AU2007342068A1

AU2007342068A1 - miR-16 regulated genes and pathways as targets for therapeutic intervention

Info

Publication number: AU2007342068A1
Application number: AU2007342068A
Authority: AU
Inventors: Andreas G. Bader; David Brown; Mike Byrom; Charles D. Johnson; Lubna Patrawala
Original assignee: Asuragen Inc
Current assignee: Asuragen Inc
Priority date: 2006-12-08
Filing date: 2007-12-31
Publication date: 2008-07-17
Also published as: WO2008085797A8; WO2008073923A2; IL199161A0; AU2007333110A1; WO2008073923A3; EP2102342A2; EP2102341A2; WO2008085797A3; WO2008085797A2; CA2671302A1

Description

WO 2008/085797 PCT/US2007/089206 DESCRIPTION miR-16 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION [0001] This application claims priority to US provisional application number 60/882,758 filed December 29, 2006 and PCT application PCT/US07/87038, filed December 10, 2007, both of which are incorporated herein by reference in their entirety. [0002] This application is related to U.S. Patent Applications serial number 11/141,707 filed May 31, 2005 and serial number 11/273,640 filed November 14, 2005, each of which is incorporated herein by reference in its entirety. BACKGROUND OF THE INVENTION I. FIELD OF THE INVENTION [0003] The present invention relates to the fields of molecular biology and medicine. More specifically, the invention relates to methods and compositions for the treatment of diseases or conditions that are affected by miR- 16 microRNAs, microRNA expression, and genes and cellular pathways directly and indirectly modulated by such. II. BACKGROUND [0004] In 2001, several groups used a cloning method to isolate and identify a large group of "microRNAs" (miRNAs) from C. elegans, Drosophila, and humans (Lagos Quintana et al., 2001; Lau et al., 2001; Lee and Ambros, 2001). Several hundreds of miRNAs have been identified in plants and animals - including humans - which do not appear to have endogenous siRNAs. Thus, while similar to siRNAs, miRNAs are distinct. [0005] miRNAs thus far observed have been approximately 21-22 nucleotides in length and they arise from longer precursors, which are transcribed from non-protein-encoding genes. See review of Carrington et al. (2003). The precursors form structures that fold back on themselves in self-complementary regions; they are then processed by the nuclease Dicer in animals or DCL1 in plants. miRNA molecules interrupt translation through precise or imprecise base-pairing with their targets. [0006] Many miRNAs are conserved among diverse organisms, and this has led to the suggestion that miRNAs are involved in essential biological processes throughout the life WO 2008/085797 PCT/US2007/089206 span of an organism (Esquela-Kerscher and Slack, 2006). In particular, miRNAs have been implicated in regulating cell growth, and cell and tissue differentiation; cellular processes that are associated with the development of cancer. For instance, lin-4 and miR-16 both regulate passage from one larval state to another during C. elegans development (Ambros, 2001). mir- 14 and bantam are Drosophila miRNAs that regulate cell death, apparently by regulating the expression of genes involved in apoptosis (Brennecke et al., 2003, Xu et al., 2003). [0007] Research on miRNAs is increasing as scientists are beginning to appreciate the broad role that these molecules play in the regulation of eukaryotic gene expression. In particular, several recent studies have shown that expression levels of numerous miRNAs are associated with various cancers (reviewed in Esquela-Kerscher and Slack, 2006). Reduced expression of two miRNAs correlates strongly with chronic lymphocytic leukemia in humans, providing a possible link between miRNAs and cancer (Calin et al., 2002). Others have evaluated the expression patterns of large numbers of miRNAs in multiple human cancers and observed differential expression of almost all miRNAs across numerous cancer types (Lu et al., 2005). Most studies link miRNAs to cancer only by indirect evidence. However, He et al. (2005) has provided more direct evidence that miRNAs may contribute directly to causing cancer by forcing the over-expression of six miRNAs in mice that resulted in a significant increase in B cell lymphomas. [0008] Others have shown that miR-16 is down-regulated in B-cells from patients with chronic lymphocytic leukemia (Calin et al., 2002). Reduced expression of these miRNAs in B cell lymphomas results in overexpression of a miR-16 target gene, BCL2, and subsequent inhibition of apoptosis by the BCL2 gene product. Reduced expression of miR-16 results in uncontrolled cellular proliferation and B cell malignancy (reviewed in Calin and Croce, 2006). Together these data suggest that miR-16-1 appears to function as a tumor suppressor in human B cells. [0009] The inventors previously demonstrated that hsa-miR-16 is involved with the regulation of numerous cell activities that represent intervention points for cancer therapy and for therapy of other diseases and disorders (U.S. Patent Applications serial number 11/141,707 filed May 31, 2005 and serial number 11/273,640 filed November 14, 2005). Expression of miR- 16 was reduced in lung tumors from numerous lung cancer patients when compared to its expression in normal adjacent lung tissues from the same patients. The inventors observed increased expression of miR- 16 in breast and prostate tumors as compared WO 2008/085797 PCT/US2007/089206 to expression in adjacent normal cells from the same cancer patients. In human foreskin fibroblasts, hsa-miR-16 activated the hTert gene that encodes the catalytic domain of telomerase. Over 90% of human cancer samples have active telomerase (reviewed in Dong et al., 2005). Hsa-miR-16 also induces cells to enter the S phase of the cell cycle and decreases the proliferation of lung cancer cells (A549 and HTB-57 lung carcinoma cells), prostate cancer cells (22Rvl), and human basal cell carcinomas (TE354T). Anti-miR inhibitors of hsa-miR- 16 increased the proliferation of non-malignant human breast epithelial cells and basal cell carcinoma cells (TE354T). In addition, the inventors previously observed that hsa-miR- 16 is up-regulated in patients with prion disease and Alzheimer's disease when compared to patients without those diseases. As is the case for cancer therapy, genes and pathways that are altered by expression of hsa-miR-16 represent targets for therapeutic intervention in the treatment of certain diseases like Alzheimer's Disease and prion diseases, in which hsa-miR-16 likely plays a role. [0010] In animals, most miRNAs are thought to interact with target genes through imprecise base pairing within the 3' untranslated regions of their gene targets. Regulation of target genes by miRNAs is thought to occur primarily by translation inhibition, but mRNA instability may also be a mechanism (Reinhart et al., 2000; Bagga et al., 2005). Bioinformatics analyses suggest that any given miRNA may bind to and alter the expression of up to several hundred different genes. In addition, a single gene may be regulated by several miRNAs. Thus, each miRNA may regulate a complex interaction among genes, gene pathways, and gene networks. Mis-regulation or alteration of these regulatory pathways and networks, involving miRNAs, are likely to contribute to the development of disorders and diseases such as cancer. Although bioinformatics tools are helpful in predicting miRNA binding targets, all have limitations. Because of the imperfect complementarity with their target binding sites, it is difficult to accurately predict miRNA targets with bioinformatics tools alone. Furthermore, the complicated interactive regulatory networks among miRNAs and target genes make it difficult to accurately predict which genes will actually be mis regulated in response to a given miRNA. [0011] Correcting gene expression errors by manipulating miRNA expression or by repairing miRNA mis-regulation represent promising methods to repair genetic disorders and cure diseases like cancer. A current, disabling limitation of this approach is that, as mentioned above, the details of the regulatory pathways and networks that are affected by WO 2008/085797 PCT/US2007/089206 any given miRNA remain largely unknown. Besides BCL2, the genes, gene pathways, and gene networks that are regulated by miR-16 in cancerous cells remain largely unknown. Currently, this represents a significant limitation for treatment of cancers in which miR-16 may play a role. A need exists to identify the genes, genetic pathways, and genetic networks that are regulated by or that may regulate hsa-miR- 16 expression. SUMMARY OF THE INVENTION [0012] The present invention provides additional compositions and methods to address problems in the art by identifying genes in cancer cells that are direct targets for hsa-miR- 16 regulation or that are downstream targets of regulation following the hsa-miR-16-mediated modification of upstream gene expression. Furthermore, the invention describes gene, disease, and/or physiologic pathways and networks that are influenced by hsa-miR-16. Many of these genes and pathways are associated with various cancers and other diseases. The altered expression of miR-16 in cells would lead to changes in the expression of these key genes and contribute to the development of disease. Introducing miR-16 (for diseases where the miRNA is down-regulated) or a miR-16 inhibitor (for diseases where the miRNA is up regulated) into disease cells or tissues would result in a therapeutic response. The identities of key genes that are regulated directly or indirectly by miR-16 and the disease with which they are associated are provided herein. In certain aspects a cell may be an epithelial, stromal, or mucosal cell. The cell can be, but is not limited to brain, a glial, a neuronal, a blood, an esophageal, a lung, a cardiovascular, a liver, a breast, a bone, a thyroid, a glandular, an adrenal, a pancreatic, a stomach, an intestinal, a kidney, a bladder, a prostate, a cervical, a uterus, an ovarian, a testicular, a splenic, a skin, a smooth muscle, a cardiac muscle, or a striated muscle cell. In certain aspects, the cell, tissue, or target may not be defective in miRNA expression yet may still respond therapeutically to expression or over expression of a miRNA. miR-16 could be used as a therapeutic target for any of these diseases. In certain aspects, compositions of the invention are administered to a subject having, suspected of having, or at risk of developing a metabolic, an immunologic, an infectious, a cardiovascular, a digestive, an endocrine, an ocular, a genitourinary, a blood, a musculoskeletal, a nervous system, a congenital, a respiratory, a skin, or a cancerous disease or condition. [0013] In particular aspects, a subject or patient may be selected for treatment based on expression and/or aberrant expression of one or more miRNA or mRNA. In a further aspect, a subject or patient may be selected for treatment based on aberrations in one or more WO 2008/085797 PCT/US2007/089206 biologic or physiologic pathway(s), including aberrant expression of one or more gene associated with a pathway, or the aberrant expression of one or more protein encoded by one or more gene associated with a pathway. In still a further aspect, a subject or patient may be selected based on aberrations in miRNA expression, or biologic and/or physiologic pathway(s). A subject may be assessed for sensitivity, resistance, and/or efficacy of a therapy or treatment regime based on the evaluation and/or analysis of miRNA or mRNA expression or lack thereof. A subject may be evaluated for amenability to certain therapy prior to, during, or after administration of one or therapy to a subject or patient. Typically, evaluation or assessment may be done by analysis of miRNA and/or mRNA, as well as combination of other assessment methods that include but are not limited to histology, immunohistochemistry, blood work, etc. [0014] In some embodiments, an infectious disease or condition includes a bacterial, viral, parasite, or fungal infection. Many of these genes and pathways are associated with various cancers and other diseases. Cancerous conditions include, but are not limited to astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, laryngeal squamous cell carcinoma, lung carcinoma, melanoma, medulloblastoma, mantle cell lymphoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, testicular tumor or thyroid carcinoma wherein the modulation of one or more gene is sufficient for a therapeutic response. Typically a cancerous condition is an aberrant hyperproliferative condition associated with the uncontrolled growth or inability to undergo cell death, including apoptosis. [0015] In certain aspect, the cancerous condition is prostate carcinoma, which can be positive or negative for PSA, and/or androgen dependent or androgen independent. Cells of the prostate require male hormones, known as androgens, to work properly. Androgens include testosterone, which is made in the testes; dehydroepiandrosterone, made in the adrenal glands; and dihydrotestosterone, which is converted from testosterone within the prostate itself. Some prostate carcinomas retain androgen dependence while others are WO 2008/085797 PCT/US2007/089206 independent of androgen. Prostate cancer screening is an attempt to find unsuspected cancers. Screening tests may lead to more specific follow-up tests such as a biopsy, where small pieces of the prostate are removed for closer study. Typical prostate cancer screening options include the digital rectal exam and the prostate specific antigen (PSA) blood test. Prostate cancer is usually a slow-growing cancer, very common among older men. [0016] A cell, tissue, or subject may be a cancer cell, a cancerous tissue, harbor cancerous tissue, or be a subject or patient diagnosed or at risk of developing a disease or condition.. In certain aspects a cancer cell is a neuronal, glial, lung, liver, brain, breast, bladder, blood, leukemic, colon, endometrial, stomach, skin, ovarian, fat, bone, cervical, esophageal, pancreatic, prostate, kidney, testicular or thyroid cell. In still a further aspect cancer includes, but is not limited to astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, laryngeal squamous cell carcinoma, lung carcinoma, melanoma, medulloblastoma, mantle cell lymphoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, testicular tumor or thyroid carcinoma. [0017] In certain aspects, the gene or genes modulated comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200 or more genes or any combination of genes identified in Table 1, 2, 4 and 5. In certain aspects the expression of a gene is down-regulated or up-regulated. In a particular aspect the gene modulated comprises or is selected from (and may even exclude) 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or all of genes identified in Table 1, 2, 4 and 5, in various combinations and permutations. In particular embodiments, the invention may exclude or choose not to include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200 or more genes or any combination of genes identified in Table 1, 2, 4 and 5, e.g., BCL2, RARS (arginyl-tRNA synthetase), BTG2, WT1, PPM1D, PAK7, and/or RAB9B. In one particular aspect the gene modulated or selected to modulate includes one or more genes of Table 1, 2, 4 and/or 5 provided that RARS (arginyl-tRNA synthetase), BTG2, WT1, PPM1D, PAK7, and/or RAB9B is not included.

WO 2008/085797 PCT/US2007/089206 [0018] Embodiments of the invention include methods of modulating gene expression, or biologic or physiologic pathways in a cell, a tissue, or a subject comprising administering to the cell, tissue, or subject an amount of an isolated nucleic acid or mimetic thereof comprising a miR- 16 nucleic acid, mimetic, or inhibitor sequence in an amount sufficient to modulate the expression of a gene positively or negatively modulated by a miR- 16 miRNA. A "miR- 16 nucleic acid sequence" or "miR-16 inhibitor" includes the full length precursor of miR-16, or complement thereof or processed (i.e., mature) sequence of miR-16 and related sequences set forth herein, as well as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or more nucleotides of a precursor miRNA or its processed sequence, or complement thereof, including all ranges and integers there between. In certain embodiments, the miR- 16 nucleic acid sequence or miR- 16 inhibitor contains the full-length processed miRNA sequence or complement thereof and is referred to as the "miR-16 full length processed nucleic acid sequence" or "miR-16 full-length processed inhibitor sequence." In still further aspects, the miR-16 nucleic acid comprises at least one 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50 nucleotide (including all ranges and integers there between) segment or complementary segment of a miR- 16 that is at least 75, 80, 85, 90, 95, 98, 99 or 100% identical to SEQ ID NOs provided herein. The general term miR- 16 includes all members of the miR- 16 family that share at least part of a mature miR-16 sequence. In still further aspects, the miR-16 nucleic acid comprises at least one 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 232, 24, 25, 50 nucleotide (including all ranges and integers there between) segment of miR-16 that is at least 75, 80, 85, 90, 95, 98, 99 or 100% identical to SEQ ID NOs:1-3. SEQ ID NO:1 uagcagcacguaaauauuggcg (accession - MIMAT0000069), SEQ ID NO:2 (hsa-mir-16-1, accession - M10000070) gucagcagugccuuagcagcacguaaauauuggcguuaagauucuaaaauuau cuccaguauuaacugugcugcugaaguaagguugac; SEQ ID NO:3 (hsa-mir-16-2, accession MI00001 15) guuccacucuagcagcacguaaauauuggcguagugaaauauauauuaaacaccaauauuacug ugcugcuuuagugugac). In certain embodiments the gene modulated or selected to modulate is from Table 1. In further embodiments the gene modulated or selected to modulate is from Table 2. In still further embodiments the gene modulated or selected to modulate is from Table 4. In yet further embodiments the gene modulated or selected to modulate is from Table 5. Embodiments of the invention may also include obtaining or assessing a gene expression profile or miRNA profile of a target cell prior to selecting the mode of treatment, e.g., administration of a miR- 16 nucleic acid.

WO 2008/085797 PCT/US2007/089206 [0019] In certain aspects, a miR- 16 nucleic acid, or a segment or a mimetic thereof, will comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or more nucleotides of the precursor miRNA or its processed sequence, including all ranges and integers there between. In certain embodiments, the miR-16 nucleic acid sequence contains the full-length processed miRNA sequence and is referred to as the "miR 16 full-length processed nucleic acid sequence." In still further aspects, a miR-16 comprises at least one 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50 nucleotide (including all ranges and integers there between) segment of miR- 16 that is at least 75, 80, 85, 90, 95, 98, 99 or 100% identical to SEQ ID NOs provided herein. [0020] In specific embodiments, a miR- 16 or miR- 16 inhibitor containing nucleic acid is a hsa-miR- 16 or hsa-miR- 16 inhibitor, or a variation thereof. In a further aspect, a miR- 16 nucleic acid or miR-16 inhibitor can be administered with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more miRNAs or miRNA inhibitors. miRNAs or their complements can be administered concurrently, sequentially, or in an ordered progression. In certain aspects, a miR-16 or miR 16 inhibitor can be administered in combination with one or more of let-7, miR-15, miR-126, miR-20, miR-21, miR-26a, miR-34a, miR-143, miR-147, miR-188, miR-200, miR-215, miR 216, miR-292-3p, and/or miR-331. All or combinations of miRNAs or inhibitors thereof may be administered in a single formulation. Administration may be before, during or after a second therapy. [0021] miR-16 nucleic acids or complement thereof may also include various heterologous nucleic acid sequences, i.e., those sequences not typically found operatively coupled with miR-16 in nature, such as promoters, enhancers, and the like. The miR-16 nucleic acid is a recombinant nucleic acid, and can be a ribonucleic acid or a deoxyribonucleic acid. The recombinant nucleic acid may comprise a miR-16 or miR-16 inhibitor expression cassette, i.e., a nucleic acid segment that expresses a nucleic acid when introduce into an environment containing components for nucleic acid synthesis. In a further aspect, the expression cassette is comprised in a viral vector, or plasmid DNA vector or other therapeutic nucleic acid vector or delivery vehicle, including liposomes and the like. In a particular aspect, the miR-16 nucleic acid is a synthetic nucleic acid. Moreover, nucleic acids of the invention may be fully or partially synthetic. In certain aspects, viral vectors can be administered at lxlO 2, lx103, 1xl1 1x10, 1x1, 1x1, 1x1, 1x1, 1xl1, 1xO1, lx10', 1x101 3 , 1xO1 4 pfu or viral particle (vp).

WO 2008/085797 PCT/US2007/089206 [0022] In a particular aspect, the miR-16 nucleic acid or miR-16 inhibitor is a synthetic nucleic acid. Moreover, nucleic acids of the invention may be fully or partially synthetic. In still further aspects, a nucleic acid of the invention or a DNA encoding such a nucleic acid of the invention can be administered at 0.001, 0.01, 0.1, 1, 10, 20, 30, 40, 50, 100, 200, 400, 600, 800, 1000, 2000, to 4000 tg or mg, including all values and ranges there between. In yet a further aspect, nucleic acids of the invention, including synthetic nucleic acid, can be administered at 0.001, 0.01, 0.1, 1, 10, 20, 30, 40, 50, 100, to 200 tg or mg per kilogram (kg) of body weight. Each of the amounts described herein may be administered over a period of time, including 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, minutes, hours, days, weeks, months or years, including all values and ranges there between. [0023] In certain embodiments, administration of the composition(s) can be enteral or parenteral. In certain aspects, enteral administration is oral. In further aspects, parenteral administration is intralesional, intravascular, intracranial, intrapleural, intratumoral, intraperitoneal, intramuscular, intralymphatic, intraglandular, subcutaneous, topical, intrabronchial, intratracheal, intranasal, inhaled, or instilled. Compositions of the invention may be administered regionally or locally and not necessarily directly into a lesion. [0024] A cell, tissue, or subject may be or suffer from an abnormal or pathologic condition, or in the case of a cell or tissue, the component of a pathological condition. In certain aspects, a cell, tissue, or subject is a cancer cell, a cancerous tissue or harbor cancerous tissue, or a cancer patient. In a particular aspect the cancer is neuronal, glial, lung, liver, brain, breast, bladder, blood, leukemic, cervical, testicular, colon, endometrial, stomach, skin, ovarian, esophageal, pancreatic, prostate, kidney, or thyroid cancer. The database content related to all nucleic acids and genes designated by an accession number or a database submission are incorporated herein by reference as of the filing date of this application. [0025] A further embodiment of the invention is directed to methods of modulating a cellular pathway comprising administering to the cell an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence in an amount sufficient to modulate the expression, function, status, or state of a cellular pathway, in particular those pathways described in Table 2 or the pathways known to include one or more genes from Table 1, 3, 4, and/or 5. Modulation of a cellular pathway includes, but is not limited to modulating the expression of one or more gene. Modulation of a gene can include inhibiting the function of WO 2008/085797 PCT/US2007/089206 an endogenous miRNA or providing a functional miRNA to a cell, tissue, or subject. Modulation refers to the expression levels or activities of a gene or its related gene product or protein, e.g., the mRNA levels may be modulated or the translation of an mRNA may be modulated, etc. Modulation may increase or up regulate a gene or gene product or it may decrease or down regulate a gene or gene product. [0026] Still a further embodiment includes methods of treating a patient with a pathological condition comprising one or more of step (a) administering to the patient an amount of an isolated nucleic acid comprising a miR- 16 nucleic acid sequence in an amount sufficient to modulate the expression of a cellular pathway; and (b) administering a second therapy, wherein the modulation of the cellular pathway sensitizes the patient to the second therapy. A cellular pathway may include, but is not limited to one or more pathway described in Table 2 below or a pathway that is known to include one or more gene of Table 1, 3, 4, and/or 5. A second therapy can include a second miRNA or other nucleic acid therapy or one or more standard therapies, such as chemotherapy, drug therapy, radiation therapy, immunotherapy, thermal therapy, and the like. [0027] Embodiments of the invention include methods of treating a subject with a pathological condition comprising one or more of the steps of (a) determining an expression profile of one or more genes selected from Table 1, 3, 4, and/or 5; (b) assessing the sensitivity of the subject to therapy based on the expression profile; (c) selecting a therapy based on the assessed sensitivity; and (d) treating the subject using selected therapy. Typically, the pathological condition will have as a component, indicator, or result the mis-regulation of one or more gene of Table 1, 3, 4, and/or 5. [0028] Further embodiments include the identification and assessment of an expression profile indicative of miR- 16 status in a cell or tissue comprising expression assessment of one or more gene from Table 1, 3, 4, and/or 5, or any combination thereof. [0029] The term "miRNA" is used according to its ordinary and plain meaning and refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. See, e.g., Carrington et al., 2003, which is hereby incorporated by reference. The term can be used to refer to the single-stranded RNA molecule processed from a precursor or in certain instances the precursor itself WO 2008/085797 PCT/US2007/089206 [0030] In some embodiments, it may be useful to know whether a cell expresses a particular miRNA endogenously or whether such expression is affected under particular conditions or when it is in a particular disease state. Thus, in some embodiments of the invention, methods include assaying a cell or a sample containing a cell for the presence of one or more marker gene or mRNA or other analyte indicative of the expression level of a gene of interest. Consequently, in some embodiments, methods include a step of generating an RNA profile for a sample. The term "RNA profile" or "gene expression profile" refers to a set of data regarding the expression pattern for one or more gene or genetic marker in the sample (e.g., a plurality of nucleic acid probes that identify one or more markers from Table 1, 3, 4, and/or 5); it is contemplated that the nucleic acid profile can be obtained using a set of RNAs, using for example nucleic acid amplification or hybridization techniques well known to one of ordinary skill in the art. The difference in the expression profile in the sample from the patient and a reference expression profile, such as an expression profile from a normal or non-pathologic sample, is indicative of a pathologic, disease, or cancerous condition. A nucleic acid or probe set comprising or identifying a segment of a corresponding mRNA can include all or part of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 ,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 100, 200, 500, or more, including any integer or range derivable there between, of a gene or genetic marker, or a nucleic acid, mRNA or a probe representative thereof that is listed in Table 1, 3, 4, and/or 5, or identified by the methods described herein. [0031] Certain embodiments of the invention are directed to compositions and methods for assessing, prognosing, or treating a pathological condition in a patient comprising measuring or determining an expression profile of one or more marker(s) in a sample from the patient, wherein a difference in the expression profile in the sample from the patient and an expression profile of a normal sample or reference expression profile is indicative of pathological condition and particularly cancer. In certain aspects of the invention, the cellular pathway, gene, or genetic marker is or is representative of one or more pathway or marker described in Table 1, 3, 4, and/or 5, including any combination thereof and excluding 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more genes. [0032] Aspects of the invention include treating, diagnosing, or prognosing a pathologic condition or preventing a pathologic condition from manifesting. For example, the methods WO 2008/085797 PCT/US2007/089206 can be used to screen for a pathological condition; assess prognosis of a pathological condition; stage a pathological condition; assess response of a pathological condition to therapy; or to modulate the expression of a gene, genes, or related pathway as a first therapy or to render a subject sensitive or more responsive to a second therapy. In particular aspects, assessing the pathological condition of the patient can be assessing prognosis of the patient. Prognosis may include, but is not limited to an estimation of the time or expected time of survival, assessment of response to a therapy, and the like. In certain aspects, the altered expression of one or more gene or marker is prognostic for a patient having a pathologic condition, wherein the marker is one or more of Table 1, 3, 4, and/or 5, including any combination thereof. [0033] Certain embodiments of the invention include determining expression of one or more marker, gene, or nucleic acid representative thereof, by using an amplification assay, a hybridization assay, or protein assay, a variety of which are well known to one of ordinary skill in the art. In certain aspects, an amplification assay can be a quantitative amplification assay, such as quantitative RT-PCR or the like. In still further aspects, a hybridization assay can include array hybridization assays or solution hybridization assays. The nucleic acids from a sample may be labeled from the sample and/or hybridizing the labeled nucleic acid to one or more nucleic acid probes. Nucleic acids, mRNA, and/or nucleic acid probes may be coupled to a support. Such supports are well known to those of ordinary skill in the art and include, but are not limited to glass, plastic, metal, or latex. In particular aspects of the invention, the support can be planar or in the form of a bead or other geometric shapes or configurations known in the art. Proteins are typically assayed by immunoblotting, chromatography, mass spectrometry or other methods known to those of ordinary skill in the art. [0034] A further embodiment of the invention is directed to methods of modulating a cellular pathway comprising administering to the cell an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence or a miR-16 inhibitor. A cell, tissue, or subject may be a cancer cell, a cancerous tissue or harbor cancerous tissue, or a cancer patient. The database content related to all nucleic acids and genes designated by an accession number or a database submission are incorporated herein by reference as of the filing date of this application.

WO 2008/085797 PCT/US2007/089206 [0035] A further embodiment of the invention is directed to methods of modulating a cellular pathway comprising administering to the cell an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence in an amount sufficient to modulate the expression, function, status, or state of a cellular pathway, in particular those pathways described or the pathways known to include one or more genes described herein. Modulation of a cellular pathway includes, but is not limited to modulating the expression of one or more gene(s). Modulation of a gene can include inhibiting the function of an endogenous miRNA or providing a functional miRNA to a cell, tissue, or subject. Modulation refers to the expression levels or activities of a gene or its related gene product (e.g., mRNA) or protein, e.g., the mRNA levels may be modulated or the translation of an mRNA may be modulated. Modulation may increase or up regulate a gene or gene product or it may decrease or down regulate a gene or gene product (e.g., protein levels or activity). [0036] Still a further embodiment includes methods of administering an miRNA or mimic thereof, and/or treating a subject or patient having, suspected of having, or at risk of developing a pathological condition comprising one or more of step (a) administering to a patient or subject an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence or a miR-16 inhibitor in an amount sufficient to modulate expression of a cellular pathway; and (b) administering a second therapy, wherein the modulation of the cellular pathway sensitizes the patient or subject, or increases the efficacy of a second therapy. An increase in efficacy can include a reduction in toxicity, a reduced dosage or duration of the second therapy, or an additive or synergistic effect. A cellular pathway may include, but is not limited to one or more pathway described herein or a pathway that is know to include one or more genes in the tables herein. The second therapy may be administered before, during, and/or after the isolated nucleic acid or miRNA or inhibitor is administered [0037] A second therapy can include administration of a second miRNA or therapeutic nucleic acid such as a siRNA or antisense oligonucleotide, or may include various standard therapies, such as pharmaceuticals, chemotherapy, radiation therapy, drug therapy, immunotherapy, and the like. Embodiments of the invention may also include the determination or assessment of gene expression or gene expression profile for the selection of an appropriate therapy. In a particular aspect, a second therapy is chemotherapy. A chemotherapy can include, but is not limited to paclitaxel, cisplatin, carboplatin, doxorubicin, oxaliplatin, larotaxel, taxol, lapatinib, docetaxel, methotrexate, capecitabine, vinorelbine, WO 2008/085797 PCT/US2007/089206 cyclophosphamide, gemcitabine, amrubicin, cytarabine, etoposide, camptothecin, dexamethasone, dasatinib, tipifarnib, bevacizumab, sirolimus, temsirolimus, everolimus, lonafarnib, cetuximab, erlotinib, gefitinib, imatinib mesylate, rituximab, trastuzumab, nocodazole, sorafenib, sunitinib, bortezomib, alemtuzumab, gemtuzumab, tositumomab or ibritumomab. [0038] Embodiments of the invention include methods of treating a subject with a disease or condition comprising one or more of the steps of (a) determining an expression profile of one or more genes selected from the tables; (b) assessing the sensitivity of the subject to therapy based on the expression profile; (c) selecting a therapy based on the assessed sensitivity; and (d) treating the subject using a selected therapy. Typically, the disease or condition will have as a component, indicator, or resulting mis-regulation of one or more gene described herein. [0039] In certain aspects, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more miRNA may be used in sequence or in combination. For instance, any combination of miR- 16 or a miR- 16 inhibitor with another miRNA. Further embodiments include the identification and assessment of an expression profile indicative of miR-16 status in a cell or tissue comprising expression assessment of one or more gene from the tables, or any combination thereof. [0040] The term "miRNA" is used according to its ordinary and plain meaning and refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. See, e.g., Carrington et al., 2003, which is hereby incorporated by reference. The term can be used to refer to the single-stranded RNA molecule processed from a precursor or in certain instances the precursor itself. [0041] In some embodiments, it may be useful to know whether a cell expresses a particular miRNA endogenously or whether such expression is affected under particular conditions or when it is in a particular disease state. Thus, in some embodiments of the invention, methods include assaying a cell or a sample containing a cell for the presence of one or more marker gene or mRNA or other analyte indicative of the expression level of a gene of interest. Consequently, in some embodiments, methods include a step of generating an RNA profile for a sample. The term "RNA profile" or "gene expression profile" refers to a set of data regarding the expression pattern for one or more gene or genetic marker or miRNA in the sample (e.g., a plurality of nucleic acid probes that identify one or more WO 2008/085797 PCT/US2007/089206 markers from the tables; it is contemplated that the nucleic acid profile can be obtained using a set of RNAs, using for example nucleic acid amplification or hybridization techniques well know to one of ordinary skill in the art. The difference in the expression profile in the sample from the patient and a reference expression profile, such as an expression profile of one or more genes or miRNAs, are indicative of which miRNAs to be administered. [0042] In certain aspects, miR-16 or miR-16 inhibitor and let-7 or let-7 inhibitor are administered to patients with astrocytoma, breast carcinoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, melanoma, medulloblastoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma. [0043] Further aspects include administering miR- 16 or miR- 16 inhibitor and miR- 10 or miR- 10 inhibitor to patients with astrocytoma, breast carcinoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, melanoma, mantle cell lymphoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma [0044] In yet another aspect, miR- 16 or miR- 16 inhibitor and miR- 15 or miR- 15 inhibitor can be administered to patients with astrocytoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, laryngeal squamous cell carcinoma, melanoma, medulloblastoma, mantle cell lymphoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

WO 2008/085797 PCT/US2007/089206 [0045] In still further aspects, miR-16 or miR-16 inhibitor and miR-20 or miR-20 inhibitor are administered to patients with astrocytoma, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma. [0046] In certain aspects, miR-16 or miR-16 inhibitor and miR-21 or miR-21 inhibitor are administered to patients with astrocytoma, breast carcinoma, bladder carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, melanoma, mantle cell lymphoma, myeloid leukemia, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck. [0047] Aspects of the invention include methods where miR- 16 or miR- 16 inhibitor and miR-26 or miR-26 inhibitor are administered to patients with anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, lung carcinoma, melanoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, rhabdomyosarcoma, testicular tumor. [0048] In still further aspects, miR-16 or miR-16 inhibitor and miR-34 or miR-34 inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, laryngeal squamous cell carcinoma, melanoma, medulloblastoma, mantle cell lymphoma, myeloid leukemia, multiple myeloma, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

WO 2008/085797 PCT/US2007/089206 [0049] In still a further aspect, miR-16 or miR-16 inhibitor and miR-124 or miR-124 inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, laryngeal squamous cell carcinoma, melanoma, medulloblastoma, mantle cell lymphoma, myxofibrosarcoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor. [0050] In yet further aspects, miR-16 or miR-16 inhibitor and miR-126 or miR-126 inhibitor are administered to patients with astrocytoma, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, melanoma, mantle cell lymphoma, myeloid leukemia, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma. [0051] In yet further aspects, miR-16 or miR-16 inhibitor and miR-143 or miR-143 inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, melanoma, medulloblastoma, mantle cell lymphoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor. [0052] In a further aspect, miR-16 or miR-16 inhibitor and miR-147 or miR-147 inhibitor are administered to patients with astrocytoma, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, WO 2008/085797 PCT/US2007/089206 oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma. [0053] In still a further aspect, miR-16 or miR-16 inhibitor and miR-188 or miR-188 inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, lung carcinoma, melanoma, multiple myeloma, non small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor. [0054] In a further aspect, miR- 16 or miR- 16 inhibitor and miR-200 or miR-200 inhibitor are administered to patients with anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, lung carcinoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor. [0055] In yet another aspect, miR-16 or miR-16 inhibitor and miR-215 or miR-215 inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor. [0056] In yet a further aspect, miR-16 or miR-16 inhibitor and miR-216 or miR-216 inhibitor are administered to patients with astrocytoma, breast carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, myeloid leukemia, neurofibroma, non-small WO 2008/085797 PCT/US2007/089206 cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, prostate carcinoma, pheochromocytoma, squamous cell carcinoma of the head and neck, testicular tumor. [0057] In other aspects, miR-16 or miR-16 inhibitor and miR-292-3p or miR-292-3p inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, lung carcinoma, laryngeal squamous cell carcinoma, melanoma, myxofibrosarcoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor. [0058] In certain aspects, miR- 16 or miR- 16 inhibitor and miR-3 31 or miR-3 31 inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, lung carcinoma, laryngeal squamous cell carcinoma, melanoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, neurofibroma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor. [0059] It is contemplated that when miR-16 or a miR-16 inhibitor is given in combination with one or more other miRNA molecules, the two different miRNAs or inhibitors may be given at the same time or sequentially. In some embodiments, therapy proceeds with one miRNA or inhibitor and that therapy is followed up with therapy with the other miRNA or inhibitor 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, 1, 2, 3, 4, 5, 6, 7 days, 1, 2, 3, 4, 5 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months or any such combination later. [0060] Further embodiments include the identification and assessment of an expression profile indicative of miR-16 status in a cell or tissue comprising expression assessment of one or more gene from the tables herein, or any combination thereof.

WO 2008/085797 PCT/US2007/089206 [0061] The term "miRNA" is used according to its ordinary and plain meaning and refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. See, e.g., Carrington et al., 2003, which is hereby incorporated by reference. The term can be used to refer to the single-stranded RNA molecule processed from a precursor or in certain instances the precursor itself or a mimetic thereof. [0062] In some embodiments, it may be useful to know whether a cell expresses a particular miRNA endogenously or whether such expression is affected under particular conditions or when it is in a particular disease state. Thus, in some embodiments of the invention, methods include assaying a cell or a sample containing a cell for the presence of one or more miRNA marker gene or mRNA or other analyte indicative of the expression level of a gene of interest. Consequently, in some embodiments, methods include a step of generating an RNA profile for a sample. The term "RNA profile" or "gene expression profile" refers to a set of data regarding the expression pattern for one or more gene or genetic marker in the sample (e.g., a plurality of nucleic acid probes that identify one or more markers or genes from the tables); it is contemplated that the nucleic acid profile can be obtained using a set of RNAs, using for example nucleic acid amplification or hybridization techniques well know to one of ordinary skill in the art. The difference in the expression profile in the sample from a patient and a reference expression profile, such as an expression profile from a normal or non-pathologic sample, or a digitized reference, is indicative of a pathologic, disease, or cancerous condition. In certain aspects the expression profile is an indicator of a propensity to or probability of (i.e., risk factor for a disease or condition) developing such a condition(s). Such a risk or propensity may indicate a treatment, increased monitoring, prophylactic measures, and the like. A nucleic acid or probe set may comprise or identify a segment of a corresponding mRNA and may include all or part of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 ,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 100, 200, 500, or more segments, including any integer or range derivable there between, of a gene or genetic marker, or a nucleic acid, mRNA or a probe representative thereof that is listed in tables or identified by the methods described herein. [0063] Certain embodiments of the invention are directed to compositions and methods for assessing, prognosing, or treating a pathological condition in a patient comprising measuring or determining an expression profile of one or more miRNA or marker(s) in a WO 2008/085797 PCT/US2007/089206 sample from the patient, wherein a difference in the expression profile in the sample from the patient and an expression profile of a normal sample or reference expression profile is indicative of pathological condition and particularly cancer (e.g., In certain aspects of the invention, the miRNAs, cellular pathway, gene, or genetic marker is or is representative of one or more pathway or marker described in the tables, including any combination thereof. [0064] Aspects of the invention include diagnosing, assessing, or treating a pathologic condition or preventing a pathologic condition from manifesting. For example, the methods can be used to screen for a pathological condition; assess prognosis of a pathological condition; stage a pathological condition; assess response of a pathological condition to therapy; or to modulate the expression of a gene, genes, or related pathway as a first therapy or to render a subject sensitive or more responsive to a second therapy. In particular aspects, assessing the pathological condition of the patient can be assessing prognosis of the patient. Prognosis may include, but is not limited to an estimation of the time or expected time of survival, assessment of response to a therapy, and the like. In certain aspects, the altered expression of one or more gene or marker is prognostic for a patient having a pathologic condition, wherein the marker is one or more of the tables, including any combination thereof. [0065] The present invention also concerns kits containing compositions of the invention or compositions to implement methods of the invention. In some embodiments, kits can be used to evaluate one or more marker molecules, and/or express one or more miRNA or miRNA inhibitor. In certain embodiments, a kit contains, contains at least or contains at most 1,2,3,4, 5,6,7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,30,31,32,33,34,35, 36, 37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53, 54, 55, 56, 57, 58, 59, 60, 61, 100, 150, 200 or more probes, recombinant nucleic acid, or synthetic nucleic acid molecules related to the markers to be assessed or an miRNA or miRNA inhibitor to be expressed or modulated, and may include any range or combination derivable therein. Kits may comprise components, which may be individually packaged or placed in a container, such as a tube, bottle, vial, syringe, or other suitable container means. Individual components may also be provided in a kit in concentrated amounts; in some embodiments, a component is provided individually in the same concentration as it would be in a solution with other components. Concentrations of components may be provided as lx, 2x, 5x, lOx, or 20x or more. Kits for using probes, synthetic nucleic acids, recombinant WO 2008/085797 PCT/US2007/089206 nucleic acids, or non-synthetic nucleic acids of the invention for therapeutic, prognostic, or diagnostic applications are included as part of the invention. Specifically contemplated are any such molecules corresponding to any miRNA reported to influence biological activity or expression of one or more marker gene or gene pathway described herein. In certain aspects, negative and/or positive controls are included in some kit embodiments. The control molecules can be used to verify transfection efficiency and/or control for transfection induced changes in cells. . [0066] Certain embodiments are directed to a kit for assessment of a pathological condition or the risk of developing a pathological condition in a patient by nucleic acid profiling of a sample comprising, in suitable container means, two or more nucleic acid hybridization or amplification reagents. The kit can comprise reagents for labeling nucleic acids in a sample and/or nucleic acid hybridization reagents. The hybridization reagents typically comprise hybridization probes. Amplification reagents include, but are not limited to amplification primers, reagents, and enzymes. [0067] In some embodiments of the invention, an expression profile is generated by steps that include: (a) labeling nucleic acid in the sample; (b) hybridizing the nucleic acid to a number of probes, or amplifying a number of nucleic acids, and (c) determining and/or quantitating nucleic acid hybridization to the probes or detecting and quantitating amplification products, wherein an expression profile is generated. See U.S. Provisional Patent Application 60/575,743 and the U.S. Provisional Patent Application 60/649,584, and U.S. Patent Application Serial No. 11/141,707 and U.S. Patent Application Serial No. 11/273,640, all of which are hereby incorporated by reference. [0068] Methods of the invention involve diagnosing and/or assessing the prognosis of a patient based on a miRNA and/or a marker nucleic acid expression profile. In certain embodiments, the elevation or reduction in the level of expression of a particular gene or genetic pathway or set of nucleic acids in a cell is correlated with a disease state or pathological condition compared to the expression level of the same in a normal or non pathologic cell or tissue sample. This correlation allows for diagnostic and/or prognostic methods to be carried out when the expression level of one or more nucleic acid is measured in a biological sample being assessed and then compared to the expression level of a normal or non-pathologic cell or tissue sample. It is specifically contemplated that expression profiles for patients, particularly those suspected of having or having a propensity for a WO 2008/085797 PCT/US2007/089206 particular disease or condition such as cancer, can be generated by evaluating any of or sets of the miRNAs and/or nucleic acids discussed in this application. The expression profile that is generated from the patient will be one that provides information regarding the particular disease or condition. In many embodiments, the profile is generated using nucleic acid hybridization or amplification, (e.g., array hybridization or RT-PCR). In certain aspects, an expression profile can be used in conjunction with other diagnostic and/or prognostic tests, such as histology, protein profiles in the serum and/or cytogenetic assessment. [0069] The methods can further comprise one or more of the steps including: (a) obtaining a sample from the patient, (b) isolating nucleic acids from the sample, (c) labeling the nucleic acids isolated from the sample, and (d) hybridizing the labeled nucleic acids to one or more probes. Nucleic acids of the invention include one or more nucleic acid comprising at least one segment having a sequence or complementary sequence of to a nucleic acid representative of one or more of genes or markers in the tables. [0070] It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein and that different embodiments may be combined. It is specifically contemplated that any methods and compositions discussed herein with respect to miRNA molecules, miRNA, genes and nucleic acids representative of genes may be implemented with respect to synthetic nucleic acids. In some embodiments the synthetic nucleic acid is exposed to the proper conditions to allow it to become a processed or mature nucleic acid, such as a miRNA under physiological circumstances. The claims originally filed are contemplated to cover claims that are multiply dependent on any filed claim or combination of filed claims. [0071] Also, any embodiment of the invention involving specific genes (including representative fragments thereof), mRNA, or miRNAs by name is contemplated also to cover embodiments involving miRNAs whose sequences are at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% identical to the sequence or mature sequence of the specified miRNA, mRNA, gene, or representative nucleic acid. [0072] It will be further understood that shorthand notations are employed such that a generic description of a gene or marker thereof, or of a miRNA refers to any of its gene family members (distinguished by a number) or representative fragments thereof, unless otherwise indicated. It is understood by those of skill in the art that a "gene family" refers to WO 2008/085797 PCT/US2007/089206 a group of genes having the same or similar coding sequence or miRNA coding sequence. Typically, miRNA members of a gene family are identified by a number following the initial designation. For example, miR- 16-1 and miR- 16-2 are members of the miR- 16 gene family and "mir-7" refers to miR-7-1, miR-7-2 and miR-7-3. Moreover, unless otherwise indicated, a shorthand notation refers to related miRNAs (distinguished by a letter). Thus, "let-7," for example, refers to let-7a, let-7b, let-7c, etc. Exceptions to this shorthand notation will be otherwise identified. [0073] Other embodiments of the invention are discussed throughout this application. Any embodiment discussed with respect to one aspect of the invention applies to other aspects of the invention as well and vice versa. The embodiments in the Example and Detailed Description section are understood to be embodiments of the invention that are applicable to all aspects of the invention. [0074] The terms "inhibiting," "reducing," or "prevention," or any variation of these terms, when used in the claims and/or the specification includes any measurable decrease or complete inhibition to achieve a desired result. [0075] The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." [0076] Throughout this application, the term "about" is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value. [0077] The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." [0078] As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

