeled primers and method of the fleece-flower root and the rib branch fleece-flower root
CN109258456B (en) * 2018-11-06 2022-04-08 兰州市农业科技研究推广中心 Artificial pollination method for Chinese rosa laevigata

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5480789A (en) 1991-04-01 1996-01-02 Florigene Europe B.V. Genetically transformed rose plants and methods for their production
US5948955A (en) * 1991-07-13 1999-09-07 International Flower Developments Pty Ltd Transgenic plants having altered anthocyann levels
GB9518731D0 (en) 1995-09-13 1995-11-15 Innes John Centre Flowering genes
DE10222632B4 (en) * 2002-05-17 2006-03-09 Con Cipio Gmbh Microsatellite markers for genetic analysis and for the differentiation of roses
JP2006149202A (en) 2003-02-04 2006-06-15 Wakunaga Pharmaceut Co Ltd Protein and gene participating in perpetual blooming of angiosperm
JP2004275048A (en) * 2003-03-14 2004-10-07 Rikogaku Shinkokai Dna and protein controlling number or size of plastid

Also Published As

Publication number Publication date
CN101617058A (en) 2009-12-30
AU2008230321A2 (en) 2009-10-15
JPWO2008117860A1 (en) 2010-07-15
EP2128274A4 (en) 2010-07-07
ECSP099647A (en) 2009-10-30
EP2128274A1 (en) 2009-12-02
CO6141480A2 (en) 2010-03-19
KR20090125086A (en) 2009-12-03
WO2008117860A1 (en) 2008-10-02
CA2681297A1 (en) 2008-10-02
AU2008230321B2 (en) 2013-04-04
EP2128274B1 (en) 2014-05-07
TW200846476A (en) 2008-12-01
US8206928B2 (en) 2012-06-26
US20100143914A1 (en) 2010-06-10
ES2462944T3 (en) 2014-05-26

Similar Documents

Publication Publication Date Title
Su et al. A genomic variation map provides insights into the genetic basis of spring Chinese cabbage (Brassica rapa ssp. pekinensis) selection
Stockhaus et al. Organ-specific and dosage-dependent expression of a leaf/stem specific gene from potato after tagging and transfer into potato and tobacco plants
Huang et al. DNA methylation and genome rearrangement characteristics of phase change in cultured shoots of Sequoia sempervirens
KR20190053406A (en) Markers for identifying floury endosperm characteristics and use thereof
CN105543222B (en) The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application
Groot et al. Expression patterns of STM-like KNOX and Histone H4 genes in shoot development of the dissected-leaved basal eudicot plants Chelidonium majus and Eschscholzia californica (Papaveraceae)
AU2008230321A1 (en) Method for determination of presence of crossing with garden-species rose plant in wild-species rose plant
CN100540665C (en) Regulate the gene of plant branching, contain the carrier of this gene,, and utilize this microorganism to regulate the method for plant branching by this carrier microorganism transformed
Frediani et al. Redundancy modulation of nuclear DNA sequences in Dasypyrum villosum
US20140013468A1 (en) Extending juvenility in grasses
McCouch et al. 13 The Dynamics of Rice Domestication: A Balance between Gene Flow and Genetic Isolation
KR102032498B1 (en) Markers for identifying floury endosperm characteristics and use thereof
Wang et al. Improved forage quality and biomass yield of alfalfa (Medicago sativa L.) by Arabidopsis QQS orphan gene
Moullet et al. Pyramiding wheat pre-harvest sprouting resistance genes in triticale breeding
Gautam et al. Development of white-grain pre-harvest sprouting tolerant and pyramided protein-rich leaf rust resistant wheats using molecular breeding
Abo Youssef et al. Estimating the genetic purity in cytoplasmic male sterile (CMS) lines of Egyptian rice
Guo et al. Identification of quantitative trait locus for seed dormancy and expression analysis of four dormancy-related genes in sorghum
Mahender et al. Physiological and molecular profiling of rice genotypes under drought stress
CN110184383A (en) Molecular marker panel and its application in Genes of Pre-harvest Sprouting molecular labeling
Wiedemann et al. Intergeneric hybrids between species Of Hydrangea and Dichroa-their germination in vivo and in vitro and molecular verification by RAPD analysis
Youssef et al. Estimating the genetic purity in cytoplasmic male sterile (CMS) lines of Egyptian rice.
Kwak et al. Application of RAPD and SI-typing techniques to confirm genetic integrity of radish (Raphanus sativus L.) varieties
Jayanthi et al. Biotechnological tools to Detect Somaclonal Variation in Oil Palm.
US20190264192A1 (en) Plant tissue collection, rna extraction and genetic analysis
dos Santos Aluminum tolerance in Secale species: genetic diversity, molecular mechanisms and gene characterization

Legal Events

Date Code Title Description
DA3 Amendments made section 104

Free format text: THE NATURE OF THE AMENDMENT IS AS SHOWN IN THE STATEMENT(S) FILED 14 SEP 2009

PC1 Assignment before grant (sect. 113)

Owner name: SUNTORY HOLDINGS LIMITED

Free format text: FORMER APPLICANT(S): INTERNATIONAL FLOWER DEVELOPMENTS PROPRIETARY LIMITED

MK25 Application lapsed reg. 22.2i(2) - failure to pay acceptance fee