WO 2008/085797 PCT/US2007/089206 [0079] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. DESCRIPTION OF THE DRAWINGS [0089] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. [0090] FIG. 1. Percent (%) proliferation of hsa-miR-16 treated cells relative to cells treated with negative control miRNA (100%). Cell lines used include the prostate cancer cell lines PPC-1, Dul45 and RWPE2. Abbreviations: miR-16, hsa-miR-16; NC, negative control miRNA; siEg5, siRNA against the motor protein kinesin 11 (Eg5). Standard deviations are indicated in the graph. [0080] FIG. 2. Equal number of cells were electroporated with 1.6 pM hsa-miR-16 or negative control miRNA (NC) and grown in standard growth media (day 0). Cells were repeatedly electroporated on days 4 and 11. At each electroporation event, fifty-thousand cells were plated separately in multiple wells of a 6-well plate, and cells were harvested and counted every other day. The population doubling was calculated using the formula PD=ln(Nf/No)/ln 2, and cell numbers were extrapolated and plotted on a linear scale. Electroporation events are indicated by arrowheads. The graph shows one representative experiment. DETAILED DESCRIPTION OF THE INVENTION [0081] The present invention is directed to compositions and methods relating to the identification and characterization of genes and biological pathways related to these genes as represented by the expression of the identified genes, as well as use of miRNAs related to such, for therapeutic, prognostic, and diagnostic applications. In particular, the present invention is directed to those methods and compositions related to assessing and/or WO 2008/085797 PCT/US2007/089206 identifying pathological conditions directly or indirectly related to miR- 16 expression or the aberrant expression thereof. The mature sequence of miR-16 is typically comprised of uagcagcacguaaauauuggcg SEQ ID NO: 1 (MIMAT0000069). [0082] In certain aspects, the invention is directed to methods for the assessment, analysis, and/or therapy of a cell or subject where certain genes have a reduced expression (relative to normal) as a result of an increased or decreased expression of miR-16 and/or genes with an increased expression (relative to normal) as a result of an increased or decreased expression of miR-16. The expression profile and/or response to miR-16 expression or lack of expression are indicative of an individual with a pathological condition, e.g., cancer. [0083] Prognostic assays featuring any one or combination of the miRNAs listed or the markers listed (including nucleic acids representative thereof) could be used to assess a patient to determine what if any treatment regimen is justified. As with the diagnostic assays mentioned above, the absolute values that define low expression will depend on the platform used to measure the miRNA(s). The same methods described for the diagnostic assays could be used for a prognostic assays. I. THERAPEUTIC METHODS [0084] Embodiments of the invention concern nucleic acids that perform the activities of or inhibit endogenous miRNAs when introduced into cells. In certain aspects, nucleic acids are synthetic or non-synthetic miRNA. Sequence-specific miRNA inhibitors can be used to inhibit sequentially or in combination the activities of one or more endogenous miRNAs in cells, as well those genes and associated pathways modulated by the endogenous miRNA. [0085] The present invention concerns, in some embodiments, short nucleic acid molecules that function as miRNAs or as inhibitors of miRNA in a cell. The term "short" refers to a length of a single polynucleotide that is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50, 100, or 150 nucleotides or fewer, including all integers or ranges range derivable there between. The nucleic acid molecules are typically synthetic. The term "synthetic" refers to a nucleic acid molecule that is isolated and not produced naturally in a cell. In certain aspects the sequence (the entire sequence) and/or chemical structure deviates from a naturally occurring nucleic acid molecule, such as an endogenous precursor miRNA or miRNA molecule or complement thereof. While in some embodiments, nucleic acids of the invention WO 2008/085797 PCT/US2007/089206 do not have an entire sequence that is identical or complementary to a sequence of a naturally-occurring nucleic acid, such molecules may encompass all or part of a naturally occurring sequence or a complement thereof.. It is contemplated, however, that a synthetic nucleic acid administered to a cell may subsequently be modified or altered in the cell such that its structure or sequence is the same as non-synthetic or naturally occurring nucleic acid, such as a mature miRNA sequence. For example, a synthetic nucleic acid may have a sequence that differs from the sequence of a precursor miRNA, but that sequence may be altered once in a cell to be the same as an endogenous, processed miRNA or an inhibitor thereof.. The term "isolated" means that the nucleic acid molecules of the invention are initially separated from different (in terms of sequence or structure) and unwanted nucleic acid molecules such that a population of isolated nucleic acids is at least about 90% homogenous, and may be at least about 95, 96, 97, 98, 99, or 100% homogenous with respect to other polynucleotide molecules. In many embodiments of the invention, a nucleic acid is isolated by virtue of it having been synthesized in vitro separate from endogenous nucleic acids in a cell. It will be understood, however, that isolated nucleic acids may be subsequently mixed or pooled together. In certain aspects, synthetic miRNA of the invention are RNA or RNA analogs. miRNA inhibitors may be DNA or RNA, or analogs thereof. miRNA and miRNA inhibitors of the invention are collectively referred to as "synthetic nucleic acids." [0086] In some embodiments, there is a miRNA or a synthetic miRNA having a length of between 17 and 130 residues. The present invention concerns miRNA or synthetic miRNA molecules that are, are at least, or are at most 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 140, 145, 150, 160, 170, 180, 190, 200 or more residues in length, including any integer or any range there between. [0087] In certain embodiments, synthetic miRNA have (a) a "miRNA region" whose sequence or binding region from 5' to 3' is identical or complementary to all or a segment of a mature miRNA sequence, and (b) a "complementary region" whose sequence from 5' to 3' is between 60% and 100% complementary to the miRNA sequence in (a). In certain WO 2008/085797 PCT/US2007/089206 embodiments, these synthetic miRNA are also isolated, as defined above. The term "miRNA region" refers to a region on the synthetic miRNA that is at least 75, 80, 85, 90, 95, or 100% identical, including all integers there between, to the entire sequence of a mature, naturally occurring miRNA sequence or a complement thereof. In certain embodiments, the miRNA region is or is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% identical to the sequence of a naturally-occurring miRNA or complement thereof. [0088] The term "complementary region" or "complement" refers to a region of a nucleic acid or mimetic that is or is at least 60% complementary to the mature, naturally occurring miRNA sequence. The complementary region is or is at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range derivable therein. With single polynucleotide sequences, there may be a hairpin loop structure as a result of chemical bonding between the miRNA region and the complementary region. In other embodiments, the complementary region is on a different nucleic acid molecule than the miRNA region, in which case the complementary region is on the complementary strand and the miRNA region is on the active strand. [0089] In other embodiments of the invention, there are synthetic nucleic acids that are miRNA inhibitors. A miRNA inhibitor is between about 17 to 25 nucleotides in length and comprises a 5' to 3' sequence that is at least 90% complementary to the 5' to 3' sequence of a mature miRNA. In certain embodiments, a miRNA inhibitor molecule is 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, or any range derivable therein. Moreover, an miRNA inhibitor may have a sequence (from 5' to 3') that is or is at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range derivable therein, to the 5' to 3' sequence of a mature miRNA, particularly a mature, naturally occurring miRNA. One of skill in the art could use a portion of the miRNA sequence that is complementary to the sequence of a mature miRNA as the sequence for a miRNA inhibitor. Moreover, that portion of the nucleic acid sequence can be altered so that it is still comprises the appropriate percentage of complementarity to the sequence of a mature miRNA. [0090] In some embodiments, of the invention, a synthetic miRNA or inhibitor contains one or more design element(s). These design elements include, but are not limited to: (i) a WO 2008/085797 PCT/US2007/089206 replacement group for the phosphate or hydroxyl of the nucleotide at the 5' terminus of the complementary region; (ii) one or more sugar modifications in the first or last 1 to 6 residues of the complementary region; or, (iii) noncomplementarity between one or more nucleotides in the last 1 to 5 residues at the 3' end of the complementary region and the corresponding nucleotides of the miRNA region. A variety of design modifications are known in the art, see below. [0091] In certain embodiments, a synthetic miRNA has a nucleotide at its 5' end of the complementary region in which the phosphate and/or hydroxyl group has been replaced with another chemical group (referred to as the "replacement design"). In some cases, the phosphate group is replaced, while in others, the hydroxyl group has been replaced. In particular embodiments, the replacement group is biotin, an amine group, a lower alkylamine group, an acetyl group, 2'O-Me (2'oxygen-methyl), DMTO (4,4'-dimethoxytrityl with oxygen), fluoroscein, a thiol, or acridine, though other replacement groups are well known to those of skill in the art and can be used as well. This design element can also be used with a miRNA inhibitor. [0092] Additional embodiments concern a synthetic miRNA having one or more sugar modifications in the first or last 1 to 6 residues of the complementary region (referred to as the "sugar replacement design"). In certain cases, there is one or more sugar modifications in the first 1, 2, 3, 4, 5, 6 or more residues of the complementary region, or any range derivable therein. In additional cases, there are one or more sugar modifications in the last 1, 2, 3, 4, 5, 6 or more residues of the complementary region, or any range derivable therein, have a sugar modification. It will be understood that the terms "first" and "last" are with respect to the order of residues from the 5' end to the 3' end of the region. In particular embodiments, the sugar modification is a 2'O-Me modification, a 2'F modification, a 2'H modification, a 2'amino modification, a 4'thioribose modification or a phosphorothioate modification on the carboxy group linked to the carbon at position 6'.. In further embodiments, there are one or more sugar modifications in the first or last 2 to 4 residues of the complementary region or the first or last 4 to 6 residues of the complementary region. This design element can also be used with a miRNA inhibitor. Thus, a miRNA inhibitor can have this design element and/or a replacement group on the nucleotide at the 5' terminus, as discussed above. [0093] In other embodiments of the invention, there is a synthetic miRNA or inhibitor in which one or more nucleotides in the last 1 to 5 residues at the 3' end of the complementary WO 2008/085797 PCT/US2007/089206 region are not complementary to the corresponding nucleotides of the miRNA region ("noncomplementarity") (referred to as the "noncomplementarity design"). The noncomplementarity may be in the last 1, 2, 3, 4, and/or 5 residues of the complementary miRNA. In certain embodiments, there is noncomplementarity with at least 2 nucleotides in the complementary region. [0094] It is contemplated that synthetic miRNA of the invention have one or more of the replacement, sugar modification, or noncomplementarity designs. In certain cases, synthetic RNA molecules have two of them, while in others these molecules have all three designs in place. [0095] The miRNA region and the complementary region may be on the same or separate polynucleotides. In cases in which they are contained on or in the same polynucleotide, the miRNA molecule will be considered a single polynucleotide. In embodiments in which the different regions are on separate polynucleotides, the synthetic miRNA will be considered to be comprised of two polynucleotides. [0096] When the RNA molecule is a single polynucleotide, there can be a linker region between the miRNA region and the complementary region. In some embodiments, the single polynucleotide is capable of forming a hairpin loop structure as a result of bonding between the miRNA region and the complementary region. The linker constitutes the hairpin loop. It is contemplated that in some embodiments, the linker region is, is at least, or is at most 2, 3, 4,5,6,7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 residues in length, or any range derivable therein. In certain embodiments, the linker is between 3 and 30 residues (inclusive) in length. [0097] In addition to having a miRNA or inhibitor region and a complementary region, there may be flanking sequences as well at either the 5' or 3' end of the region. In some embodiments, there is or is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides or more, or any range derivable therein, flanking one or both sides of these regions. [0098] Methods of the invention include reducing or eliminating activity of one or more miRNAs in a cell comprising introducing into a cell a miRNA inhibitor (which may be described generally herein as an miRNA, so that a description of miRNA, where appropriate, also will refer to a miRNA inhibitor); or supplying or enhancing the activity of one or more miRNAs in a cell. The present invention also concerns inducing certain cellular WO 2008/085797 PCT/US2007/089206 characteristics by providing to a cell a particular nucleic acid, such as a specific synthetic miRNA molecule or a synthetic miRNA inhibitor molecule. However, in methods of the invention, the miRNA molecule or miRNA inhibitor need not be synthetic. They may have a sequence that is identical to a naturally occurring miRNA or they may not have any design modifications. In certain embodiments, the miRNA molecule and/or the miRNA inhibitor are synthetic, as discussed above. [0099] The particular nucleic acid molecule provided to the cell is understood to correspond to a particular miRNA in the cell, and thus, the miRNA in the cell is referred to as the "corresponding miRNA." In situations in which a named miRNA molecule is introduced into a cell, the corresponding miRNA will be understood to be the induced or inhibited miRNA or induced or inhibited miRNA function.. It is contemplated, however, that the miRNA molecule introduced into a cell is not a mature miRNA but is capable of becoming or functioning as a mature miRNA under the appropriate physiological conditions. In cases in which a particular corresponding miRNA is being inhibited by a miRNA inhibitor, the particular miRNA will be referred to as the "targeted miRNA." It is contemplated that multiple corresponding miRNAs may be involved. In particular embodiments, more than one miRNA molecule is introduced into a cell. Moreover, in other embodiments, more than one miRNA inhibitor is introduced into a cell. Furthermore, a combination of miRNA molecule(s) and miRNA inhibitor(s) may be introduced into a cell. The inventors contemplate that a combination of miRNA may act at one or more points in cellular pathways of cells with aberrant phenotypes and that such combination may have increased efficacy on the target cell while not adversely effecting normal cells. Thus, a combination of miRNA may have a minimal adverse effect on a subject or patient while supplying a sufficient therapeutic effect, such as amelioration of a condition, growth inhibition of a cell, death of a targeted cell, alteration of cell phenotype or physiology, slowing of cellular growth, sensitization to a second therapy, sensitization to a particular therapy, and the like. [00100] Methods include identifying a cell or patient in need of inducing those cellular characteristics. Also, it will be understood that an amount of a synthetic nucleic acid that is provided to a cell or organism is an "effective amount," which refers to an amount needed (or a sufficient amount) to achieve a desired goal, such as inducing a particular cellular characteristic(s).

WO 2008/085797 PCT/US2007/089206 [00101] In certain embodiments of the methods include providing or introducing to a cell a nucleic acid molecule corresponding to a mature miRNA in the cell in an amount effective to achieve a desired physiological result. [00102] Moreover, methods can involve providing synthetic or nonsynthetic miRNA molecules. It is contemplated that in these embodiments, that the methods may or may not be limited to providing only one or more synthetic miRNA molecules or only one or more nonsynthetic miRNA molecules. Thus, in certain embodiments, methods may involve providing both synthetic and nonsynthetic miRNA molecules. In this situation, a cell or cells are most likely provided a synthetic miRNA molecule corresponding to a particular miRNA and a nonsynthetic miRNA molecule corresponding to a different miRNA. Furthermore, any method articulated using a list of miRNAs using Markush group language may be articulated without the Markush group language and a disjunctive article (i.e., or) instead, and vice versa. [00103] In some embodiments, there is a method for reducing or inhibiting cell proliferation comprising introducing into or providing to the cell an effective amount of (i) a miRNA inhibitor molecule or (ii) a synthetic or nonsynthetic miRNA molecule that corresponds to a miRNA sequence. In certain embodiments the methods involves introducing into the cell an effective amount of (i) an miRNA inhibitor molecule having a 5' to 3' sequence that is at least 90% complementary to the 5' to 3' sequence of one or more mature miRNA. [00104] Certain embodiments of the invention include methods of treating a pathologic condition, in particular cancer, e.g., lung or liver cancer. In one aspect, the method comprises contacting a target cell with one or more nucleic acid, synthetic miRNA, or miRNA comprising at least one nucleic acid segment having all or a portion of a miRNA sequence. The segment may be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides or nucleotide analog, including all integers there between. An aspect of the invention includes the modulation of gene expression, miRNA expression or function or mRNA expression or function within a target cell, such as a cancer cell. [00105] Typically, an endogenous gene, miRNA or mRNA is modulated in the cell. In particular embodiments, the nucleic acid sequence comprises at least one segment that is at least 70, 75, 80, 85, 90, 95, or 100% identical in nucleic acid sequence to one or more miRNA or gene sequence. Modulation of the expression or processing of an endogenous WO 2008/085797 PCT/US2007/089206 gene, miRNA, or mRNA can be through modulation of the processing of a mRNA, such processing including transcription, transportation and/or translation with in a cell. Modulation may also be effected by the inhibition or enhancement of miRNA activity with a cell, tissue, or organ. Such processing may affect the expression of an encoded product or the stability of the mRNA. In still other embodiments, a nucleic acid sequence can comprise a modified nucleic acid sequence. In certain aspects, one or more miRNA sequence may include or comprise a modified nucleobase or nucleic acid sequence. [00106] It will be understood in methods of the invention that a cell or other biological matter such as an organism (including patients) can be provided a miRNA or miRNA molecule corresponding to a particular miRNA by administering to the cell or organism a nucleic acid molecule that functions as the corresponding miRNA once inside the cell. The form of the molecule provided to the cell may not be the form that acts a miRNA once inside the cell. Thus, it is contemplated that in some embodiments, a synthetic miRNA or a nonsynthetic miRNA is provided a synthetic miRNA or a nonsynthetic miRNA, such as one that becomes processed into a mature and active miRNA once it has access to the cell's miRNA processing machinery. In certain embodiments, it is specifically contemplated that the miRNA molecule provided to the biological matter is not a mature miRNA molecule but a nucleic acid molecule that can be processed into the mature miRNA once it is accessible to miRNA processing machinery. The term "nonsynthetic" in the context of miRNA means that the miRNA is not "synthetic," as defined herein. Furthermore, it is contemplated that in embodiments of the invention that concern the use of synthetic miRNAs, the use of corresponding nonsynthetic miRNAs is also considered an aspect of the invention, and vice versa. It will be understand that the term "providing" an agent is used to include "administering" the agent to a patient. [00107] In certain embodiments, methods also include targeting a miRNA to modulate in a cell or organism. The term "targeting a miRNA to modulate" means a nucleic acid of the invention will be employed so as to modulate the selected miRNA. In some embodiments the modulation is achieved with a synthetic or non-synthetic miRNA that corresponds to the targeted miRNA, which effectively provides the targeted miRNA to the cell or organism (positive modulation). In other embodiments, the modulation is achieved with a miRNA inhibitor, which effectively inhibits the targeted miRNA in the cell or organism (negative modulation).

WO 2008/085797 PCT/US2007/089206 [00108] In some embodiments, the miRNA targeted to be modulated is a miRNA that affects a disease, condition, or pathway. In certain embodiments, the miRNA is targeted because a treatment can be provided by negative modulation of the targeted miRNA. In other embodiments, the miRNA is targeted because a treatment can be provided by positive modulation of the targeted miRNA or its targets. [00109] In certain methods of the invention, there is a further step of administering the selected miRNA modulator to a cell, tissue, organ, or organism (collectively "biological matter") in need of treatment related to modulation of the targeted miRNA or in need of the physiological or biological results discussed herein (such as with respect to a particular cellular pathway or result like decrease in cell viability). Consequently, in some methods of the invention there is a step of identifying a patient in need of treatment that can be provided by the miRNA modulator(s). It is contemplated that an effective amount of a miRNA modulator can be administered in some embodiments. In particular embodiments, there is a therapeutic benefit conferred on the biological matter, where a "therapeutic benefit" refers to an improvement in the one or more conditions or symptoms associated with a disease or condition or an improvement in the prognosis, duration, or status with respect to the disease. It is contemplated that a therapeutic benefit includes, but is not limited to, a decrease in pain, a decrease in morbidity, a decrease in a symptom. For example, with respect to cancer, it is contemplated that a therapeutic benefit can be inhibition of tumor growth, prevention of metastasis, reduction in number of metastases, inhibition of cancer cell proliferation, induction of cell death in cancer cells, inhibition of angiogenesis near cancer cells, induction of apoptosis of cancer cells, reduction in pain, reduction in risk of recurrence, induction of chemo- or radiosensitivity in cancer cells, prolongation of life, and/or delay of death directly or indirectly related to cancer. [00110] Furthermore, it is contemplated that the miRNA compositions may be provided as part of a therapy to a patient, in conjunction with traditional therapies or preventative agents. Moreover, it is contemplated that any method discussed in the context of therapy may be applied as preventatively, particularly in a patient identified to be potentially in need of the therapy or at risk of the condition or disease for which a therapy is needed. [00111] In addition, methods of the invention concern employing one or more nucleic acids corresponding to a miRNA and a therapeutic drug. The nucleic acid can enhance the effect or efficacy of the drug, reduce any side effects or toxicity, modify its bioavailability, WO 2008/085797 PCT/US2007/089206 and/or decrease the dosage or frequency needed. In certain embodiments, the therapeutic drug is a cancer therapeutic. Consequently, in some embodiments, there is a method of treating cancer in a patient comprising administering to the patient the cancer therapeutic and an effective amount of at least one miRNA molecule that improves the efficacy of the cancer therapeutic or protects non-cancer cells. Cancer therapies also include a variety of combination therapies with both chemical and radiation based treatments. Combination chemotherapies include but are not limited to, for example, 5-fluorouracil, alemtuzumab, amrubicin, bevacizumab, bleomycin, bortezomib, busulfan, camptothecin, capecitabine, cisplatin (CDDP), carboplatin, cetuximab, chlorambucil, cisplatin (CDDP), EGFR inhibitors (gefitinib and cetuximab), procarbazine, mechlorethamine, cyclophosphamide, camptothecin, COX-2 inhibitors (e.g., celecoxib), cyclophosphamide, cytarabine, ) ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, dasatinib, daunorubicin, dexamethasone, docetaxel, doxorubicin (adriamycin), EGFR inhibitors (gefitinib and cetuximab), erlotinib, estrogen receptor binding agents, bleomycin, plicomycin, mitomycin, etoposide (VP16), everolimus, tamoxifen, raloxifene, estrogen receptor binding agents, taxol, taxotere, gemcitabien, navelbine, farnesyl-protein transferase inhibitors, gefitinib, gemcitabine, gemtuzumab, ibritumomab, ifosfamide, imatinib mesylate, larotaxel, lapatinib, lonafarnib, mechlorethamine, melphalan, transplatinum, 5-fluorouracil, vincristin, vinblastin and methotrexate, mitomycin, navelbine, nitrosurea, nocodazole, oxaliplatin, paclitaxel, plicomycin, procarbazine, raloxifene, rituximab, sirolimus, sorafenib, sunitinib, tamoxifen, taxol, taxotere, temsirolimus, tipifarnib, tositumomab, transplatinum, trastuzumab, vinblastin, vincristin, or vinorelbine or any analog or derivative variant of the foregoing. [00112] Generally, inhibitors of miRNAs can be given to decrease the activity of an endogenous miRNA. For example, inhibitors of miRNA molecules that increase cell proliferation can be provided to cells to increase proliferation or inhibitors of such molecules can be provided to cells to decrease cell proliferation. The present invention contemplates these embodiments in the context of the different physiological effects observed with the different miRNA molecules and miRNA inhibitors disclosed herein. These include, but are not limited to, the following physiological effects: increase and decreasing cell proliferation, increasing or decreasing apoptosis, increasing transformation, increasing or decreasing cell viability, activating or inhibiting a kinase (e.g., Erk)ERK, activating/inducing or inhibiting hTert, inhibit stimulation of growth promoting pathway (e.g., Stat 3 signaling), reduce or increase viable cell number, and increase or decrease number of cells at a particular phase of WO 2008/085797 PCT/US2007/089206 the cell cycle. Methods of the invention are generally contemplated to include providing or introducing one or more different nucleic acid molecules corresponding to one or more different miRNA molecules. It is contemplated that the following, at least the following, or at most the following number of different nucleic acid or miRNA molecules may be provided or introduced: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or any range derivable therein. This also applies to the number of different miRNA molecules that can be provided or introduced into a cell. II. PHARMACEUTICAL FORMULATIONS AND DELIVERY [00113] Methods of the present invention include the delivery of an effective amount of a miRNA or an expression construct encoding the same. An "effective amount" of the pharmaceutical composition, generally, is defined as that amount sufficient to detectably and repeatedly to achieve the stated desired result, for example, to ameliorate, reduce, minimize or limit the extent of the disease or its symptoms. Other more rigorous definitions may apply, including elimination, eradication or cure of disease. A. Administration [00114] In certain embodiments, it is desired to kill cells, inhibit cell growth, inhibit metastasis, decrease tumor or tissue size, and/or reverse or reduce the malignant or disease phenotype of cells. The routes of administration will vary, naturally, with the location and nature of the lesion or site to be targeted, and include, e.g., intradermal, subcutaneous, regional, parenteral, intravenous, intramuscular, intranasal, systemic, and oral administration and formulation. Direct injection, intratumoral injection, or injection into tumor vasculature is specifically contemplated for discrete, solid, accessible tumors, or other accessible target areas. Local, regional, or systemic administration also may be appropriate. For tumors of>4 cm, the volume to be administered will be about 4-10 ml (preferably 10 ml), while for tumors of <4 cm, a volume of about 1-3 ml will be used (preferably 3 ml). [00115] Multiple injections delivered as a single dose comprise about 0.1 to about 0.5 ml volumes. Compositions of the invention may be administered in multiple injections to a WO 2008/085797 PCT/US2007/089206 tumor or a targeted site. In certain aspects, injections may be spaced at approximately 1 cm intervals. [00116] In the case of surgical intervention, the present invention may be used preoperatively, to render an inoperable tumor subject to resection. Alternatively, the present invention may be used at the time of surgery, and/or thereafter, to treat residual or metastatic disease. For example, a resected tumor bed may be injected or perfused with a formulation comprising a miRNA or combinations thereof. Administration may be continued post resection, for example, by leaving a catheter implanted at the site of the surgery. Periodic post-surgical treatment also is envisioned. Continuous perfusion of an expression construct or a viral construct also is contemplated. [00117] Continuous administration also may be applied where appropriate, for example, where a tumor or other undesired affected area is excised and the tumor bed or targeted site is treated to eliminate residual, microscopic disease. Delivery via syringe or catherization is contemplated. Such continuous perfusion may take place for a period from about 1-2 hours, to about 2-6 hours, to about 6-12 hours, to about 12-24 hours, to about 1-2 days, to about 1-2 wk or longer following the initiation of treatment. Generally, the dose of the therapeutic composition via continuous perfusion will be equivalent to that given by a single or multiple injections, adjusted over a period of time during which the perfusion occurs. [00118] Treatment regimens may vary as well and often depend on tumor type, tumor location, immune condition, target site, disease progression, and health and age of the patient. Certain tumor types will require more aggressive treatment. The clinician will be best suited to make such decisions based on the known efficacy and toxicity (if any) of the therapeutic formulations. [00119] In certain embodiments, the tumor or affected area being treated may not, at least initially, be resectable. Treatments with compositions of the invention may increase the resectability of the tumor due to shrinkage at the margins or by elimination of certain particularly invasive portions. Following treatments, resection may be possible. Additional treatments subsequent to resection may serve to eliminate microscopic residual disease at the tumor or targeted site. [00120] Treatments may include various "unit doses." A unit dose is defined as containing a predetermined quantity of a therapeutic composition(s). The quantity to be administered, WO 2008/085797 PCT/US2007/089206 and the particular route and formulation, are within the skill of those in the clinical arts. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. With respect to a viral component of the present invention, a unit dose may conveniently be described in terms of tg or mg of miRNA or miRNA mimetic. Alternatively, the amount specified may be the amount administered as the average daily, average weekly, or average monthly dose. [00121] miRNA can be administered to the patient in a dose or doses of about or of at least about 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000 tg or mg, or more, or any range derivable therein. Alternatively, the amount specified may be the amount administered as the average daily, average weekly, or average monthly dose, or it may be expressed in terms of mg/kg, where kg refers to the weight of the patient and the mg is specified above. In other embodiments, the amount specified is any number discussed above but expressed as mg/m 2 (with respect to tumor size or patient surface area). B. Injectable Compositions and Formulations [00122] In some embodiments, the method for the delivery of a miRNA or an expression construct encoding such or combinations thereof is via systemic administration. However, the pharmaceutical compositions disclosed herein may also be administered parenterally, subcutaneously, directly, intratracheally, intravenously, intradermally, intramuscularly, or even intraperitoneally as described in U.S. Patents 5,543,158; 5,641,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety). [00123] Injection of nucleic acids may be delivered by syringe or any other method used for injection of a solution, as long as the nucleic acid and any associated components can pass through the particular gauge of needle required for injection. A syringe system has also been described for use in gene therapy that permits multiple injections of predetermined quantities of a solution precisely at any depth (U.S. Patent 5,846,225).

WO 2008/085797 PCT/US2007/089206 [00124] Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. [00125] In certain formulations, a water-based formulation is employed while in others, it may be lipid-based. In particular embodiments of the invention, a composition comprising a tumor suppressor protein or a nucleic acid encoding the same is in a water-based formulation. In other embodiments, the formulation is lipid based. [00126] For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intratumoral, intralesional, and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage WO 2008/085797 PCT/US2007/089206 may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologics standards. [00127] As used herein, a "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions. [00128] The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human. [00129] The nucleic acid(s) are administered in a manner compatible with the dosage formulation, and in such amount as will be therapeutically effective. The quantity to be administered depends on the subject to be treated, including, e.g., the aggressiveness of the disease or cancer, the size of any tumor(s) or lesions, the previous or other courses of treatment. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner. Suitable regimes for initial administration and subsequent administration are also variable, but are typified by an initial administration followed by other administrations. Such administration may be systemic, as a single dose, continuous over a period of time spanning 10, 20, 30, 40, 50, 60 minutes, and/or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more hours, and/or 1, 2, 3, 4, 5, 6, 7, days or more. Moreover, administration may be through a time release or sustained release mechanism, implemented by formulation and/or mode of administration.

WO 2008/085797 PCT/US2007/089206 C. Combination Treatments [00130] In certain embodiments, the compositions and methods of the present invention involve a miRNA, or expression construct encoding such. These miRNA compositions can be used in combination with a second therapy to enhance the effect of the miRNA therapy, or increase the therapeutic effect of another therapy being employed. These compositions would be provided in a combined amount effective to achieve the desired effect, such as the killing of a cancer cell and/or the inhibition of cellular hyperproliferation. This process may involve contacting the cells with the miRNA or second therapy at the same or different time. This may be achieved by contacting the cell with one or more compositions or pharmacological formulation that includes or more of the agents, or by contacting the cell with two or more distinct compositions or formulations, wherein one composition provides (1) miRNA; and/or (2) a second therapy. A second composition or method may be administered that includes a chemotherapy, radiotherapy, surgical therapy, immunotherapy, or gene therapy. [00131] It is contemplated that one may provide a patient with the miRNA therapy and the second therapy within about 12-24 h of each other and, more preferably, within about 6-12 h of each other. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations. [00132] In certain embodiments, a course of treatment will last 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 days or more. It is contemplated that one agent may be given on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, any combination thereof, and another agent is given on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, or any combination WO 2008/085797 PCT/US2007/089206 thereof. Within a single day (24-hour period), the patient may be given one or multiple administrations of the agent(s). Moreover, after a course of treatment, it is contemplated that there is a period of time at which no treatment is administered. This time period may last 1, 2, 3, 4, 5, 6, 7 days, and/or 1, 2, 3, 4, 5 weeks, and/or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months or more, depending on the condition of the patient, such as their prognosis, strength, health, etc. [00133] Various combinations may be employed, for example miRNA therapy is "A" and a second therapy is "B": [00134] A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B [00135] B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A [00136] B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A [00137] Administration of any compound or therapy of the present invention to a patient will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the vector or any protein or other agent. Therefore, in some embodiments there is a step of monitoring toxicity that is attributable to combination therapy. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the described therapy. [00138] In specific aspects, it is contemplated that a second therapy, such as chemotherapy, radiotherapy, immunotherapy, surgical therapy or other gene therapy, is employed in combination with the miRNA therapy, as described herein. 1. Chemotherapy [00139] A wide variety of chemotherapeutic agents may be used in accordance with the present invention. The term "chemotherapy" refers to the use of drugs to treat cancer. A "chemotherapeutic agent" is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid WO 2008/085797 PCT/US2007/089206 synthesis. Most chemotherapeutic agents fall into the following categories: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas. a. Alkylating agents [00140] Alkylating agents are drugs that directly interact with genomic DNA to prevent the cancer cell from proliferating. This category of chemotherapeutic drugs represents agents that affect all phases of the cell cycle, that is, they are not phase-specific. Alkylating agents can be implemented to treat chronic leukemia, non-Hodgkin's lymphoma, Hodgkin's disease, multiple myeloma, and particular cancers of the breast, lung, and ovary. They include: busulfan, chlorambucil, cisplatin, cyclophosphamide (cytoxan), dacarbazine, ifosfamide, mechlorethamine (mustargen), and melphalan. Troglitazaone can be used to treat cancer in combination with any one or more of these alkylating agents. b. Antimetabolites [00141] Antimetabolites disrupt DNA and RNA synthesis. Unlike alkylating agents, they specifically influence the cell cycle during S phase. They have been used to combat chronic leukemias in addition to tumors of breast, ovary and the gastrointestinal tract. Antimetabolites include 5-fluorouracil (5-FU), cytarabine (Ara-C), fludarabine, gemcitabine, and methotrexate. [00142] 5-Fluorouracil (5-FU) has the chemical name of 5-fluoro-2,4(1H,3H) pyrimidinedione. Its mechanism of action is thought to be by blocking the methylation reaction of deoxyuridylic acid to thymidylic acid. Thus, 5-FU interferes with the synthesis of deoxyribonucleic acid (DNA) and to a lesser extent inhibits the formation of ribonucleic acid (RNA). Since DNA and RNA are essential for cell division and proliferation, it is thought that the effect of 5-FU is to create a thymidine deficiency leading to cell death. Thus, the effect of 5-FU is found in cells that rapidly divide, a characteristic of metastatic cancers. c. Antitumor Antibiotics [00143] Antitumor antibiotics have both antimicrobial and cytotoxic activity. These drugs also interfere with DNA by chemically inhibiting enzymes and mitosis or altering cellular membranes. These agents are not phase specific so they work in all phases of the cell cycle. Thus, they are widely used for a variety of cancers. Examples of antitumor antibiotics include bleomycin, dactinomycin, daunorubicin, doxorubicin (Adriamycin), and idarubicin, WO 2008/085797 PCT/US2007/089206 some of which are discussed in more detail below. Widely used in clinical setting for the treatment of neoplasms, these compounds are administered through bolus injections intravenously at doses ranging from 25-75 mg/m2 at 21 day intervals for adriamycin, to 35 100 mg/m 2 for etoposide intravenously or orally. d. Mitotic Inhibitors [00144] Mitotic inhibitors include plant alkaloids and other natural agents that can inhibit either protein synthesis required for cell division or mitosis. They operate during a specific phase during the cell cycle. Mitotic inhibitors comprise docetaxel, etoposide (VP16), paclitaxel, taxol, taxotere, vinblastine, vincristine, and vinorelbine. e. Nitrosureas [00145] Nitrosureas, like alkylating agents, inhibit DNA repair proteins. They are used to treat non-Hodgkin's lymphomas, multiple myeloma, malignant melanoma, in addition to brain tumors. Examples include carmustine and lomustine. 2. Radiotherapy [00146] Radiotherapy, also called radiation therapy, is the treatment of cancer and other diseases with ionizing radiation. Ionizing radiation deposits energy that injures or destroys cells in the area being treated by damaging their genetic material, making it impossible for these cells to continue to grow. Although radiation damages both cancer cells and normal cells, the latter are able to repair themselves and function properly. Radiotherapy may be used to treat localized solid tumors, such as cancers of the skin, tongue, larynx, brain, breast, or cervix. It can also be used to treat leukemia and lymphoma (cancers of the blood-forming cells and lymphatic system, respectively). [00147] Radiation therapy used according to the present invention may include, but is not limited to, the use of y-rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves, proton beam irradiation (U.S. Patents 5,760,395 and 4,870,287) and UV-irradiation. It is most likely that all of these factors affect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage WO 2008/085797 PCT/US2007/089206 ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells. Radiotherapy may comprise the use of radiolabeled antibodies to deliver doses of radiation directly to the cancer site (radioimmunotherapy). Once injected into the body, the antibodies actively seek out the cancer cells, which are destroyed by the cell-killing (cytotoxic) action of the radiation. This approach can minimize the risk of radiation damage to healthy cells. [00148] Stereotactic radio-surgery (gamma knife) for brain and other tumors does not use a knife, but very precisely targeted beams of gamma radiotherapy from hundreds of different angles. Only one session of radiotherapy, taking about four to five hours, is needed. For this treatment a specially made metal frame is attached to the head. Then, several scans and x rays are carried out to find the precise area where the treatment is needed. During the radiotherapy for brain tumors, the patient lies with their head in a large helmet, which has hundreds of holes in it to allow the radiotherapy beams through. Related approaches permit positioning for the treatment of tumors in other areas of the body. 3. Immunotherapy [00149] In the context of cancer treatment, immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. Trastuzumab (Herceptin

TM

) is such an example. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually affect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells. The combination of therapeutic modalities, i.e., direct cytotoxic activity and inhibition or reduction of ErbB2 would provide therapeutic benefit in the treatment of ErbB2 overexpressing cancers. [00150] In one aspect of immunotherapy, the tumor or disease cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present invention. Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase (p97), gp68, TAG-72, WO 2008/085797 PCT/US2007/089206 HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B and p155. An alternative aspect of immunotherapy is to combine anticancer effects with immune stimulatory effects. Immune stimulating molecules also exist including: cytokines such as IL-2, IL-4, IL-12, GM-CSF, gamma-IFN, and chemokines such as MIP-1, MCP-1, IL-8 and growth factors such as FLT3 ligand. Combining immune stimulating molecules, either as proteins or using gene delivery in combination with a tumor suppressor such as MDA-7 has been shown to enhance anti-tumor effects (Ju et al., 2000). Moreover, antibodies against any of these compounds can be used to target the anti-cancer agents discussed herein. [00151] Examples of immunotherapies currently under investigation or in use are immune adjuvants e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene and aromatic compounds (U.S. Patents 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al., 1998), cytokine therapy e.g., interferons a, P and y; IL-1, GM-CSF and TNF (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al., 1998) gene therapy e.g., TNF, IL-1, IL-2, p53 (Qin et al., 1998; Austin-Ward and Villaseca, 1998; U.S. Patents 5,830,880 and 5,846,945) and monoclonal antibodies e.g., anti-ganglioside GM2, anti-HER 2, anti-p185; Pietras et al., 1998; Hanibuchi et al., 1998; U.S. Patent 5,824,311). Herceptin (trastuzumab) is a chimeric (mouse-human) monoclonal antibody that blocks the HER2-neu receptor. It possesses anti-tumor activity and has been approved for use in the treatment of malignant tumors (Dillman, 1999). A non-limiting list of several known anti-cancer immunotherapeutic agents and their targets includes, but is not listed to (Generic Name (Target)) Cetuximab (EGFR), Panitumumab (EGFR), Trastuzumab (erbB2 receptor), Bevacizumab (VEGF), Alemtuzumab (CD52), Gemtuzumab ozogamicin (CD33), Rituximab (CD20), Tositumomab (CD20), Matuzumab (EGFR), Ibritumomab tiuxetan (CD20), Tositumomab (CD20), HuPAM4 (MUC1), MORAb-009 (Mesothelin), G250 (carbonic anhydrase IX), mAb 8H9 (8H9 antigen), M195 (CD33), Ipilimumab (CTLA4), HuLuc63 (CSI), Alemtuzumab (CD53), Epratuzumab (CD22), BC8 (CD45), HuJ591 (Prostate specific membrane antigen), hA20 (CD20), Lexatumumab (TRAIL receptor-2), Pertuzumab (HER-2 receptor), Mik-beta-1 (IL-2R), RAV12 (RAAG12), SGN-30 (CD30), AME-133v (CD20), HeFi-1 (CD30), BMS-663513 (CD137), Volociximab (anti-a5 1 integrin), GC1008 (TGF3), HCD122 (CD40), Siplizumab (CD2), MORAb-003 (Folate receptor alpha), CNTO 328 (IL 6), MDX-060 (CD30), Ofatumumab (CD20), or SGN-33 (CD33). It is contemplated that one or more of these therapies may be employed with the miRNA therapies described herein.

WO 2008/085797 PCT/US2007/089206 [00152] A number of different approaches for passive immunotherapy of cancer exist. They may be broadly categorized into the following: injection of antibodies alone; injection of antibodies coupled to toxins or chemotherapeutic agents; injection of antibodies coupled to radioactive isotopes; injection of anti-idiotype antibodies; and finally, purging of tumor cells in bone marrow. 4. Gene Therapy [00153] In yet another embodiment, a combination treatment involves gene therapy in which a therapeutic polynucleotide is administered before, after, or at the same time as one or more therapeutic miRNA. Delivery of a therapeutic polypeptide or encoding nucleic acid in conjunction with a miRNA may have a combined therapeutic effect on target tissues. A variety of proteins are encompassed within the invention, some of which are described below. Various genes that may be targeted for gene therapy of some form in combination with the present invention include, but are not limited to inducers of cellular proliferation, inhibitors of cellular proliferation, regulators of programmed cell death, cytokines and other therapeutic nucleic acids or nucleic acid that encode therapeutic proteins. [00154] The tumor suppressor oncogenes function to inhibit excessive cellular proliferation. The inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation. The tumor suppressors (e.g., therapeutic polypeptides) p53, FHIT, p16 and C-CAM can be employed. [00155] In addition to p53, another inhibitor of cellular proliferation is p16. The major transitions of the eukaryotic cell cycle are triggered by cyclin-dependent kinases, or CDK's. One CDK, cyclin-dependent kinase 4 (CDK4), regulates progression through the G1. The activity of this enzyme may be to phosphorylate Rb at late G1. The activity of CDK4 is controlled by an activating subunit, D-type cyclin, and by an inhibitory subunit, the p1 61NK4 has been biochemically characterized as a protein that specifically binds to and inhibits CDK4, and thus may regulate Rb phosphorylation (Serrano et al., 1993; Serrano et al., 1995). Since the p16INK4 protein is a CDK4 inhibitor (Serrano, 1993), deletion of this gene may increase the activity of CDK4, resulting in hyperphosphorylation of the Rb protein. p16 also is known to regulate the function of CDK6. [00156] p 1 61NK4 belongs to a newly described class of CDK-inhibitory proteins that also includes pl6B, p19, p21WAF1, and p27KIP1. The p16INK4 gene maps to 9p2l, a WO 2008/085797 PCT/US2007/089206 chromosome region frequently deleted in many tumor types. Homozygous deletions and mutations of the p16INK4 gene are frequent in human tumor cell lines. This evidence suggests that the p161NK4 gene is a tumor suppressor gene. This interpretation has been challenged, however, by the observation that the frequency of the p16INK4 gene alterations is much lower in primary uncultured tumors than in cultured cell lines (Caldas et al., 1994; Cheng et al., 1994; Hussussian et al., 1994; Kamb et al., 1994; Mori et al., 1994; Okamoto et al., 1994; Nobori et al., 1995; Orlow et al., 1994; Arap et al., 1995). Restoration of wild-type p1 61NK4 function by transfection with a plasmid expression vector reduced colony formation by some human cancer cell lines (Okamoto, 1994; Arap, 1995). [00157] Other genes that may be employed according to the present invention include Rb, APC, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, zac1, p73, VHL, MMAC1 / PTEN, DBCCR-1, FCC, rsk-3, p27, p27/p16 fusions, p2l/p27 fusions, anti-thrombotic genes (e.g., COX-1, TFPI), PGS, Dp, E2F, ras, myc, neu, raf, erb, fins, trk, ret, gsp, hst, abl, ElA, p300, genes involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-1, GDAIF, or their receptors) and MCC. 5. Surgery [00158] Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative and palliative surgery. Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies. [00159] Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery). It is further contemplated that the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue. [00160] Upon excision of part of all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or WO 2008/085797 PCT/US2007/089206 every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well. 6. Other Agents [00161] It is contemplated that other agents may be used in combination with the present invention to improve the therapeutic efficacy of treatment. These additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers, or other biological agents. Immunomodulatory agents include tumor necrosis factor; interferon alpha, beta, and gamma; IL-2 and other cytokines; F42K and other cytokine analogs; or MIP-1, MIP-lbeta, MCP-1, RANTES, and other chemokines. It is further contemplated that the upregulation of cell surface receptors or their ligands such as Fas / Fas ligand, DR4 or DR5 / TRAIL (Apo-2 ligand) would potentiate the apoptotic inducing abilities of the present invention by establishment of an autocrine or paracrine effect on hyperproliferative cells. Increases intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with the present invention to improve the anti-hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present invention. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with the present invention to improve the treatment efficacy. [00162] Apo2 ligand (Apo2L, also called TRAIL) is a member of the tumor necrosis factor (TNF) cytokine family. TRAIL activates rapid apoptosis in many types of cancer cells, yet is not toxic to normal cells. TRAIL mRNA occurs in a wide variety of tissues. Most normal cells appear to be resistant to TRAIL's cytotoxic action, suggesting the existence of mechanisms that can protect against apoptosis induction by TRAIL. The first receptor described for TRAIL, called death receptor 4 (DR4), contains a cytoplasmic "death domain"; DR4 transmits the apoptosis signal carried by TRAIL. Additional receptors have been identified that bind to TRAIL. One receptor, called DR5, contains a cytoplasmic death domain and signals apoptosis much like DR4. The DR4 and DR5 mRNAs are expressed in WO 2008/085797 PCT/US2007/089206 many normal tissues and tumor cell lines. Recently, decoy receptors such as DcR1 and DcR2 have been identified that prevent TRAIL from inducing apoptosis through DR4 and DR5. These decoy receptors thus represent a novel mechanism for regulating sensitivity to a pro apoptotic cytokine directly at the cell's surface. The preferential expression of these inhibitory receptors in normal tissues suggests that TRAIL may be useful as an anticancer agent that induces apoptosis in cancer cells while sparing normal cells. (Marsters et al., 1999). [00163] There have been many advances in the therapy of cancer following the introduction of cytotoxic chemotherapeutic drugs. However, one of the consequences of chemotherapy is the development/acquisition of drug-resistant phenotypes and the development of multiple drug resistance. The development of drug resistance remains a major obstacle in the treatment of such tumors and therefore, there is an obvious need for alternative approaches such as gene therapy. [00164] Another form of therapy for use in conjunction with chemotherapy, radiation therapy or biological therapy includes hyperthermia, which is a procedure in which a patient's tissue is exposed to high temperatures (up to 106'F). External or internal heating devices may be involved in the application of local, regional, or whole-body hyperthermia. Local hyperthermia involves the application of heat to a small area, such as a tumor. Heat may be generated externally with high-frequency waves targeting a tumor from a device outside the body. Internal heat may involve a sterile probe , including thin, heated wires or hollow tubes filled with warm water, implanted microwave antennae, or radiofrequency electrodes. [00165] A patient's organ or a limb is heated for regional therapy, which is accomplished using devices that produce high energy, such as magnets. Alternatively, some of the patient's blood may be removed and heated before being perfused into an area that will be internally heated. Whole-body heating may also be implemented in cases where cancer has spread throughout the body. Warm-water blankets, hot wax, inductive coils, and thermal chambers may be used for this purpose. [00166] Hormonal therapy may also be used in conjunction with the present invention or in combination with any other cancer therapy previously described. The use of hormones may be employed in the treatment of certain cancers such as breast, prostate, ovarian, or cervical cancer to lower the level or block the effects of certain hormones such as WO 2008/085797 PCT/US2007/089206 testosterone or estrogen. This treatment is often used in combination with at least one other cancer therapy as a treatment option or to reduce the risk of metastases. [00167] This application incorporates U.S. Application Serial No. 11/349,727 filed on February 8, 2006 claiming priority to U.S. Provisional Application Serial No. 60/650,807 filed February 8, 2005 herein by references in its entirety. III. MIRNA MOLECULES [00168] MicroRNA molecules ("miRNAs") are generally 21 to 22 nucleotides in length, though lengths of 19 and up to 23 nucleotides have been reported. The miRNAs are each processed from a longer precursor RNA molecule ("precursor miRNA"). Precursor miRNAs are transcribed from non-protein-encoding genes. The precursor miRNAs have two regions of complementarity that enables them to form a stem-loop- or fold-back-like structure, which is cleaved in animals by a ribonuclease III-like nuclease enzyme called Dicer. The processed miRNA is typically a portion of the stem. [00169] The processed miRNA (also referred to as "mature miRNA") becomes part of a large complex to down-regulate a particular target gene or its gene product. Examples of animal miRNAs include those that imperfectly basepair with the target, which halts translation (Olsen et al., 1999; Seggerson et al., 2002). siRNA molecules also are processed by Dicer, but from a long, double-stranded RNA molecule. siRNAs are not naturally found in animal cells, but they can direct the sequence-specific cleavage of an mRNA target through a RNA-induced silencing complex (RISC) (Denli et al., 2003). A. Array Preparation [00170] Certain embodiments of the present invention concerns the preparation and use of mRNA or nucleic acid arrays, miRNA or nucleic acid arrays, and/or miRNA or nucleic acid probe arrays, which are macroarrays or microarrays of nucleic acid molecules (probes) that are fully or nearly complementary (over the length of the prove) or identical (over the length of the prove) to a plurality of nucleic acid, mRNA or miRNA molecules, precursor miRNA molecules, or nucleic acids derived from the various genes and gene pathways modulated by miR-16 miRNAs and that are positioned on a support or support material in a spatially separated organization. Macroarrays are typically sheets of nitrocellulose or nylon upon which probes have been spotted. Microarrays position the nucleic acid probes more densely such that up to 10,000 nucleic acid molecules can be fit into a region typically 1 to 4 square WO 2008/085797 PCT/US2007/089206 centimeters. Microarrays can be fabricated by spotting nucleic acid molecules, e.g., genes, oligonucleotides, etc., onto substrates or fabricating oligonucleotide sequences in situ on a substrate. Spotted or fabricated nucleic acid molecules can be applied in a high density matrix pattern of up to about 30 non-identical nucleic acid molecules per square centimeter or higher, e.g. up to about 100 or even 1000 per square centimeter. Microarrays typically use coated glass as the solid support, in contrast to the nitrocellulose-based material of filter arrays. By having an ordered array of marker RNA and/or miRNA-complementing nucleic acid samples, the position of each sample can be tracked and linked to the original sample. [00171] A variety of different array devices in which a plurality of distinct nucleic acid probes are stably associated with the surface of a solid support are known to those of skill in the art. Useful substrates for arrays include nylon, glass, metal, plastic, latex, and silicon. Such arrays may vary in a number of different ways, including average probe length, sequence or types of probes, nature of bond between the probe and the array surface, e.g. covalent or non-covalent, and the like. The labeling and screening methods of the present invention and the arrays are not limited in its utility with respect to any parameter except that the probes detect miRNA, or genes or nucleic acid representative of genes; consequently, methods and compositions may be used with a variety of different types of nucleic acid arrays. [00172] Representative methods and apparatus for preparing a microarray have been described, for example, in U.S. Patents 5,143,854; 5,202,231; 5,242,974; 5,288,644; 5,324,633; 5,384,261; 5,405,783; 5,412,087; 5,424,186; 5,429,807; 5,432,049; 5,436,327; 5,445,934; 5,468,613; 5,470,710; 5,472,672; 5,492,806; 5,525,464; 5,503,980; 5,510,270; 5,525,464; 5,527,681; 5,529,756; 5,532,128; 5,545,531; 5,547,839; 5,554,501; 5,556,752; 5,561,071; 5,571,639; 5,580,726; 5,580,732; 5,593,839; 5,599,695; 5,599,672; 5,610;287; 5,624,711; 5,631,134; 5,639,603; 5,654,413; 5,658,734; 5,661,028; 5,665,547; 5,667,972; 5,695,940; 5,700,637; 5,744,305; 5,800,992; 5,807,522; 5,830,645; 5,837,196; 5,871,928; 5,847,219; 5,876,932; 5,919,626; 6,004,755; 6,087,102; 6,368,799; 6,383,749; 6,617,112; 6,638,717; 6,720,138, as well as WO 93/17126; WO 95/11995; WO 95/21265; WO 95/21944; WO 95/35505; WO 96/31622; WO 97/10365; WO 97/27317; WO 99/35505; WO 09923256; WO 09936760; W00138580; WO 0168255; WO 03020898; WO 03040410; WO 03053586; WO 03087297; WO 03091426; W003100012; WO 04020085; WO 04027093; WO 2008/085797 PCT/US2007/089206 EP 373 203; EP 785 280; EP 799 897 and UK 8 803 000; the disclosures of which are all herein incorporated by reference. [00173] It is contemplated that the arrays can be high density arrays, such that they contain 2, 20, 25, 50, 80, 100 or more different probes. It is contemplated that they may contain 1000, 16,000, 65,000, 250,000 or 1,000,000 or more different probes. The probes can be directed to mRNA and/or miRNA targets in one or more different organisms or cell types. The oligonucleotide probes range from 5 to 50, 5 to 45, 10 to 40, 9 to 34, or 15 to 40 nucleotides in length in some embodiments. In certain embodiments, the oligonucleotide probes are 5, 10, 15, 20 to 20, 25, 30, 35, 40 nucleotides in length including all integers and ranges there between. [00174] The location and sequence of each different probe sequence in the array are generally known. Moreover, the large number of different probes can occupy a relatively small area providing a high density array having a probe density of generally greater than about 60, 100, 600, 1000, 5,000, 10,000, 40,000, 100,000, or 400,000 different oligonucleotide probes per cm 2 . The surface area of the array can be about or less than about 2 1, 1.6, 2, 3, 4, 5, 6, 7, 8, 9, or 10 cm2 [00175] Moreover, a person of ordinary skill in the art could readily analyze data generated using an array. Such protocols are disclosed above, and include information found in WO 9743450; WO 03023058; WO 03022421; WO 03029485; WO 03067217; WO 03066906; WO 03076928; WO 03093810; WO 03100448A1, all of which are specifically incorporated by reference. B. Sample Preparation [00176] It is contemplated that the RNA and/or miRNA of a wide variety of samples can be analyzed using the arrays, index of probes, or array technology of the invention. While endogenous miRNA is contemplated for use with compositions and methods of the invention, recombinant miRNA - including nucleic acids that are complementary or identical to endogenous miRNA or precursor miRNA - can also be handled and analyzed as described herein. Samples may be biological samples, in which case, they can be from biopsy, fine needle aspirates, exfoliates, blood, tissue, organs, semen, saliva, tears, other bodily fluid, hair follicles, skin, or any sample containing or constituting biological cells, particularly cancer or hyperproliferative cells. In certain embodiments, samples may be, but are not limited to, WO 2008/085797 PCT/US2007/089206 biopsy, or cells purified or enriched to some extent from a biopsy or other bodily fluids or tissues. Alternatively, the sample may not be a biological sample, but be a chemical mixture, such as a cell-free reaction mixture (which may contain one or more biological enzymes). C. Hybridization [00177] After an array or a set of probes is prepared and/or the nucleic acid in the sample or probe is labeled, the population of target nucleic acids is contacted with the array or probes under hybridization conditions, where such conditions can be adjusted, as desired, to provide for an optimum level of specificity in view of the particular assay being performed. Suitable hybridization conditions are well known to those of skill in the art and reviewed in Sambrook et al. (2001) and WO 95/21944. Of particular interest in many embodiments is the use of stringent conditions during hybridization. Stringent conditions are known to those of skill in the art. [00178] It is specifically contemplated that a single array or set of probes may be contacted with multiple samples. The samples may be labeled with different labels to distinguish the samples. For example, a single array can be contacted with a tumor tissue sample labeled with Cy3, and normal tissue sample labeled with Cy5. Differences between the samples for particular miRNAs corresponding to probes on the array can be readily ascertained and quantified. [00179] The small surface area of the array permits uniform hybridization conditions, such as temperature regulation and salt content. Moreover, because of the small area occupied by the high density arrays, hybridization may be carried out in extremely small fluid volumes (e.g., about 250 pl or less, including volumes of about or less than about 5, 10, 25, 50, 60, 70, 80, 90, 100 [1, or any range derivable therein). In small volumes, hybridization may proceed very rapidly. D. Differential Expression Analyses [00180] Arrays of the invention can be used to detect differences between two samples. Specifically contemplated applications include identifying and/or quantifying differences between miRNA or gene expression from a sample that is normal and from a sample that is not normal, between a disease or condition and a cell not exhibiting such a disease or condition, or between two differently treated samples. Also, miRNA or gene expression may be compared between a sample believed to be susceptible to a particular disease or condition WO 2008/085797 PCT/US2007/089206 and one believed to be not susceptible or resistant to that disease or condition. A sample that is not normal is one exhibiting phenotypic or genotypic trait(s) of a disease or condition, or one believed to be not normal with respect to that disease or condition. It may be compared to a cell that is normal with respect to that disease or condition. Phenotypic traits include symptoms of, or susceptibility to, a disease or condition of which a component is or may or may not be genetic, or caused by a hyperproliferative or neoplastic cell or cells. [00181] An array comprises a solid support with nucleic acid probes attached to the support. Arrays typically comprise a plurality of different nucleic acid probes that are coupled to a surface of a substrate in different, known locations. These arrays, also described as "microarrays" or colloquially "chips" have been generally described in the art, for example, U.S. Patents 5,143,854, 5,445,934, 5,744,305, 5,677,195, 6,040,193, 5,424,186 and Fodor et al., (1991), each of which is incorporated by reference in its entirety for all purposes. Techniques for the synthesis of these arrays using mechanical synthesis methods are described in, e.g., U.S. Patent 5,384,261, incorporated herein by reference in its entirety for all purposes. Although a planar array surface is used in certain aspects, the array may be fabricated on a surface of virtually any shape or even a multiplicity of surfaces. Arrays may be nucleic acids on beads, gels, polymeric surfaces, fibers such as fiber optics, glass or any other appropriate substrate, see U.S. Patents 5,770,358, 5,789,162, 5,708,153, 6,040,193 and 5,800,992, which are hereby incorporated in their entirety for all purposes. Arrays may be packaged in such a manner as to allow for diagnostics or other manipulation of an all inclusive device, see for example, U.S. Patents 5,856,174 and 5,922,591 incorporated in their entirety by reference for all purposes. See also U.S. patent application Ser. No. 09/545,207, filed April, 7, 2000 for additional information concerning arrays, their manufacture, and their characteristics, which is incorporated by reference in its entirety for all purposes. [00182] Particularly, arrays can be used to evaluate samples with respect to pathological condition such as cancer and related conditions. It is specifically contemplated that the invention can be used to evaluate differences between stages or sub-classifications of disease, such as between benign, cancerous, and metastatic tissues or tumors. [00183] Phenotypic traits to be assessed include characteristics such as longevity, morbidity, expected survival, susceptibility or receptivity to particular drugs or therapeutic treatments (drug efficacy), and risk of drug toxicity. Samples that differ in these phenotypic traits may also be evaluated using the compositions and methods described.

WO 2008/085797 PCT/US2007/089206 [00184] In certain embodiments, miRNA and/or expression profiles may be generated to evaluate and correlate those profiles with pharmacokinetics or therapies. For example, these profiles may be created and evaluated for patient tumor and blood samples prior to the patient's being treated or during treatment to determine if there are miRNA or genes whose expression correlates with the outcome of the patient's treatment. Identification of differential miRNAs or genes can lead to a diagnostic assay for evaluation of tumor and/or blood samples to determine what drug regimen the patient should be provided. In addition, it can be used to identify or select patients suitable for a particular clinical trial. If an expression profile is determined to be correlated with drug efficacy or drug toxicity, that profile is relevant to whether that patient is an appropriate patient for receiving a drug, for receiving a combination of drugs, or for receiving a particular dosage of the drug. [00185] In addition to the above prognostic assay, samples from patients with a variety of diseases can be evaluated to determine if different diseases can be identified based on miRNA and/or related gene expression levels. A diagnostic assay can be created based on the profiles that doctors can use to identify individuals with a disease or who are at risk to develop a disease. Alternatively, treatments can be designed based on miRNA profiling. Examples of such methods and compositions are described in the U.S. Provisional Patent Application entitled "Methods and Compositions Involving miRNA and miRNA Inhibitor Molecules" filed on May 23, 2005 in the names of David Brown, Lance Ford, Angie Cheng and Rich Jarvis, which is hereby incorporated by reference in its entirety. E. Other Assays [00186] In addition to the use of arrays and microarrays, it is contemplated that a number of different assays could be employed to analyze miRNAs or related genes, their activities, and their effects. Such assays include, but are not limited to, nucleic acid amplification, polymerase chain reaction, quantitative PCR, RT-PCR, in situ hybridization, Northern hybridization, hybridization protection assay (HPA)(GenProbe), branched DNA (bDNA) assay (Chiron), rolling circle amplification (RCA), single molecule hybridization detection (US Genomics), Invader assay (ThirdWave Technologies), and/or Bridge Litigation Assay (Genaco).

WO 2008/085797 PCT/US2007/089206 IV. NUCLEIC ACIDS [00187] The present invention concerns nucleic acids, modified or mimetic nucleic acids, miRNAs, mRNAs, genes, and representative fragments thereof that can be labeled, used in array analysis, or employed in diagnostic, therapeutic, or prognostic applications, particularly those related to pathological conditions such as cancer. The molecules may have been endogenously produced by a cell, or been synthesized or produced chemically or recombinantly. They may be isolated and/or purified. Each of the miRNAs described herein and includes the corresponding SEQ ID NO and accession numbers for these miRNA sequences. The name of a miRNA is often abbreviated and referred to without a "hsa-" prefix and will be understood as such, depending on the context. Unless otherwise indicated, miRNAs referred to in the application are human sequences identified as miR-X or let-X, where X is a number and/or letter. [00188] In certain aspects, a miRNA probe designated by a suffix "5P" or "3P" can be used. "5P" indicates that the mature miRNA derives from the 5' end of the precursor and a corresponding "3P" indicates that it derives from the 3' end of the precursor, as described on the world wide web at sanger.ac.uk. Moreover, in some embodiments, a miRNA probe is used that does not correspond to a known human miRNA. It is contemplated that these non human miRNA probes may be used in embodiments of the invention or that there may exist a human miRNA that is homologous to the non-human miRNA. In other embodiments, any mammalian cell, biological sample, or preparation thereof may be employed. [00189] In some embodiments of the invention, methods and compositions involving miRNA may concern miRNA, markers (e.g., mRNAs), and/or other nucleic acids. Nucleic acids may be, be at least, or be at most 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,21,22,23,24,25,26,27,28,29,30,31,32,33, 34,35,36,37,38,39,40,41,42,43,44, 45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 nucleotides, or any range WO 2008/085797 PCT/US2007/089206 derivable therein, in length. Such lengths cover the lengths of processed miRNA, miRNA probes, precursor miRNA, miRNA containing vectors, mRNA, mRNA probes, control nucleic acids, and other probes and primers. [00190] In many embodiments, miRNA are 19-24 nucleotides in length, while miRNA probes are 19-35 nucleotides in length, depending on the length of the processed miRNA and any flanking regions added. miRNA precursors are generally between 62 and 110 nucleotides in humans. [00191] Nucleic acids of the invention may have regions of identity or complementarity to another nucleic acid. It is contemplated that the region of complementarity or identity can be at least 5 contiguous residues, though it is specifically contemplated that the region is, is at least, or is at most 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51, 52,53,54,55,56,57,58,59,60,61,62,63,64,65,66, 67,68,69,70,71,72,73,74,75,76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 contiguous nucleotides. It is further understood that the length of complementarity within a precursor miRNA or other nucleic acid or between a miRNA probe and a miRNA or a miRNA gene are such lengths. Moreover, the complementarity may be expressed as a percentage, meaning that the complementarity between a probe and its target is 90% or greater over the length of the probe. In some embodiments, complementarity is or is at least 90%, 95% or 100%. In particular, such lengths may be applied to any nucleic acid comprising a nucleic acid sequence identified in any of SEQ ID NOs described herein, accession number, or any other sequence disclosed herein. Typically, the commonly used name of the miRNA is given (with its identifying source in the prefix, for example, "hsa" for human sequences) and the processed miRNA sequence. Unless otherwise indicated, a miRNA without a prefix will be understood to refer to a human miRNA. Moreover, a lowercase letter in a miRNA name may or may not be lowercase; for example, hsa-mir-130b WO 2008/085797 PCT/US2007/089206 can also be referred to as miR-130B. The term "miRNA probe" refers to a nucleic acid probe that can identify a particular miRNA or structurally related miRNAs. [00192] It is understood that some nucleic acids are derived from genomic sequences or a gene. In this respect, the term "gene" is used for simplicity to refer to the genomic sequence encoding the precursor nucleic acid or miRNA for a given miRNA or gene. However, embodiments of the invention may involve genomic sequences of a miRNA that are involved in its expression, such as a promoter or other regulatory sequences. [00193] The term "recombinant" may be used and this generally refers to a molecule that has been manipulated in vitro or that is a replicated or expressed product of such a molecule. [00194] The term "nucleic acid" is well known in the art. A "nucleic acid" as used herein will generally refer to a molecule (one or more strands) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A," a guanine "G," a thymine "T" or a cytosine "C") or RNA (e.g., an A, a G, an uracil "U" or a C). The term "nucleic acid" encompasses the terms "oligonucleotide" and "polynucleotide," each as a subgenus of the term "nucleic acid." [00195] The term "miRNA" generally refers to a single-stranded molecule, but in specific embodiments, molecules implemented in the invention will also encompass a region or an additional strand that is partially (between 10 and 50% complementary across length of strand), substantially (greater than 50% but less than 100% complementary across length of strand) or fully complementary to another region of the same single-stranded molecule or to another nucleic acid. Thus, miRNA nucleic acids may encompass a molecule that comprises one or more complementary or self-complementary strand(s) or "complement(s)" of a particular sequence. For example, precursor miRNA may have a self-complementary region, which is up to 100% complementary. miRNA probes or nucleic acids of the invention can include, can be or can be at least 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100% complementary to their target. [00196] It is understood that a "synthetic nucleic acid" of the invention means that the nucleic acid does not have all or part of a chemical structure or sequence of a naturally occurring nucleic acid. Consequently, it will be understood that the term "synthetic miRNA" WO 2008/085797 PCT/US2007/089206 refers to a "synthetic nucleic acid" that functions in a cell or under physiological conditions as a naturally occurring miRNA. [00197] While embodiments of the invention may involve synthetic miRNAs or synthetic nucleic acids, in some embodiments of the invention, the nucleic acid molecule(s) need not be "synthetic." In certain embodiments, a non-synthetic nucleic acid or miRNA employed in methods and compositions of the invention may have the entire sequence and structure of a naturally occurring mRNA or miRNA precursor or the mature mRNA or miRNA. For example, non-synthetic miRNAs used in methods and compositions of the invention may not have one or more modified nucleotides or nucleotide analogs. In these embodiments, the non-synthetic miRNA may or may not be recombinantly produced. In particular embodiments, the nucleic acid in methods and/or compositions of the invention is specifically a synthetic miRNA and not a non-synthetic miRNA (that is, not a miRNA that qualifies as "synthetic"); though in other embodiments, the invention specifically involves a non synthetic miRNA and not a synthetic miRNA. Any embodiments discussed with respect to the use of synthetic miRNAs can be applied with respect to non-synthetic miRNAs, and vice versa. [00198] It will be understood that the term "naturally occurring" refers to something found in an organism without any intervention by a person; it could refer to a naturally-occurring wildtype or mutant molecule. In some embodiments a synthetic miRNA molecule does not have the sequence of a naturally occurring miRNA molecule. In other embodiments, a synthetic miRNA molecule may have the sequence of a naturally occurring miRNA molecule, but the chemical structure of the molecule, particularly in the part unrelated specifically to the precise sequence (non-sequence chemical structure) differs from chemical structure of the naturally occurring miRNA molecule with that sequence. In some cases, the synthetic miRNA has both a sequence and non-sequence chemical structure that are not found in a naturally-occurring miRNA. Moreover, the sequence of the synthetic molecules will identify which miRNA is effectively being provided or inhibited; the endogenous miRNA will be referred to as the "corresponding miRNA." Corresponding miRNA sequences that can be used in the context of the invention include, but are not limited to, all or a portion of those sequences in the SEQ IDs provided herein, as well as any other miRNA sequence, miRNA precursor sequence, or any sequence complementary thereof. In some embodiments, the sequence is or is derived from or contains all or part of a sequence WO 2008/085797 PCT/US2007/089206 identified herein to target a particular miRNA (or set of miRNAs) that can be used with that sequence. Any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100,110, 120, 130 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260 or any number or range of sequences there between may be selected to the exclusion of all non-selected sequences. [00199] As used herein, "hybridization", "hybridizes" or "capable of hybridizing" is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature. The term "anneal" as used herein is synonymous with "hybridize." The term "hybridization", "hybridize(s)" or "capable of hybridizing" encompasses the terms "stringent condition(s)" or "high stringency" and the terms "low stringency" or "low stringency condition(s)." [00200] As used herein "stringent condition(s)" or "high stringency" are those conditions that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but preclude hybridization of random sequences. Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are well known to those of ordinary skill in the art, and are preferred for applications requiring high selectivity. Non-limiting applications include isolating a nucleic acid, such as a gene or a nucleic acid segment thereof, or detecting at least one specific mRNA transcript or a nucleic acid segment thereof, and the like. [00201] Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.5 M NaCl at temperatures of about 42'C to about 70'C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and to the presence or concentration of formamide, tetramethylammonium chloride or other solvent(s) in a hybridization mixture. [00202] It is also understood that these ranges, compositions and conditions for hybridization are mentioned by way of non-limiting examples only, and that the desired stringency for a particular hybridization reaction is often determined empirically by comparison to one or more positive or negative controls. Depending on the application envisioned it is preferred to employ varying conditions of hybridization to achieve varying WO 2008/085797 PCT/US2007/089206 degrees of selectivity of a nucleic acid towards a target sequence. In a non-limiting example, identification or isolation of a related target nucleic acid that does not hybridize to a nucleic acid under stringent conditions may be achieved by hybridization at low temperature and/or high ionic strength. Such conditions are termed "low stringency" or "low stringency conditions," and non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCI at a temperature range of about 20'C to about 50'C. Of course, it is within the skill of one in the art to further modify the low or high stringency conditions to suite a particular application. A. Nucleobase, Nucleoside, Nucleotide, and Modified Nucleotides [00203] As used herein a "nucleobase" refers to a heterocyclic base, such as for example a naturally occurring nucleobase (i.e., an A, T, G, C or U) found in at least one naturally occurring nucleic acid (i.e., DNA and RNA), and naturally or non-naturally occurring derivative(s) and analogs of such a nucleobase. A nucleobase generally can form one or more hydrogen bonds ("anneal" or "hybridize") with at least one naturally occurring nucleobase in a manner that may substitute for naturally occurring nuclcobase pairing (e.g., the hydrogen bonding between A and T, G and C, and A and U). [00204] "Purine" and/or "pyrimidine" nucleobase(s) encompass naturally occurring purine and/or pyrimidine nucleobases and also derivative(s) and analog(s) thereof, including but not limited to, those a purine or pyrimidine substituted by one or more of an alkyl, caboxyalkyl, amino, hydroxyl, halogen (i.e., fluoro, chloro, bromo, or iodo), thiol or alkylthiol moiety. Preferred alkyl (e.g., alkyl, carboxyalkyl, etc.) moieties comprise of from about 1, about 2, about 3, about 4, about 5, to about 6 carbon atoms. Other non-limiting examples of a purine or pyrimidine include a deazapurine, a 2,6-diaminopurine, a 5-fluorouracil, a xanthine, a hypoxanthine, a 8-bromoguanine, a 8-chloroguanine, a bromothymine, a 8-aminoguanine, a 8-hydroxyguanine, a 8-methylguanine, a 8-thioguanine, an azaguanine, a 2-aminopurine, a 5 ethylcytosine, a 5-methylcyosine, a 5-bromouracil, a 5-ethyluracil, a 5-iodouracil, a 5 chlorouracil, a 5-propyluracil, a thiouracil, a 2-methyladenine, a methylthioadenine, a N,N diemethyladenine, an azaadenines, a 8-bromoadenine, a 8-hydroxyadenine, a 6 hydroxyaminopurine, a 6-thiopurine, a 4-(6-aminohexyl/cytosine), and the like. Other examples are well known to those of skill in the art. [00205] As used herein, a "nucleoside" refers to an individual chemical unit comprising a nucleobase covalently attached to a nucleobase linker moiety. A non-limiting example of a WO 2008/085797 PCT/US2007/089206 "nucleobase linker moiety" is a sugar comprising 5-carbon atoms (i.e., a "5-carbon sugar"), including but not limited to a deoxyribose, a ribose, an arabinose, or a derivative or an analog of a 5-carbon sugar. Non-limiting examples of a derivative or an analog of a 5-carbon sugar include a 2'-fluoro-2'-deoxyribose or a carbocyclic sugar where a carbon is substituted for an oxygen atom in the sugar ring. Different types of covalent attachment(s) of a nucleobase to a nucleobase linker moiety are known in the art (Kornberg and Baker, 1992). [00206] As used herein, a "nucleotide" refers to a nucleoside further comprising a "backbone moiety". A backbone moiety generally covalently attaches a nucleotide to another molecule comprising a nucleotide, or to another nucleotide to form a nucleic acid. The "backbone moiety" in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5-carbon sugar. The attachment of the backbone moiety typically occurs at either the 3'- or 5'-position of the 5-carbon sugar. However, other types of attachments are known in the art, particularly when a nucleotide comprises derivatives or analogs of a naturally occurring 5-carbon sugar or phosphorus moiety. [00207] A nucleic acid may comprise, or be composed entirely of, a derivative or analog of a nucleobase, a nucleobase linker moiety and/or backbone moiety that may be present in a naturally occurring nucleic acid. RNA with nucleic acid analogs may also be labeled according to methods of the invention. As used herein a "derivative" refers to a chemically modified or altered form of a naturally occurring molecule, while the terms "mimic" or "analog" refer to a molecule that may or may not structurally resemble a naturally occurring molecule or moiety, but possesses similar functions. As used herein, a "moiety" generally refers to a smaller chemical or molecular component of a larger chemical or molecular structure. Nucleobase, nucleoside and nucleotide analogs or derivatives are well known in the art, and have been described (see for example, Scheit, 1980, incorporated herein by reference). [00208] Additional non-limiting examples of nucleosides, nucleotides or nucleic acids include those in: U.S. Patents 5,681,947, 5,652,099 and 5,763,167, 5,614,617, 5,670,663, 5,872,232, 5,859,221, 5,446,137, 5,886,165, 5,714,606, 5,672,697, 5,466,786, 5,792,847, 5,223,618, 5,470,967, 5,378,825, 5,777,092, 5,623,070, 5,610,289, 5,602,240, 5,858,988, 5,214,136, 5,700,922, 5,708,154, 5,728,525, 5,637,683, 6,251,666, 5,480,980, and 5,728,525, each of which is incorporated herein by reference in its entirety.

WO 2008/085797 PCT/US2007/089206 [00209] Labeling methods and kits of the invention specifically contemplate the use of nucleotides that are both modified for attachment of a label and can be incorporated into a miRNA molecule. Such nucleotides include those that can be labeled with a dye, including a fluorescent dye, or with a molecule such as biotin. Labeled nucleotides are readily available; they can be acquired commercially or they can be synthesized by reactions known to those of skill in the art. [00210] Modified nucleotides for use in the invention are not naturally occurring nucleotides, but instead, refer to prepared nucleotides that have a reactive moiety on them. Specific reactive functionalities of interest include: amino, sulfhydryl, sulfoxyl, aminosulfhydryl, azido, epoxide, isothiocyanate, isocyanate, anhydride, monochlorotriazine, dichlorotriazine, mono-or dihalogen substituted pyridine, mono- or disubstituted diazine, maleimide, epoxide, aziridine, sulfonyl halide, acid halide, alkyl halide, aryl halide, alkylsulfonate, N-hydroxysuccinimide ester, imido ester, hydrazine, azidonitrophenyl, azide, 3-(2-pyridyl dithio)-propionamide, glyoxal, aldehyde, iodoacetyl, cyanomethyl ester, p nitrophenyl ester, o-nitrophenyl ester, hydroxypyridine ester, carbonyl imidazole, and the other such chemical groups. In some embodiments, the reactive functionality may be bonded directly to a nucleotide, or it may be bonded to the nucleotide through a linking group. The functional moiety and any linker cannot substantially impair the ability of the nucleotide to be added to the miRNA or to be labeled. Representative linking groups include carbon containing linking groups, typically ranging from about 2 to 18, usually from about 2 to 8 carbon atoms, where the carbon containing linking groups may or may not include one or more heteroatoms, e.g. S, 0, N etc., and may or may not include one or more sites of unsaturation. Of particular interest in many embodiments is alkyl linking groups, typically lower alkyl linking groups of 1 to 16, usually 1 to 4 carbon atoms, where the linking groups may include one or more sites of unsaturation. The functionalized nucleotides (or primers) used in the above methods of functionalized target generation may be fabricated using known protocols or purchased from commercial vendors, e.g., Sigma, Roche, Ambion, Biosearch Technologies and NEN. Functional groups may be prepared according to ways known to those of skill in the art, including the representative information found in U.S. Patents 4,404,289; 4,405,711; 4,337,063 and 5,268,486, and U.K.. Patent 1,529,202, which are all incorporated by reference.

WO 2008/085797 PCT/US2007/089206 [00211] Amine-modified nucleotides are used in several embodiments of the invention. The amine-modified nucleotide is a nucleotide that has a reactive amine group for attachment of the label. It is contemplated that any ribonucleotide (G, A, U, or C) or deoxyribonucleotide (G, A, T, or C) can be modified for labeling. Examples include, but are not limited to, the following modified ribo- and deoxyribo-nucleotides: 5-(3-aminoallyl) UTP; 8-[(4-amino)butyl]-amino-ATP and 8-[(6-amino)butyl]-amino-ATP; N6-(4 amino)butyl-ATP, N6-(6-amino)butyl-ATP, N4-[2,2-oxy-bis-(ethylamine)]-CTP; N6-(6 Amino)hexyl-ATP; 8-[(6-Amino)hexyl]-amino-ATP; 5-propargylamino-CTP, 5 propargylamino-UTP; 5-(3 -aminoallyl)-dUTP; 8-[(4-amino)butyl]-amino-dATP and 8-[(6 amino)butyl]-amino-dATP; N6-(4-amino)butyl-dATP, N6-(6-amino)butyl-dATP, N4-[2,2 oxy-bis-(ethylamine)]-dCTP; N6-(6-Amino)hexyl-dATP; 8-[(6-Amino)hexyl]-amino-dATP; 5-propargylamino-dCTP, and 5-propargylamino-dUTP. Such nucleotides can be prepared according to methods known to those of skill in the art. Moreover, a person of ordinary skill in the art could prepare other nucleotide entities with the same amine-modification, such as a 5-(3-aminoallyl)-CTP, GTP, ATP, dCTP, dGTP, dTTP, or dUTP in place of a 5-(3 aminoallyl)-UTP. B. Preparation of Nucleic Acids [00212] A nucleic acid may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production, or biological production. It is specifically contemplated that miRNA probes of the invention are chemically synthesized. [00213] In some embodiments of the invention, miRNAs are recovered or isolated from a biological sample. The miRNA may be recombinant or it may be natural or endogenous to the cell (produced from the cell's genome). It is contemplated that a biological sample may be treated in a way so as to enhance the recovery of small RNA molecules such as miRNA. U.S. Patent Application Serial No. 10/667,126 describes such methods and it is specifically incorporated by reference herein. Generally, methods involve lysing cells with a solution having guanidinium and a detergent. [00214] Alternatively, nucleic acid synthesis is performed according to standard methods. See, for example, Itakura and Riggs (1980) and U.S. Patents 4,704,362, 5,221,619, and 5,583,013, each of which is incorporated herein by reference. Non-limiting examples of a synthetic nucleic acid (e.g., a synthetic oligonucleotide), include a nucleic acid made by in WO 2008/085797 PCT/US2007/089206 vitro chemically synthesis using phosphotriester, phosphite, or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., 1986 and U.S. Patent 5,705,629, each incorporated herein by reference. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Patents 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference. [00215] A non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCRrm (see for example, U.S. Patents 4,683,202 and 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Patent 5,645,897, incorporated herein by reference. See also Sambrook et al., 2001, incorporated herein by reference). [00216] Oligonucleotide synthesis is well known to those of skill in the art. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Patents 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference. [00217] Recombinant methods for producing nucleic acids in a cell are well known to those of skill in the art. These include the use of vectors (viral and non-viral), plasmids, cosmids, and other vehicles for delivering a nucleic acid to a cell, which may be the target cell (e.g., a cancer cell) or simply a host cell (to produce large quantities of the desired RNA molecule). Alternatively, such vehicles can be used in the context of a cell free system so long as the reagents for generating the RNA molecule are present. Such methods include those described in Sambrook, 2003, Sambrook, 2001 and Sambrook, 1989, which are hereby incorporated by reference. C. Isolation of Nucleic Acids [00218] Nucleic acids may be isolated using techniques well known to those of skill in the art, though in particular embodiments, methods for isolating small nucleic acid molecules, and/or isolating RNA molecules can be employed. Chromatography is a process often used to separate or isolate nucleic acids from protein or from other nucleic acids. Such methods can involve electrophoresis with a gel matrix, filter columns, alcohol precipitation, and/or other chromatography. If miRNA from cells is to be used or evaluated, methods generally WO 2008/085797 PCT/US2007/089206 involve lysing the cells with a chaotropic (e.g., guanidinium isothiocyanate) and/or detergent (e.g., N-lauroyl sarcosine) prior to implementing processes for isolating particular populations of RNA. [00219] In particular methods for separating miRNA from other nucleic acids, a gel matrix is prepared using polyacrylamide, though agarose can also be used. The gels may be graded by concentration or they may be uniform. Plates or tubing can be used to hold the gel matrix for electrophoresis. Usually one-dimensional electrophoresis is employed for the separation of nucleic acids. Plates are used to prepare a slab gel, while the tubing (glass or rubber, typically) can be used to prepare a tube gel. The phrase "tube electrophoresis" refers to the use of a tube or tubing, instead of plates, to form the gel. Materials for implementing tube electrophoresis can be readily prepared by a person of skill in the art or purchased, such as from C.B.S. Scientific Co., Inc. or Scie-Plas. [00220] Methods may involve the use of organic solvents and/or alcohol to isolate nucleic acids, particularly miRNA used in methods and compositions of the invention. Some embodiments are described in U.S. Patent Application Serial No. 10/667,126, which is hereby incorporated by reference. Generally, this disclosure provides methods for efficiently isolating small RNA molecules from cells comprising: adding an alcohol solution to a cell lysate and applying the alcohol/lysate mixture to a solid support before eluting the RNA molecules from the solid support. In some embodiments, the amount of alcohol added to a cell lysate achieves an alcohol concentration of about 55% to 60%. While different alcohols can be employed, ethanol works well. A solid support may be any structure, and it includes beads, filters, and columns, which may include a mineral or polymer support with electronegative groups. A glass fiber filter or column has worked particularly well for such isolation procedures. [00221] In specific embodiments, miRNA isolation processes include: a) lysing cells in the sample with a lysing solution comprising guanidinium, wherein a lysate with a concentration of at least about 1 M guanidinium is produced; b) extracting miRNA molecules from the lysate with an extraction solution comprising phenol; c) adding to the lysate an alcohol solution for forming a lysate/alcohol mixture, wherein the concentration of alcohol in the mixture is between about 35% to about 70%; d) applying the lysate/alcohol mixture to a solid support; e) eluting the miRNA molecules from the solid support with an ionic solution; and, WO 2008/085797 PCT/US2007/089206 f) capturing the miRNA molecules. Typically the sample is dried and resuspended in a liquid and volume appropriate for subsequent manipulation. V. LABELS AND LABELING TECHNIQUES [00222] In some embodiments, the present invention concerns miRNA that are labeled. It is contemplated that miRNA may first be isolated and/or purified prior to labeling. This may achieve a reaction that more efficiently labels the miRNA, as opposed to other RNA in a sample in which the miRNA is not isolated or purified prior to labeling. In many embodiments of the invention, the label is non-radioactive. Generally, nucleic acids may be labeled by adding labeled nucleotides (one-step process) or adding nucleotides and labeling the added nucleotides (two-step process). A. Labeling Techniques [00223] In some embodiments, nucleic acids are labeled by catalytically adding to the nucleic acid an already labeled nucleotide or nucleotides. One or more labeled nucleotides can be added to miRNA molecules. See U.S. Patent 6,723,509, which is hereby incorporated by reference. [00224] In other embodiments, an unlabeled nucleotide or nucleotides is catalytically added to a miRNA, and the unlabeled nucleotide is modified with a chemical moiety that enables it to be subsequently labeled. In embodiments of the invention, the chemical moiety is a reactive amine such that the nucleotide is an amine-modified nucleotide. Examples of amine-modified nucleotides are well known to those of skill in the art, many being commercially available such as from Ambion, Sigma, Jena Bioscience, and TriLink. [00225] In contrast to labeling of cDNA during its synthesis, the issue for labeling miRNA is how to label the already existing molecule. The present invention concerns the use of an enzyme capable of using a di- or tri-phosphate ribonucleotide or deoxyribonucleotide as a substrate for its addition to a miRNA. Moreover, in specific embodiments, it involves using a modified di- or tri-phosphate ribonucleotide, which is added to the 3' end of a miRNA. Enzymes capable of adding such nucleotides include, but are not limited to, poly(A) polymerase, terminal transferase, and polynucleotide phosphorylase. In specific embodiments of the invention, a ligase is contemplated as not being the enzyme used to add the label, and instead, a non-ligase enzyme is employed. Terminal transferase catalyzes the WO 2008/085797 PCT/US2007/089206 addition of nucleotides to the 3' terminus of a nucleic acid. Polynucleotide phosphorylase can polymerize nucleotide diphosphates without the need for a primer. B. Labels [00226] Labels on miRNA or miRNA probes may be colorimetric (includes visible and UV spectrum, including fluorescent), luminescent, enzymatic, or positron emitting (including radioactive). The label may be detected directly or indirectly. Radioactive labels include , 32p, 33 P, and 31S. Examples of enzymatic labels include alkaline phosphatase, luciferase, horseradish peroxidase, and p-galactosidase. Labels can also be proteins with luminescent properties, e.g., green fluorescent protein and phycoerythrin. [00227] The colorimetric and fluorescent labels contemplated for use as conjugates include, but are not limited to, Alexa Fluor dyes, BODIPY dyes, such as BODIPY FL; Cascade Blue; Cascade Yellow; coumarin and its derivatives, such as 7-amino-4 methylcoumarin, aminocoumarin and hydroxycoumarin; cyanine dyes, such as Cy3 and Cy5; eosins and erythrosins; fluorescein and its derivatives, such as fluorescein isothiocyanate; macrocyclic chelates of lanthanide ions, such as Quantum DyeTM; Marina Blue; Oregon Green; rhodamine dyes, such as rhodamine red, tetramethylrhodamine and rhodamine 6G; Texas Red; , fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer; and, TOTAB. [00228] Specific examples of dyes include, but are not limited to, those identified above and the following: Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500. Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, and, Alexa Fluor 750; amine-reactive BODIPY dyes, such as BODIPY 493/503, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/655, BODIPY FL, BODIPY R6G, BODIPY TMR, and, BODIPY-TR; Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, 2',4',5',7'-Tetrabromosulfonefluorescein, and TET. [00229] Specific examples of fluorescently labeled ribonucleotides are available from Molecular Probes, and these include, Alexa Fluor 488-5-UTP, Fluorescein-12-UTP, BODIPY WO 2008/085797 PCT/US2007/089206 FL-14-UTP, BODIPY TMR-14-UTP, Tetramethylrhodamine-6-UTP, Alexa Fluor 546-14 UTP, Texas Red-5-UTP, and BODIPY TR-14-UTP. Other fluorescent ribonucleotides are available from Amersham Biosciences, such as Cy3-UTP and Cy5-UTP. [00230] Examples of fluorescently labeled deoxyribonucleotides include Dinitrophenyl (DNP)-1-dUTP, Cascade Blue-7-dUTP, Alexa Fluor 488-5-dUTP, Fluorescein-12-dUTP, Oregon Green 488-5-dUTP, BODIPY FL-14-dUTP, Rhodamine Green-5-dUTP, Alexa Fluor 532-5-dUTP, BODIPY TMR-14-dUTP, Tetramethylrhodamine-6-dUTP, Alexa Fluor 546 14-dUTP, Alexa Fluor 568-5-dUTP, Texas Red-12-dUTP, Texas Red-5-dUTP, BODIPY TR 14-dUTP, Alexa Fluor 594-5-dUTP, BODIPY 630/650-14-dUTP, BODIPY 650/665-14 dUTP; Alexa Fluor 488-7-OBEA-dCTP, Alexa Fluor 546-16-OBEA-dCTP, Alexa Fluor 594 7-OBEA-dCTP, Alexa Fluor 647-12-OBEA-dCTP. [00231] It is contemplated that nucleic acids may be labeled with two different labels. Furthermore, fluorescence resonance energy transfer (FRET) may be employed in methods of the invention (e.g., Klostermeier et al., 2002; Emptage, 2001; Didenko, 2001, each incorporated by reference). [00232] Alternatively, the label may not be detectable per se, but indirectly detectable or allowing for the isolation or separation of the targeted nucleic acid. For example, the label could be biotin, digoxigenin, polyvalent cations, chelator groups and the other ligands, include ligands for an antibody. C. Visualization Techniques [00233] A number of techniques for visualizing or detecting labeled nucleic acids are readily available. Such techniques include, microscopy, arrays, Fluorometry, Light cyclers or other real time PCR machines, FACS analysis, scintillation counters, Phosphoimagers, Geiger counters, MRI, CAT, antibody-based detection methods (Westerns, immunofluorescence, immunohistochemistry), histochemical techniques, HPLC (Griffey et al., 1997), spectroscopy, capillary gel electrophoresis (Cummins et al., 1996), spectroscopy; mass spectroscopy; radiological techniques; and mass balance techniques. [00234] When two or more differentially colored labels are employed, fluorescent resonance energy transfer (FRET) techniques may be employed to characterize association of one or more nucleic acid. Furthermore, a person of ordinary skill in the art is well aware of WO 2008/085797 PCT/US2007/089206 ways of visualizing, identifying, and characterizing labeled nucleic acids, and accordingly, such protocols may be used as part of the invention. Examples of tools that may be used also include fluorescent microscopy, a BioAnalyzer, a plate reader, Storm (Molecular Dynamics), Array Scanner, FACS (fluorescent activated cell sorter), or any instrument that has the ability to excite and detect a fluorescent molecule. VI. KITS [00235] Any of the compositions described herein may be comprised in a kit. In a non limiting example, reagents for isolating miRNA, labeling miRNA, and/or evaluating a miRNA population using an array, nucleic acid amplification, and/or hybridization can be included in a kit, as well reagents for preparation of samples from blood samples. The kit may further include reagents for creating or synthesizing miRNA probes. The kits will thus comprise, in suitable container means, an enzyme for labeling the miRNA by incorporating labeled nucleotide or unlabeled nucleotides that are subsequently labeled. In certain aspects, the kit can include amplification reagents. In other aspects, the kit may include various supports, such as glass, nylon, polymeric beads, and the like, and/or reagents for coupling any probes and/or target nucleic acids. It may also include one or more buffers, such as reaction buffer, labeling buffer, washing buffer, or a hybridization buffer, compounds for preparing the miRNA probes, and components for isolating miRNA. Other kits of the invention may include components for making a nucleic acid array comprising miRNA, and thus, may include, for example, a solid support. [00236] Kits for implementing methods of the invention described herein are specifically contemplated. In some embodiments, there are kits for preparing miRNA for multi-labeling and kits for preparing miRNA probes and/or miRNA arrays. In these embodiments, kit comprise, in suitable container means, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more of the following: (1) poly(A) polymerase; (2) unmodified nucleotides (G, A, T, C, and/or U); (3) a modified nucleotide (labeled or unlabeled); (4) poly(A) polymerase buffer; and, (5) at least one microfilter; (6) label that can be attached to a nucleotide; (7) at least one miRNA probe; (8) reaction buffer; (9) a miRNA array or components for making such an array; (10) acetic acid; (11) alcohol; (12) solutions for preparing, isolating, enriching, and purifying miRNAs or miRNA probes or arrays. Other reagents include those generally used for manipulating RNA, such as formamide, loading dye, ribonuclease inhibitors, and DNase.

WO 2008/085797 PCT/US2007/089206 [00237] In specific embodiments, kits of the invention include an array containing miRNA probes, as described in the application. An array may have probes corresponding to all known miRNAs of an organism or a particular tissue or organ in particular conditions, or to a subset of such probes. The subset of probes on arrays of the invention may be or include those identified as relevant to a particular diagnostic, therapeutic, or prognostic application. For example, the array may contain one or more probes that is indicative or suggestive of (1) a disease or condition (acute myeloid leukemia), (2) susceptibility or resistance to a particular drug or treatment; (3) susceptibility to toxicity from a drug or substance; (4) the stage of development or severity of a disease or condition (prognosis); and (5) genetic predisposition to a disease or condition. [00238] For any kit embodiment, including an array, there can be nucleic acid molecules that contain or can be used to amplify a sequence that is a variant of, identical to or complementary to all or part of any of SEQ IDs described herein. In certain embodiments, a kit or array of the invention can contain one or more probes for the miRNAs identified by the SEQ IDs described herein. Any nucleic acid discussed above may be implemented as part of a kit. [00239] The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit (labeling reagent and label may be packaged together), the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing the nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow molded plastic containers into which the desired vials are retained. [00240] When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.

WO 2008/085797 PCT/US2007/089206 [00241] However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means. In some embodiments, labeling dyes are provided as a dried power. It is contemplated that 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 pg or at least or at most those amounts of dried dye are provided in kits of the invention. The dye may then be resuspended in any suitable solvent, such as DMSO. [00242] Such kits may also include components that facilitate isolation of the labeled miRNA. It may also include components that preserve or maintain the miRNA or that protect against its degradation. Such components may be RNAse-free or protect against RNAses. Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution. [00243] A kit will also include instructions for employing the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented. [00244] Kits of the invention may also include one or more of the following: Control RNA; nuclease-free water; RNase-free containers, such as 1.5 ml tubes; RNase-free elution tubes; PEG or dextran; ethanol; acetic acid; sodium acetate; ammonium acetate; guanidinium; detergent; nucleic acid size marker; RNase-free tube tips; and RNase or DNase inhibitors. [00245] It is contemplated that such reagents are embodiments of kits of the invention. Such kits, however, are not limited to the particular items identified above and may include any reagent used for the manipulation or characterization of miRNA. VII. EXAMPLES [00246] The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. One skilled in the art will appreciate readily that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those objects, ends and advantages inherent herein. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not WO 2008/085797 PCT/US2007/089206 intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art. Unless otherwise designated, catalog numbers refer to products available by that number from Ambion, Inc.@, The RNA Company. EXAMPLE 1: GENE EXPRESSION ANALYSIS FOLLOWING TRANSFECTION WITH HSA MIR-16 [00247] miRNAs are believed to primarily influence gene expression at the level of translation. Translational regulation leading to an up or down change in protein expression may lead to changes in activity and expression of downstream gene products and genes that are in turn regulated by those proteins. These regulatory effects would be revealed as changes in the global mRNA expression profile. Furthermore, it has recently been reported that, in some instances, miRNAs may reduce the mRNA levels of their direct targets (Bagga et al., 2005; Lim et al., 2005), and such changes can be observed upon microarray gene expression analysis. Microarray gene expression analyses were performed to identify genes that are mis-regulated by hsa-miR-16. [00248] Synthetic Pre-miR-16 (Ambion) was reverse transfected into quadruplicate samples of A549 cells for each of three time points. Cells were transfected using siPORT NeoFX (Ambion) according to the manufacturer's recommendations using the following parameters: 200,000 cells per well in a 6 well plate, 5.0 pil of NeoFX, 30 nM final concentration of miRNA in 2.5 ml. Cells were harvested at 4 h, 24 h, and 72 h post transfection. Total RNA was extracted using RNAqueous-4PCR (Ambion) according to the manufacturer's recommended protocol. [00249] mRNA array analyses were performed by Asuragen Services (Austin,TX), according to the company's standard operating procedures. Using the MessageAmp TM 11-96 aRNA Amplification Kit (Ambion, cat #1819) 2 ptg of total RNA were used for target preparation and labeling with biotin. cRNA yields were quantified using an Agilent Bioanalyzer 2100 capillary electrophoresis protocol. Labeled target was hybridized to Affymetrix mRNA arrays (Human HG-U133A 2.0 arrays) using the manufacturer's recommendations and the following parameters. Hybridizations were carried out at 45'C for 16 hr in an Affymetrix Model 640 hybridization oven. Arrays were washed and stained on an WO 2008/085797 PCT/US2007/089206 Affymetrix FS450 Fluidics station, running the wash script Midi-euk2v3_450. The arrays were scanned on a Affymetrix GeneChip Scanner 3000. Summaries of the image signal data, group mean values, p-values with significance flags, log ratios and gene annotations for every gene on the array were generated using the Affymetrix Statistical Algorithm MAS 5.0 (GCOS v1.3). Data were reported in a file (cabinet) containing the Affymetrix data and result files and in files (.cel) containing the primary image and processed cell intensities of the arrays. Data were normalized for the effect observed by the average of two negative control microRNA sequences and then were averaged together for presentation. A list of genes whose expression levels varied by at least 0.7 log2 from the average negative control was assembled. Results of the microarray gene expression analysis are shown in Table 1.

WO 2008/085797 PCT/US2007/089206 Table 1. Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miR hsa-miR- 16. Gene Symbol RefSeq Transcript ID A log 2 ABCB6///ATG9A NM 005689 /// NM 024085 -0.774183 ACOX2 NM 003500 -0.747677 ACTR2 NM 001005386//NM 005722 0.706621 NM001033049 /// NM 001112 /// ADARBI NM 015833 ///NM 015834 1.12042 ADRB2 NM 000024 0.822471 ANKRD12 NM 015208 0.920296 AOX1 NM 001159 0.71218 ARHGDIA NM 004309 -1.31009 ARHGDIB NM 001175 0.974886 ARL2 NM 001667 -1.26863 ARL2BP NM 012106 1.35222 ATP6VOE NM 003945 1.25179 AXL NM 001699 //NM 021913 1.17272 BAMBI NM 012342 -0.890685 NM 000716 //NM 001017364//I C4BPB NM 001017365 ///NM 001017366 //NM 001017367 1.48739 CA12 NM 001218 I//NM 206925 -1.09634 CCND1 NM 053056 -0.747979 CCNG2 NM 004354 0.94188 CDC37L1 NM 017913 -0.851037 CDH1 NM 004360 -0.735543 CDH17 NM 004063 -0.805907 CDKN2C NM 001262 ///NM 078626 -0.77508 CDS2 NM 003818 -0.948554 CFH /// CFHLI NM 000186///NM 001014975///NM 002113 -0.917773 CGI-48 NM 016001 1.48424 CHAF1A NM 005483 -0.704031 CHUK NM 001278 -1.05995 COL11A1 NM 001854///NM 080629///NM 080630 0.7736 COL1A1 NM 000088 -0.705029 CPS1 NM 001875 -0.713235 CTGF NM 001901 1.22906 CYP4F11 NM021187 -0.829511 CYP4F3 NM 000896 -1.12563 DDAH1 NM 012137 0.822493 D102 NM 000793 //NM 001007023 //NM 013989 0.814143 DSU NM 018000 0.74556 DUSPI NM 004417 0.773277 E2F8 NM 024680 -0.773773 EEF1D NM 001960///NM 032378 0.95742 EFEMPI NM 004105 ///NM 018894 0.882177 ENO1 NM 001428 1.00751 FBXO11 NM 012167///NM 018693//NM 025133 0.924295 FGF2 NM 002006 -1.19115 FGFR4 NM 002011///NM 022963 ///NM 213647 -0.872234 FGG NM 000509 /// NM 021870 -0.813252 FLJ13910 NM 022780 0.846746 FNBP1 NM 015033 0.743257 WO 2008/085797 PCT/US2007/089206 GALNT7 NM 017423 -1.01457 GBP1 NM 002053 0.807432 HAS2 NM 005328 -0.861488 HEG XM 087386 0.738182 IF116 NM 005531 0.829221 INHBC NM 005538 0.797435 INSL4 NM 002195 -0.916801 KCNJ2 NM 000891 0.857436 KIAA0485 - 0.743897 KLF4 NM 004235 -0.992125 KRT7 NM 005556 1.17333 LCN2 NM 005564 -0.811381 LRP12 NM 013437 -0.882349 MAP7 NM 003980 -0.940371 MCLI NM 021960 // NM 182763 1.11653 MYL9 NM 006097 // NM 181526 1.15849 NABI NM 005966 -0.724633 NM 001033053 //NM 014922 /I/NM033004 NALP1 ///NM 033006 //NM 033007 0.914964 NF1 NM 000267 -1.03572 NNMT NM 006169 0.997492 NPC1 NM 000271 0.911858 NUCKS NM 022731 2.31221 NUPLI NM 001008564 //NM 001008565 //NM 014089 -0.908999 PGK1 NM 000291 1.70175 PHACTR2 NM 014721 -1.1275 PLA2G4A NM 024420 -0.878708 PLSCR4 NM 020353 -1.92309 PMCH NM 002674 1.09088 PODXL NM 001018111 // NM 005397 0.927375 PPAP2C NM 003712 // NM 177526 // NM 177543 -0.792886 PRO1843 --- 1.14274 PTENP1 --- 0.952354 PTGS2 NM 000963 -1.72596 PTK9 NM 002822 // NM 198974 0.970336 PTPN12 NM 002835 0.711122 NM006775 // NM 206853 /I QKI NM 206854 I//NM 206855 0.795792 RAB2 NM 002865 1.24122 RAFTLIN NM 015150 1.16163 RBL1 NM 002895 I//NM 183404 -0.766312 RDX NM 002906 0.704751 RHEB NM 005614 1.07577 RIP NM 001033002 // NM 032308 1.34286 RPL14 NM 001034996//NM 003973 0.934016 RPL38 NM 000999 1.3638 RPS11 NM 001015 1.22134 RPS6KA3 NM 004586 -0.875649 RPS6KA5 NM 004755 //NM 182398 0.806899 SlooP NM 005980 -0.840949 SCARB2 NM 005506 0.857602 WO 2008/085797 PCT/US2007/089206 NM 015129 /// NM 032569 // NM 145799 SEPT6 /// N-PAC I//NM 145800//NM 145802 0.703914 SKP2 NM 005983 /I NM 032637 0.728768 SLC11A2 NM 000617 -1.01869 SLC4A7 NM 003615 -0.80415 SMARCA2 NM 003070 //NM 139045 0.967136 SPARC NM 003118 1.07583 STCl NM 003155 0.787502 SULTICI NM 001056 I//NM 176825 1.12689 SUMO2 NM 001005849 //NM 006937 0.792739 NM015293 // NM 033071 /I SYNEl NM 133650 //NM 182961 0.852103 TACCI NM 006283 -1.02015 TAGLN NM 001001522///NM 003186 1.8698 TFG NM 001007565 ///NM 006070 0.981989 THBD NM 000361 0.840966 THBS1 NM 003246 -0.872199 THUMPD1 NM 017736 -0.721243 TMEM45A NM 018004 -0.874868 TNFSF9 NM 003811 -1.13877 TOX NM 014729 1.16189 NM 000366 //NM 001018004 ///NM 001018005 TPM1 //NM 001018006//NM 001018007/ 0.792231 TRA1 NM 003299 2.10346 TRIM22 NM 006074 1.24509 TXN NM 003329 1.37224 NM 003345 // NM 194259 /// UBE2I NM 194260 //NM 194261 0.882609 UBE2L6 NM 004223 I//NM 198183 0.709343 USP34 NM 014709 0.818893 VDAC3 NM 005662 1.14436 VIL2 NM 003379 0.899532 WISP2 NM 003881 0.703121 XTP2 NM 015172 1.05499 ZBED2 NM 024508 0.770913 [00250] Manipulation of the expression levels of the genes listed in Table 1 represents a potentially useful therapy for cancer and other diseases in which increased or reduced expression of hsa-miR-16 has a role in the disease. EXAMPLE 2: CELLULAR PATHWAYS AFFECTED BY HSA-MIR-16 [00251] The mis-regulation of gene expression by hsa-miR-16 (Table 1) affects many cellular pathways that represent potential therapeutic targets for the control of cancer and other diseases and disorders. The inventors determined the identity and nature of the cellular genetic pathways affected by the regulatory cascade induced by hsa-miR-16 expression.

WO 2008/085797 PCT/US2007/089206 Cellular pathway analyses were performed using Ingenuity Pathways Analysis (Ingenuity* Systems, Redwood City, CA). The most significantly affected pathways following over expression of hsa-miR-16 in A549 cells are shown in Table 2. Table 2. Significantly affected functional cellular pathways following hsa-miR-16 over expression in human cancer cells. Number of Genes Pathway Functions 15 Drug Metabolism, Lipid Metabolism, Small Molecule Biochemistry 14 Cancer, Cell Morphology, Cell Cycle 13 Cellular Growth and Proliferation, Cancer, Cellular Development 1 Molecular Transport, Protein Trafficking, Cell-To-Cell Signaling and Interaction 1 Cellular Assembly and Organization, Cell Morphology, Molecular Transport [00252] These data demonstrate that hsa-miR-16 directly or indirectly affects the expression of numerous metabolic-, cellular proliferation-, cellular development-, and cell cycle-related genes and thus primarily affects functional pathways related to cellular growth, development, and proliferation. Those cellular processes all have integral roles in the development and progression of various cancers. Manipulation of the expression levels of genes in the cellular pathways shown in Table 2 represents a potentially useful therapy for cancer and other diseases in which increased or reduced expression of hsa-miR- 16 has a role in the disease. EXAMPLE 3: PREDICTED GENE TARGETS OF HSA-MIR-16 [00253] Gene targets for binding of and regulation by hsa-miR-16-1 were predicted using the proprietary algorithm miRNATarget (Asuragen) and are shown in Table 3.

WO 2008/085797 PCT/US2007/089206 Table 3. Predicted target genes of hsa-miR-16. Gene Symbol Trascrip ID Description AAAl NM_207285 AAAl protein isoform III AACS NM 023928 acetoacetyl-CoA synthetase AADAT NM_016228 alpha-aminoadipate aminotransferase AASDHPPT NM_015423 aminoadipate-semialdehyde AATF NM_012138 apoptosis antagonizing transcription factor ABAT NM_000663 4-aminobutyrate aminotransferase precursor ABCA1 NM_005502 ATP-binding cassette, sub-family A member 1 ABCA3 NM_001089 ATP-binding cassette, sub-family A member 3 ABCB8 NM 007188 ATP-binding cassette, sub-family B, member 8 ABCB9 NM_203445 ATP-binding cassette, sub-family B (MDR/TAP), ABCC1O NM_033450 ATP-binding cassette, sub-family C, member 10 ABCC13 NM_138726 ATP-binding cassette protein C13 isoform a ABCC3 NM_020038 ATP-binding cassette, sub-family C, member 3 ABCC5 NM_005688 ATP-binding cassette, sub-family C, member 5 ABCF1 NM_001025091 ATP-binding cassette, sub-family F, member 1 ABCF2 NM_005692 ATP-binding cassette, sub-family F, member 2 ABCF3 NM_018358 ATP-binding cassette, sub-family F (GCN20), ABCG4 NM_022169 ATP-binding cassette, subfamily G, member 4 ABHD11 NM_031295 abhydrolase domain containing 11 isoform 4 ABHD13 NM_032859 hypothetical protein LOC84945 ABHD2 NM_007011 alpha/beta hydrolase domain containing protein ABI3 NM_016428 NESH protein ABLI NM_005157 v-abl Abelson murine leukemia viral oncogene ABLIMl NM_001003407 actin-binding LIM protein 1 isoform b ABTB2 NM_145804 ankyrin repeat and BTB (POZ) domain containing ACAA1 NM_001607 acetyl-Coenzyme A acyltransferase 1 ACACA NM_198834 acetyl-Coenzyme A carboxylase alpha isoform 1 ACACB NM_001093 acetyl-Coenzyme A carboxylase beta ACAD9 NM_014049 acyl-Coenzyme A dehydrogenase family, member 9 ACCN4 NM 018674 amiloride-sensitive cation channel 4 isoform 1 ACE NM_152831 angiotensin I converting enzyme isoform 3 ACOT 11 NM_147161 thioesterase, adipose associated isoform BFIT2 ACOT7 NM_007274 acyl-CoA thioesterase 7 isoform hBACHa ACOT8 NM_183385 peroxisomal acyl-CoA thioesterase 1 isoform b ACOXI NM_004035 acyl-Coenzyme A oxidase isoform a ACOX3 NM_003501 acyl-Coenzyme A oxidase 3, pristanoyl ACP2 NM_001610 lysosomal acid phosphatase 2 precursor ACPT NM_080789 testicular acid phosphatase isoform b precursor ACSBG1 NM_015162 lipidosin ACSBG2 NM_030924 bubblegum related protein ACSL1 NM_001995 acyl-CoA synthetase long-chain family member 1 ACSL4 NM_004458 acyl-CoA synthetase long-chain family member 4 ACSL5 NM_016234 acyl-CoA synthetase long-chain family member 5 ACSS2 NM_018677 acyl-CoA synthetase short-chain family member 2 ACTRIA NM_005736 ARPI actin-related protein 1 homolog A, ACTR2 NM_001005386 actin-related protein 2 isoform a ACTR3B NM_020445 actin-related protein 3-beta isoform 1 ACTR8 NM_022899 actin-related protein 8 WO 2008/085797 PCT/US2007/089206 ACVR2A NM_001616 activin A receptor, type IIA precursor ADAM10 NM_001110 ADAM metallopeptidase domain 10 ADAM11 NM_002390 ADAM metallopeptidase domain 11 preproprotein ADAM12 NM_021641 ADAM metallopeptidase domain 12 isoform 2 ADAMTS1 NM_006988 ADAM metallopeptidase with thrombospondin type 1 ADAMTS13 NM_139028 ADAM metallopeptidase with thrombospondin type 1 ADAMTS18 NM_199355 ADAM metallopeptidase with thrombospondin type 1 ADAMTS3 NM_014243 ADAM metallopeptidase with thrombospondin type 1 ADAMTS4 NM_005099 ADAM metallopeptidase with thrombospondin type 1 ADAMTS5 NM_007038 ADAM metallopeptidase with thrombospondin type 1 ADAMTS6 NM_197941 ADAM metallopeptidase with thrombospondin type 1 ADAMTSL1 NM_139238 ADAMTS-like 1 isoform 1 ADAMTSL2 NM_014694 ADAMTS-like 2 ADAMTSL3 NM_207517 ADAMTS-like 3 ADAR NM_001025107 adenosine deaminase, RNA-specific isoform d ADARBI NM_001033049 RNA-specific adenosine deaminase BI isoform 4 ADARB2 NM_018702 adenosine deaminase, RNA-specific, B2 ADCY1 NM_021116 brain adenylate cyclase 1 ADCY7 NM_001114 adenylate cyclase 7 ADCY9 NM_001116 adenylate cyclase 9 ADDI NM_001119 adducin 1 (alpha) isoform a ADD2 NM 017482 adducin 2 isoform b ADM2 NM_024866 adrenomedullin 2 precusor ADORAl NM_000674 adenosine Al receptor ADORA2A NM_000675 adenosine A2a receptor ADPRH NM_001125 ADP-ribosylarginine hydrolase ADRAIB NM_000679 alpha-1B-adrenergic receptor ADRA2A NM 000681 alpha-2A-adrenergic receptor ADRA2B NM_000682 alpha-2B-adrenergic receptor ADRB2 NM_000024 adrenergic, beta-2-, receptor, surface ADRBK1 NM_001619 beta adrenergic receptor kinase 1 ADSS NM_001126 adenylosuccinate synthase AEBP2 NM_153207 AE binding protein 2 AFAP NM_021638 actin filament associated protein AFF2 NM_002025 fragile X mental retardation 2 AFF4 NM_014423 ALLI fused gene from 5q31 AFM NM_001133 afamin precursor AGA NM_000027 aspartylglucosaminidase precursor AGPAT2 NM_001012727 1 -acylglycerol-3 -phosphate O-acyltransferase 2 AGPAT4 NM_001012733 1 -acylglycerol-3 -phosphate 0-acyltransferase 4 AGPAT5 NM_018361 1 -acylglycerol-3-phosphate 0-acyltransferase 5 AGPAT6 NM_178819 lysophosphatidic acid acyltransferase zeta AGPAT7 NM_153613 PLSC domain containing protein AGRN NM_198576 agrin AGTR2 NM_000686 angiotensin II receptor, type 2 AHCYL1 NM_006621 S-adenosylhomocysteine hydrolase-like I AHNAK NM_024060 AHNAK nucleoprotein isoform 2 AHSA1 NM_012111 AHAI, activator of heat shock 90kDa protein AIMI NM_001624 absent in melanoma 1 AK3L1 NM_001005353 adenylate kinase 3-like 1 AKAP1 NM_003488 A-kinase anchor protein 1 isoform 1 precursor AKAP 11 NM_016248 A-kinase anchor protein 11 isoform 1 WO 2008/085797 PCT/US2007/089206 AKAP12 NM_005100 A-kinase anchor protein 12 isoform 1 AKAP13 NM_006738 A-kinase anchor protein 13 isoform 1 AKNA NM_030767 AT-hook transcription factor AKR1CL1 NM_001007536 aldo-keto reductase family 1, member C-like 1 AKR1Dl NM_005989 aldo-keto reductase family 1, member D1 AKT3 NM 005465 v-akt murine thymoma viral oncogene homolog 3 ALAD NM_000031 delta-aminolevulinic acid dehydratase isoform b ALDH1A3 NM_000693 aldehyde dehydrogenase 1 A3 ALDH3A2 NM_000382 aldehyde dehydrogenase 3A2 isoform 2 ALDH3B1 NM_000694 aldehyde dehydrogenase 3B1 isoform a ALDH5A1 NM_001080 aldehyde dehydrogenase 5Al precursor, isoform 2 ALKBH3 NM_139178 alkB, alkylation repair homolog 3 ALKBH5 NM_017758 hypothetical protein LOC54890 ALKBH6 NM_032878 hypothetical protein LOC84964 isoform 2 ALOX12 NM_000697 arachidonate 12-lipoxygenase ALPK3 NM_020778 alpha-kinase 3 ALPPL2 NM 031313 placental-like alkaline phosphatase ALS2 NM 020919 alsin ALS2CL NM 147129 ALS2 C-terminal like isoform 1 ALS2CR16 NM_205543 amyotrophic lateral sclerosis 2 (juvenile) ALS2CR2 NM_018571 amyotrophic lateral sclerosis 2 (juvenile) AMIGO3 NM_198722 amphoterin-induced gene and ORF 3 AMMECR1 NM_001025580 AMMECRI protein isoform 2 AMOT NM_133265 angiomotin AMOTL1 NM_130847 angiomotin like 1 AMOTL2 NM_016201 angiomotin like 2 AMPD2 NM_004037 adenosine monophosphate deaminase 2 (isoform L) AMPD3 NM_000480 erythrocyte adenosine monophosphate deaminase AMT NM_000481 aminomethyltransferase (glycine cleavage system ANAPC1 1 NM 001002244 APC1 1 anaphase promoting complex subunit 11 ANAPC13 NM_015391 anaphase promoting complex subunit 13 ANGEL1 NM 015305 angel homolog 1 ANK1 NM_000037 ankyrin 1 isoform 3 ANK2 NM_001148 ankyrin 2 isoform I ANK3 NM_001149 ankyrin 3 isoform 2 ANKRDl 1 NM_013275 ankyrin repeat domain 11 ANKRD12 NM_015208 ankyrin repeat domain 12 ANKRD13B NM_152345 hypothetical protein LOC 124930 ANKRD13D NM_207354 ankyrin repeat domain 13 family, member D ANKRD15 NM_015158 ankyrin repeat domain protein 15 isoform a ANKRD17 NM_032217 ankyrin repeat domain protein 17 isoform a ANKRD19 NM_001010925 ankyrin repeat domain 19 ANKRD29 NM_173505 ankyrin repeat domain 29 ANKRD39 NM_016466 ankyrin repeat domain 39 ANKRD46 NM 198401 ankyrin repeat domain 46 ANKRD53 NM_024933 hypothetical protein LOC79998 ANKS1A NM_015245 ankyrin repeat and sterile alpha motif domain ANKS4B NM_145865 harmonin-interacting ankyrin-repeat containing ANKZF1 NM_018089 ankyrin repeat and zinc finger domain containing ANLN NM_018685 anillin, actin binding protein (scraps homolog, ANP32E NM_030920 acidic (leucine-rich) nuclear phosphoprotein 32 ANXAl l NM_001157 annexin Al l WO 2008/085797 PCT/US2007/089206 APIGI NM_001030007 adaptor-related protein complex 1, gamma 1 AP1GBP1 NM_007247 AP 1 gamma subunit binding protein 1 isoform 1 APISI NM_001283 adaptor-related protein complex 1, sigma 1 APlS2 NM_003916 adaptor-related protein complex 1 sigma 2 AP2A1 NM_014203 adaptor-related protein complex 2, alpha 1 AP2A2 NM_012305 adaptor-related protein complex 2, alpha 2 AP2B1 NM_001030006 adaptor-related protein complex 2, beta 1 AP3B 1 NM_003664 adaptor-related protein complex 3, beta 1 AP3MI NM_012095 adaptor-related protein complex 3, mu I subunit AP3S2 NM_005829 adaptor-related protein complex 3, sigma 2 APBAl NM_001163 amyloid beta A4 precursor protein-binding, APBB3 NM_133175 amyloid beta precursor protein-binding, family APC2 NM_005883 adenomatosis polyposis coli 2 APLN NM_017413 apelin preproprotein APLP2 NM_001642 amyloid beta (A4) precursor-like protein 2 APOA4 NM_000482 apolipoprotein A-IV precursor APOA5 NM_052968 apolipoprotein AV APOBEC2 NM_006789 apolipoprotein B mRNA editing enzyme, catalytic APOC3 NM_000040 apolipoprotein C-III precursor APP NM_000484 amyloid beta A4 protein precursor, isoform a APPBP1 NM_001018159 amyloid beta precursor protein-binding protein 1 APPBP2 NM_006380 amyloid beta precursor protein-binding protein APTX NM_017692 aprataxin isoform d AQP1 NM_198098 aquaporin 1 AQP11 NM_173039 aquaporin 11 AQP2 NM_000486 aquaporin 2 AQP4 NM 001650 aquaporin 4 isoform a AQP8 NM_001169 aquaporin 8 ARC NM_015193 activity-regulated cytoskeleton-associated ARCN1 NM 001655 archain ARF3 NM_001659 ADP-ribosylation factor 3 ARFGAP1 NM 018209 ADP-ribosylation factor GTPase activating ARFRP1 NM_003224 ADP-ribosylation factor related protein 1 ARHGAP1 NM_004308 Rho GTPase activating protein 1 ARHGAP1O NM_024605 Rho GTPase activating protein 10 ARHGAP12 NM_018287 Rho GTPase activating protein 12 ARHGAP18 NM_033515 Rho GTPase activating protein 18 ARHGAP19 NM_032900 Rho GTPase activating protein 19 ARHGAP20 NM_020809 Rho GTPase activating protein 20 ARHGAP22 NM_021226 Rho GTPase activating protein 2 ARHGAP26 NM_015071 GTPase regulator associated with the focal ARHGAP27 NM_199282 Rho GTPase activating protein 27 ARHGAP28 NM_001010000 Rho GTPase activating protein 28 isoform a ARHGAP4 NM_001666 Rho GTPase activating protein 4 ARHGAP5 NM_001030055 Rho GTPase activating protein 5 isoform a ARHGDIA NM_004309 Rho GDP dissociation inhibitor (GDI) alpha ARHGDIG NM_001176 Rho GDP dissociation inhibitor (GDI) gamma ARHGEF1O NM_014629 Rho guanine nucleotide exchange factor 10 ARHGEF12 NM_015313 Rho guanine nucleotide exchange factor (GEF) 12 ARHGEF4 NM 015320 Rho guanine nucleotide exchange factor 4 isoform ARHGEF5 NM_001002861 rho guanine nucleotide exchange factor 5 isoform ARHGEF7 NM 145735 Rho guanine nucleotide exchange factor 7 isoform WO 2008/085797 PCT/US2007/089206 ARHGEF9 NM 015185 Cdc42 guanine exchange factor 9 ARID5A NM_006673 AT rich interactive domain 5A isoform 2 ARLI NM_001177 ADP-ribosylation factor-like 1 ARL1O NM_173664 ADP-ribosylation factor-like 10 ARLI1 NM_138450 ADP-ribosylation factor-like 11 ARL2 NM_001667 ADP-ribosylation factor-like 2 ARL3 NM_004311 ADP-ribosylation factor-like 3 ARL5B NM_178815 ADP-ribosylation factor-like 8 ARL6IP5 NM 006407 ADP-ribosylation-like factor 6 interacting ARL8B NM_018184 ADP-ribosylation factor-like 1 OC ARMC1 NM_018120 armadillo repeat-containing protein ARMC5 NM_024742 armadillo repeat containing 5 ARMC6 NM 033415 armadillo repeat containing 6 ARMCX1 NM 016608 armadillo repeat containing, X-linked 1 ARMCX2 NM 014782 ALEX2 protein ARNT NM_001668 aryl hydrocarbon receptor nuclear translocator ARNT2 NM_014862 aryl hydrocarbon receptor nuclear translocator ARPC1B NM_005720 actin related protein 2/3 complex subunit 1B ARPP-19 NM 006628 cyclic AMP phosphoprotein, 19 kD ARPP-21 NM_001025068 cyclic AMP-regulated phosphoprotein, 21 kD ARRDC4 NM 183376 arrestin domain containing 4 ARSD NM_001669 arylsulfatase D isoform a precursor ARTS-1 NM 016442 type 1 tumor necrosis factor receptor shedding ARVCF NM_001670 armadillo repeat protein AS3MT NM_020682 arsenic (+3 oxidation state) methyltransferase ASBI NM_016114 ankyrin repeat and SOCS box-containing protein ASB13 NM_024701 ankyrin repeat and SOCS box-containing protein ASB15 NM_080928 ankyrin repeat and SOCS box-containing 15 ASB6 NM 017873 ankyrin repeat and SOCS box-containing 6 isoform ASCC3 NM_022091 activating signal cointegrator 1 complex subunit ASCL2 NM_005170 achaete-scute complex homolog-like 2 ASNSD1 NM_019048 asparagine synthetase domain containing 1 ASPH NM_032466 aspartate beta-hydroxylase isoform c ASTN NM 004319 astrotactin isoform 1 ASXL1 NM 015338 additional sex combs like 1 ASXL2 NM_018263 additional sex combs like 2 ATAD4 NM_024320 ATPase family, AAA domain containing 4 ATF3 NM 004024 activating transcription factor 3 isoform 2 ATF6 NM 007348 activating transcription factor 6 ATF7IP2 NM 024997 activating transcription factor 7 interacting ATG4B NM_013325 APG4 autophagy 4 homolog B isoform a ATG4D NM 032885 APG4 autophagy 4 homolog D ATG9A NM 024085 APG9 autophagy 9-like 1 ATG9B NM 173681 nitric oxide synthase 3 antisense ATHL1 NM_025092 hypothetical protein LOC80162 ATNI NM _001007026 atrophin-1 ATOH8 NM 032827 atonal homolog 8 ATP11A NM_015205 ATPase, Class VI, type l lA isoform a ATP11C NM_001010986 ATPase, Class VI, type I1C isoform b ATP13A2 NM_022089 ATPase type 13A2 ATP1B2 NM 001678 Na+/K+ -ATPase beta 2 subunit ATP 1B4 NM_012069 ATPase, (Na+)/K+ transporting, beta 4 WO 2008/085797 PCT/US2007/089206 ATP2A1 NM_004320 ATPase, Ca++ transporting, fast twitch 1 isoform ATP2A3 NM_005173 sarco/endoplasmic reticulum Ca2+ -ATPase isoform ATP2B2 NM_001001331 plasma membrane calcium ATPase 2 isoform a ATP2B3 NM_001001344 plasma membrane calcium ATPase 3 isoform 3b ATP2B4 NM_001001396 plasma membrane calcium ATPase 4 isoform 4a ATP4B NM_000705 ATPase, H+/K+ exchanging, beta polypeptide ATP6VOB NM_004047 ATPase, H+ transporting, lysosomal 21kDa, VO ATP6VOE2L NM_145230 ATPase, H+ transporting, VO subunit ATP6V1B2 NM 001693 vacuolar H+ATPase B2 ATP6V1C1 NM_001007254 ATPase, H+ transporting, lysosomal 42kDa, VI ATP6VlC2 NM_144583 vacuolar H+ ATPase C2 isoform b ATP6V1G1 NM_004888 vacuolar H+ ATPase GI ATP7A NM_000052 ATPase, Cu++ transporting, alpha polypeptide ATP7B NM_000053 ATPase, Cu++ transporting, beta polypeptide ATP8B3 NM_138813 ATPase, Class I, type 8B, member 3 ATPBD1C NM_016301 ATP binding domain 1 family, member C ATRNL1 NM_207303 attractin-like 1 ATXN2 NM_002973 ataxin 2 ATXN7L2 NM_153340 ataxin 7-like 2 AURKAIP1 NM_017900 aurora-A kinase interacting protein AVEN NM_020371 cell death regulator aven AXIN2 NM_004655 axin 2 AXUDI NM_033027 AXINI up-regulated 1 B3GALNT1 NM_003781 UDP-Gal:betaGlcNAc beta B3GALT5 NM 006057 UDP-Gal:betaGlcNAc beta B3GALT6 NM_080605 UDP-Gal:betaGal beta 1,3-galactosyltransferase B3GATl NM_018644 beta-1,3-glucuronyltransferase 1 B3GAT3 NM_012200 beta-1,3-glucuronyltransferase 3 B3GNT2 NM_006577 UDP-GlcNAc:betaGal B3GNT3 NM_014256 UDP-GlcNAc:betaGal B3GNT4 NM_030765 UDP-GlcNAc:betaGal B4GALT1 NM_001497 UDP-Gal:betaGlcNAc beta 1,4 B4GALT2 NM_001005417 UDP-Gal:betaGleNAc beta 1,4 B4GALT4 NM_003778 UDP-Gal:betaGlcNAc beta 1,4 B4GALT5 NM_004776 UDP-Gal:betaGlcNAc beta 1,4 bAl6L21.2.1 NM_001015882 hypothetical protein LOC548645 BAAT NM_001701 bile acid Coenzyme A: amino acid BACEl NM_012104 beta-site APP-cleaving enzyme I isoform A BACE2 NM_138992 beta-site APP-cleaving enzyme 2 isoform B BACHI NM_001011545 BTB and CNC homology 1 isoform b BACH2 NM_021813 BTB and CNC homology 1, basic leucine zipper BAG3 NM 004281 BCL2-associated athanogene 3 BAG4 NM_004874 BCL2-associated athanogene 4 BAG5 NM 001015048 BCL2-associated athanogene 5 isoform b BAHD1 NM_014952 bromo adjacent homology domain containing 1 BAIl NM_001702 brain-specific angiogenesis inhibitor 1 BAIAP2 NM_006340 BAIl-associated protein 2 isoform 3 BAPI NM_004656 BRCA1 associated protein-1 BAT2D 1 NM_015172 HBxAg transactivated protein 2 BAT4 NM_033177 HLA-B associated transcript 4 BAZIB NM_032408 bromodomain adjacent to zinc finger domain, 1B BAZ2A NM_013449 bromodomain adjacent to zinc finger domain, 2A o e WO 2008/085797 PCT/US2007/089206 BBC3 NM_014417 BCL2 binding component 3 BCAP29 NM 001008406 B-cell receptor-associated protein BAP29 isoform BCAP31 NM 005745 B-cell receptor-associated protein 31 BCAS1 NM_003657 breast carcinoma amplified sequence 1 BCAS4 NM 001010974 breast carcinoma amplified sequence 4 isoform c BCL11B NM_022898 B-cell CLL/lymphoma 11B isoform 2 BCL2 NM_000633 B-cell lymphoma protein 2 alpha isoform BCL2L1 NM_001191 BCL2-like 1 isoform 2 BCL2L1 1 NM 006538 BCL2-like 11 isoform 6 BCL2L12 NM 052842 BCL2-like 12 isoform 2 BCL2L14 NM_030766 BCL2-like 14 isoform 2 BCL2L2 NM_004050 BCL2-like 2 protein BCL7A NM_001024808 B-cell CLL/lymphoma 7A isoform b BCL7B NM_001707 B-cell CLL/lymphoma 7B isoform 1 BCL9 NM_004326 B-cell CLL/lymphoma 9 BCL9L NM_182557 B-cell CLL/lymphoma 9-like BCOR NM_020926 BCL-6 interacting corepressor isoform 2 BCORL1 NM_021946 BCL6 co-repressor-like 1 BCR NM_004327 breakpoint cluster region isoform 1 BDH2 NM_020139 3-hydroxybutyrate dehydrogenase, type 2 BDKRB2 NM_000623 bradykinin receptor B2 BDNF NM_001709 brain-derived neurotrophic factor isoform a BET1L NM_016526 blocked early in transport 1 homolog (S. BHLHB2 NM 003670 basic helix-loop-helix domain containing, class BHLHB3 NM_030762 basic helix-loop-helix domain containing, class BHMT2 NM_017614 betaine-homocysteine methyltransferase 2 BICD2 NM 001003800 bicaudal D homolog 2 isoform 1 BIK NM_001197 BCL2-interacting killer BINI NM 004305 bridging integrator 1 isoform 8 BIRC5 NM_001012270 baculoviral IAP repeat-containing protein 5 BLCAP NM_006698 bladder cancer associated protein BLMH NM_000386 bleomycin hydrolase BLR1 NM_001716 Burkitt lymphoma receptor 1 isoform 1 BMF NM_001003940 Bcl2 modifying factor isoform bmf-1 BMPER NM_133468 BMP-binding endothelial regulator precursor BMPR1A NM_004329 bone morphogenetic protein receptor, type IA BMPR2 NM_001204 bone morphogenetic protein receptor type II BMS1L NM_014753 BMSl-like, ribosome assembly protein BMX NM_001721 BMX non-receptor tyrosine kinase BNIP1 NM_001205 BCL2/adenovirus ElB l9kD interacting protein 1 BOLA2 NM_001031833 BolA-like protein 2 isoform b BOLA3 NM 212552 bolA-like 3 isoform 1 BRCA1 NM_007306 breast cancer 1, early onset isoform BRD1 NM_014577 bromodomain containing protein 1 BRD8 NM_139199 bromodomain containing 8 isoform 2 BRF2 NM_018310 RNA polymerase III transcription initiation BRI3 NM_015379 brain protein 13 BRMS1 NM_015399 breast cancer metastasis suppressor 1 isoform 1 BRP44L NM_016098 brain protein 44-like BRPF3 NM_015695 bromodomain and PHD finger containing, 3 BRS3 NM 001727 bombesin-like receptor 3 BRWD1 NM_001007246 bromodomain and WD repeat domain containing 1 WO 2008/085797 PCT/US2007/089206 BSDC1 NM_018045 BSD domain containing 1 BSN NM_003458 bassoon protein BSND NM 057176 barttin BSPRY NM 017688 B-box and SPRY domain containing BTAF1 NM_003972 BTAF1 RNA polymerase II, B-TFIID transcription BTBD14B NM_052876 transcriptional repressor NACl BTBD15 NM_014155 BTB (POZ) domain containing 15 BTBD2 NM_017797 BTB (POZ) domain containing 2 BTBD3 NM_014962 BTB/POZ domain containing protein 3 isoform a BTBD4 NM_025224 BTB (POZ) domain containing 4 BTBD7 NM_001002860 BTB (POZ) domain containing 7 isoform 1 BTF3 NM 001207 basic transcription factor 3 isoform B BTG2 NM_006763 B-cell translocation gene 2 BTN1Al NM_001732 butyrophilin, subfamily 1, member Al BTRC NM_003939 beta-transducin repeat containing protein BUB3 NM_004725 BUB3 budding uninhibited by benzimidazoles 3 BVES NM_007073 blood vessel epicardial substance BZW1 NM_014670 basic leucine zipper and W2 domains 1 ClOorflO8 NM_001012714 hypothetical protein LOC414235 ClOorf26 NM_017787 hypothetical protein LOC54838 ClOorf39 NM_194303 hypothetical protein LOC282973 C10orf4 NM_145246 FRA1OACI protein isoform FRA1OAC1-1 C1Oorf42 NM 138357 hypothetical protein LOC90550 ClOorf46 NM_153810 hypothetical protein LOC143384 C10orf53 NM_182554 hypothetical protein LOC282966 ClOorf54 NM 022153 hypothetical protein LOC64115 ClOorf56 NM 153367 hypothetical protein LOC219654 ClOorf6 NM 018121 hypothetical protein LOC55719 ClOorf63 NM_145010 enkurin ClOorf67 NM_153714 hypothetical protein LOC256815 C10orf7 NM 006023 D123 gene product C10orf72 NM144984 hypothetical protein LOC196740 isoform 2 ClOorf76 NM_024541 hypothetical protein LOC79591 C10orf77 NM 024789 hypothetical protein LOC79847 ClOorf8l NM_024889 hypothetical protein LOC79949 ClOorf83 NM_178832 hypothetical protein LOCI 18812 C10orf9 NM_145012 cyclin fold protein 1 isoform 1 ClOorf95 NM_024886 hypothetical protein LOC79946 Cl lorfl0 NM_014206 hypothetical protein LOC746 Cl 1orf I NM 006133 neural stem cell-derived dendrite regulator C 11orfl7 NM_182901 chromosome 11 open reading frame 17 C1 1orf24 NM_022338 hypothetical protein LOC53838 C 11orf42 NM 173525 hypothetical protein LOC160298 Cl lorf45 NM 145013 hypothetical protein LOC219833 Cl lorf46 NM_152316 hypothetical protein LOCl20534 C1 1orf49 NM_001003676 hypothetical protein LOC79096 isoform 1 C1 1orf53 NM 198498 hypothetical protein LOC341032 C1 lorf55 NM_207428 hypothetical protein LOC399879 C 11orf68 NM_031450 basophilic leukemia expressed protein BLES03 Cl2orf22 NM 030809 TGF-beta induced apoptosis protein 12 Cl2orf30 NM 024953 hypothetical protein LOC80018 Cl2orf34 NM_032829 hypothetical protein LOC84915 WO 2008/085797 PCT/US2007/089206 Cl2orf38 NM_024809 TECT2 C12orf4 NM_020374 hypothetical protein LOC57102 C12orf47 NM_016534 apoptosis-related protein PNAS-1 Cl2orf53 NM_153685 hypothetical protein LOC196500 C13orfl NM_020456 hypothetical protein LOC57213 Cl3orfl8 NM_025113 hypothetical protein LOC80183 C14orfl NM_007176 hypothetical protein LOCI 1161 C14orfl 11 NM_015962 hypothetical protein LOC51077 Cl4orfl29 NM_016472 hypothetical protein LOC51527 Cl4orfl32 NM_020215 hypothetical protein LOC56967 Cl4orfl39 NM 024633 hypothetical protein LOC79686 Cl4orfl43 NM_145231 hypothetical protein LOC90141 Cl4orfl50 NM_001008726 hypothetical protein LOC112840 C14orf32 NM 144578 MAPK-interacting and spindle-stabilizing C14orf37 NM_001001872 hypothetical protein LOC145407 C14orf4 NM_024496 chromosome 14 open reading frame 4 C14orf43 NM_194278 hypothetical protein LOC91748 Cl4orf45 NM_025057 hypothetical protein LOC80127 C14orf68 NM_207117 chromosome 14 open reading frame 68 C14orf79 NM_174891 hypothetical protein LOC122616 C15orf37 NM 175898 hypothetical protein LOC283687 Cl5orf39 NM_015492 hypothetical protein LOC56905 C15orf4O NM_144597 hypothetical protein LOC123207 C15orf4l NM_032499 hypothetical protein LOC84529 C15orf42 NM_152259 leucine-rich repeat kinase 1 Cl6orfl4 NM_138418 hypothetical protein LOC84331 Cl6orf34 NM 144570 chromosome 16 open reading frame 34 Cl6orf55 NM_153025 hypothetical protein LOC124045 Cl6orf56 NM_025082 hypothetical protein LOC80152 Cl6orf57 NM_024598 hypothetical protein LOC79650 C16orf58 NM_022744 hypothetical protein LOC64755 C16orf63 NM_144600 hypothetical protein LOC123811 C16orf7 NM_004913 chromosome 16 open reading frame 7 C16orf70 NM 025187 lin-10 C17orf27 NM_020914 chromosome 17 open reading frame 27 C17orf32 NM 152464 hypothetical protein LOC147007 Cl7orf39 NM_024052 hypothetical protein LOC79018 C17orf41 NM 024857 chromosome fragility associated gene 1 C17orf49 NM_174893 hypothetical protein LOC124944 C17orf54 NM_182564 hypothetical protein LOC283982 Cl7orf56 NM_144679 hypothetical protein LOC146705 C17orf59 NM_017622 hypothetical protein LOC54785 C17orf62 NM 001033046 hypothetical protein LOC79415 C17orf81 NM_203413 S-phase 2 protein isoform 2 C17orf82 NM_203425 hypothetical protein LOC388407 CI8orfl NM 001003674 hypothetical protein LOC753 isoform gamma 1 C18orf25 NM_001008239 chromosome 18 open reading frame 25 isoform b Cl8orf34 NM_198995 hypothetical protein LOC374864 C18orf4 NM_032160 hypothetical protein LOC92126 C18orf43 NM_006553 chromosome 18 open reading frame 43 C18orf45 NM_032933 hypothetical protein LOC85019 Cl8orf54 NM_173529 hypothetical protein LOC162681 0 0 WO 2008/085797 PCT/US2007/089206 C18orf58 NM_173817 hypothetical protein L0C284222 C19orfl2 NM 001031726 hypothetical protein L0C83636 isoform 1 C19orf23 NM 152480 hypothetical protein LOC148046 Cl9orf25 NM 152482 hypothetical protein L0C148223 C19orf26 NM 152769 hypothetical protein L0C255057 Cl9orf36 NM 001031735 hypothetical protein LOCI 13177 isoform 1 C19orf6 NM 033420 membralin isoform 2 ClorflOl NM 173807 hypothetical protein L0C257044 Clorfl02 NM 145047 oxidored-nitro domain-containing protein isoform Clorfl03 NM 001006945 receptor-interacting factor 1 isoform 2 Clorfl07 NM 014388 hypothetical protein L0C27042 Clorf1 13 NM 024676 hypothetical protein L0C79729 Clorfl 14 NM 021179 hypothetical protein L0C57821 Clorfl 15 NM 024709 hypothetical protein L0C79762 Clorfl 16 NM_023938 specifically androgen-regulated protein Clorfl 19 NM_020141 hypothetical protein L0C56900 Clorfl26 NM 182534 hypothetical protein LOC200197 Clorfl30 NM 001010980 hypothetical protein L0C400746 Clorfl42 NM 053052 hypothetical protein LOCI 16841 Clorfl51 NM 001032363 chromosome 1 open reading frame 151 protein Cl orfl 73 NM 001002912 hypothetical protein LOCI27254 Clorfl87 NM 198545 chromosome 1 open reading frame 187 Clorfl88 NM 173795 hypothetical protein L0C148646 Clorfl9 NM 052965 hypothetical protein LOCI 16461 Clorf190 NM_001013615 hypothetical protein L0C541468 Clorf2 NM 006589 hypothetical protein LOCI0712 isoform a Clorf2l NM 030806 chromosome 1 open reading frame 21 Clorf36 NM 183059 chromosome I open reading frame 36 Clorf38 NM_004848 basement membrane-induced gene isoform 1 Clorf54 NM 024579 hypothetical protein L0C79630 Clorf62 NM 152763 hypothetical protein L0C254268 Clorf69 NM 001010867 hypothetical protein L0C200205 Clorf84 NM_001012960 RPI 1-506B15.1 protein isoform 1 Clorf9 NM 014283 chromosome 1 open reading frame 9 protein Clorf95 NM 001003665 hypothetical protein L0C375057 C1QA NM 015991 complement component 1, q subcomponent, A chain ClQB NM 000491 complement component 1, q subcomponent, B chain C1QL3 NM 001010908 complement component 1, q subcomponent-like 3 C1QL4 NM 001008223 hypothetical protein L0C338761 C1QTNF3 NM_030945 CIq and tumor necrosis factor related protein 3 C1QTNF5 NM 015645 CIq and tumor necrosis factor related protein 5 C1QTNF6 NM 031910 C1 q and tumor necrosis factor related protein 6 C1QTNF8 NM 207419 hypothetical protein L0C390664 C20orfl 1 NM 017896 chromosome 20 open reading frame 11 C20orfl 17 NM 080627 hypothetical protein LC140710 isoform I C20orfl21 NM 024331 hypothetical protein L0C79183 C20orfl60 NM 080625 hypothetical protein L0C140706 C20orfl61 NM 033421 sorting nexin 21 isoform a C20orfl66 NM 178463 hypothetical protein L0C128826 C20orfl86 NM 182519 antimicrobial peptide RY2G5 C20orf23 NM 024704 kinesin-like motor protein C2Oorf23 C2Oorf29 NM 018347 hypothetical protein LOC55317 WO 2008/085797 PCT/US2007/089206 C20orf3 NM_020531 chromosome 20 open reading frame 3 C20orf39 NM_024893 hypothetical protein LOC79953 C20orf42 NM_017671 chromosome 20 open reading frame 42 C20orf43 NM_016407 hypothetical protein LOC51507 C20orf44 NM_018244 basic FGF-repressed Zic binding protein isoform C20orf45 NM_016045 hypothetical protein LOC51012 C20orf46 NM_018354 hypothetical protein LOC55321 C20orf58 NM_152864 hypothetical protein LOC128414 C20orf7l NM_178466 hypothetical protein LOC128861 isoform b C20orf77 NM_021215 hypothetical protein LOC58490 C20orf96 NM_153269 hypothetical protein LOC140680 C2lorfl23 NM_199175 hypothetical protein LOC378832 C21orfl25 NM 194309 hypothetical protein LOC284836 C21orfl29 NM_152506 hypothetical protein LOC150135 C21orf24 NM_001001789 hypothetical protein LOC400866 C21orf25 NM_199050 hypothetical protein LOC25966 C21orf33 NM_004649 es I protein isoform Ia precursor C21orf57 NM_001006114 hypothetical protein LOC54059 isoform 2 C2lorf58 NM_199071 hypothetical protein LOC54058 isoform 2 C2lorf6 NM_016940 hypothetical protein LOC10069 C21orf62 NM_019596 hypothetical protein LOC56245 C21orf69 NM_058189 chromosome 21 open reading frame 69 C21orf84 NM_153752 hypothetical protein LOCI 14038 C21orf93 NM_145179 hypothetical protein LOC246704 C22orfl3 NM_031444 chromosome 22 open reading frame 13 C22orf5 NM_012264 chromosome 22 open reading frame 5 C22orf9 NM_001009880 hypothetical protein LOC23313 isoform b C2orfl7 NM_024293 hypothetical protein LOC79137 C2orfl9 NM_001024676 chromosome 2 open reading frame 19 C2orf26 NM 023016 hypothetical protein LOC65124 C3orfl0 NM_018462 chromosome 3 open reading frame 10 C3orfl8 NM_016210 hypothetical protein LOC51161 C3orfl9 NM_016474 hypothetical protein LOC51244 C3orf23 NM_001029839 hypothetical protein LOC285343 isoform 2 C3orf27 NM_007354 putative GR6 protein C3orf37 NM_001006109 hypothetical protein LOC56941 C3orf56 NM_001007534 hypothetical protein LOC285311 C3orf58 NM_173552 hypothetical protein LOC205428 C4orfl5 NM_024511 hypothetical protein LOC79441 C4orfl9 NM_018302 hypothetical protein LOC55286 C5orf2l NM_032042 hypothetical protein LOC83989 C5orf24 NM_152409 hypothetical protein LOC134553 C6orflO6 NM_022758 chromosome 6 open reading frame 106 isoform b C6orfl28 NM_145316 hypothetical protein LOC221468 C6orfl42 NM_138569 hypothetical protein LOC90523 C6orfl45 NM_183373 hypothetical protein LOC221749 C6orfl51 NM 152551 Ul l/U12 snRNP 48K C6orf152 NM_181714 hypothetical protein LOC167691 C6orfl55 NM_024882 hypothetical protein LOC79940 C6orfl 68 NM_032511 hypothetical protein LOC84553 C6orfl99 NM 145025 hypothetical protein LOC221264 C6orf35 NM 018452 hypothetical protein LOC55836 WO 2008/085797 PCT/US2007/089206 C6orf47 NM 021184 G4 protein C6orf49 NM_013397 over-expressed breast tumor protein C6orf5l NM 138408 hypothetical protein LOCI 12495 C6orf55 NM 016485 hypothetical protein LOC51534 C6orf57 NM_145267 hypothetical protein LOC135154 C6orf59 NM_024929 hypothetical protein LOC79992 C6orf64 NM_018322 hypothetical protein LOC55776 C6orf71 NM_203395 chromosome 6 open reading frame 71 C6orf85 NM 021945 ion transporter protein C7orfl6 NM 006658 G-substrate C7orfl9 NM_032831 hypothetical protein LOC80228 C7orf2O NM_015949 hypothetical protein LOC51608 C7orf2l NM_031434 hypothetical protein LOC83590 C7orf29 NM_138434 hypothetical protein LOCI 13763 C8orf3OA NM 016458 brain protein 16 C8orf38 NM 152416 hypothetical protein LOC137682 C8orf4 NM_020130 chromosome 8 open reading frame 4 C8orf42 NM_175075 hypothetical protein LOC157695 C8orf49 NM_001031839 hypothetical protein LOC606553 C8orf58 NM_001013842 hypothetical protein LOC541565 C8orf7O NM 016010 hypothetical protein LOC5 1101 C9orflOO NM 032818 hypothetical protein LOC84904 C9orf106 NM 001012715 hypothetical protein LOC414318 C9orflOOS NM_198841 hypothetical protein LOC158293 C9orfl 14 NM_016390 hypothetical protein LOC51490 C9orfl2l NM_145283 nucleoredoxin C9orfl23 NM 033428 hypothetical protein LOC90871 C9orfl28 NM 001012446 hypothetical protein LOC392307 C9orfI50 NM_203403 hypothetical protein LOC286343 C9orfl63 NM 152571 hypothetical protein LOC158055 C9orfl64 NM182635 hypothetical protein LOC349236 C9orfl9 NM 022343 chromosome 9 open reading frame 19 C9orf25 NM147202 hypothetical protein LOC203259 C9orf26 NM 033439 interleukin 33 C9orf28 NM001011703 hypothetical protein LOC89853 isoform 2 C9orf3 NM032823 aminopeptidase 0 C9orf42 NM 138333 hypothetical protein LOCI 16224 C9orf48 NM_194313 hypothetical protein LOC347240 C9orf5 NM 032012 hypothetical protein LOC23731 C9orf61 NM 004816 chromosome 9 open reading frame 61 C9orf66 NM_152569 hypothetical protein LOC157983 C9orf7 NM 017586 hypothetical protein LOCI 1094 C9orf74 NM 030914 hypothetical protein LOC81605 C9orf82 NM 024828 hypothetical protein LOC79886 C9orf88 NM 022833 hypothetical protein LOC64855 C9orf89 NM_032310 chromosome 9 open reading frame 89 C9orf91 NM153045 hypothetical protein LOC203197 CAl2 NM 001218 carbonic anhydrase XII isoform I precursor CA2 NM 000067 carbonic anhydrase II CA8 NM 004056 carbonic anhydrase VIII CAB39 NM 016289 calcium binding protein 39 CAB39L NM_030925 calcium binding protein 39-like isoform 2 WO 2008/085797 PCT/US2007/089206 CABC1 NM_020247 chaperone, ABCl activity ofbcI complex like CABLES2 NM_031215 Cdk5 and AbI enzyme substrate 2 CABP1 NM 001033677 calcium binding protein 1 isoform 3 CABP7 NM_182527 calcium binding protein 7 CACNAlE NM_000721 calcium channel, voltage-dependent, alpha IE CACNAII NM_001003406 voltage-dependent T-type calcium channel CACNA2D4 NM 001005737 voltage-gated calcium channel alpha(2)delta-4 CACNB1 NM 000723 calcium channel, voltage-dependent, beta 1 CACNB4 NM_000726 calcium channel, voltage-dependent, beta 4 CAD NM_004341 carbamoylphosphate synthetase 2/aspartate CALB2 NM 001740 calbindin 2 full length protein isoform CALMI NM_006888 calmodulin 1 CALML4 NM 033429 calmodulin-like 4 isoform 2 CALML5 NM_017422 calmodulin-like skin protein CALML6 NM_138705 calmodulin-like 6 CALN NM 001017440 calneuron 1 CALU NM 001219 calumenin precursor CAMK2A NM_015981 calcium/calmodulin-dependent protein kinase hA CAMK2G NM_001222 calcium/calmodulin-dependent protein kinase 11 CAMKK2 NM_006549 calcium/calmodulin-dependent protein kinase CAMKV NM 024046 CaM kinase-like vesicle-associated CAMSAP1 NM 015447 calmodulin regulated spectrin-associated protein CAMSAPlL1 NM 203459 calmodulin regulated spectrin-associated protein CANX NM 001024649 calnexin precursor CAP1 NM 006367 adenylyl cyclase-associated protein CAP2 NM 006366 adenylyl cyclase-associated protein 2 CAPN12 NM 144691 calpain12 CAPN3 NM 212464 calpain 3 isoform g CAPN5 NM 004055 calpain 5 CAPN6 NM_014289 calpain 6 CAPS NM 004058 calcyphosine isoform a CAPZA2 NM 006136 capping protein actionn filament) muscle Z-line, CARD10 NM 014550 caspase recruitment domain protein 10 CARD14 NM 052819 caspase recruitment domain protein 14 isoform 2 CARD4 NM 006092 caspase recruitment domain family, member 4 CARM1 NM_199141 coactivator-associated arginine CARS NM 001014437 cysteinyl-tRNA synthetase isoform c CASKIN1 NM_020764 CASK interacting protein 1 CASP1O NM 001230 caspase 10 isoform a preproprotein CASP4 NM 033307 caspase 4 isoform delta CASQ2 NM_001232 cardiac calsequestrin 2 CASR NM 000388 calcium-sensing receptor CAST NM 173060 calpastatin isoform b CAST1 NM 015576 cytomatrix protein p 10 CASZ1 NM 017766 castor homolog 1, zinc finger CBARAI NM_006077 calcium binding atopy-related autoantigen 1 CBFA2T2 NM 001032999 core-binding factor, runt domain, alpha subunit CBFA2T3 NM_005187 myeloid translocation gene-related protein 2 CBFB NM 001755 core-binding factor, beta subunit isoform 2 CBL NM 005188 Cas-Br-M marinee) ecotropic retroviral CBLC NM 012116 Cas-Br-M marinee) ecotropic retroviral CBR3 NM_001236 carbonyl reductase 3 WO 2008/085797 PCT/US2007/089206 CBX2 NM_005189 chromobox homolog 2 isoform I CBX4 NM_003655 chromobox homolog 4 CC2DlB NM_032449 coiled-coil and C2 domain containing lB CCDC18 NM_206886 sarcoma antigen NY-SAR-41 CCDC19 NM 012337 nasopharyngeal epithelium specific protein 1 CCDC21 NM_022778 coiled-coil domain containing 21 CCDC25 NM 001031708 coiled-coil domain containing 25 isoform 1 CCDC28A NM_015439 hypothetical protein LOC25901 CCDC3 NM_031455 coiled-coil domain containing 3 CCDC32 NM_052849 coiled-coil domain containing 32 CCDC4 NM_207406 hypothetical protein LOC389206 CCDC44 NM_016360 clone HQ0477 PRO0477p CCDC47 NM 020198 hypothetical protein LOC57003 CCDC52 NM_144718 coiled-coil domain containing 52 CCDC55 NM_001033563 hypothetical protein LOC84081 isoform 2 CCDC6 NM_005436 coiled-coil domain containing 6 CCDC68 NM_025214 CTCL tumor antigen se57-1 CCDC80 NM_199511 steroid-sensitive protein 1 CCDC81 NM_021827 hypothetical protein LOC60494 CCDC83 NM 173556 hypothetical protein LOC220047 CCDC88 NM_032251 hypothetical protein LOC283234 CCDC94 NM_018074 hypothetical protein LOC55702 CCDC95 NM_173618 coiled-coil domain containing 95 CCDC97 NM_052848 hypothetical protein LOC90324 CCL15 NM_004167 chemokine (C-C motif) ligand 15 precursor CCL22 NM_002990 small inducible cytokine A22 precursor CCND1 NM_053056 cyclin D1 CCND2 NM 001759 cyclin D2 CCND3 NM_001760 cyclin D3 CCNE1 NM 001238 cyclin El isoform 1 CCNE2 NM_057735 cyclin E2 isoform 2 CCNF NM_001761 cyclin F CCNJ NM_019084 cyclin J CCNT2 NM_001241 cyclin T2 isoform a CCR7 NM_001838 chemokine (C-C motif) receptor 7 precursor CCR9 NM_006641 chemokine (C-C motif) receptor 9 isoform B CCRK NM_012119 cell cycle related kinase isoform 2 CCS NM_005125 copper chaperone for superoxide dismutase CD151 NM 004357 CD151 antigen CD163 NM 004244 CD163 antigen isoform a CD164 NM 006016 CD164 antigen, sialomucin CD180 NM_005582 CD180 antigen CD200R1 NM 138806 CD200 receptor 1 isoform a CD209 NM 021155 CD209 antigen CD22 NM_001771 CD22 antigen CD274 NM 014143 CD274 antigen CD276 NM 001024736 CD276 antigen isoform a CD28 NM 006139 CD28 antigen CD300C NM_006678 CD300C antigen CD300LG NM_145273 triggering receptor expressed on myeloid cells CD302 NM 014880 CD302 antigen CD37 NM_001774 CD37 antigen isoform A WO 2008/085797 PCT/US2007/089206 CD3E NM 000733 CD3E antigen, epsilon polypeptide (TiT3 CD4 NM_000616 CD4 antigen precursor CD40 NM_001250 CD40 antigen isoform 1 precursor CD47 NM_001025079 CD47 molecule isoform 3 precursor CD48 NM_001778 CD48 antigen (B-cell membrane protein) CD5 NM 014207 CD5 antigen (p56-62) CD6 NM_006725 CD6 antigen CD69 NM_001781 CD69 antigen (p60, early T-cell activation CD80 NM_005191 CD80 antigen (CD28 antigen ligand 1, B7-1 CD82 NM_001024844 CD82 antigen isoform 2 CD83 NM_004233 CD83 antigen isoform a CD93 NM_012072 CD93 antigen precursor CD97 NM_001025160 CD97 antigen isoform 3 precursor CD99L2 NM_031462 CD99 antigen-like 2 isoform E3'-E4'-E3-E4 CDADC1 NM_030911 cytidine and dCMP deaminase domain containing 1 CDC14A NM_003672 CDCl4 homolog A isoform 1 CDC14B NM_003671 CDC14 homolog B isoform 1 CDC23 NM 004661 cell division cycle protein 23 CDC25A NM_001789 cell division cycle 25A isoform a CDC25B NM_004358 cell division cycle 25B isoform 2 CDC25C NM_001790 cell division cycle 25C protein isoform a CDC27 NM_001256 cell division cycle protein 27 CDC34 NM_004359 cell division cycle 34 CDC37L1 NM_017913 cell division cycle 37 homolog (S. CDC42 NM_044472 cell division cycle 42 isoform 2 CDC42BPA NM 003607 CDC42-binding protein kinase alpha isoform B CDC42BPB NM_006035 CDC42-binding protein kinase beta CDC42EP2 NM006779 Cdc42 effector protein 2 CDC42EP4 NM012121 Cdc42 effector protein 4 CDC7 NM_003503 CDC7 cell division cycle 7 CDCA4 NM_017955 cell division cycle associated 4 CDCA5 NM 080668 cell division cycle associated 5 CDCAL NM4 18719 transcription factor RAi2 CDCP2 NM_201546 hypothetical protein LC200008 CDH NM_004360 cadherin 1, type preproprotein CDH22 NM_021248 cadherin 22 precursor CDKO NM 052988 cyclin-dependent kinase 10 isoform 3 CDK5R1 NM_003885 cyclin-dependent kinase 5, regulatory subunit 1 CDK5RAP1 NM_016082 CDK5 regulatory subunit associated protein 1 CDK5RAP3 NM 025197 CDK5 regulatory subunit associated protein 3 CDK6 NM 001259 cyclin-dependent kinase 6 CDKN1A NM_000389 cyclin-dependent kinase inhibitor A CDKN2A NM 058197 cyclin-dependent kinase inhibitor 2A isoform 3 CDKN2B NM 078487 cyclin-dependent kinase inhibitor 2B isoform 2 CDKN2D NM 001800 cyclin-dependent kinase inhibitor 2D CDR2 NM 001802 cerebellar degeneration-related protein 2 CDS2 NM 003818 phosphatidate cytidylyltransferase 2 CDT1 NM 030928 DNA replication factor CDV3 NM_017548 CDV3 homolog CDX NM_001804 caudal type home box transcription factor 1 CDX2 NM_001265 caudal type homeo box transcription factor 2 CEACAM19 NM 020219 carcinoembryonic antigen-like 1 WO 2008/085797 PCT/US2007/089206 CEACAM6 NM_002483 carcinoembryonic antigen-related cell adhesion CEACAM7 NM_006890 carcinoembryonic antigen-related cell adhesion CEBPG NM_001806 CCAAT/enhancer binding protein gamma CECRI NM_017424 cat eye syndrome critical region protein 1 CECR6 NM_031890 cat eye syndrome chromosome region, candidate 6 CENTAl NM_006869 centaurin, alpha I CENTDI NM_015230 centaurin delta 1 isoform a CENTG1 NM_014770 centaurin, gamma 1 CEP152 NM_014985 hypothetical protein LOC22995 CEP170 NM 014812 centrosomal protein 170kDa CEP27 NM_018097 hypothetical protein LOC55142 CEP350 NM_014810 centrosome-associated protein 350 CEP55 NM_018131 centrosomal protein 55kDa CERK NM 022766 ceramide kinase isoform a CERKL NM_201548 ceramide kinase-like isoform a CGGBP1 NM_001008390 CGG triplet repeat binding protein 1 CGI-38 NM_015964 hypothetical protein LOC51673 CGI-69 NM_016016 hypothetical protein LOC51629 CGN NM_020770 cingulin CGNL1 NM_032866 cingulin-like 1 CHACI NM_024111 hypothetical protein LOC79094 CHD5 NM_015557 chromodomain helicase DNA binding protein 5 CHD6 NM_032221 chromodomain helicase DNA binding protein 6 CHD7 NM_017780 chromodomain helicase DNA binding protein 7 CHD8 NM_020920 chromodomain helicase DNA binding protein 8 CHD9 NM_025134 chromodomain helicase DNA binding protein 9 CHDH NM_018397 choline dehydrogenase CHEKI NM_001274 CHK1 checkpoint homolog CHERP NM_006387 calcium homeostasis endoplasmic reticulum CHFR NM_018223 checkpoint with forkhead and ring finger CHGA NM_001275 chromogranin A precursor CHIDl NM_023947 hypothetical protein LOC66005 CHKB NM_152253 choline/ethanolamine kinase isoform b CHMP4B NM 176812 chromatin modifying protein 4B CHMP6 NM_024591 chromatin modifying protein 6 CHORDC1 NM_012124 cysteine and histidine-rich domain CHP NM_007236 calcium binding protein P22 CHPT1 NM_020244 choline phosphotransferase 1 CHRACI NM_017444 chromatin accessibility complex 1 CHRD NM_177978 chordin isoform b CHRFAM7A NM_139320 CHRNA7-FAM7A fusion isoform 1 CHRNA3 NM_000743 cholinergic receptor, nicotinic, alpha CHRNA4 NM_000744 cholinergic receptor, nicotinic, alpha 4 subunit CHRNA5 NM_000745 cholinergic receptor, nicotinic, alpha CHRNB2 NM 000748 cholinergic receptor, nicotinic, beta CHRNB3 NM_000749 cholinergic receptor, nicotinic, beta CHRNB4 NM_000750 cholinergic receptor, nicotinic, beta CHRNE NM_ 000080 nicotinic acetylcholine receptor epsilon CHSTIO NM_004854 HNK-1 sulfotransferase CHST3 NM_004273 carbohydrate (chondroitin 6) sulfotransferase 3 CHST6 NM_021615 carbohydrate (N-acetylglucosamine 6-0) CHUK NM 001278 conserved helix-loop-helix ubiquitous kinase WO 2008/085797 PCT/US2007/089206 CHX10 NM_182894 ceh-10 homeo domain containing homolog CIAPINI NM 020313 cytokine induced apoptosis inhibitor 1 CIB2 NM 006383 DNA-dependent protein kinase catalytic CIDEB NM 014430 cell death-inducing DFFA-like effector b CINP NM_032630 cyclin-dependent kinase 2-interacting protein CKAP5 NM_001008938 colonic and hepatic tumor over-expressed protein CKB NM 001823 brain creatine kinase CLASP1 NM_015282 CLIP-associating protein 1 CLASP2 NM_015097 CLIP-associating protein 2 CLCN3 NM_001829 chloride channel 3 isoform b CLCN4 NM_001830 chloride channel 4 CLCN5 NM 000084 chloride channel 5 CLCN6 NM 001286 chloride channel 6 isoform ClC-6a CLCN7 NM 001287 chloride channel 7 CLDN1 NM 021101 claudin 1 CLDN12 NM 012129 claudin 12 CLDN14 NM_012130 claudin 14 CLDN2 NM 020384 claudin 2 CLDN4 NM 001305 claudin 4 CLDN5 NM 003277 claudin 5 CLDN6 NM 021195 claudin 6 CLEC12A NM 201625 myeloid inhibitory C-type lectin-like receptor CLEC12B NM_205852 macrophage antigen h CLEC2D NM_001004419 osteoclast inhibitory lectin isoform 2 CLEC4F NM_173535 C-type lectin, superfamily member 13 CLEC4M NM_214677 CD299 antigen isoform 3 CLIC5 NM 016929 chloride intracellular channel 5 CLKl NM 001024646 CDC-like kinase 1 isoform 2 CLK4 NM 020666 CDC-like kinase 4 CLLU1 NM_001025233 hypothetical protein LOC574028 CLN8 NM_018941 CLN8 protein CLOCK NM 004898 clock CLSTNI NM_001009566 calsyntenin 1 isoform 1 CLTB NM_001834 clathrin, light polypeptide isoform a CLU NM_001831 clusterin isoform 1 CLUAPI NM_024793 clusterin associated protein 1 isoform 2 CMIP NM_030629 c-Maf-inducing protein Tc-mip isoform CMPK NM 016308 cytidylate kinase CMTM1 NM 052999 chemokine-like factor superfamily 1 isoform 13 CMTM3 NM 144601 chemokine-like factor superfamily 3 isoform a CMTM4 NM 178818 chemokine-like factor superfamily 4 isoform I CMTM6 NM 017801 CKLF-like MARVEL transmembrane domain -N containing CNIH2 NM_182553 cornichon homolog 2 CNIH3 NM_152495 cornichon homolog 3 CNN1 NM 001299 calponin 1, basic, smooth muscle CNNM2 NM_017649 cyclin M2 isoform 1 CNNM3 NM_017623 cyclin M3 isoform 1 CNOT6 NM_015455 CCR4-NOT transcription complex, subunit 6 CNTD2 NM_024877 hypothetical protein LOC79935 CNTN3 NM_020872 contactin 3 CNTNAP1 NM_003632 contactin associated protein 1 WO 2008/085797 PCT/US2007/089206 COBLL1 NM 014900 COBL-like 1 COG3 NM_031431 component of golgi transport complex 3 COG7 NM_153603 component of oligomeric golgi complex 7 COL11A2 NM_080679 collagen, type XI, alpha 2 isoform 3 COL12AI NM_004370 collagen, type XII, alpha 1 long isoform COL23AI NM_173465 collagen, type XXIII, alpha 1 COL24A1 NM_152890 collagen, type XXIV, alpha 1 COL3AI NM_000090 procollagen, type III, alpha 1 COL4Al NM_001845 alpha 1 type IV collagen preproprotein COL6A1 NM_001848 collagen, type VI, alpha 1 precursor COL8A2 NM_005202 collagen, type VIII, alpha 2 COL9A2 NM 001852 alpha 2 type IX collagen COLEC12 NM 030781 collectin sub-family member 12 isoform II COLQ NM 005677 acetylcholinesterase collagen-like tail subunit COMMD5 NM 014066 hypertension-related calcium-regulated gene COMMD9 NM 014186 COMM domain containing 9 COPA NM 004371 coatomer protein complex, subunit alpha COPG2 NM_012133 coatomer protein complex, subunit gamma 2 COPS2 NM_004236 COP9 constitutive photomorphogenic homolog COPS7A NM 016319 COP9 complex subunit 7a COPS7B NM 022730 COP9 constitutive photomorphogenic homolog COQIOB NM_025147 hypothetical protein LOC80219 COQ5 NM_032314 hypothetical protein LOC84274 COQ9 NM_020312 hypothetical protein LOC57017 CORO6 NM 032854 coronin 6 CORO7 NM 024535 coronin 7 COX10 NM 001303 heme A:famesyltransferase COX15 NM_078470 COX15 homolog isoform 1 precursor CPD NM 001304 carboxypeptidase D precursor CPEB2 NM 182485 cytoplasmic polyadenylation element binding CPEB3 NM 014912 cytoplasmic polyadenylation element binding CPEB4 NM 030627 cytoplasmic polyadenylation element binding CPLX1 NM 006651 complexin 1 CPLX3 NM_001030005 complexin 3 CPLX4 NM_181654 complexin 4 CPNE1 NM_003915 copine I CPSF3L NM_032179 related to CPSF subunits 68 kDa isoform 2 CPT1B NM_004377 carnitine palmitoyltransferase lB isoform a CPXM2 NM_198148 carboxypeptidase X (M14 family), member 2 CRAMP1L NM_020825 Crm, cramped-like CRB2 NM 173689 crumbs homolog 2 CREB3L1 NM_052854 cAMP responsive element binding protein 3-like CREB5 NM_001011666 cAMP responsive element binding protein 5 CREBLI NM 004381 cAMP responsive element binding protein-like 1 CREBL2 NM 001310 cAMP responsive element binding protein-like 2 CREG1 NM 003851 cellular repressor of EIA-stimulated genes CREG2 NM_153836 cellular repressor of ElA-stimulated genes 2 CRELDI NM 001031717 cysteine-rich with EGF-like domains 1 isoform 1 CRHRI NM_004382 corticotropin releasing hormone receptor 1 CRIM1 NM 016441 cysteine-rich motor neuron 1 CRISPLD2 NM 031476 cysteine-rich secretory protein LCCL domain CRKL NM 005207 v-crk sarcoma virus CT10 oncogene homolog WO 2008/085797 PCT/US2007/089206 CRP NM_000567 C-reactive protein, pentraxin-related CRSP7 NM_004831 cofactor required for Sp 1 transcriptional CRSP8 NM_004269 cofactor required for SpI transcriptional CRSP9 NM_004270 cofactor required for SpI transcriptional CRTACl NM_018058 cartilage acidic protein I CRY2 NM_021117 cryptochrome 2 (photolyase-like) CRYM NM 001014444 crystallin, mu isoform 2 CRYZLI NM_145858 crystallin, zeta-like 1 CSDC2 NM_014460 RNA-binding protein pippin CSDE1 NM_001007553 upstream of NRAS isoform 1 CSF2 NM_000758 colony stimulating factor 2 precursor CSH1 NM_022640 chorionic somatomammotropin hormone 1 isoform 2 CSH2 NM_022644 chorionic somatomammotropin hormone 2 isoform 2 CSNK1A1 NM_001025105 casein kinase 1, alpha 1 isoform 1 CSNK1G1 NM_022048 casein kinase 1, gamma 1 isoform S CSNK1G2 NM_001319 casein kinase 1, gamma 2 CSNK2A1 NM_001895 casein kinase II alpha 1 subunit isoform a CSPG4 NM 001897 melanoma-associated chondroitin sulfate CSPG5 NM_006574 chondroitin sulfate proteoglycan 5 (neuroglycan CST6 NM_001323 cystatin M precursor CST9 NM 001008693 cystatin 9 CST9L NM_080610 cystatin 9-like precursor CSTA NM_005213 cystatin A CTAGE1 NM_172241 cutaneous T-cell lymphoma-associated antigen 1 CTDP1 NM_004715 CTD (carboxy-terminal domain, RNA polymerase II, CTDSP1 NM_021198 CTD (carboxy-terminal domain, RNA polymerase II, CTDSP2 NM 005730 nuclear LIM interactor-interacting factor 2 CTDSPL NM 001008392 small CTD phosphatase 3 isoform 1 CTH NM 001902 cystathionase isoform 1 CTNNA1 NM_001903 catenin, alpha 1 CTNNBIP1 NM_001012329 catenin, beta interacting protein 1 CTNNDI NM_001331 catenin (cadherin-associated protein), delta 1 CTSB NM_001908 cathepsin B preproprotein CTSC NM_148170 cathepsin C isoform b precursor CTSF NM_003793 cathepsin F CTSO NM 001334 cathepsin 0 preproprotein CTTN NM 005231 cortactin isoform a CUL2 NM 003591 cullin 2 CUL3 NM_003590 cullin 3 CX3CL1 NM_002996 chemokine (C-X3-C motif) ligand 1 CX3CR1 NM_001337 chemokine (C-X3-C motif) receptor 1 CXCLIO NM_001565 small inducible cytokine B10 precursor CXCR3 NM_001504 chemokine (C-X-C motif) receptor 3 CXCR6 NM_006564 G protein-coupled receptor TYMSTR CXorfl NM_004709 hypothetical protein LOC9142 CXorf4OA NM_178124 chromosome X open reading frame 40 CXorf4OB NM_001013845 hypothetical protein LOC541578 CXorf6 NM_005491 hypothetical protein LOC10046 CYB561 NM_001017916 cytochrome b-561 isoform 1 CYB561D1 NM_182580 cytochrome b-561 domain containing 1 CYB5D1 NM_144607 hypothetical protein LOCI 24637 CYBASC3 NM_153611 cytochrome b, ascorbate dependent 3 WO 2008/085797 PCT/US2007/089206 CYBRD1 NM_024843 cytochrome b reductase 1 CYCS NM_018947 cytochrome c CYFIPI NM 001033028 cytoplasmic FMR1 interacting protein I isoform CYGB NM_134268 cytoglobin CYPIBI NM_000104 cytochrome P450, family 1, subfamily B, CYP26BI NM 019885 cytochrome P450, family 26, subfamily b, CYP27A1 NM_000784 cytochrome P450, family 27, subfamily A, CYP27BI NM 000785 cytochrome P450, family 27, subfamily B, CYP2C8 NM_000770 cytochrome P450, family 2, subfamily C, CYP2C9 NM 000771 cytochrome P450, family 2, subfamily C, CYP2Sl NM_030622 cytochrome P450, family 2, subfamily S, CYP2U1 NM_183075 cytochrome P450, family 2, subfamily U, CYP4F3 NM_000896 cytochrome P450, family 4, subfamily F, D2HGDH NM 152783 D-2-hydroxyglutarate dehydrogenase D4S234E NM_014392 brain neuron cytoplasmic protein 1 D4ST1 NM_130468 dermatan 4 sulfotransferase 1 DAB2IP NM_032552 DAB2 interacting protein isoform 1 DACHI NM_004392 dachshund homolog 1 isoform c DACT2 NM_214462 dapper homolog 2, antagonist of beta-catenin DAPK3 NM 001348 death-associated protein kinase 3 DBF4B NM 025104 DBF4 homolog B isoform 2 DBH NM_000787 dopamine beta-hydroxylase precursor DBNDD2 NM_033542 SCF apoptosis response protein 1 isoform 2 DCAKD NM_024819 dephospho-CoA kinase domain containing DCAMKL1 NM_004734 doublecortin and CaM kinase-like 1 DCBLD2 NM 080927 discoidin, CUB and LCCL domain containing 2 DCTN3 NM_024348 dynactin 3 isoform 2 DCTN4 NM_016221 dynactin 4 (p62) DCTN5 NM_032486 dynactin 4 DCUN1D1 NM_020640 RP42 homolog DCUN1D2 NM_001014283 hypothetical protein LOC55208 isoform b DCUN1D4 NM_015115 DCNI, defective in cullin neddylation 1, domain DCX NM 000555 doublecortin isoform a DDEF1 NM 018482 development and differentiation enhancing factor DDEF2 NM 003887 development- and differentiation-enhancing DDHD2 NM_015214 DDHD domain containing 2 DDIl NM 001001711 hypothetical protein LOC414301 DDXl 1 NM 030655 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 DDX17 NM 006386 DEAD box polypeptide 17 isoform p82 DDX19A NM 018332 DDX19-like protein DDX26B NM 182540 hypothetical protein LOC203522 DDX28 NM_018380 DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 DDX31 NM_138620 DEAD (Asp-Glu-Ala-Asp) box polypeptide 31 DDX3X NM 001356 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3 DDX3Y NM 004660 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, DDX52 NM 007010 ATP-dependent RNA helicase ROKI isoform a DDX54 NM 024072 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 DDX59 NM 031306 DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 DEADCl NM_182503 deaminase domain containing 1 DECI NM 017418 deleted in esophageal cancer 1 DEDD NM 032998 death effector domain-containing protein DEFB4 NM 004942 defensin, beta 4 precursor WO 2008/085797 PCT/US2007/089206 DENND1A NM_020946 hypothetical protein LOC57706 isoform 1 DENND2C NM_198459 DENN/MADD domain containing 2C DENND4A NM_005848 c-myc promoter binding protein DENR NM_003677 density-regulated protein DEPDC4 NM_152317 DEP domain containing 4 DEPDC5 NM_014662 DEP domain containing 5 isoform 1 DERL3 NM_00 1002862 derlin-3 protein isoform b DFFB NM_001004285 DNA fragmentation factor, 40 kD, beta DGAT2L4 NM_001002254 diacylglycerol O-acyltransferase 2-like 4 DGCR13 NM_001024733 DiGeorge syndrome gene H DGCR2 NM_005137 integral membrane protein DGCR2 DGCR6 NM_005675 DiGeorge syndrome critical region protein 6 DGCR6L NM_033257 DiGeorge syndrome critical region gene 6 like DGCR8 NM_022720 DiGeorge syndrome critical region gene 8 DGKD NM_003648 diacylglycerol kinase, delta 130kDa isoform 1 DHDDS NM_024887 dehydrodolichyl diphosphate synthase isoform a DHFR NM_000791 dihydrofolate reductase DHFRL1 NM_176815 dihydrofolate reductase-like 1 DHTKD1 NM_018706 dehydrogenase El and transketolase domain DHX30 NM_138614 DEAH (Asp-Glu-Ala-His) box polypeptide 30 DHX33 NM_020162 DEAH (Asp-Glu-Ala-His) box polypeptide 33 DHX35 NM_021931 DEAH (Asp-Glu-Ala-His) box polypeptide 35 DIAPH1 NM_005219 diaphanous 1 DICERI NM 030621 dicer1 D102 NM_000793 deiodinase, iodothyronine, type II isoform a DIP NM_015124 death-inducing-protein DIP2A NM_015151 DIP2-like protein isoform a DIRAS1 NM_145173 small GTP-binding tumor suppressor 1 DIRAS2 NM_017594 Di-Ras2 DIRC1 NM_052952 hypothetical protein LOCI 16093 DISC1 NM_001012957 disrupted in schizophrenia 1 isoform Lv DISP2 NM_033510 dispatched B DIXDC1 NM_033425 DIX domain containing 1 isoform b dJ341D10.1 NM_001007535 hypothetical protein LOC286453 DKC1 NM_001363 dyskerin DKFZp434I1020 NM_194295 hypothetical protein LOC196968 DKFZp434K191 NM_001029950 hypothetical protein LOC29797 DKFZp434NO35 NM_032262 hypothetical protein LOC84222 DKFZp451A211 NM_001003399 hypothetical protein LOC400169 DKFZP56400823 NM_015393 DKFZP56400823 protein DKFZP586DO919 NM_206914 hypothetical protein LOC25895 isoform b DKFZp666GO57 NM_001008226 hypothetical protein LOC283726 DKFZp667M2411 NM_207323 hypothetical protein LOC147172 DKFZp686I15217 NM_207495 hypothetical protein LOC401232 DKFZp686024166 NM_001009913 hypothetical protein LOC374383 DKFZp761E198 NM_138368 hypothetical protein LOC91056 DKFZP761H1710 NM_031297 hypothetical protein LOC83459 DKFZp761I2123 NM 031449 hypothetical protein LOC83637 isoform 1 DKFZp779B1540 NM 001010903 hypothetical protein LOC389384 DLEC1 NM_007335 deleted in lung and esophageal cancer 1 isoform DLEU7 NM_198989 deleted in lymphocytic leukemia, 7 DLGAP2 NM_004745 discs large-associated protein 2 WO 2008/085797 PCT/US2007/089206 DLGAP4 NM_014902 disks large-associated protein 4 isoform a DLK1 NM_001032997 delta-like 1 homolog isoform 2 DLL1 NM_005618 delta-like 1 DLL4 NM_019074 delta-like 4 protein precursor DLST NM_001933 dihydrolipoamide S-succinyltransferase (E2 DMAP1 NM_019100 DNA methyltransferase 1 associated protein 1 DMD NM_000109 dystrophin Dp427c isoform DMPK NM_004409 myotonic dystrophy protein kinase DMRT2 NM_006557 doublesex and mab-3 related transcription factor DMRTB1 NM_033067 DMRT-like family B with proline-rich C-terminal, DMTF1 NM_021145 cyclin D binding myb-like transcription factor DNAJA2 NM_005880 DnaJ subfamily A member 2 DNAJA3 NM_005147 DnaJ (Hsp40) homolog, subfamily A, member 3 DNAJA4 NM_018602 DnaJ (Hsp40) homolog, subfamily A, member 4 DNAJB12 NM_001002762 DnaJ (Hsp40) homolog, subfamily B, member 12 DNAJB14 NM_024920 DnaJ (Hsp40) homolog, subfamily B, member 14 DNAJB4 NM_007034 DnaJ (Hsp40) homolog, subfamily B, member 4 DNAJB5 NM_012266 DnaJ (Hsp40) homolog, subfamily B, member 5 DNAJB6 NM_058246 DnaJ (Hsp40) homolog, subfamily B, member 6 DNAJC18 NM_152686 DnaJ (Hsp40) homolog, subfamily C, member 18 DNAJC5G NM_173650 DnaJ (Hsp40) homolog, subfamily C, member 5 DNAJC9 NM_015190 DnaJ homolog, subfamily C, member 9 DNAL4 NM_005740 dynein light chain 4, axonemal DNALIl NM_003462 axonemal dynein light chain DNASE IL1 NM_001009932 deoxyribonuclease I-like 1 precursor DNASEIL2 NM_001374 deoxyribonuclease I-like 2 DNM1L NM_012062 dynamin 1-like protein isoform 1 DOCK2 NM 004946 dedicator of cytokinesis 2 DOCK3 NM_004947 dedicator of cytokinesis 3 DOCK5 NM_024940 dedicator of cytokinesis 5 DOK2 NM_003974 docking protein 2 DOK4 NM_018110 downstream of tyrosine kinase 4 DOLPP1 NM_020438 dolichyl pyrophosphate phosphatase 1 DPF3 NM 012074 D4, zinc and double PHD fingers, family 3 DPH2 NM_001384 diphthamide biosynthesis protein 2 isoform a DPP9 NM_139159 dipeptidylpeptidase 9 DPPA4 NM_018189 developmental pluripotency associated 4 DPT NM_001937 dermatopontin precursor DPY19L4 NM 181787 hypothetical protein LOC286148 DPYSL2 NM 001386 dihydropyrimidinase-like 2 DPYSL3 NM_001387 dihydropyrimidinase-like 3 DRD1 NM 000794 dopamine receptor D1 DRD2 NM_000795 dopamine receptor D2 isoform long DRD5 NM 000798 dopamine receptor D5 DREV1 NM_016025 hypothetical protein LOC51108 DSC3 NM_024423 desmocollin 3 isoform Dsc3b preproprotein DSCR10 NM_148676 hypothetical protein LOC259234 DSCR3 NM_006052 Down syndrome critical region protein 3 DTNA NM_001390 dystrobrevin alpha isoform 1 DUOX2 NM_014080 dual oxidase 2 precursor DUSIL NM_022156 PP3111 protein DUSP1O NM_007207 dual specificity phosphatase 10 isoform a WO 2008/085797 PCT/US2007/089206 DUSP13 NM_001007271 muscle-restricted dual specificity phosphatase DUSP2 NM_004418 dual specificity phosphatase 2 DUSP26 NM_024025 dual specificity phosphatase 26 DUSP3 NM_004090 dual specificity phosphatase 3 DUSP9 NM_001395 dual specificity phosphatase 9 DUXI NM_012146 double homeobox, 1 DUXA NM_001012729 hypothetical protein LOC503835 DVL1 NM 004421 dishevelled 1 isoform a DVL2 NM 004422 dishevelled 2 DVL3 NM_004423 dishevelled 3 DXYS155E NM_005088 DNA segment on chromosome X and Y (unique) 155 DYNC1Il NM_004411 dynein, cytoplasmic, intermediate polypeptide 1 DYNC1LI2 NM_006141 dynein, cytoplasmic, light intermediate DYNLT3 NM_006520 t-complex-associated-testis-expressed 1-like DYRK1A NM_101395 dual-specificity tyrosine-(Y)-phosphorylation DYRKIB NM_004714 dual-specificity tyrosine-(Y)-phosphorylation DZIP1 NM_014934 DAZ interacting protein 1 isoform 1 DZIP3 NM_014648 zinc finger DAZ interacting protein 3 E2F3 NM_001949 E2F transcription factor 3 E2F7 NM_203394 E2F transcription factor 7 EBI3 NM_005755 Epstein-Barr virus induced gene 3 precursor ECE2 NM 014693 endothelin converting enzyme 2 isoform A ECHDC1 NM_018479 enoyl Coenzyme A hydratase domain containing 1 ECHS 1 NM_004092 mitochondrial short-chain enoyl-coenzyme A ECOP NM_030796 EGFR-coamplified and overexpressed protein EDA NM_001005609 ectodysplasin A isoform EDA-A2 EDA2R NM_021783 X-linked ectodysplasin receptor EDAR NM_022336 ectodysplasin A receptor EDARADD NM_080738 EDAR-associated death domain isoform B EDG1 NM_001400 endothelial differentiation, sphingolipid EDN2 NM_001956 endothelin 2 EED NM_152991 embryonic ectoderm development isoform b EEFSEC NM_021937 elongation factor for selenoprotein translation EFCAB1 NM_024593 EF-hand calcium binding domain 1 EFCAB4A NM_173584 hypothetical protein LOC283229 EFCAB5 NM_198529 EF-hand calcium binding domain 5 isoform 1 EFNA3 NM_004952 ephrin A3 EFNB1 NM_004429 ephrin-B 1 precursor EFNB2 NM 004093 ephrin B2 EFNB3 NM_001406 ephrin-B3 precursor EFTUDI NM 024580 elongation factor Tu GTP binding domain EGFL7 NM_016215 EGF-like-domain, multiple 7 EGLN1 NM 022051 egI nine homolog 1 EGLN2 NM 017555 EGL nine (C.elegans) homolog 2 isoform 2 EGR3 NM 004430 early growth response 3 EHD1 NM_006795 EH-domain containing 1 EHMTI NM_024757 euchromatic histone methyltransferase 1 EHMT2 NM_006709 HLA-B associated transcript 8 isoform a EIFlAX NM_001412 X-linked eukaryotic translation initiation EIF2B2 NM 014239 eukaryotic translation initiation factor 2B, EIF2B5 NM_003907 eukaryotic translation initiation factor 2B, EIF2C1 NM_0 12199 eukaryotic translation initiation factor 2C, 1 WO 2008/085797 PCT/US2007/089206 EIF2C2 NM_012154 eukaryotic translation initiation factor 2C, 2 EIF2C4 NM_017629 eukaryotic translation initiation factor 2C, 4 EIF2S2 NM_003908 eukaryotic translation initiation factor 2 beta EIF3S1O NM 003750 eukaryotic translation initiation factor 3, EIF3S8 NM 003752 eukaryotic translation initiation factor 3, EIF4B NM 001417 eukaryotic translation initiation factor 4B EIF4E NM_001968 eukaryotic translation initiation factor 4E EIF4E3 NM_173359 eukaryotic translation initiation factor 4E EIF4EBP2 NM_004096 eukaryotic translation initiation factor 4E EIF4G1 NM_004953 eukaryotic translation initiation factor 4 EIF5A NM_001970 eukaryotic translation initiation factor 5A EIF5A2 NM_020390 eIF-5A2 protein ELACl NM_018696 elaC homolog 1 ELAVL1 NM 001419 ELAV-like 1 ELF4 NM_001421 E74-like factor 4 (ets domain transcription ELL NM_006532 elongation factor RNA polymerase II ELL2 NM_012081 elongation factor, RNA polymerase II, 2 Ellsl NM_152793 hypothetical protein LOC222166 ELMO2 NM_133171 engulfment and cell motility 2 ELMOD1 NM_018712 ELMO domain containing 1 ELOVL1 NM_022821 elongation of very long chain fatty acids ELOVL2 NM 017770 elongation of very long chain fatty acids ELOVL5 NM 021814 homolog of yeast long chain polyunsaturated ELOVL6 NM 024090 ELOVL family member 6, elongation of long chain ELOVL7 NM 024930 ELOVL family member 7, elongation of long chain ELP3 NM 018091 elongation protein 3 homolog EMCN NM_016242 endomucin EMILIN3 NM_052846 elastin microfibril interfacer 3 EML5 NM_183387 echinoderm microtubule associated protein like EMR2 NM_013447 egf-like module containing, mucin-like, hormone EMR3 NM_ 152939 egf-like module-containing mucin-like receptor 3 EMX1 NM_004097 empty spiracles homolog 1 isoform 1 EN2 NM_001427 engrailed homolog 2 ENAH NM 001008493 enabled homolog isoform a ENC1 NM 003633 ectodermal-neural cortex (with BTB-like domain) ENG NM_000118 endoglin precursor ENPP4 NM_014936 ectonucleotide pyrophosphatase/phosphodiesterase ENSA NM_207043 endosulfine alpha isoform 2 ENTPD6 NM_001247 ectonucleoside triphosphate diphosphohydrolase ENTPD7 NM_020354 ectonucleoside triphosphate diphosphohydrolase EPB41L1 NM_012156 erythrocyte membrane protein band 4.1-like 1 EPB41L4B NM 018424 erythrocyte membrane protein band 4.1 like 4B EPB41L5 NM 020909 erythrocyte membrane protein band 4.1 like 5 EPB49 NM 001978 erythrocyte membrane protein band 4.9 (dematin) EPHAl NM_005232 ephrin receptor EphAl EPHA7 NM_004440 ephrin receptor EphA7 EPHB2 NM 004442 ephrin receptor EphB2 isoform 2 precursor EPHB4 NM 004444 ephrin receptor EphB4 precursor EPHX2 NM_001979 epoxide hydrolase 2, cytoplasmic EPM2AIPI NM 014805 EPM2A interacting protein 1 EPS8L2 NM 022772 epidermal growth factor receptor pathway ERGICI NM 001031711 endoplasmic reticulum-golgi intermediate ERN2 NM_033266 endoplasmic reticulum to nucleus signalling 2 WO 2008/085797 PCT/US2007/089206 ESAM NM_138961 endothelial cell adhesion molecule ESPN NM_031475 espin ESRI NM 000125 estrogen receptor 1 ESRRA NM_004451 estrogen-related receptor alpha ESRRG NM_001438 estrogen-related receptor gamma isoform 1 ET NM 024311 hypothetical protein L0C79157 ETS1 NM 005238 v-ets erythroblastosis virus E26 oncogene ETS2 NM_005239 v-ets erythroblastosis virus E26 oncogene ETVI NM_004956 ets variant gene 1 ETV6 NM_001987 ets variant gene 6 EVI5 NM_005665 ecotropic viral integration site 5 EVL NM_016337 EnahlVasp-like EXOC2 NM_018303 Sec5 protein EXOC4 NM 021807 SEC8 protein isoform a EXOC5 NM_006544 SEC 10 protein EXOC7 NM 001013839 exocyst complex component 7 isofonn a EXOD1 NM 080663 hypothetical protein LOC 12479 EXOSCl NM 016046 exosomal core protein CSL4 EXOSC10 NM 001001998 exosome component 10 isoform 1 EXT2 NM_000401 exostosin 2 EXTL3 NM_001440 Reg receptor EYAl NM 000503 eyes absent 1 isoform b EZH1 NM 001991 enhancer of zeste homolog 1 F1IR NM_016946 F 1 receptor isoform a precursor F2RL1 NM_005242 coagulation factor II (thrombin) receptor-like 1 F7 NM 000131 coagulation factor VII precursor, isoform a FABP2 NM 000134 intestinal fatty acid binding protein 2 FADS 1 NM_013402 fatty acid desaturase 1 FADS2 NM_004265 fatty acid desaturase 2 FADS6 NM 178128 fatty acid desaturase domain family, member 6 FAIM2 NM 012306 Fas apoptotic inhibitory molecule 2 FALZ NM 004459 fetal Alzheimer antigen isoform 2 FAM1OA NM 181709 hypothetical protein L0C144347 FAM102A NM 203305 early estrogen-induced gene 1 protein isoform b FAM107A NM 007177 downregulated in renal cell carcinoma FAM107B NM 031453 hypothetical protein L0C83641 FAM111A NM 022074 hypothetical protein L0C63901 FAMI 16A NM 152678 hypothetical protein LOC201627 FAMllA NM 032508 family with sequence similarity 11, member A FAM18B NM 016078 hypothetical protein LOC51030 FAM20B NM 014864 family with sequence similarity 20, member B FAM29A NM_017645 hypothetical protein LC54801 FAM32A NM 014077 hypothetical protein L0C26017 FAM38A NM 014745 family with sequence similarity 38, member A FAM3A NM 021806 family 3, memberAprotein FAM43B NM_207334 hypothetical protein LOC163933 FAM46C NM_017709 hypothetical protein L0C54855 FAM50A NM 004699 XAP-5 protein FAM53A NM 001013622 dorsal neural-tube nuclear protein FAM54B NM 019557 hypothetical protein L0C56181 FAM55C NM_145037 hypothetical protein LOC91775 FAM57B NM 031478 hypothetical protein L0C83723 FAM58A NM_152274 hypothetical protein LOC92002 WO 2008/085797 PCT/US2007/089206 FAM59A vNM_022751 hypothetical protein LOC64762 FAM60A NM_021238 family with sequence similarity 60, member A FAM62A NM_015292 family with sequence similarity 62 (C2 domain FAM63A NM_018379 hypothetical protein LOC55793 isoform 1 FAM63B NM_019092 hypothetical protein LOC54629 FAM70A NM_017938 hypothetical protein LOC55026 FAM73A NM_198549 hypothetical protein LOC374986 FAM78A NM_033387 hypothetical protein LOC286336 FAM78B NM_001017961 hypothetical protein LOC149297 FAM79A NM_182752 hypothetical protein LOC127262 FAM79B NM_198485 hypothetical protein LOC285386 FAM81A NM_152450 hypothetical protein LOC145773 FAM84B NM 174911 breast cancer membrane protein 101 FAM86BI NM_032916 hypothetical protein LOC85002 FAM86C NM_018172 hypothetical protein LOC55199 isoform 1 FAM89A NM_198552 hypothetical protein LOC375061 FAM89B NM_152832 Mouse Mammary Turmor Virus Receptor homolog 1 FAM91A1 NM_144963 hypothetical protein LOC 157769 FAM98B NM_173611 hypothetical protein LOC283742 FAM99A NM_001014374 hypothetical protein LOC387742 FANCA NM_000135 Fanconi anemia, complementation group A isoform FANCE NM_021922 Fanconi anemia, complementation group E FARSLA NM 004461 phenylalanine-tRNA synthetase-like protein FASN NM_004104 fatty acid synthase FAT2 NM_00 1447 FAT tumor suppressor 2 precursor FBLN1 NM_006487 fibulin 1 isoform A precursor FBX017 NM_024907 F-box protein FBG4 isoform 2 FBXO21 NM_015002 F-box only protein 21 isoform 2 FBXO22 NM 147188 F-box only protein 22 isoform a FBXO24 NM_012172 F-box only protein 24 isoform 2 FBXO27 NM_178820 F-box protein 27 FBXO31 NM_024735 F-box protein 31 FBXO33 NM_203301 F-box protein 33 FBXO44 NM_001014765 F-box protein 44 isoform 1 FBXW11 NM_012300 F-box and WD-40 domain protein lB isoform C FBXW4 NM_022039 F-box and WD-40 domain protein 4 FBXW5 NM_018998 F-box and WD-40 domain protein 5 FBXW7 NM_001013415 F-box protein FBW7 isoform 3 FCHO1 NM_015122 FCH domain only 1 FCHSD1 NM 033449 FCH and double SH3 domains 1 FCHSD2 NM 014824 FCH and double SH3 domains 2 FCMD NM 006731 fukutin FCRL2 NM_030764 Fc receptor-like 2 isoform b FCRL5 NM_031281 Fc receptor-like 5 FDFT1 NM 004462 famesyl-diphosphate famesyltransferase 1 FECH NM_000140 ferrochelatase isoform b precursor FEM1C NM_020177 feminization 1 homolog a FES NM_002005 V-FES feline sarcoma viral/V-FPS fujinami avian FEZI NM_022549 zygin 1 isoform 2 FEZ2 NM_005102 zygin 2 FFAR3 NM_005304 G protein-coupled receptor 41 FGD3 NM 033086 FYVE, RhoGEF and PH domain containing 3 FGF11 NM_004112 fibroblast growth factor 11 WO 2008/085797 PCT/US2007/089206 FGF19 NM_005117 fibroblast growth factor 19 precursor FGF2 NM_002006 fibroblast growth factor 2 FGF23 NM_020638 fibroblast growth factor 23 precursor FGF7 NM 002009 fibroblast growth factor 7 precursor FGFR1 NM_023107 fibroblast growth factor receptor 1 isoform 5 FGFRIOP NM 007045 FGFR1 oncogene partner isoform a FGFR2 NM 000141 fibroblast growth factor receptor 2 isoform 1 FGFR3 NM_000142 fibroblast growth factor receptor 3 isoform 1 FGFR4 NM_002011 fibroblast growth factor receptor 4 isoform 1 FGL1 NM_004467 fibrinogen-like 1 precursor FGR NM_005248 Gardner-Rasheed feline sarcoma viral (v-fgr) FHL1 NM 001449 four and a half LIM domains 1 FHL2 NM_001450 four and a half LIM domains 2 FIBCD1 NM_032843 fibrinogen C domain containing 1 FIGF NM_004469 vascular endothelial growth factor D FIS NM_175616 hypothetical protein LOC202299 FKBP1O NM_021939 FK506 binding protein 10, 65 kDa FKBPlA NM_000801 FK506-binding protein IA FKBPlB NM_004116 FK506-binding protein lB isoform a FKBP5 NM_004117 FK506 binding protein 5 FKBP9 NM_007270 FK506 binding protein 9 FKBP9L NM_182827 FK506 binding protein 9-like FKRP NM_024301 fukutin-related protein FKSG44 NM_031904 FKSG44 protein FLCN NM 144997 folliculin isoform 1 FLJ10159 NM_018013 hypothetical protein LOC55084 FLJ10324 NM_018059 hypothetical protein LOC55698 FLJ10769 NM 018210 hypothetical protein LOC55739 FLJ10803 NM_018224 hypothetical protein LOC55744 FLJ10916 NM 018271 hypothetical protein LOC55258 FLJ10945 NM_018280 hypothetical protein LOC55267 FLJ 11259 NM_018370 hypothetical protein LOC55332 FLJ 11292 NM_018382 hypothetical protein LOC55338 FLJ1 1506 NM_024666 hypothetical protein LOC79719 FLJ1 1783 NM 024891 hypothetical protein LOC79951 FLJ1 1806 NM_024824 nuclear protein UKp68 isoform 1 FLJ12118 NM_024537 hypothetical protein LOC79587 FLJ12529 NM_024811 pre-mRNA cleavage factor I, 59 kDa subunit FLJ12700 NM 024910 hypothetical protein LOC79970 FLJ12716 NM_199053 hypothetical protein LOC60684 isoform b FLJ12788 NM_022492 hypothetical protein LOC64427 FLJ13841 NM 024702 hypothetical protein LOC79755 FLJ14001 NM 024677 hypothetical protein LOC79730 FLJ14107 NM 025026 hypothetical protein LOC80094 FLJ14154 NM 024845 hypothetical protein LOC79903 FLJ14213 NM 024841 hypothetical protein LOC79899 FLJ14816 NM_032845 hypothetical protein LOC84931 FLJ16008 NM 001001665 hypothetical protein LOC339761 FLJ16165 NM_001004318 hypothetical protein LOC390928 FLJ20032 NM_017628 hypothetical protein LOC54790 FLJ20186 NM_207514 differentially expressed in FDCP 8 isoform 1 FLJ20232 NM_019008 hypothetical protein LOC54471 FLJ20298 NM 017752 hypothetical protein LOC54885 isoform a WO 2008/085797 PCT/US2007/089206 FLJ20487 NM_017841 hypothetical protein LOC54949 FLJ20551 NM_017875 hypothetical protein LOC54977 FLJ20558 NM_017880 hypothetical protein LOC54980 FLJ20699 NM 017931 hypothetical protein LOC55020 FLJ20701 NM 017933 hypothetical protein LOC55022 FLJ20758 NM_017952 hypothetical protein LOC55037 FLJ20850 NM_017967 hypothetical protein LOC55049 FLJ21125 NM 024627 hypothetical protein LOC79680 FLJ21687 NM_024859 PDZ domain containing, X chromosome FLJ21736 NM 024922 esterase 31 FLJ21742 NM_032207 hypothetical protein LOC84167 FLJ21945 NM_025203 hypothetical protein LOC80304 FLJ21986 NM_024913 hypothetical protein LOC79974 FLJ22349 NM_024821 hypothetical protein LOC79879 FLJ22374 NM_032222 hypothetical protein LOC84182 FLJ23436 NM_024671 hypothetical protein LOC79724 FLJ25102 NM 182626 hypothetical protein LOC348738 FLJ25143 NM_182500 hypothetical protein LOC130813 FLJ25169 NM_152568 hypothetical protein LOC157848 FLJ25222 NM_199163 hypothetical protein LOC374666 FLJ25410 NM_144605 hypothetical protein LOCl24404 FLJ25476 NM 152493 hypothetical protein LOC149076 FLJ27255 NM 207501 hypothetical protein LOC401281 FLJ30294 NM_144632 hypothetical protein LOC130827 FLJ30313 NM 152757 hypothetical protein LOC253868 FLJ31132 NM_001004355 hypothetical protein LOC441522 FLJ32011 NM_182516 hypothetical protein LOC148930 FLJ32028 NM 152680 hypothetical protein LOC201799 FLJ32063 NM 153031 hypothetical protein LOC150538 FLJ32252 NM_182510 hypothetical protein LOC146336 FLJ33708 NM_173675 hypothetical protein LOC285780 FLJ35220 NM_173627 hypothetical protein LOC284131 FLJ35424 NM_173661 hypothetical protein LOC285492 FLJ35429 NM 001003807 hypothetical protein LOC285830 FLJ35530 NM_207467 hypothetical protein LOC400798 FLJ35695 NM_207444 hypothetical protein LOC400359 FLJ35740 NM_147195 FLJ35740 protein FLJ35767 NM_207459 hypothetical protein LOC400629 FLJ35880 NM 153264 hypothetical protein LOC256076 FLJ36070 NM 182574 hypothetical protein LOC284358 FLJ36208 NM_176677 hypothetical protein LOC283948 FLJ36492 NM182568 hypothetical protein LOC284047 FLJ36888 NM 178830 hypothetical protein LOC126526 FLJ37357 NM 173645 hypothetical protein LOC284944 FLJ37478 NM 178557 hypothetical protein LOC339983 FLJ37538 NM_173564 hypothetical protein FLJ37538 FLJ37543 NM_173667 hypothetical protein LOC285668 FLJ38723 NM_173805 hypothetical protein FLJ38723 FLJ38973 NM_153689 hypothetical protein LOC205327 FLJ39237 NM 198571 hypothetical protein LOC375607 FLJ39827 NM_152424 hypothetical protein LOC139285 FLJ40142 NM 207435 hypothetical protein LOC400073 FLJ40172 NM_173649 hypothetical protein LOC285051 WO 2008/085797 PCT/US2007/089206 FLJ40288 NM_173682 hypothetical protein LOC286023 FLJ40432 NM_152523 hypothetical protein LOC151195 FLJ40504 NM_173624 hypothetical protein LOC284085 FLJ41046 NM_207479 hypothetical protein LOC400940 FLJ41423 NM_001001679 hypothetical protein LOC399886 FLJ41821 NM_001001697 hypothetical protein LOC401011 FLJ41993 NM_001001694 hypothetical protein LOC400935 FLJ42102 NM_001001680 hypothetical protein LOC399923 FLJ42133 NM_001001690 hypothetical protein LOC400844 FLJ42289 NM_207383 hypothetical protein LOC388182 FLJ42291 NM 207367 hypothetical protein LOC346547 FLJ43093 NM_207498 hypothetical protein LOC401258 FLJ43339 NM_207380 hypothetical protein LOC388115 FLJ43582 NM_207412 hypothetical protein LOC389649 FLJ43980 NM_001004299 hypothetical protein LOCl24149 FLJ44385 NM_207478 hypothetical protein LOC400934 FLJ44815 NM 207454 hypothetical protein LOC400591 FLJ44968 NM 198537 hypothetical protein LOC374887 FLJ45079 NM_001001685 hypothetical protein LOC400624 FLJ45121 NM_207451 hypothetical protein LOC400556 FLJ45248 NM_207505 hypothetical protein LOC401472 FLJ45300 NM_001001681 hypothetical protein LOC399957 FLJ45422 NM_001004349 hypothetical protein LOC441140 FLJ45455 NM_207386 hypothetical protein LOC388336 FLJ45537 NM_001001709 hypothetical protein LOC401535 FLJ45645 NM_198557 hypothetical protein LOC375287 FLJ45684 NM_207462 hypothetical protein LOC400666 FLJ45831 NM_001001684 hypothetical protein LOC400576 FLJ45964 NM_207483 hypothetical protein LOC401040 FLJ45966 NM_001001700 hypothetical protein LOC401120 FLJ45974 NM_001001707 hypothetical protein LOC401337 FLJ46020 NM_207472 hypothetical protein LOC400863 FLJ46026 NM 207458 hypothetical protein LOC400627 FLJ46082 NM_207417 hypothetical protein LOC389799 FLJ46154 NM 198462 FLJ46154 protein FLJ46210 NM 001004315 hypothetical protein LOC389152 FLJ46230 NM_207463 hypothetical protein LOC400679 FLJ46257 NM_001001693 hypothetical protein LOC400932 FLJ46347 NM_001005303 hypothetical protein LOC389064 FLJ46358 NM_207439 hypothetical protein LOC4001 10 FLJ46363 NM_207434 hypothetical protein LOC400002 FLJ46365 NM 207504 hypothetical protein LOC401459 FLJ46385 NM_001001675 hypothetical protein LOC390963 FLJ46481 NM_207405 hypothetical protein LOC389197 FLJ46831 NM_207426 forkhead box 12 FLJ46838 NM_001007546 hypothetical protein LOC440865 FLJ90166 NM 153360 hypothetical protein LOC164284 FLJ90579 NM_173591 hypothetical protein LOC283310 FLJ90650 NM 173800 laeverin FLJ90709 NM 173514 hypothetical protein LOC153129 FLNA NM_001456 filamin 1 (actin-binding protein-280) FLNB NM 001457 filamin B, beta (actin binding protein 278) FLOT2 NM 004475 flotillin 2 WO 2008/085797 PCT/US2007/089206 FLRT2 NM 013231 fibronectin leucine rich transmembrane protein FLT3 NM_004119 fins-related tyrosine kinase 3 FLYWCH1 NM_032296 FLYWCH-type zinc finger 1 isoform a FMNL1 NM_005892 formin-like I FMNL3 NM 175736 formin-like 3 isoform 1 FN3KRP NM_024619 fructosamine-3-kinase-related protein FNDC3A NM_014923 fibronectin type III domain containing 3A FNDC3B NM_022763 fibronectin type III domain containing 3B FNDC4 NM_022823 fibronectin type III domain containing 4 FNDC5 NM_153756 fibronectin type III domain containing 5 FNDC7 NM_173532 hypothetical protein LOC163479 FNDC8 NM 017559 hypothetical protein LOC54752 FNTA NM_001018676 famesyltransferase, CAAX box, alpha isoform b FNTB NM_002028 famesyltransferase, CAAX box, beta FOLR2 NM_000803 folate receptor 2 precursor FOSB NM_006732 FBJ murine osteosarcoma viral oncogene homolog FOSLI NM_005438 FOS-like antigen 1 FOSL2 NM_005253 FOS-like antigen 2 FOXA3 NM 004497 forkhead box A3 FOXF1 NM 001451 forkhead box F1 FOXL2 NM 023067 forkhead box L2 FOXN1 NM 003593 forkhead box Nl FOXOlA NM_002015 forkhead box OA FOXP4 NM_001012426 forkhead box P4 isoform I FOXRED1 NM_017547 FAD-dependent oxidoreductase domain containing FRAG1 NM 014489 FGF receptor activating protein 1 FRAS1 NM_032863 Fraser syndrome 1 isoform 4 FRAT1 NM_005479 GSK-3 binding protein FRATl FREQ NM_014286 frequenin homolog FRMD4A NM 018027 FERM domain containing 4A FRMD6 NM 152330 FERM domain containing 6 FRMPD1 NM_014907 FERM and PDZ domain containing 1 FRMPD2 NM_152428 FERM and PDZ domain containing 2 isoform 1 FRMPD4 NM_014728 PDZ domain containing 10 FRY NM_023037 hypothetical protein CGO03 FSD1 NM_024333 fibronectin type III and SPRY domain containing FSD2 NM_001007122 SPRY domain containing 1 FSIP2 NM_173651 fibrous sheath interacting protein 2 FSTLI NM 007085 follistatin-like 1 precursor FSTL3 NM 005860 follistatin-like 3 glycoprotein precursor FSTL4 NM 015082 follistatin-like 4 FUBP1 NM_003902 far upstream element-binding protein FUCAl NM 000147 fucosidase, alpha-L- 1, tissue FURIN NM_002569 furin preproprotein FUT1 NM_000148 fucosyltransferase 1 FUT2 NM 000511 fucosyltransferase 2 (secretor status included) FUT3 NM_000149 fucosyltransferase 3 (galactoside FUT4 NM_002033 fucosyltransferase 4 FVT1 NM_002035 follicular lymphoma variant translocation 1 FXN NM_000144 frataxin isoform 1 preproprotein FXYD2 NM_001680 FXYD domain-containing ion transport regulator 2 FXYD6 NM_022003 FXYD domain-containing ion transport regulator FYCO1 NM 024513 FYVE and coiled-coil domain containing 1 WO 2008/085797 PCT/US2007/089206 FZD10 NM_007197 frizzled 10 FZD4 NM012193 frizzled 4 FZD6 NM_003506 frizzled 6 FZD7 NM 003507 frizzled 7 FZD9 NM 003508 frizzled 9 GOS2 NM_015714 putative lymphocyte GO/GI switch gene G3BP2 NM_012297 Ras-GTPase activating protein SH3 domain-binding G6PD NM_000402 glucose-6-phosphate dehydrogenase GAA NM_000152 acid alpha-glucosidase preproprotein GAB2 NM 012296 GRB2-associated binding protein 2 isoform b GAB3 NM_080612 Gab3 protein GABARAPL1 NM_031412 GABA(A) receptor-associated protein like 1 GABBR1 NM_001470 gamma-aminobutyric acid (GABA) B receptor 1 GABPA NM_002040 GA binding protein transcription factor, alpha GABRA1 NM_000806 gamma-aminobutyric acid (GABA) A receptor, alpha GABRE NM_004961 gamma-aminobutyric acid (GABA) A receptor, GABRP NM_014211 gamma-aminobutyric acid (GABA) A receptor, pi GADD45G NM_006705 growth arrest and DNA-damage-inducible, gamma GAGE1 NM_001468 G antigen 1 GAK NM_005255 cyclin G associated kinase GALC NM_000153 galactosylceramidase isoform a precursor GALM NM_138801 galactose mutarotase (aldose 1-epimerase) GALNTI NM_020474 polypeptide N-acetylgalactosaminyltransferase 1 GALNTII NM 022087 GALNAC-T1l GALNT13 NM_052917 UDP-N-acetyl-alpha-D-galactosaniine:polypeptide GALNT2 NM_004481 polypeptide N-acetylgalactosaminyltransferase 2 GALNT4 NM_003774 polypeptide N-acetylgalactosaminyltransferase 4 GALNT7 NM_017423 polypeptide N-acetylgalactosaminyltransferase 7 GALNT9 NM_021808 polypeptide N-acetylgalactosaminyltransferase 9 GAN NM_022041 gigaxonin GANAB NM_198334 alpha glucosidase II alpha subunit isoform 2 GARNL1 NM_014990 GTPase activating Rap/RanGAP domain-like 1 GARNL4 NM_015085 GTPase activating Rap/RanGAP domain-like 4 GAS2L1 NM 152237 growth arrest-specific 2 like 1 isoform b GAS7 NM_003644 growth arrest-specific 7 isoform a GATA2 NM_032638 GATA binding protein 2 GATA4 NM_002052 GATA binding protein 4 GATA5 NM_080473 GATA binding protein 5 GATAD2A NM_017660 GATA zinc finger domain containing 2A GATAD2B NM_020699 GATA zinc finger domain containing 2B GBA NM_000 157 glucocerebrosidase precursor GBF1 NM_004193 golgi-specific brefeldin A resistance factor 1 GBL NM_022372 G protein beta subunit-like GCC1 NM_024523 Golgi coiled-coil protein 1 GCC2 NM_014635 GRIP and coiled-coil domain-containing 2 isoform GCK NM 000162 glucokinase isoform 1 GCLC NM 001498 glutamate-cysteine ligase, catalytic subunit GCM1 NM 003643 glial cells missing homolog a GCNT3 NM_004751 glucosaminyl (N-acetyl) transferase 3, mucin GDI2 NM 001494 GDP dissociation inhibitor 2 GDPD2 NM_017711 osteoblast differentiation promoting factor Gene symbol hsa-miR-16 targets Gene name GFAP NM_002055 glial fibrillary acidic protein WO 2008/085797 PCT/US2007/089206 GFER NM_005262 ervl-like growth factor GFI1B NM_004188 growth factor independent 1 B (potential GFM1 NM_024996 G elongation factor, mitochondrial 1 GFPT1 NM_002056 glucosamine-fructose-6-phosphate GFRA4 NM_022139 GDNF family receptor alpha 4 isoform a GGA2 NM_015044 ADP-ribosylation factor binding protein 2 GGA3 NM_014001 ADP-ribosylation factor binding protein 3 GH1 NM_022562 growth hormone 1 isoform 5 GH2 NM_022557 growth hormone 2 isoform 2 GHR NM_000163 growth hormone receptor precursor GIMAP5 NM_018384 GTPase, IMAP family member 5 GITI NM 014030 G protein-coupled receptor kinase interactor 1 GJA4 NM 002060 connexin 37 GLCE NM_015554 D-glucuronyl C5-epimerase GLIS3 NM_152629 GLIS family zinc finger 3 GLRX NM_002064 glutaredoxin (thioltransferase) GLS NM_014905 glutaminase C GLS2 NM 013267 glutaminase GA isoform a GLT1D1 NM_144669 hypothetical protein LOC144423 GLT25D2 NM_015101 glycosyltransferase 25 domain containing 2 GLTP NM_016433 glycolipid transfer protein GLUD1 NM_005271 glutamate dehydrogenase 1 GLUD2 NM_012084 glutamate dehydrogenase 2 GM2A NM_000405 GM2 ganglioside activator precursor GM632 NM_020713 hypothetical protein LOC57473 GMEB2 NM_012384 glucocorticoid modulatory element binding GNA12 NM_007353 guanine nucleotide binding protein (G protein) GNA15 NM_002068 guanine nucleotide binding protein (G protein), GNAI3 NM 006496 guanine nucleotide binding protein (G protein), GNAL NM_002071 guanine nucleotide binding protein (G protein), GNAOl NM_020988 guanine nucleotide binding protein, alpha GNAQ NM_002072 guanine nucleotide binding protein (G protein), GNAS NM_016592 guanine nucleotide binding protein, alpha GNB1 NM_002074 guanine nucleotide-binding protein, beta-I GNG12 NM_018841 G-protein gamma-12 subunit GNG2 NM 053064 guanine nucleotide binding protein (G protein), GNG7 NM_052847 guanine nucleotide binding protein (G protein), GNL3L NM_019067 guanine nucleotide binding protein-like 3 GOLGA NM_018652 golgin-like protein GOLGA1 NM_002077 golgin 97 GOLGA2 NM_004486 Golgi autoantigen, golgin subfamily a, 2 GOLGA3 NM_005895 Golgi autoantigen, golgin subfamily a, 3 GOLGA4 NM_002078 golgi autoantigen, golgin subfamily a, 4 GOLGA7 NM_001002296 golgi autoantigen, golgin subfamily a, 7 GOLPH4 NM_014498 golgi phosphoprotein 4 GOLTlB NM_016072 golgi transport 1 homolog B GORASP1 NM_031899 Golgi reassembly stacking protein 1 GORASP2 NM_015530 golgi reassembly stacking protein 2 GOSR1 NM_001007024 golgi SNAP receptor complex member 1 isoform 3 GOT2 NM_002080 aspartate aminotransferase 2 precursor GPA33 NM 005814 transmembrane glycoprotein A33 precursor GPAM NM_020918 mitochondrial glycerol 3-phosphate GPATC4 NM 015590 G patch domain containing 4 protein isoform 1 WO 2008/085797 PCT/US2007/089206 GPC1 NM_002081 glypican 1 precursor GPC3 NM_004484 glypican 3 GPDI NM_005276 glycerol-3-phosphate dehydrogenase 1 (soluble) GPIAP1 NM_005898 membrane component chromosome 11 surface marker GPR109A NM_177551 G protein-coupled receptor 109A GPR109B NM 006018 G protein-coupled receptor 109B GPRl 14 NM_153837 G-protein coupled receptor 114 GPR124 NM 032777 G protein-coupled receptor 124 GPR126 NM_001032394 G protein-coupled receptor 126 alpha 2 GPR132 NM 013345 G protein-coupled receptor 132 GPR146 NM 138445 G protein-coupled receptor 146 GPR171 NM 013308 G protein-coupled receptor 171 GPR180 NM 180989 G protein-coupled receptor 180 precursor GPR23 NM_005296 G protein-coupled receptor 23 GPR26 NM 153442 G protein-coupled receptor 26 GPR30 NM 001505 G protein-coupled receptor 30 GPR55 NM 005683 G protein-coupled receptor 55 GPR6 NM 005284 G protein-coupled receptor 6 GPR63 NM 030784 G protein-coupled receptor 63 GPR68 NM 003485 G protein-coupled receptor 68 GPR78 NM 080819 G protein-coupled receptor 78 GPR83 NM 016540 G protein-coupled receptor 83 GPR88 NM 022049 G-protein coupled receptor 88 GPR92 NM 020400 putative G protein-coupled receptor 92 GPS 1 NM_004127 G protein pathway suppressor 1 isoform 2 GPSM3 NM 022107 G-protein signalling modulator 3 (AGS3-like, C. GPX1 NM 000581 glutathione peroxidase 1 isoform 1 GRAMD2 NM_001012642 hypothetical protein L0C196996 GRAMD3 NM_023927 GRAM domain containing 3 GRB10 NM 001001549 growth factor receptor-bound protein 10 isoform GRB2 NM 002086 growth factor receptor-bound protein 2 isoform GRB7 NM 001030002 growth factor receptor-bound protein 7 GREM2 NM_022469 gremlin 2 precursor GRIMG NM 000828 glutamate receptor 3 isoform flop precursor GRIK3 NM00083 glutamate receptor 7 precursor GRIN 1 NMg000832 NMDA receptor 1 isoform NR1-1 precursor GRTN2B NM000834 N-methyl-D-aspartate receptor subunit 2B GRE2C NM 000835 N-methyl-D-aspartate receptor subunit 2C GRIN3A NM 133445 glutamate receptor, ionotropic, GRK6 NM 001004106 G protein-coupled receptor kinase 6 isofor A GRM1 NM 000838 glutamate receptor, metabotropic 1 GRM7 NM 000844 glutamate receptor, metabotropic 7 isoform a GRPR NM 005314 gastrin-releasing peptide receptor GRTPI NM_024719 growth hormone regulated TBC protein 1 GRWD NM 031485 glutamate-rich WD repeat containing 1 GSDMDC1 NM 024736 gasdermin domain containing 1 GSG1 NM_153823 germ cell associated 1 isoform 2 GST2 NM_000854 glutathione S-transferase theta 2 GTDC NM 001006636 glycosyltransferase-like domain containing 1 GTF3C NM 012087 general transcription factor IIC, polypeptide GTPBP1 NM 004286 GTP binding protein 1 GTPBP8 NM 001008235 hypothetical protein L C29083 isoform 3 GUCAIB NM_002098 guanylate cyclase activator B (retina) WO 2008/085797 PCT/US2007/089206 GUSBL2 NM_206910 hypothetical protein LOC375513 isoform 2 GYLTLIB NM_152312 glycosyltransferase-like 1B GYS1 NM_002103 glycogen synthase 1 (muscle) H2AFJ NM_018267 H2A histone family, member J isoform 1 H2-ALPHA NM 080386 alpha-tubulin isotype H2-alpha H6PD NM_004285 hexose-6-phosphate dehydrogenase precursor HADHSC NM_005327 L-3-hydroxyacyl-Coenzyme A dehydrogenase HAPLN4 NM_023002 brain link protein 2 HARSL NM_012208 histidyl-tRNA synthetase-like HAS1 NM_001523 hyaluronan synthase 1 HAS2 NM_005328 hyaluronan synthase 2 HAS3 NM 005329 hyaluronan synthase 3 isoform a HCCA2 NM_053005 HCCA2 protein HCFC1 NM_005334 host cell factor Cl (VPI6-accessory protein) HD NM_002111 huntingtin HDGF NM_004494 hepatoma-derived growth factor (high-mobility HECTDI NM_015382 HECT domain containing I HECW1 NM_015052 NEDD4-like ubiquitin-protein ligase 1 HELZ NM_014877 helicase with zinc finger domain HEMK1 NM_016173 HemK methyltransferase family member 1 HERC2 NM_004667 hect domain and RLD 2 HERC4 NM 001017972 hect domain and RLD 4 isoform c HERC6 NM 001013000 hect domain and RLD 6 isoform c HERV-FRD NM_207582 HERV-FRD provirus ancestral Env polyprotein HES2 NM_019089 hairy and enhancer of split homolog 2 HES5 NM_001010926 hairy and enhancer of split 5 HEXA NM_000520 hexosaminidase A preproprotein HEYl NM_012258 hairy/enhancer-of-split related with YRPW motif HEY2 NM 012259 hairy/enhancer-of-split related with YRPW motif HEYL NM_014571 hairy/enhancer-of-split related with YRPW HICI NM_006497 hypermethylated in cancer 1 HIC2 NM_015094 hypermethylated in cancer 2 HIGD1A NM_014056 HIGI domain family, member 1A HIP 1 NM_005338 huntingtin interacting protein 1 HIRA NM_003325 HIR (histone cell cycle regulation defective, S. HIST1H2AG NM_021064 H2A histone family, member P HIST2H2BE NM_003528 H2B histone family, member Q HKl NM_000188 hexokinase 1 isoform HKI HK2 NM 000189 hexokinase 2 HKR2 NM_181846 GLI-Kruppel family member HKR2 HLA-DQA1 NM_002122 major histocompatibility complex, class II, DQ HMBOX1 NM_024567 hypothetical protein LOC79618 HMBS NM_000190 hydroxymethylbilane synthase isoform 1 HMG20A NM_018200 high-mobility group 20A HMG2L1 NM 001003681 high-mobility group protein 2-like 1 isoform b HMGA1 NM_002131 high mobility group AT-hook 1 isoform b HMGA2 NM 001015886 high mobility group AT-hook 2 isoform c HMGB3 NM_005342 high-mobility group box 3 HMOX2 NM_002134 heme oxygenase (decyclizing) 2 HNF4A NM_000457 hepatocyte nuclear factor 4 alpha isoform b HNF4G NM_004133 hepatocyte nuclear factor 4, gamma HNRPAO NM_006805 heterogeneous nuclear ribonucleoprotein AO HNRPA1 NM_002136 heterogeneous nuclear ribonucleoprotein Al WO 2008/085797 PCT/US2007/089206 HNRPDL NM_005463 heterogeneous nuclear ribonucleoprotein D-like HNRPU NM_004501 heterogeneous nuclear ribonucleoprotein U HOXA1O NM 018951 homeobox A10 isoform a HOXA3 NM_030661 homeobox A3 isoform a HOXB13 NM 006361 homeobox B13 HOXB4 NM_024015 homeobox B4 HOXB7 NM_004502 homeobox B7 HOXCI1 NM_014212 homeobox CI1 HOXC13 NM_017410 homeobox C13 HOXC8 NM 022658 homeobox C8 HOXD1 NM 024501 homeobox D1 HOXD9 NM 014213 homeobox D9 HPCAL4 NM_016257 hippocalcin-like protein 4 HPSI NM_182637 Hermansky-Pudlak syndrome 1 protein isoform b HPS4 NM_022081 light ear protein isoform a HPSE2 NM_021828 heparanase 2 HR NM_005144 hairless protein isoform a HRH2 NM 022304 histamine receptor H2 HRH3 NM_007232 histamine receptor H3 HS2STl NM_012262 heparan sulfate 2-0-sulfotransferase 1 HS6STl NM_004807 heparan sulfate 6-0-sulfotransferase HS6ST2 NM 147175 heparan sulfate 6-0-sulfotransferase 2 HSDL2 NM 032303 hydroxysteroid dehydrogenase like 2 HSF2BP NM_007031 heat shock transcription factor 2 binding HSPA1B NM_005346 heat shock 70kDa protein 1B HSPA4L NM 014278 heat shock 70kDa protein 4-like HSPA8 NM_006597 heat shock 70kDa protein 8 isoform 1 HSPB7 NM_014424 heat shock 27kDa protein family, member 7 HSPBAP1 NM 024610 Hspb associated protein 1 HSPC049 NM_014149 HSPC049 protein HSPC117 NM_014306 hypothetical protein LOC51493 HSPG2 NM_005529 heparan sulfate proteoglycan 2 HSU79303 NM_013301 hypothetical protein LOC29903 HTF9C NM 022727 HpaII tiny fragments locus 9C HTR2A NM_000621 5-hydroxytryptamine (serotonin) receptor 2A HTR2C NM 000868 5-hydroxytryptamine (serotonin) receptor 2C HTR4 NM 000870 serotonin 5-HT4 receptor isoform b HTRA2 NM_013247 HtrA serine peptidase 2 isoform 1 preproprotein HTRA3 NM_053044 HtrA serine peptidase 3 HYOU1 NM_006389 oxygen regulated protein precursor IARS NM_002161 isoleucine-tRNA synthetase IBRDC1 NM_152553 IBR domain containing 1 IBRDC2 NM_182757 IBR domain containing 2 ICA1 NM_022307 islet cell autoantigen 1 ICMT NM_012405 isoprenylcysteine carboxyl methyltransferase ICOS NM_012092 inducible T-cell co-stimulator precursor ICOSLG NM 015259 inducible T-cell co-stimulator ligand IDH3A NM_005530 isocitrate dehydrogenase 3 (NAD+) alpha IER2 NM 004907 immediate early response 2 IFITl NM 001548 interferon-induced protein with IFNAR1 NM_000629 interferon-alpha receptor 1 precursor IFNGR2 NM_005534 interferon-gamma receptor beta chain precursor IFT140 NM_014714 intraflagellar transport 140 WO 2008/085797 PCT/US2007/089206 IFT20 NM_174887 intraflagellar transport protein IFT20 IFT57 NM 018010 estrogen-related receptor beta like 1 IFT74 NM_025103 coiled-coil domain containing 2 IGF1 NM_000618 insulin-like growth factor I (somatomedin C) IGF1R NM_000875 insulin-like growth factor 1 receptor precursor IGF2BP1 NM_006546 insulin-like growth factor 2 mRNA binding IGF2R NM_000876 insulin-like growth factor 2 receptor IGFBP3 NM_000598 insulin-like growth factor binding protein 3 IGSF22 NM_173588 hypothetical protein LOC283284 IGSF3 NM_001007237 immunoglobulin superfamily, member 3 isoform 2 IGSF4 NM 014333 immunoglobulin superfamily, member 4D IHPK1 NM_001006115 inositol hexaphosphate kinase 1 isoform 2 IHPK3 NM_054111 inositol hexaphosphate kinase 3 IKBKAP NM_003640 inhibitor of kappa light polypeptide gene IKBKB NM_001556 inhibitor of kappa light polypeptide gene IKBKE NM 014002 IKK-related kinase epsilon IKBKG NM_003639 inhibitor of kappa light polypeptide gene IL1ORA NM_001558 interleukin 10 receptor, alpha precursor IL1ORB NM_000628 interleukin 10 receptor, beta precursor IL13 NM_002188 interleukin 13 precursor IL15 NM_000585 interleukin 15 preproprotein IL16 NM_004513 interleukin 16 isoform 1 precursor IL17D NM 138284 interleukin 17D precursor IL17E NM_022789 interleukin 17E isoform 1 precursor IL17RB NM_172234 interleukin 17B receptor isoform 2 precursor IL17RC NM_032732 interleukin 17 receptor C isoform 3 precursor IL17RD NM_017563 interleukin 17 receptor D IL17RE NM_144640 interleukin 17 receptor E isoform 3 IL18BP NM_173042 interleukin 18 binding protein precursor IL18R1 NM_003855 interleukin 18 receptor 1 precursor IL1F5 NM_012275 interleukin 1 family, member 5 ILlF8 NM_173178 interleukin 1 family, member 8 isoform 2 ILlF9 NM_019618 interleukin 1 family, member 9 ILIRI NM_000877 interleukin 1 receptor, type I precursor ILIRAP NM_134470 interleukin 1 receptor accessory protein isoform ILIRAPLI NM_ 014271 interleukin 1 receptor accessory protein-like 1 ILIRLI NM_003856 interleukin 1 receptor-like 1 isoform 2 IL20 NM_018724 interleukin 20 precursor IL28RA NM_170743 interleukin 28 receptor, alpha isoform 1 IL2RA NM_000417 interleukin 2 receptor, alpha chain precursor IL2RB NM 000878 interleukin 2 receptor beta precursor IL3 NM 000588 interleukin 3 precursor IL3RA NM_002183 interleukin 3 receptor, alpha precursor IL6R NM_000565 interleukin 6 receptor isoform 1 precursor IL9R NM_176786 interleukin 9 receptor isoform 2 ILDRI NM_175924 immunoglobulin-like domain containing receptor ILF3 NM_004516 interleukin enhancer binding factor 3 isoform b IMMP2L NM_032549 IMP2 inner mitochondrial membrane protease-like IMPA2 NM_014214 inositol(myo)-1(or 4)-monophosphatase 2 INCENP NM 020238 inner centromere protein antigens 135/155kDa ING5 NM_032329 inhibitor of growth family, member 5 INPP5A NM_005539 inositol polyphosphate-5-phosphatase A INSM2 NM 032594 insulinoma-associated protein IA-6 WO 2008/085797 PCT/US2007/089206 INSR NM_000208 insulin receptor INVS NM_014425 inversin isoform a IP08 NM_006390 importin 8 IPPK NM 022755 inositol 1,3,4,5,6-pentakisphosphate 2-kinase IQCE NM 152558 IQ motif containing E IQGAP1 NM_003870 IQ motif containing GTPase activating protein 1 IQGAP3 NM_178229 IQ motif containing GTPase activating protein 3 IRAK1 NM_001025242 interleukin- 1 receptor-associated kinase 1 IRAK2 NM_001570 interleukin- 1 receptor-associated kinase 2 IRF2BP1 NM_015649 interferon regulatory factor 2 binding protein IRF4 NM_002460 interferon regulatory factor 4 IRF5 NM 002200 interferon regulatory factor 5 isoform a IRS1 NM_005544 insulin receptor substrate 1 IRS2 NM_003749 insulin receptor substrate 2 IRX3 NM_024336 iroquois homeobox protein 3 ISLR NM_005545 immunoglobulin superfamily containing ISOCl NM 016048 isochorismatase domain containing 1 ISOC2 NM_024710 isochorismatase domain containing 2 ITFG3 NM_032039 integrin alpha FG-GAP repeat containing 3 ITGA1O NM_003637 integrin, alpha 10 precursor ITGA2 NM 002203 integrin alpha 2 precursor ITGAM NM 000632 integrin alpha M precursor ITGAX NM_000887 integrin alpha X precursor ITGB4BP NM_002212 integrin beta 4 binding protein isoform a ITGB5 NM_002213 integrin, beta 5 ITGBL1 NM_004791 integrin, beta-like 1 (with EGF-like repeat ITIH1 NM_002215 inter-alpha (globulin) inhibitor HI ITIH5 NM_001001851 inter-alpha trypsin inhibitor heavy chain ITK NM 005546 1L2-inducible T-cell kinase ITPK1 NM_014216 inositol 1,3,4-triphosphate 5/6 kinase ITPR1 NM_002222 inositol 1,4,5-triphosphate receptor, type 1 ITSN1 NM_001001132 intersectin 1 isoform ITSN-s IVNS1ABP NM_006469 influenza virus NS1A binding protein isoform a JAGNI NM_032492 jagunal homolog 1 JAK2 NM 004972 Janus kinase 2 JARIDlB NM_006618 Jumonji, AT rich interactive domain 1B JARID2 NM_004973 jumonji, AT rich interactive domain 2 protein JMJD2D NM_018039 jumonji domain containing 2D JMJD4 NM_023007 jumonji domain containing 4 JMJD5 NM_024773 hypothetical protein LOC79831 JOSD1 NM_014876 Josephin domain containing 1 JPH1 NM_020647 junctophilin 1 JPH2 NM_020433 junctophilin 2 isoform 1 JUB NM_032876 jub, ajuba homolog isoform 1 JUP NM 002230 junction plakoglobin K6HF NM 004693 cytokeratin type II K6IRS3 NM 175068 keratin 6 irs3 K6IRS4 NM_175053 keratin 6 irs4 KALI NM_000216 Kallmann syndrome 1 protein KALRN NM_001024660 kalirin, RhoGEF kinase isoform 1 KARS NM_005548 lysyl-tRNA synthetase KATNAL1 NM_001014380 katanin p60 subunit A-like 1 KATNB1 NM_005886 katanin p80 subunit B 1 WO 2008/085797 PCT/US2007/089206 KBTBD2 NM_015483 kelch repeat and BTB (POZ) domain containing 2 KBTBD4 NM_016506 kelch repeat and BTB (POZ) domain containing 4 KBTBD5 NM_152393 kelch repeat and BTB (POZ) domain containing 5 KCNA3 NM_002232 potassium voltage-gated channel, shaker-related KCNAB1 NM_003471 potassium voltage-gated channel, shaker-related KCNAB2 NM_003636 potassium voltage-gated channel, shaker-related KCNC2 NM_139136 Shaw-related voltage-gated potassium channel KCND3 NM_004980 potassium voltage-gated channel, Shal-related KCNElL NM 012282 potassium voltage-gated channel, Isk-related KCNG3 NM_133329 potassium voltage-gated channel, subfamily G, KCNG4 NM_133490 potassium voltage-gated channel, subfamily G, KCNH4 NM_012285 potassium voltage-gated channel, subfamily H, KCNIP1 NM 014592 Kv channel interacting protein 1 isoform 2 KCNIP3 NM_013434 Kv channel interacting protein 3 isoform 1 KCNJ1 1 NM_000525 potassium inwardly-rectifying channel J 11 KCNJ16 NM_018658 potassium inwardly-rectifying channel J 16 KCNJ2 NM_000891 potassium inwardly-rectifying channel J2 KCNJ9 NM_004983 potassium inwardly-rectifying channel subfamily KCNK1 NM_002245 potassium channel, subfamily K, member 1 KCNK2 NM_001017424 potassium channel, subfamily K, member 2 isoform KCNK7 NM_005714 potassium channel, subfamily K, member 7 isoform KCNMA1 NM 001014797 large conductance calcium-activated potassium KCNN4 NM_002250 intermediate conductance calcium-activated KCNQ1 NM_000218 potassium voltage-gated channel, KQT-like KCNQ2 NM_004518 potassium voltage-gated channel KQT-like protein KCNQ5 NM_019842 potassium voltage-gated channel, KQT-like KCNRG NM 173605 potassium channel regulator isoform I KCNS1 NM 002251 potassium voltage-gated channel KCNT1 NM_020822 potassium channel, subfamily T, member 1 KCNT2 NM_198503 potassium channel, subfamily T, member 2 KCTD1 NM_198991 potassium channel tetramerisation domain KCTD12 NM_138444 potassium channel tetramerisation domain KCTD15 NM_024076 potassium channel tetramerisation domain KCTD2 NM_015353 potassium channel tetramerisation domain KCTD3 NM_016121 potassium channel tetramerisation domain KCTD5 NM_018992 potassium channel tetramerisation domain KCTD7 NM_153033 potassium channel tetramerisation domain KCTD8 NM_198353 potassium channel tetramerisation domain KGFLP1 NM_174950 hypothetical protein LOC387628 KIAA0125 NM_014792 hypothetical protein LOC9834 KIAA0143 NM_015137 hypothetical protein LOC23167 KIAAO152 NM_014730 hypothetical protein LOC9761 KIAA0174 NM_014761 putative MAPK activating protein PM28 KIAA0179 NM_015056 hypothetical protein LOC23076 KIAAO182 NM_014615 hypothetical protein LOC23199 KIAA0232 NM_014743 hypothetical protein LOC9778 KIAA0240 NM_015349 hypothetical protein LOC23506 KIAA0241 NM_015060 hypothetical protein LOC23080 KIAA0247 NM_014734 hypothetical protein LOC9766 KIAA0251 NM_ 015027 hypothetical protein LOC23042 KIAA0265 NM_0 14997 hypothetical protein LOC23008 KIAA0284 NM_015005 hypothetical protein LOC283638 KIAA0286 NM_015257 hypothetical protein LOC23306 WO 2008/085797 PCT/US2007/089206 KIAA0319L NM_024874 polycystic kidney disease 1-like isoform a KIAA0323 NM 015299 hypothetical protein LOC23351 KIAA0329 NM_014844 hypothetical protein LOC9895 KIAA0350 NM_015226 hypothetical protein LOC23274 KIAA0355 NM_014686 hypothetical protein LOC9710 KIAA0376 NM_015330 cytospin A KIAA0423 NM_015091 hypothetical protein LOC23116 KIAA0427 NM_014772 hypothetical protein LOC9811 KIAA0446 NM_014655 hypothetical protein LOC9673 KIAA0494 NM_014774 hypothetical protein LOC9813 KIAA0495 NM 207306 KIAA0495 KIAA0513 NM_014732 hypothetical protein LOC9764 KIAA0523 NM_015253 hypothetical protein LOC23302 KIAA0553 NM_001002909 hypothetical protein LOC23131 KIAA0556 NM_015202 hypothetical protein LOC23247 KIAA0562 NM_014704 glycine-, glutamate-, KIAA0564 NM_001009814 hypothetical protein LOC23078 isoform b KIAA0649 NM 014811 1 A6/DRIM (down-regulated in metastasis) KIAA0652 NM_014741 hypothetical protein LOC9776 KIAA0664 NM_015229 hypothetical protein LOC23277 KIAA0672 NM_014859 hypothetical protein LOC9912 KIAA0676 NM_015043 hypothetical protein LOC23061 isoform b KIAA0683 NM_016111 hypothetical protein LOC9894 KIAA0746 NM 015187 hypothetical protein LOC23231 KIAA0773 NM_014690 hypothetical protein LOC9715 KIAA0789 NM_014653 hypothetical protein LOC9671 KIAA0804 NM_001009921 hypothetical protein LOC23355 isoform a KIAA0828 NM_015328 KIAA0828 protein KIAA0831 NM_014924 hypothetical protein LOC22863 KIAA0853 NM_015070 KIAA0853 KIAA0859 NM_001007239 CGI-01 protein isoform 3 KIAA0863 NM_014913 hypothetical protein LOC22850 KIAA0895 NM_015314 hypothetical protein LOC23366 KIAAl 161 NM 020702 hypothetical protein LOC57462 KIAA1 166 NM 018684 hepatocellular carcinoma-associated antigen 127 KIAA1199 NM 018689 KIAA1199 KIAA1267 NM_015443 hypothetical protein LOC284058 KIAA1274 NM_014431 KIAA1274 KIAA1303 NM_020761 raptor KIAA1333 NM 017769 hypothetical protein LOC55632 KIAA1411 NM_020819 hypothetical protein LOC57579 KIAA1434 NM_019593 hypothetical protein LOC56261 KIAA1456 NM 020844 hypothetical protein LOC57604 KIAA1522 NM_020888 hypothetical protein LOC57648 KIAA1530 NM_020894 hypothetical protein LOC57654 KIAA1542 NM_020901 CTD-binding SR-like protein rA9 KIAA1559 NM_020917 zinc finger protein 14-like KIAA1576 NM_020927 hypothetical protein LOC57687 KIAA1600 NM_020940 hypothetical protein LOC57700 KIAA1609 NM_020947 hypothetical protein LOC57707 KIAA1618 NM_020954 hypothetical protein LOC57714 KIAA1688 NM_025251 KIAA1688 protein KIAA1715 NM_030650 Lunapark WO 2008/085797 PCT/US2007/089206 KIAA1727 NM_033393 hypothetical protein LOC85462 KIAA1729 NM_053042 hypothetical protein LOC85460 KIAA1737 NM_033426 KIAA1737 protein KIAA1772 NM_024935 hypothetical protein LOC80000 KIAA1804 NM_032435 mixed lineage kinase 4 KIAA1815 NM_024896 hypothetical protein LOC79956 KIAA1853 NM_194286 KIAA1853 protein KIAA1862 NM_032534 KIAA1862 protein KIAA1875 NM_032529 KIAA1875 protein KIAA1909 NM_052909 hypothetical protein LOC153478 KIAA1920 NM_052919 hypothetical protein LOC1 14817 KIAA1924 NM_145294 hypothetical protein LOC197335 KIAA1961 NM_001008738 hypothetical protein LOC96459 isoform 2 KIAA2022 NM_001008537 hypothetical protein LOC340533 KIF12 NM_138424 kinesin family member 12 KIF13B NM_015254 kinesin family member 13B KIF1A NM_004321 axonal transport of synaptic vesicles KIFIB NM 015074 kinesin family member 1B isoform b KIFIC NM_006612 kinesin family member IC KIF2 NM_004520 kinesin heavy chain member 2 KIF21A NM_017641 kinesin family member 21A KIF23 NM_004856 kinesin family member 23 isoform 2 KIF2C NM 006845 kinesin family member 2C KIF3B NM_004798 kinesin family member 3B KIF5A NM_004984 kinesin family member 5A KIF5B NM_004521 kinesin family member 5B KIF6 NM_145027 kinesin family member 6 KIFC3 NM 005550 kinesin family member C3 KIR2DS4 NM_012314 killer cell immunoglobulin-like receptor, two KITLG NM_000899 KIT ligand isoform b precursor KL NM 004795 klotho isoform a KLC2 NM_022822 likely ortholog of kinesin light chain 2 KLC4 NM_201521 kinesin-like 8 isoform a KLF12 NM_016285 Kruppel-like factor 12 isoform b KLF13 NM 015995 Kruppel-like factor 13 KLHDC6 NM_207335 hypothetical protein LOC166348 KLHDC8B NM_173546 hypothetical protein LOC200942 KLHL18 NM 025010 kelch-like 18 KLHL2 NM_007246 kelch-like 2, Mayven KLHL21 NM 014851 kelch-like 21 KLHL26 NM_018316 hypothetical protein LOC55295 KLHL3 NM_017415 kelch-like 3 (Drosophila) KLHL4 NM_019117 kelch-like 4 isoform 1 KLK2 NM_00 1002231 kallikrein 2, prostatic isoform 2 KLKB1 NM_000892 plasma kallikrein B1 precursor KNDC1 NM_152643 kinase non-catalytic C-lobe domain (KIND) KNS2 NM 005552 kinesin 2 60/7OkDa isoform 1 KPNA3 NM_002267 karyopherin alpha 3 KPNA4 NM_002268 karyopherin alpha 4 KRAS NM_004985 c-K-ras2 protein isoform b KRTIB NM 175078 keratin 1B KRT20 NM 019010 keratin 20 KRT2B NM_015848 cytokeratin 2 WO 2008/085797 PCT/US2007/089206 KRTAP1O-l NM_198691 keratin associated protein 10-1 KRTAP10-12 NM_198699 keratin associated protein 10-12 KRTAP10-8 NM_198695 keratin associated protein 10-8 KRTAP11-1 NM_175858 keratin associated protein 11-1 KRTAP26-1 NM_203405 hypothetical protein LOC388818 KRTAP4-4 NM 032524 keratin associated protein 4.4 KRTAP9-2 NM_031961 keratin associated protein 9.2 KRTAP9-3 NM_031962 keratin associated protein 9.3 KRTAP9-4 NM_033191 keratin associated protein 9-4 KRTHA3B NM_002279 type I hair keratin 3B KRTHB4 NM_033045 keratin, hair, basic, 4 KSR1 NM_014238 kinase suppressor of ras Kua-UEV NM_003349 ubiquitin-conjugating enzyme E2 Kua-UEV isoform KU-MEL-3 NM_001011540 KU-MEL-3 protein LAMC1 NM 002293 laminin, gamma 1 precursor LAMP1 NM_005561 lysosomal-associated membrane protein 1 LAMP2 NM_013995 lysosomal-associated membrane protein 2 LAMP3 NM_014398 lysosomal-associated membrane protein 3 LANCLI NM_006055 lanthionine synthetase C-like protein 1 LANCL2 NM_018697 LanC lantibiotic synthetase component C-like 2 LARP2 NM_032239 La ribonucleoprotein domain family member 2 LASP1 NM_006148 LIM and SH3 protein 1 LASSI NM_021267 longevity assurance gene 1 isoform 1 LASS3 NM_178842 hypothetical protein LOC204219 LASS6 NM_203463 longevity assurance homolog 6 LAT NM_001014987 linker for activation of T cells isoform b LATS1 NM_004690 LATS homolog 1 LATS2 NM_014572 LATS, large tumor suppressor, homolog 2 LCE1E NM_178353 late cornified envelope IE LCN2 NM_005564 lipocalin 2 (oncogene 24p3) LCP1 NM_002298 L-plastin LDB3 NM_007078 LIM domain binding 3 LDLRAD2 NM_001013693 hypothetical protein LOC401944 LDLRAP 1 NM_015627 low density lipoprotein receptor adaptor protein LDOC1 NM 012317 leucine zipper, down-regulated in cancer 1 LDOC1L NM_032287 hypothetical protein LOC84247 LEMD1 NM_001001552 LEM domain containing 1 LENG12 NM_033206 hypothetical protein LOC90011 LEP NM_000230 leptin precursor LETM1 NM_012318 leucine zipper-EF-hand containing transmembrane LGALS8 NM_006499 galectin 8 isoform a LGI2 NM_018176 leucine-rich repeat LGI family, member 2 LGI4 NM_139284 leucine-rich repeat LGI family, member 4 LGR6 NM_001017403 leucine-rich repeat-containing G protein-coupled LHFPL5 NM_182548 lipoma HMGIC fusion partner-like 5 LHPP NM_022126 phospholysine phosphohistidine inorganic LHX3 NM_014564 LIM homeobox protein 3 isoform b LIF NM_002309 leukemia inhibitory factor (cholinergic LIMD1 NM_014240 LIM domains containing 1 LIMS3 NM_033514 LIM and senescent cell antigen-like domains 3 LIN28 NM_024674 lin-28 homolog LIN28B NM_001004317 lin-28 homolog B LIPE NM 005357 hormone-sensitive lipase WO 2008/085797 PCT/US2007/089206 LIPG NM_006033 endothelial lipase precursor LIPH NM_139248 lipase, member H precursor LITAF NM_004862 LPS-induced TNF-alpha factor LKAP NM 014647 limkain bI LMAN2L NM_030805 lectin, mannose-binding 2-like LMNA NM_170707 lamin A/C isoform 1 precursor LMO7 NM_005358 LIM domain only 7 LMOD1 NM_012134 leiomodin 1 (smooth muscle) LNX1 NM_032622 multi-PDZ-domain-containing protein LNX2 NM_153371 PDZ domain containing ring finger 1 LOCl12714 NM 207312 hypothetical protein LOCl 12714 LOC115648 NM_145326 hypothetical protein LOC1 15648 LOC116143 NM_138458 monad LOC133308 NM_178833 hypothetical protein LOC133308 LOC144233 NM 181708 hypothetical protein LOC144233 LOC144363 NM_001001660 hypothetical protein LOC144363 LOC144983 NM_001011724 heterogeneous nuclear ribonucleoprotein A l-like LOC147650 NM_207324 hypothetical protein LOC147650 LOC147804 NM_001010856 hypothetical protein LOC147804 LOC150383 NM 001008917 hypothetical protein LOCI 50383 isoform 2 LOC151194 NM_145280 hypothetical protein LOCI 51194 LOC153222 NM_153607 hypothetical protein LOC153222 LOC155060 NM 001004302 hypothetical protein LOC155060 LOC158381 NM_001029857 hypothetical protein LOC158381 LOC159090 NM_145284 hypothetical protein LOC159090 LOC161931 NM 139174 hypothetical protein LOC161931 LOC162427 NM_178126 hypothetical protein LOC162427 LOC165186 NM_199280 hypothetical protein LOC165186 LOC196463 NM 173542 hypothetical protein LOC196463 LOC197322 NM_174917 hypothetical protein LOC197322 LOC201164 NM_178836 hypothetical protein LOC201164 LOC203427 NM_145305 mitochondrial solute carrier protein LOC203547 NM_001017980 hypothetical protein LOC203547 LOC220594 NM_145809 TL132 protein LOC221442 NM_001010871 hypothetical protein LOC221442 LOC255374 NM_203397 hypothetical protein LOC255374 LOC283487 NM_178514 hypothetical protein LOC283487 LOC283537 NM_181785 hypothetical protein LOC283537 LOC283849 NM_178516 hypothetical protein LOC283849 LOC284434 NM_001007525 hypothetical protein LOC284434 LOC284757 NM_001004305 hypothetical protein LOC284757 LOC284861 NM 201565 hypothetical protein LOC284861 LOC285074 NM_001012626 hypothetical protein LOC285074 LOC285382 NM_001025266 hypothetical protein LOC285382 LOC285498 NM_194439 hypothetical protein LOC285498 LOC285636 NM_175921 hypothetical protein LOC285636 LOC286526 NM 001031834 Ras-like GTPase-like LOC317671 NM_173362 hypothetical protein LOC317671 LOC339768 NM_194312 hypothetical protein LOC339768 LOC340156 NM 001012418 hypothetical protein LOC340156 LOC340529 NM_001012977 hypothetical protein LOC340529 LOC348174 NM_182619 secretory protein LOC348174 LOC348262 NM_207368 hypothetical protein LOC348262 WO 2008/085797 PCT/US2007/089206 LOC348840 NM_182631 hypothetical protein LOC348840 LOC352909 NM_001031802 hypothetical protein LOC352909 isoform 2 LOC387646 NM_001006604 hypothetical protein LOC387646 LOC387720 NM_001013633 hypothetical protein LOC387720 LOC387758 NM_203371 hypothetical protein LOC387758 LOC387856 NM_001013635 hypothetical protein LOC387856 LOC388886 NM_207644 hypothetical protein LOC388886 LOC389541 NM_001008395 hypothetical protein LOC389541 LOC390980 NM_001023563 similar to Zinc finger protein 264 LOC391356 NM 001013663 hypothetical protein LOC391356 LOC399706 NM_001010910 hypothetical protein LOC399706 LOC399900 NM_001013667 hypothetical protein LOC399900 LOC400120 NM_203451 hypothetical protein LOC400120 LOC400145 NM 001013669 hypothetical protein LOC400145 LOC400258 NM_001008404 hypothetical protein LOC400258 LOC400451 NM_207446 hypothetical protein LOC400451 LOC400464 NM_001013670 hypothetical protein LOC400464 LOC400696 NM_207646 hypothetical protein LOC400696 LOC400707 NM_001013673 hypothetical protein LOC400707 LOC400891 NM_001013675 hypothetical protein LOC400891 LOC400924 NM_001013676 hypothetical protein LOC400924 LOC400965 NM_001013677 hypothetical protein LOC400965 LOC401152 NM_001001701 hypothetical protein LOC401152 LOC401233 NM_001013680 hypothetical protein LOC401233 LOC401252 NM_001013681 hypothetical protein LOC401252 LOC401286 NM_001023565 hypothetical protein LOC401286 LOC401431 NM_001008745 hypothetical protein LOC401431 LOC401498 NM_212558 hypothetical protein LOC401498 LOC401589 NM_001013687 hypothetical protein LOC401589 LOC401720 NM_001013690 hypothetical protein LOC401720 LOC402055 NM 001013694 hypothetical protein LOC402055 LOC405753 NM_207581 Numb-interacting protein LOC440157 NM_001013701 hypothetical protein LOC440157 LOC440248 NM_199045 hypothetical protein LOC440248 LOC440742 NM_001013710 hypothetical protein LOC440742 LOC440944 NM_001013713 hypothetical protein LOC440944 LOC441046 NM_001011539 hypothetical protein LOC441046 LOC441087 NM_001013716 hypothetical protein LOC441087 LOC441120 NM 001013718 hypothetical protein LOC441120 LOC441177 NM_001013720 hypothetical protein LOC441177 LOC441193 NM_001013722 hypothetical protein LOC441193 LOC441208 NM 001013723 hypothetical protein LOC441208 LOC441257 NM_001023562 hypothetical protein LOC441257 LOC441426 NM_001013727 hypothetical protein LOC441426 LOC442582 NM_001025202 STAG3-like LOC493856 NM_001008388 hypothetical protein LOC493856 LOC497190 NM_001011880 hypothetical protein LOC497190 LOC51057 NM_015910 hypothetical protein LOC51057 LOC541469 NM_001013617 hypothetical protein LOC541469 LOC55565 NM_017530 hypothetical protein LOC55565 LOC56964 NM_020212 hypothetical protein LOC56964 LOC619208 NM_001033564 hypothetical protein LOC619208 LOC89944 NM_138342 hypothetical protein LOC89944 WO 2008/085797 PCT/US2007/089206 LOC90321 NM_001010851 hypothetical protein LOC90321 LOC90639 NM_001031617 hypothetical protein LOC90639 LOC90693 NM_138771 hypothetical protein LOC90693 LOC91461 NM_138370 hypothetical protein LOC91461 LOC91689 NM_033318 hypothetical protein LOC91689 LOC93349 NM_138402 hypothetical protein LOC93349 LOC93622 NM_138699 hypothetical protein LOC93622 LOXL2 NM_002318 lysyl oxidase-like 2 precursor LPHN1 NM 001008701 latrophilin 1 isoform 1 precursor LPHN2 NM_012302 latrophilin 2 precursor LPIN2 NM_014646 lipin 2 LPIN3 NM_022896 lipin 3 LPP NM_005578 LIM domain containing preferred translocation LPPR2 NM_022737 lipid phosphate phosphatase-related protein type LRCH1 NM_015116 leucine-rich repeats and calponin homology (CH) LRCH4 NM_002319 leucine-rich repeats and calponin homology (CH) LRIGl NM_015541 leucine-rich repeats and immunoglobulin-like LRIG2 NM 014813 leucine-rich repeats and immunoglobulin-like LRP10 NM_014045 low density lipoprotein receptor-related protein LRP12 NM_013437 suppression of tumorigenicity LRP1B NM_018557 low density lipoprotein-related protein lB LRP6 NM_002336 low density lipoprotein receptor-related protein LRP8 NM_001018054 low density lipoprotein receptor-related protein LRPPRC NM 133259 leucine-rich PPR motif-containing protein LRRC1 NM_018214 leucine rich repeat containing 1 LRRC14 NM_014665 leucine rich repeat containing 14 LRRC15 NM_130830 leucine rich repeat containing 15 LRRC21 NM_015613 retina specific protein PAL LRRC22 NM_001017924 leucine rich repeat containing 22 LRRC25 NM 145256 leucine rich repeat containing 25 LRRC27 NM_030626 leucine rich repeat containing 27 LRRC3 NM_030891 leucine-rich repeat-containing 3 precursor LRRC32 NM_005512 leucine rich repeat containing 32 precursor LRRC47 NM_020710 leucine rich repeat containing 47 LRRC55 NM_001005210 hypothetical protein LOC219527 LRRC57 NM_153260 hypothetical protein LOC255252 LRRC61 NM_023942 hypothetical protein LOC65999 LRRC8A NM_019594 leucine-rich repeat-containing 8 LRRFIP2 NM_017724 leucine rich repeat (in FLII) interacting LRRK1 NM_024652 leucine-rich repeat kinase 1 LRRN3 NM_018334 leucine rich repeat neuronal 3 LRRN6A NM_032808 leucine-rich repeat neuronal 6A LRRTM2 NM_015564 leucine rich repeat transmembrane neuronal 2 LRSAM1 NM_001005373 leucine rich repeat and sterile alpha motif LSMl 1 NM_173491 LSM 11, U7 small nuclear RNA associated LSM16 NM_025083 LSM16 homolog (EDC3, S. cerevisiae) LSM4 NM_012321 U6 snRNA-associated Sm-like protein 4 LSM7 NM_016199 U6 snRNA-associated Sm-like protein LSm7 LSP1 NM_001013253 lymphocyte-specific protein 1 isoform 2 LSS NM_002340 lanosterol synthase LTB NM_009588 lymphotoxin-beta isoform b LTBP1 NM_000627 latent transforming growth factor beta binding LTC4S NM_000897 leukotriene C4 synthase isoform 2 WO 2008/085797 PCT/US2007/089206 LUZPl NM_033631 leucine zipper protein 1 LY6E NM_002346 lymphocyte antigen 6 complex, locus E LY6G5C NM_001002848 lymphocyte antigen 6 complex G5C isoform C LY6K NM_017527 lymphocyte antigen 6 complex, locus K LY86 NM_004271 MD-1, RP105-associated LY9 NM_001033667 lymphocyte antigen 9 isoform b LYCAT NM 001002257 lysocardiolipin acyltransferase isoform 2 LYK5 NM_001003786 protein kinase LYK5 isoform 2 LYPD5 NM 001031749 LY6/PLAUR domain containing 5 LYPLA2 NM_007260 lysophospholipase II LYPLA3 NM_012320 lysophospholipase 3 (lysosomal phospholipase LYSMD4 NM_152449 hypothetical protein LOC145748 LYST NM_000081 lysosomal trafficking regulator isoform 1 LYZL4 NM_144634 lysozyme-like 4 LZTFLI NM 020347 leucine zipper transcription factor-like 1 LZTR1 NM_006767 leucine-zipper-like transcription regulator, 1 LZTSI NM_021020 leucine zipper, putative tumor suppressor 1 LZTS2 NM_032429 leucine zipper, putative tumor suppressor 2 M6PR NM_002355 cation-dependent mannose-6-phosphate receptor MACF1 NM 012090 microfilament and actin filament cross-linker MADD NM_003682 MAP-kinase activating death domain-containing MAF NM_001031804 v-maf musculoaponeurotic fibrosarcoma oncogene MAFB NM_005461 transcription factor MAFB MAFG NM_002359 v-maf musculoaponeurotic fibrosarcoma oncogene MAG NM_080600 myelin associated glycoprotein isoform b MAGEB4 NM_002367 melanoma antigen family B, 4 MAK NM_005906 male germ cell-associated kinase MAMDC2 NM_153267 MAM domain containing 2 MAN2A2 NM_006122 mannosidase, alpha, class 2A, member 2 MANBAL NM_001003897 mannosidase, beta A, lysosomal-like MAPIA NM_002373 microtubule-associated protein 1A MAP2Kl NM_002755 mitogen-activated protein kinase kinase 1 MAP2K1IP1 NM_021970 mitogen-activated protein kinase kinase 1 MAP2K2 NM_030662 mitogen-activated protein kinase kinase 2 MAP2K3 NM_002756 mitogen-activated protein kinase kinase 3 MAP2K4 NM 003010 mitogen-activated protein kinase kinase 4 MAP2K7 NM_145185 mitogen-activated protein kinase kinase 7 MAP3K14 NM_003954 mitogen-activated protein kinase kinase kinase MAP3K3 NM 002401 mitogen-activated protein kinase kinase kinase 3 MAP3K4 NM_005922 mitogen-activated protein kinase kinase kinase 4 MAP3K7 NM_003188 mitogen-activated protein kinase kinase kinase 7 MAP3K9 NM_033141 mitogen-activated protein kinase kinase kinase MAP4 NM_002375 microtubule-associated protein 4 isoform 1 MAP6 NM_207577 microtubule-associated protein 6 isoform 2 MAP7 NM_003980 microtubule-associated protein 7 MAPK1 NM_002745 mitogen-activated protein kinase 1 MAPK14 NM_001315 mitogen-activated protein kinase 14 isoform 1 MAPK3 NM_002746 mitogen-activated protein kinase 3 isoform 1 MAPK8 NM 002750 mitogen-activated protein kinase 8 isoform 2 MAPK8IP1 NM_005456 mitogen-activated protein kinase 8 interacting MAPK8IP2 NM 012324 mitogen-activated protein kinase 8 interacting MAPK8IP3 NM_015133 mitogen-activated protein kinase 8 interacting MAPK9 NM_002752 mitogen-activated protein kinase 9 isoform 1 WO 2008/085797 PCT/US2007/089206 MAPKAP1 NM_001006617 mitogen-activated protein kinase associated MAPKAPK2 NM_004759 mitogen-activated protein kinase-activated MAPKBPl NM 014994 mitogen-activated protein kinase binding protein MAPRE1 NM_012325 microtubule-associated protein, RP/EB family, MAPRE3 NM_012326 microtubule-associated protein, RP/EB family, MARCH4 NM_020814 membrane-associated ring finger (C3HC4) 4 MARCH5 NM_017824 ring finger protein 153 MARCH9 NM_138396 membrane-associated RING-CH protein IX MARK4 NM_031417 MAP/microtubule affinity-regulating kinase 4 MASPI NM_001031849 mannan-binding lectin serine protease 1 isoform MATlA NM_000429 methionine adenosyltransferase I, alpha MBD1 NM_002384 methyl-CpG binding domain protein 1 isoform 4 MBD3 NM_003926 methyl-CpG binding domain protein 3 MBD6 NM_052897 methyl-CpG binding domain protein 6 MBNL2 NM_144778 muscleblind-like 2 isoform 1 MBP NM_001025100 Golli-mbp isoform 2 MCART1 NM_033412 mitochondrial carrier triple repeat 1 MCART6 NM_001012755 hypothetical protein LOC401612 MCFD2 NM_139279 multiple coagulation factor deficiency 2 MCM2 NM_004526 minichromosome maintenance protein 2 MDGA1 NM_153487 MAM domain containing MECP2 NM_004992 methyl CpG binding protein 2 MECR NM_001024732 nuclear receptor-binding factor 1 isoform b MED11 NM_001001683 hypothetical protein LOC400569 MED9 NM_018019 mediator of RNA polymerase II transcription, MEFV NM_000243 Mediterranean fever protein MEOX1 NM_004527 mesenchyme homeobox 1 isoform 1 MEOX2 NM_005924 mesenchyme homeobox 2 MESDC2 NM 015154 mesoderm development candidate 2 METTL4 NM 022840 methyltransferase like 4 MFAP5 NM_003480 microfibrillar associated protein 5 MFN2 NM_014874 mitofusin 2 MFSD2 NM_032793 major facilitator superfamily domain containing MGAT5 NM 002410 alpha-1,3(6)-mannosylglycoprotein MGC10911 NM_032302 hypothetical protein LOC84262 MGC11102 NM_032325 hypothetical protein LOC84285 MGC14289 NM_080660 hypothetical protein LOC92092 MGC16385 NM_145039 hypothetical protein LOC92806 MGC17330 NM 052880 HGFL protein MGC20470 NM 145053 hypothetical protein LOC143630 MGC21675 NM_052861 hypothetical protein LOC92070 MGC21830 NM_182563 hypothetical protein LOC283870 MGC24381 NM 001001410 hypothetical protein LOCI 15939 MGC26694 NM 178526 hypothetical protein LOC284439 MGC26718 NM_00 1029999 hypothetical protein LOC440482 MGC26885 NM_152339 hypothetical protein LOC124044 MGC29671 NM_182538 hypothetical protein LOC201305 MGC3123 NM_024107 hypothetical protein LOC79089 isoform 1 MGC3265 NM_024028 hypothetical protein LOC78991 MGC33214 NM_153354 hypothetical protein LOC 153396 MGC33556 NM_001004307 hypothetical protein LOC339541 MGC34761 NM_173619 hypothetical protein LOC283971 MGC35308 NM_175922 hypothetical protein MGC35308 WO 2008/085797 PCT/US2007/089206 MGC35361 NM_147194 hypothetical protein LOC222234 MGC3731 NM_024313 hypothetical protein LOC79159 MGC40405 NM_152789 hypothetical protein LOC257415 isoform 1 MGC4093 NM 030578 hypothetical protein LOC80776 MGC42105 NM_153361 hypothetical protein LOC167359 MGC4268 NM_031445 hypothetical protein LOC83607 MGC52000 NM_198943 CXYorfl -related protein MGC5242 NM_024033 hypothetical protein LOC78996 MGC57359 NM_001004351 hypothetical protein LOC441272 MGC87631 NM_001004306 hypothetical protein LOC339184 MGC9712 NM 152689 hypothetical protein LOC202915 MGC9850 NM 152705 hypothetical protein MGC9850 MGC99813 NM_001005209 hypothetical protein LOCl30612 MGRN1 NM_015246 mahogunin, ring finger 1 MIBI NM_020774 mindbomb homolog 1 MICB NM 005931 MHC class I polypeptide-related sequence B MIDI NM 000381 midline 1 isoform alpha MIER2 NM_017550 hypothetical protein LOC54531 MINKI NM_001024937 misshapen/NIK-related kinase isoform 4 MIOX NM 017584 myo-inositol oxygenase MKL2 NM_014048 megakaryoblastic leukemia 2 protein MKNK1 NM_003684 MAP kinase interacting serine/threonine kinase 1 MKX NM_173576 hypothetical protein LOC283078 MLC1 NM_015166 megalencephalic leukoencephalopathy with MLCK NM_182493 MLCK protein MLR1 NM_153686 transcription factor MLR1 MLXIPL NM_032951 Williams Beuren syndrome chromosome region 14 MLYCD NM_012213 malonyl-CoA decarboxylase MMAB NM_052845 cob(I)alamin adenosyltransferase MMACHC NM_015506 hypothetical protein LOC25974 MMD NM_012329 monocyte to macrophage MMD2 NM_198403 monocyte-to-macrophage differentiation factor 2 MME NM_000902 membrane metallo-endopeptidase MMP14 NM_004995 matrix metalloproteinase 14 preproprotein MMP15 NM_002428 matrix metalloproteinase 15 preproprotein MMP19 NM 001032360 matrix metalloproteinase 19 isoform 2 precursor MMP24 NM_006690 matrix metalloproteinase 24 preproprotein MMP3 NM_002422 matrix metalloproteinase 3 preproprotein MMS19L NM_022362 MMS19-like (MET18 homolog, S. cerevisiae) MNI NM_002430 meningioma 1 MNT NM_020310 MAX binding protein MOBKL2A NM 130807 MOB-LAK MOBKL2B NM 024761 MOB 1, Mps One Binder kinase activator-like 2B MOCS1 NM_005942 molybdenum cofactor synthesis-step 1 protein MON1B NM_014940 MON1 homolog B MORF4L1 NM_006791 MORF-related gene 15 isoform 1 MOSC1 NM_022746 MOCO sulphurase C-terminal domain containing 1 MOV1O NM_020963 Mov10, Moloney leukemia virus 10, homolog MOVIOLl NM 018995 MOV1O-like 1 MPDU1 NM 004870 mannose-P-dolichol utilization defect 1 MPL NM_005373 myeloproliferative leukemia virus oncogene MPP2 NM 005374 palmitoylated membrane protein 2 MPPED1 NM_001585 hypothetical protein LOC758 WO 2008/085797 PCT/US2007/089206 MPZL1 NM_003953 myelin protein zero-like 1 isoform a MRAS NM 012219 muscle RAS oncogene homolog MRPL1 1 NM_170739 mitochondrial ribosomal protein LI1 isoform c MRPL12 NM_002949 mitochondrial ribosomal protein L12 MRPL14 NM_032111 mitochondrial ribosomal protein L14 MRPL35 NM_016622 mitochondrial ribosomal protein L35 isoform a MRPL37 NM_016491 mitochondrial ribosomal protein L37 MRPL4 NM_146388 mitochondrial ribosomal protein L4 isoform b MRPL40 NM_003776 mitochondrial ribosomal protein L40 MRPL45 NM_032351 mitochondrial ribosomal protein L45 MRPS18A NM_018135 mitochondrial ribosomal protein S18A MRPS2 NM_016034 mitochondrial ribosomal protein S2 MRPS25 NM_022497 mitochondrial ribosomal protein S25 MRRF NM_138777 mitochondrial ribosome recycling factor isoform MS4A10 NM_206893 membrane-spanning 4-domains, subfamily A, member MS4A2 NM_000139 membrane-spanning 4-domains, subfamily A, member MS4A7 NM_021201 membrane-spanning 4-domains, subfamily A, member MSH5 NM_002441 mutS homolog 5 isoform c MSRB2 NM_012228 methionine sulfoxide reductase B2 MST150 NM_032947 putative small membrane protein NID67 MTAP NM 002451 5'-methylthioadenosine phosphorylase MTCP1 NM_001018024 mature T-cell proliferation 1 isoform p8 MTG1 NM 138384 GTP binding protein MTHFR NM_005957 5,10-methylenetetrahydrofolate reductase MTM1 NM_000252 myotubularin MTMR1 1 NM_181873 myotubularin related protein 11 MTMR3 NM 021090 myotubularin-related protein 3 isoform c MTMR4 NM_004687 myotubularin related protein 4 MTMR8 NM_017677 myotubularin related protein 8 MTMR9 NM_015458 myotubularin-related protein 9 MTNRIB NM_005959 melatonin receptor 1B MTPN NM_145808 myotrophin MTRR NM 002454 methionine synthase reductase isoform 1 MTSS1 NM_014751 metastasis suppressor 1 MUCi NM_001018021 MUCI mucin isoform 4 precursor MUCDHL NM_031265 mu-protocadherin isoform 4 MULK NM_018238 multiple substrate lipid kinase MUM1 NM_032853 melanoma ubiquitous mutated protein MXD3 NM_031300 MAX dimerization protein 3 MXD4 NM 006454 MAD4 MYADM NM 001020818 myeloid-associated differentiation marker MYB NM 005375 v-myb myeloblastosis viral oncogene homolog MYBPCl NM_002465 myosin binding protein C, slow type isoform 1 MYCLI NM_001033081 1-myc-1 proto-oncogene isoform 1 MYD88 NM 002468 myeloid differentiation primary response gene MYEF2 NM_016132 myelin gene expression factor 2 MYH14 NM 024729 myosin, heavy polypeptide 14 MYL1 NM_079420 fast skeletal myosin alkali light chain 1 MYLK NM_005965 myosin light chain kinase isoform 6 MYOl8A NM_078471 myosin 18A isoform a MYOlD NM 015194 myosin ID MYOlE NM 004998 myosin IE MYO5C NM 018728 myosin VC WO 2008/085797 PCT/US2007/089206 MYO9B NM_004145 myosin IXB MYOHD1 NM_001033579 myosin head domain containing 1 isoform 2 MYOM3 NM_152372 myomesin family, member 3 MYOZ3 NM_133371 myozenin 3 MYRIP NM_015460 myosin VIIA and Rab interacting protein MYT1L NM_015025 myelin transcription factor 1-like N4BP1 NM_153029 Nedd4 binding protein 1 N4BP3 NM_015111 Nedd4 binding protein 3 NAALADL2 NM_207015 N-acetylated alpha-linked acidic dipeptidase 2 NAG8 NM_014411 nasopharyngeal carcinoma associated gene NANOG NM_024865 Nanog homeobox NANOSI NM_001009553 nanos homolog 1 isoform 2 NAP1L4 NM_005969 nucleosome assembly protein 1-like 4 NAPA NM_003827 N-ethylmaleimide-sensitive factor attachment NAPE-PLD NM_198990 N-acyl-phosphatidylethanolamine-hydrolyzing NARF NM_012336 nuclear prelamin A recognition factor isoform a NARFL NM_022493 nuclear prelamin A recognition factor-like NARGI NM_057175 NMDA receptor regulated 1 NARS NM_004539 asparaginyl-tRNA synthetase NAT10 NM_024662 N-acetyltransferase-like protein NAT 11 NM_024771 hypothetical protein LOC79829 NAVI NM_020443 neuron navigator 1 NBEA NM 015678 neurobeachin NBR1 NM_005899 neighbor of BRCA1 gene 1 NCAM1 NM 181351 neural cell adhesion molecule 1 isoform 2 NCF4 NM_013416 neutrophil cytosolic factor 4 (40kD) isoform 2 NCKIPSD NM_016453 NCK interacting protein with SH3 domain isoform NCOA4 NM_005437 nuclear receptor coactivator 4 NCOR2 NM_006312 nuclear receptor co-repressor 2 NDNL2 NM 138704 necdin-like 2 NDOR1 NM_014434 NADPH dependent diflavin oxidoreductase 1 NDP NM_000266 norrin NDRG2 NM_016250 N-myc downstream-regulated gene 2 isoform b NDRG4 NM_020465 NDRG family member 4 NDST1 NM_001543 N-deacetylase/N-sulfotransferase (heparan NDUFA4L2 NM 020142 NADH:ubiquinone oxidoreductase MLRQ subunit NEBL NM 006393 nebulette sarcomeric isoform NECAPI NM 015509 adaptin-ear-binding coat-associated protein 1 NEDD9 NM_182966 neural precursor cell expressed, developmentally NEK1O NM_001031741 NIMA (never in mitosis gene a)- related kinase NEK6 NM_014397 putative serine-threonine protein kinase NEK8 NM_178170 NIMA-related kinase 8 NELF NM_015537 nasal embryonic LHRH factor NEU4 NM_080741 sialidase 4 NEURL NM_004210 neuralized-like NEUROG3 NM_020999 neurogenin 3 NF2 NM_000268 neurofibromin 2 isoform I NFASC NM_015090 neurofascin precursor NFAT5 NM_006599 nuclear factor of activated T-cells 5 isoform c NFATC3 NM_004555 cytoplasmic nuclear factor of activated T-cells NFATC4 NM_004554 cytoplasmic nuclear factor of activated T-cells NFE2L1 NM_003204 nuclear factor (erythroid-derived 2)-like 1 NFIC NM 005597 nuclear factor I/C isoform 1 WO 2008/085797 PCT/US2007/089206 NFKB1 NM_003998 nuclear factor kappa-B, subunit I NFKBIB NM_001001716 nuclear factor of kappa light polypeptide gene NFKBIL1 NM_005007 nuclear factor of kappa light polypeptide gene NFKBIL2 NM_013432 I-kappa-B-related protein NFSI NM 021100 NFS1 nitrogen fixation 1 isoform a precursor NFYC NM 014223 nuclear transcription factor Y, gamma NGFR NM_002507 nerve growth factor receptor precursor NHEJl NM_024782 XRCC4-like factor NHLH1 NM_005598 nescient helix loop helix 1 NHS NM_198270 Nance-Horan syndrome protein NIBP NM_031466 NIK and IKK(beta) binding protein NID I NM_002508 nidogen (enactin) NIN NM_020921 ninein isoform 2 NISCH NM_007184 nischarin NKD1 NM 033119 naked cuticle homolog 1 NKIRAS2 NM_001001349 NFKB inhibitor interacting Ras-like 2 NKX2-8 NM_014360 NK2 transcription factor related, locus 8 NKX3-1 NM_006167 NK3 transcription factor related, locus 1 NLGN1 NM_014932 neuroligin 1 NMD3 NM_015938 NMD3 homolog NME3 NM_002513 nucleoside-diphosphate kinase 3 NMNAT2 NM_015039 nicotinamide mononucleotide adenylyltransferase NMTl NM_021079 N-myristoyltransferase 1 NMT2 NM_004808 glycylpeptide N-tetradecanoyltransferase 2 NOBI NM_014062 nin one binding protein NOC2L NM_015658 nucleolar complex associated 2 homolog NOD9 NM_024618 NOD9 protein isoform 1 NODAL NM_018055 mouse nodal homolog precursor NOL3 NM_003946 nucleolar protein 3 NOMOl NM 014287 nodal modulator 1 NOMO2 NM_173614 nodal modulator 2 isoform 2 NOMO3 NM 001004067 nodal modulator 3 NOS I NM_000620 nitric oxide synthase 1 (neuronal) NOSlAP NM_014697 nitric oxide synthase 1 (neuronal) adaptor NOS2A NM 000625 nitric oxide synthase 2A isoform 1 NOTCH2 NM_024408 notch 2 preproprotein NP NM_000270 purine nucleoside phosphorylase NPAL3 NM_020448 NIPA-like domain containing 3 NPC2 NM_006432 Niemann-Pick disease, type C2 precursor NPEPPS NM 006310 aminopeptidase puromycin sensitive NPHP4 NM 015102 nephroretinin NPLOC4 NM_017921 nuclear protein localization 4 NPNT NM_001033047 nephronectin NPR2 NM_003995 natriuretic peptide receptor B precursor NPTXR NM_014293 neuronal pentraxin receptor isoform 1 NR2F6 NM 005234 nuclear receptor subfamily 2, group F, member 6 NR4Al NM_002135 nuclear receptor subfamily 4, group A, member 1 NR4A3 NM 173199 nuclear receptor subfamily 4, group A, member 3 NR5Al NM 004959 nuclear receptor subfamily 5, group A, member 1 NRBP1 NM_013392 nuclear receptor binding protein NRG1 NM_013958 neuregulin 1 isoform HRG-beta3 NRIP2 NM_031474 nuclear receptor interacting protein 2 NRN1 NM_016588 neuritin precursor WO 2008/085797 PCT/US2007/089206 NRP2 NM_003872 neuropilin 2 isoform 2 precursor NSF NM_006178 N-ethylmaleimide-sensitive factor NSUN4 NM_199044 NOL1/NOP2/Sun domain family 4 protein NT5DC3 NM_016575 hypothetical protein LOC51559 isoform 2 NTE NM_006702 neuropathy target esterase NTN2L NM 006181 netrin 2-like NTNG2 NM 032536 netrin G2 NTRK2 NM_001007097 neurotrophic tyrosine kinase, receptor, type 2 NTSRI NM_002531 neurotensin receptor 1 NUAK1 NM_014840 AMPK-related protein kinase 5 NUAK2 NM_030952 NUAK family, SNF1-like kinase, 2 NUBP2 NM_012225 nucleotide binding protein 2 (MinD homolog, E. NUCB 1 NM 006184 nucleobindin 1 NUDCD3 NM_015332 NudC domain containing 3 NUDT1 NM_002452 nudix-type motif 1 isoform p18 NUDT11 NM_018159 nudix-type motif 1I NUDT8 NM_181843 nudix-type motif 8 NUP188 NM_015354 nucleoporin 188kDa NUP210 NM_024923 nucleoporin 210 NUP35 NM_001008544 nucleoporin 35kDa isoform b NUP50 NM_007172 nucleoporin 50kDa isoform b NUP98 NM_005387 nucleoporin 98kD isoform 3 NUTF2 NM_005796 nuclear transport factor 2 NXF5 NM_033153 nuclear RNA export factor 5 isoform c NXPH1 NM_152745 neurexophilin 1 precursor NXPH4 NM_007224 neurexophilin 4 OAF NM_178507 hypothetical protein LOC220323 OAS2 NM_001032731 2'-5'-oligoadenylate synthetase 2 isoform 3 OAS3 NM 006187 2'-5'oligoadenylate synthetase 3 OATL1 NM 001006113 ornithine aminotransferase-like 1 isoform 1 OBSCN NM_052843 obscurin, cytoskeletal calmodulin and OCRL NM_000276 phosphatidylinositol polyphosphate 5-phosphatase ODF2 NM_153437 outer dense fiber of sperm tails 2 isoform 2 OGDH NM_002541 oxoglutarate (alpha-ketoglutarate) dehydrogenase OGDHL NM_018245 oxoglutarate dehydrogenase-like OGFR NM_007346 opioid growth factor receptor OGT NM_003605 O-linked GlcNAc transferase isoform 3 OIP5 NM_007280 Opa interacting protein 5 OLFM2 NM 058164 olfactomedin 2 OMG NM_002544 oligodendrocyte myelin glycoprotein OPHNI NM_002547 oligophrenin 1 OPRL1 NM_000913 opiate receptor-like 1 ORMDL1 NM_016467 ORMI-like 1 ORMDL3 NM_139280 ORMl -like 3 OS9 NM_001017956 amplified in osteosarcoma isoform 2 precursor OSBPL3 NM_015550 oxysterol-binding protein-like protein 3 isoform OSCAR NM_130771 osteoclast-associated receptor isoform 3 OSM NM_020530 oncostatin M precursor OSRI NM_145260 odd-skipped related I OSTM1 NM 014028 osteopetrosis associated transmembrane protein OTOF NM 004802 otoferlin isoform b OTUB1 NM_017670 OTU domain, ubiquitin aldehyde binding 1 OTUB2 NM_023112 OTU domain, ubiquitin aldehyde binding 2 WO 2008/085797 PCT/US2007/089206 OTUD4 NM_199324 OTU domain containing 4 protein isoform 1 OTUD6A NM_207320 HIN-6 protease OTX1 NM_014562 orthodenticle 1 OVOLl NM_004561 OVO-like 1 binding protein P15RS NM_018170 hypothetical protein FLJ10656 P18SRP NM_173829 P18SRP protein P2RX2 NM_012226 purinergic receptor P2X2 isoform I P2RX7 NM_177427 purinergic receptor P2X7 isoform b P2RXL1 NM_005446 purinergic receptor P2X-like 1, orphan receptor P2RY8 NM_178129 G-protein coupled purinergic receptor P2Y8 PA2G4 NM_006191 proliferation-associated 2G4, 38kDa PABPN1 NM_004643 poly(A) binding protein, nuclear 1 PACRG NM 152410 PARK2 co-regulated PACSIN1 NM_020804 protein kinase C and casein kinase substrate in PAEP NM_001018049 glycodelin precursor PAFAH1B1 NM_000430 platelet-activating factor acetylhydrolase, PAFAH2 NM_000437 platelet-activating factor acetylhydrolase 2 PAG1 NM_018440 phosphoprotein associated with glycosphingolipid PAGEl NM_003785 P antigen family, member 1 PAICS NM_006452 phosphoribosylaminoimidazole carboxylase PAK2 NM_002577 p21-activated kinase 2 PAK6 NM_020168 p21-activated kinase 6 PAK7 NM_020341 p21-activated kinase 7 PALM2-AKAP2 NM_007203 PALM2-AKAP2 protein isoform 1 PAM NM_000919 peptidylglycine alpha-amidating monooxygenase PANK1 NM_138316 pantothenate kinase 1 isoform gamma PANX1 NM_015368 pannexin I PAPD1 NM_018109 PAP associated domain containing 1 PAPOLG NM_022894 poly(A) polymerase gamma PAPPA NM_002581 pregnancy-associated plasma protein A PARD6B NM_032521 PAR-6 beta PARD6G NM_032510 PAR-6 gamma protein PARP 11 NM_020367 poly (ADP-ribose) polymerase family, member 11 PARP12 NM_022750 zinc finger CCCH-type domain containing 1 PARP14 NM_017554 poly (ADP-ribose) polymerase family, member 14 PATE NM_138294 expressed in prostate and testis PAX2 NM_000278 paired box protein 2 isoform b PAX8 NM_003466 paired box gene 8 isoform PAX8A PAXIPI NM_007349 PAX interacting protein 1 PBX3 NM_006195 pre-B-cell leukemia transcription factor 3 PCBP4 NM_020418 poly(rC) binding protein 4 isoform a PCDH1 NM_032420 protocadherin 1 isoform 2 precursor PCDH17 NM 014459 protocadherin 17 PCDH19 NM_020766 protocadherin 19 PCDH21 NM_033100 protocadherin 21 precursor PCDH9 NM_020403 protocadherin 9 isoform 2 precursor PCDHA1 NM_018900 protocadherin alpha 1 isoform 1 precursor PCDHA10 NM_018901 protocadherin alpha 10 isoform 1 precursor PCDHA1 1 NM_018902 protocadherin alpha 11 isoform 1 precursor PCDHA12 NM_018903 protocadherin alpha 12 isoform 1 precursor PCDHA13 NM_018904 protocadherin alpha 13 isoform 1 precursor PCDHA2 NM_018905 protocadherin alpha 2 isoform 1 precursor PCDHA3 NM_018906 protocadherin alpha 3 isoform I precursor WO 2008/085797 PCT/US2007/089206 PCDHA4 NM_018907 protocadherin alpha 4 isoform 1 precursor PCDHA5 NM_018908 protocadherin alpha 5 isoform 1 precursor PCDHA6 NM 018909 protocadherin alpha 6 isoform I precursor PCDHA7 NM_018910 protocadherin alpha 7 isoform 1 precursor PCDHA8 NM_018911 protocadherin alpha 8 isoform 1 precursor PCDHA9 NM_031857 protocadherin alpha 9 isoform 1 precursor PCDHACl NM_018898 protocadherin alpha subfamily C, 1 isoform 1 PCDHAC2 NM_018899 protocadherin alpha subfamily C, 2 isoform 1 PCGF5 NM_032373 polycomb group ring finger 5 PCID2 NM_018386 PCI domain containing 2 PCMT1 NM_005389 protein-L-isoaspartate (D-aspartate) PCNXL2 NM_014801 pecanex-like 2 PCOLN3 NM_002768 procollagen (type III) N-endopeptidase PCQAP NM_001003891 positive cofactor 2, glutamine/Q-rich-associated PCSK2 NM_002594 proprotein convertase subtilisin/kexin type 2 PCSK6 NM_002570 paired basic amino acid cleaving system 4 PCSK9 NM_174936 proprotein convertase subtilisin/kexin type 9 PCTK2 NM_002595 PCTAIRE protein kinase 2 PCTP NM_021213 phosphatidylcholine transfer protein PCYOX1 NM_016297 prenylcysteine oxidase 1 PDAP1 NM_014891 PDGFA associated protein 1 PDCD1 NM_005018 programmed cell death 1 precursor PDCD11 NM 014976 programmed cell death 11 PDCD4 NM_014456 programmed cell death 4 isoform I PDCD6IP NM_013374 programmed cell death 6 interacting protein PDCD7 NM_005707 programmed cell death 7 PDCL NM_005388 phosducin-like PDDC1 NM_182612 hypothetical protein LOC347862 PDE3B NM_000922 phosphodiesterase 3B, cGMP-inhibited PDE4D NM_006203 cAMP-specific phosphodiesterase 4D PDE7B NM_018945 phosphodiesterase 7B PDGFRA NM_006206 platelet-derived growth factor receptor alpha PDGFRB NM_002609 platelet-derived growth factor receptor beta PDIA6 NM_005742 protein disulfide isomerase-associated 6 PDIKlL NM_152835 PDLIM1 interacting kinase 1 like PDK2 NM_002611 pyruvate dehydrogenase kinase, isoenzyme 2 PDK4 NM_002612 pyruvate dehydrogenase kinase 4 PDLIM2 NM_176871 PDZ and LIM domain 2 isoform 1 PDLIM5 NM_001011513 PDZ and LIM domain 5 isoform b PDPK1 NM_002613 3-phosphoinositide dependent protein kinase-1 PDPN NM_001006624 lung type-I cell membrane-associated PDPR NM_017990 pyruvate dehydrogenase phosphatase regulatory PDRG1 NM_030815 p53 and DNA damage-regulated protein PDXK NM_003681 pyridoxal kinase PDYN NM_024411 beta-neoendorphin-dynorphin preproprotein PDZD2 NM_178140 PDZ domain containing 2 PELI2 NM_021255 pellino 2 PELI3 NM_145065 pellino 3 alpha PEMT NM_007169 phosphatidylethanolamine N-methyltransferase PER3 NM_016831 period 3 PERLD1 NM_033419 CAB2 protein PERP NM_022121 PERP, TP53 apoptosis effector PEX1O NM_002617 peroxisome biogenesis factor 10 isoform 2 WO 2008/085797 PCT/US2007/089206 PEX12 NM_000286 peroxisomal biogenesis factor 12 PEX13 NM_002618 peroxisome biogenesis factor 13 PEX16 NM_057174 peroxisomal biogenesis factor 16 isoform 2 PEX19 NM_002857 peroxisomal biogenesis factor 19 PEX5 NM_000319 peroxisomal biogenesis factor 5 PFKFB2 NM_006212 6-phosphofructo-2-kinase/fructose-2, PFKFB4 NM_004567 6-phosphofructo-2-kinase/fructose-2, PFKL NM_001002021 liver phosphofructokinase isoform a PGAM5 NM_138575 Bcl-XL-binding protein v68 PGD NM_002631 phosphogluconate dehydrogenase PGEA1 NM_001002880 PKD2 interactor, golgi and endoplasmic reticulum PGLS NM 012088 6-phosphogluconolactonase PGM1 NM_002633 phosphoglucomutase 1 PGM2L1 NM_173582 phosphoglucomutase 2-like 1 PHACTR1 NM_030948 phosphatase and actin regulator 1 PHACTR2 NM_014721 phosphatase and actin regulator 2 PHACTR4 NM_023923 phosphatase and actin regulator 4 PHB NM_002634 prohibitin PHF13 NM_153812 PHD finger protein 13 PHF15 NM_015288 PHD finger protein 15 PHF17 NM_024900 Jadel protein short isoform PHF19 NM_015651 PHD finger protein 19 isoform a PHF20 NM_016436 PHD finger protein 20 PHF20L1 NM_016018 PHD finger protein 20-like 1 isoform 1 PHIP NM_017934 pleckstrin homology domain interacting protein PHLDA3 NM_012396 pleckstrin homology-like domain, family A, PHLDB3 NM 198850 pleckstrin homology-like domain, family B, PHLPPL NM_015020 PH domain and leucine rich repeat protein PHOX2B NM_003924 paired-like homeobox 2b PHYHIP NM 014759 phytanoyl-CoA hydroxylase interacting protein PI4K2B NM_018323 phosphatidylinositol 4-kinase type-II beta PI4KII NM_018425 phosphatidylinositol 4-kinase type II PIAS 1 NM_016166 protein inhibitor of activated STAT, 1 PIB5PA NM_001002837 phosphatidylinositol (4,5) bisphosphate PIGA NM_002641 phosphatidylinositol PIGB NM_004855 phosphatidylinositol glycan, class B PIGQ NM_004204 phosphatidylinositol glycan, class Q isoform 2 PIGR NM 002644 polymeric immunoglobulin receptor PIGT NM_015937 phosphatidylinositol glycan, class T precursor PIK3C2B NM_002646 phosphoinositide-3-kinase, class 2, beta PIK3R1 NM_181504 phosphoinositide-3-kinase, regulatory subunit, PIK3R2 NM_005027 phosphoinositide-3-kinase, regulatory subunit 2 PIK3R3 NM_003629 phosphoinositide-3-kinase, regulatory subunit 3 PIK4CB NM_002651 phosphatidylinositol 4-kinase, catalytic, beta PILRB NM_013440 paired immunoglobulin-like type 2 receptor beta PIM1 NM_002648 pim-1 oncogene PIM3 NM_001001852 pim-3 oncogene PIP3-E NM_015553 phosphoinositide-binding protein PIP3-E PIP5KlB NM_001031687 phosphatidylinositol-4-phosphate 5-kinase, type PIP5K1C NM_012398 phosphatidylinositol-4-phosphate 5-kinase, type PIP5K2C NM 024779 phosphatidylinositol-4-phosphate 5-kinase, type PIP5K3 NM_001002881 phosphatidylinositol-3 PISD NM_014338 phosphatidylserine decarboxylase WO 2008/085797 PCT/US2007/089206 PITPNA NM_006224 phosphatidylinositol transfer protein, alpha PKD1 NM_000296 polycystin 1 isoform 2 precursor PKDlL2 NM_182740 polycystin 1-like 2 isoform b PKHD1 NM_138694 polyductin isoform 1 PKLR NM_000298 pyruvate kinase, liver and RBC isoform 1 PKNOX1 NM_004571 PBX/knotted 1 homeobox 1 isoform 1 PKP1 NM_000299 plakophilin 1 isoform lb PLA2G2F NM_022819 phospholipase A2, group IIF PLA2G4D NM_178034 phospholipase A2, group IVD PLAC2 NM 153375 placenta-specific 2 PLAGI NM_002655 pleiomorphic adenoma gene 1 PLAGLI NM_002656 pleiomorphic adenoma gene-like 1 isoform 1 PLCD1 NM_006225 phospholipase C, delta 1 PLCXD1 NM_018390 phosphatidylinositol-specific phospholipase C, X PLCXD3 NM_001005473 phosphatidylinositol-specific phospholipase C, X PLD1 NM_002662 phospholipase Dl, phophatidylcholine-specific PLD2 NM 002663 phospholipase D2 PLDN NM_012388 pallidin PLEKHA1 NM_001001974 pleckstrin homology domain containing, family A PLEKHA5 NM 019012 pleckstrin homology domain containing, family A PLEKHA6 NM 014935 phosphoinositol 3-phosphate-binding protein-3 PLEKHA7 NM_175058 pleckstrin homology domain containing, family A PLEKHB2 NM_017958 pleckstrin homology domain containing, family B PLEKHC1 NM_006832 pleckstrin homology domain containing, family C PLEKHG1 NM_001029884 pleckstrin homology domain containing, family G PLEKHG3 NM_015549 pleckstrin homology domain containing, family G, PLEKHG5 NM 198681 putative NFkB activating protein isoform b PLEKHH1 NM_020715 pleckstrin homology domain containing, family H PLEKHH2 NM_172069 pleckstrin homology domain containing, family H PLEKHJ1 NM_018049 pleckstrin homology domain containing, family J PLEKHK1 NM_145307 pleckstrin homology domain containing, family K PLEKHM1 NM_014798 pleckstrin homology domain containing, family M PLEKHQ1 NM 025201 PH domain-containing protein PLRG1 NM 002669 pleiotropic regulator 1 (PRL1 homolog, PLS1 NM_002670 plastin 1 PLSCR4 NM_020353 phospholipid scramblase 4 PLUNC NM_130852 palate, lung and nasal epithelium carcinoma PLXDC1 NM_020405 plexin domain containing 1 precursor PLXNA1 NM_032242 plexin Al PLXNA2 NM_025179 plexin A2 PLXNB1 NM_002673 plexin BI PLXND1 NM_015103 plexin DI PML NM_033239 promyelocytic leukemia protein isoform 9 PMM1 NM_002676 phosphomannomutase 1 PMM2 NM_000303 phosphomannomutase 2 PMP2 NM_002677 peripheral myelin protein 2 PMP22 NM_000304 peripheral myelin protein 22 PNKD NM 015488 myofibrillogenesis regulator 1 isoform 1 PNLIPRP1 NM_006229 pancreatic lipase-related protein 1 PNMA3 NM_013364 paraneoplastic cancer-testis-brain antigen PNMA5 NM_052926 hypothetical protein LOCI 14824 PNMA6A NM_032882 hypothetical protein LOC84968 PNPO NM 018129 pyridoxine 5'-phosphate oxidase WO 2008/085797 PCT/US2007/089206 PNRC2 NM_017761 proline-rich nuclear receptor coactivator 2 PODN NM_153703 podocan PODXL NM_001018111 podocalyxin-like precursor isoform 1 POFIB NM_024921 premature ovarian failure, 1B POFUTI NM_015352 protein 0-fucosyltransferase 1 isoform 1 POFUT2 NM_015227 protein 0-fucosyltransferase 2 isoform A POLD3 NM_006591 polymerase (DNA directed), delta 3 POLDIP3 NM_032311 DNA polymerase delta interacting protein 3 POLE NM_006231 DNA polymerase epsilon catalytic subunit POLE4 NM_019896 DNA polymerase epsilon subunit 4 POLL NM_013274 polymerase (DNA directed), lambda POLR2D NM_004805 DNA directed RNA polymerase II polypeptide D POLR2E NM_002695 DNA directed RNA polymerase II polypeptide E POLR2G NM_002696 DNA directed RNA polymerase II polypeptide G POLR2J NM_006234 DNA directed RNA polymerase II polypeptide J POLR3B NM_018082 polymerase (RNA) III (DNA directed) polypeptide POLR3D NM_001722 RNA polymerase III 53 kDa subunit RPC4 POLR3F NM_006466 DNA-directed RNA polymerase III39 kDa POM121 NM_172020 nuclear pore membrane protein 121 POMT2 NM_013382 putative protein O-mannosyltransferase POMZP3 NM_012230 POMZP3 fusion protein isoform 1 POU2AFI NM_006235 POU domain, class 2, associating factor 1 POU3F2 NM_005604 POU domain, class 3, transcription factor 2 POU4F1 NM_006237 POU domain, class 4, transcription factor 1 POU4F2 NM_004575 POU domain, class 4, transcription factor 2 POU6F1 NM_002702 POU domain, class 6, transcription factor 1 PPAP2A NM_003711 phosphatidic acid phosphatase type 2A isoform 1 PPAP2B NM_003713 phosphatidic acid phosphatase type 2B PPAP2C NM 003712 phosphatidic acid phosphatase type 2C isoform 1 PPAPDC2 NM_203453 phosphatidic acid phosphatase type 2 domain PPAPDC3 NM_032728 phosphatidic acid phosphatase type 2 domain PPARA NM_001001928 peroxisome proliferative activated receptor, PPARD NM_006238 peroxisome proliferative activated receptor, PPARGC1A NM_013261 peroxisome proliferative activated receptor PPFIA3 NM_003660 PTPRF interacting protein alpha 3 PPFIA4 NM_015053 protein tyrosine phosphatase, receptor type, f PPIE NM_006112 peptidylprolyl isomerase E isoform 1 PPIF NM_005729 peptidylprolyl isomerase F precursor PPIH NM_006347 peptidylprolyl isomerase H PPIL1 NM_016059 peptidylprolyl isomerase-like 1 PPIL2 NM_014337 peptidylprolyl isomerase-like 2 isoform a PPIL4 NM_139126 peptidylprolyl isomerase-like 4 PPL NM_002705 periplakin PPM1A NM_021003 protein phosphatase 1A isoform 1 PPM1D NM_003620 protein phosphatase ID PPM1E NM_014906 protein phosphatase IE PPM1F NM_014634 protein phosphatase IF PPM1L NM_139245 protein phosphatase 1 (formerly 2C)-like PPM1M NM_144641 protein phosphatase IM (PP2C domain containing) PPM2C NM_018444 pyruvate dehydrogenase phosphatase precursor PPME1 NM_016147 protein phosphatase methylesterase-1 PPP1CA NM 001008709 protein phosphatase 1, catalytic subunit, alpha PPP1Rl 1 NM_021959 protein phosphatase 1, regulatory (inhibitor) WO 2008/085797 PCT/US2007/089206 PPPlR12A NM_002480 protein phosphatase 1, regulatory (inhibitor) PPPIR12B NM_002481 protein phosphatase 1, regulatory (inhibitor) PPPIR12C NM 017607 protein phosphatase 1, regulatory subunit 12C PPPIR13B NM_015316 protein phosphatase 1, regulatory (inhibitor) PPPIR14C NM_030949 protein phosphatase 1, regulatory (inhibitor) PPP1R16B NM 015568 protein phosphatase 1 regulatory inhibitor PPPlR1A NM_006741 protein phosphatase 1, regulatory (inhibitor) PPPlR2 NM 006241 protein phosphatase 1, regulatory (inhibitor) PPP1R3B NM_024607 protein phosphatase 1, regulatory (inhibitor) PPP2CA NM_002715 protein phosphatase 2, catalytic subunit, alpha PPP2R1A NM_014225 alpha isoform of regulatory subunit A, protein PPP2R1B NM_002716 beta isoform of regulatory subunit A, protein PPP2R2C NM_020416 gamma isoform of regulatory subunit B55, protein PPP2R2D NM_001003656 protein phosphatase 2, regulatory subunit B, PPP2R4 NM_021131 protein phosphatase 2A, regulatory subunit B' PPP2R5C NM_002719 gamma isoform of regulatory subunit B56, protein PPP3CB NM_021132 protein phosphatase 3 (formerly 2B), catalytic PPP4R1L NM_018498 hypothetical protein LOC55370 PPP6C NM_002721 protein phosphatase 6, catalytic subunit PPRC1 NM_015062 PGC-1 related co-activator PPT1 NM_000310 palmitoyl-protein thioesterase 1 PPT2 NM_005155 palmitoyl-protein thioesterase 2 isoform a PPTC7 NM_139283 T-cell activation protein phosphatase 2C PQLC1 NM_025078 PQ loop repeat containing 1 PRDM12 NM_021619 PR domain containing 12 PRDM16 NM_022114 PR domain containing 16 isoform 1 PRDM2 NM_001007257 retinoblastoma protein-binding zinc finger PRDM4 NM_012406 PR domain containing 4 PREI3 NM_015387 preimplantation protein 3 isoform 1 PRELP NM_002725 proline arginine-rich end leucine-rich repeat PRF1 NM_005041 perforin 1 precursor PRH2 NM_005042 proline-rich protein HaeIII subfamily 2 PRIC285 NM_033405 PPAR-alpha interacting complex protein 285 PRICKLE2 NM 198859 prickle-like 2 PRKAA1 NM_006251 protein kinase, AMP-activated, alpha 1 catalytic PRKAB2 NM_005399 AMP-activated protein kinase beta 2 PRKACA NM_002730 cAMP-dependent protein kinase catalytic subunit PRKAR1A NM_002734 cAMP-dependent protein kinase, regulatory PRKAR2A NM_004157 cAMP-dependent protein kinase, regulatory PRKCA NM_002737 protein kinase C, alpha PRKCBPl NM_012408 protein kinase C binding protein 1 isoform b PRKCD NM_006254 protein kinase C, delta PRKCG NM_002739 protein kinase C, gamma PRKCI NM_002740 protein kinase C, iota PRKCZ NM_001033581 protein kinase C, zeta isoform 2 PRKD2 NM_016457 protein kinase D2 PRKD3 NM_005813 protein kinase D3 PRKG1 NM_006258 protein kinase, cGMP-dependent, type I PRNT NM_177549 prion protein (testis specific) PROO 149 NM_014117 hypothetical protein LOC29035 PROK2 NM_021935 prokineticin 2 ProSAPiP1 NM_014731 ProSAPiP1 protein PROSC NM_007198 proline synthetase co-transcribed homolog WO 2008/085797 PCT/US2007/089206 PRPF38A NM_032864 PRP38 pre-mRNA processing factor 38 (yeast) PRPS2 NM_002765 phosphoribosyl pyrophosphate synthetase 2 PRR13 NM_001005354 hypothetical protein LOC54458 isoform 2 PRR3 NM_025263 proline-rich protein 3 PRRG1 NM_000950 proline rich Gla (G-carboxyglutamic acid) I PRRX1 NM_006902 paired mesoderm homeobox 1 isoform pmx-la PRSS12 NM_003619 neurotrypsin precursor PRSS22 NM_022119 protease, serine, 22 PRSS23 NM_007173 protease, serine, 23 precursor PRSS27 NM_031948 marapsin PRSS33 NM_152891 protease, serine, 33 PRSS7 NM 002772 enterokinase precursor PRX NM_020956 periaxin isoform 1 PSAP NM_002778 prosaposin PSATI NM_021154 phosphoserine aminotransferase isoform 2 PSCA NM_005672 prostate stem cell antigen preproprotein PSCD3 NM_004227 pleckstrin homology, Sec7 and coiled/coil PSD3 NM_015310 ADP-ribosylation factor guanine nucleotide PSD4 NM_012455 pleckstrin and Sec7 domain containing 4 PSKHl NM_006742 protein serine kinase HI PSMB5 NM_002797 proteasome beta 5 subunit PSMD13 NM_002817 proteasome 26S non-ATPase subunit 13 isoform I PSMD7 NM 002811 proteasome 26S non-ATPase subunit 7 PSMD9 NM_002813 proteasome 26S non-ATPase subunit 9 PSME3 NM_005789 proteasome activator subunit 3 isoform 1 PSME4 NM 014614 proteasome (prosome, macropain) activator PSORS1C2 NM_014069 SPRI protein PSRC2 NM 144982 hypothetical protein LOC196441 PTBP1 NM_002819 polypyrimidine tract-binding protein 1 isoform PTCH NM_000264 patched PTDO08 NM_016145 hypothetical protein LOC51398 PTDSS1 NM_014754 phosphatidylserine synthase 1 PTER NM_001001484 phosphotriesterase related PTGER3 NM_198718 prostaglandin E receptor 3, subtype EP3 isoform PTGES2 NM 198939 prostaglandin E synthase 2 isoform 3 PTGFRN NM_020440 prostaglandin F2 receptor negative regulator PTGIR NM_000960 prostaglandin 12 (prostacyclin) receptor (IP) PTGS1 NM 000962 prostaglandin-endoperoxide synthase I isoform 1 PTH NM_000315 parathyroid hormone preproprotein PTHLH NM_198965 parathyroid hormone-like hormone isoform 1 PTK2B NM_004103 PTK2B protein tyrosine kinase 2 beta isoform a PTK6 NM_005975 PTK6 protein tyrosine kinase 6 PTK7 NM_152883 PTK7 protein tyrosine kinase 7 isoform e PTPDC1 NM_152422 protein tyrosine phosphatase domain containing 1 PTPLAD2 NM_001010915 hypothetical protein LOC401494 PTPN18 NM_014369 protein tyrosine phosphatase, non-receptor type PTPN20B NM_015605 protein tyrosine phosphatase, non-receptor type PTPN3 NM_002829 protein tyrosine phosphatase, non-receptor type PTPN4 NM_002830 protein tyrosine phosphatase, non-receptor type PTPN7 NM_002832 protein tyrosine phosphatase, non-receptor type PTPRF NM 002840 protein tyrosine phosphatase, receptor type, F PTPRM NM_002845 protein tyrosine phosphatase, receptor type, M PTPRR NM 002849 protein tyrosine phosphatase, receptor type, R WO 2008/085797 PCT/US2007/089206 PTPRT NM_007050 protein tyrosine phosphatase, receptor type, T PURA NM_005859 purine-rich element binding protein A PURB NM_033224 purine-rich element binding protein B PURG NM_013357 purine-rich element binding protein G isoform A PUSL1 NM_153339 pseudouridylate synthase-like 1 PWWP2 NM_138499 PWWP domain containing 2 PXMP4 NM_007238 peroxisomal membrane protein 4 isoform a PXN NM_002859 paxillin PYCRI NM 006907 pyrroline-5-carboxylate reductase 1 isoform 1 PYCR2 NM_013328 pyrroline-5-carboxylate reductase family, member PYCRL NM_023078 pyrroline-5-carboxylate reductase-like PYY2 NM_021093 peptide YY, 2 (seminalplasmin) QKI NM_206853 quaking homolog, KH domain RNA binding isoform QPRT NM_014298 quinolinate phosphoribosyltransferase QSCN6L1 NM 181701 quiescin Q6-like 1 QTRTD1 NM 024638 queuine tRNA-ribosyltransferase domain RAB10 NM_016131 ras-related GTP-binding protein RAB 10 RABIIFIPI NM_001002814 Rab coupling protein isoform 3 RABi1FIP2 NM_014904 RAB 11 family interacting protein 2 (class I) RABi1FIP3 NM_014700 rabl 1-family interacting protein 3 RABi1FIP4 NM 032932 RAB 11 family interacting protein 4 (class II) RABiiFIP5 NM 015470 RAB 11 family interacting protein 5 (class I) RAB 15 NM_198686 Ras-related protein Rab-15 RAB1A NM_004161 RAB1A, member RAS oncogene family RAB22A NM_020673 RAS-related protein RAB-22A RAB23 NM_016277 Ras-related protein Rab-23 RAB2B NM_032846 RAB2B protein RAB39B NM_171998 RAB39B, member RAS oncogene family RAB3B NM_002867 RAB3B, member RAS oncogene family RAB3D NM_004283 RAB3D, member RAS oncogene family RAB40A NM_080879 RAB40A, member RAS oncogene family RAB40B NM_006822 RAB40B, member RAS oncogene family RAB43 NM_198490 RAB43 protein RAB4B NM_016154 ras-related GTP-binding protein 4b RAB6B NM_016577 RAB6B, member RAS oncogene family RAB6IP2 NM_015064 RAB6-interacting protein 2 isoform alpha RAB8B NM_016530 RAB8B, member RAS oncogene family RAB9A NM_004251 RAB9A, member RAS oncogene family RABACI NM_006423 Rab acceptor 1 RABEP2 NM_024816 rabaptin, RAB GTPase binding effector protein 2 RABL3 NM_173825 RAB, member of RAS oncogene family-like 3 RACGAP1 NM_013277 Rac GTPase activating protein 1 RAD23A NM_005053 UV excision repair protein RAD23 homolog A RAD23B NM 002874 UV excision repair protein RAD23 homolog B RAD50 NM_005732 RAD50 homolog isoform 1 RAD51LI NM_133509 RAD51-like 1 isoform 3 RAD51L3 NM 002878 RAD5 1-like 3 isoform 1 RAD9A NM_004584 RAD9 homolog RAETIG NM_001001788 retinoic acid early transcript IG RAF NM_002880 v-raf-1 murine leukemia viral oncogene homolog RAGE NM_014226 MAPK/MAK/MRK overlapping kinase RAI14 NM 015577 retinoic acid induced 14 RAI17 NM_020338 retinoic acid induced 17 WO 2008/085797 PCT/US2007/089206 RALB NM_002881 v-ral simian leukemia viral oncogene homolog B RALBP1 NM_006788 ralA binding protein 1 RALGPS1 NM_014636 Ral GEF with PH domain and SH3 binding motif 1 RANBP1O NM_020850 RAN binding protein 10 RANBP3 NM_003624 RAN binding protein 3 isoform RANBP3-a RANGAP1 NM_002883 Ran GTPase activating protein 1 RAPIGAP NM_002885 RAP 1, GTPase activating protein 1 RAPIGDS1 NM_021159 RAP 1, GTP-GDP dissociation stimulator I RAP2C NM_021183 RAP2C, member of RAS oncogene family RAPGEF1 NM_005312 guanine nucleotide-releasing factor 2 isoform a RAPGEFL1 NM 016339 Rap guanine nucleotide exchange factor RAPHI NM 213589 Ras association and pleckstrin homology domains RARB NM_000965 retinoic acid receptor, beta isoform 1 RARG NM_000966 retinoic acid receptor, gamma RARRES2 NM_002889 retinoic acid receptor responder (tazarotene RASA3 NM_007368 RAS p21 protein activator 3 RASA4 NM_006989 RAS p21 protein activator 4 RASAL1 NM_004658 RAS protein activator like 1 RASGEFIB NM_152545 RasGEF domain family, member lB RASGEFIC NM_001031799 RasGEF domain family, member i C isoform 2 RASL12 NM_016563 RAS-like, family 12 protein RASSF1 NM_007182 Ras association domain family 1 isoform A RASSF2 NM_014737 Ras association domain family 2 RASSF3 NM_178169 Ras association (RalGDS/AF-6) domain family 3 RASSF4 NM_032023 Ras association domain family 4 isoform a RASSF5 NM_031437 Ras association (RaIGDS/AF-6) domain family 5 RBBP6 NM_006910 retinoblastoma-binding protein 6 isoform 1 RBED1 NM_032213 RNA binding motif and ELMO domain 1 RBJ NM_016544 Ras-associated protein RapI RBL2 NM_005611 retinoblastoma-like 2 (p130) RBM12 NM_006047 RNA binding motif protein 12 RBM12B NM_203390 hypothetical protein LOC389677 RBM16 NM_014892 RNA-binding motif protein 16 RBM19 NM_016196 RNA binding motif protein 19 RBM21 NM_022830 RNA binding motif protein 21 RBM23 NM 018107 hypothetical protein LOC55147 RBM24 NM_153020 hypothetical protein LOC221662 RBM33 NM_001008408 hypothetical protein LOC155435 RBM35B NM_024939 hypothetical protein LOC80004 RBM6 NM_005777 RNA binding motif protein 6 RBM7 NM_016090 RNA binding motif protein 7 RBPMS2 NM_194272 RNA binding protein with multiple splicing 2 RCE1 NM 001032279 prenyl protein peptidase RCE1 isoform 2 RCL1 NM_005772 RNA cyclase homolog RCOR3 NM_018254 REST corepressor 3 RDH13 NM_138412 retinol dehydrogenase 13 (all-trans and 9-cis) RDM1 NM 145654 RAD52 motif 1 isoform 1 RDS NM_000322 retinal degeneration slow protein RECK NM_021111 RECK protein precursor RECQL5 NM_004259 RecQ protein-like 5 isoform 1 REEP1 NM_022912 receptor expression enhancing protein 1 REEP3 NM 001001330 receptor expression enhancing protein 3 RELN NM 005045 reelin isoform a WO 2008/085797 PCT/US2007/089206 RET NM_020975 ret proto-oncogene isoform a REXO1 NM_020695 transcription elongation factor B polypeptide 3 REXO4 NM_020385 XPMC2 prevents mitotic catastrophe 2 homolog RFFL NM_001017368 rififylin RFK NM_018339 riboflavin kinase RFT1 NM_052859 hypothetical protein LOC91869 RFWD2 NM_001001740 ring finger and WD repeat domain 2 isoform d24 RFWD3 NM_018124 ring finger and WD repeat domain 3 RFX4 NM_002920 regulatory factor X4 isoform b RGAG4 NM_001024455 retrotransposon gag domain containing 4 RGL1 NM_015149 ral guanine nucleotide dissociation RGMA NM_020211 RGM domain family, member A RGMB NM_001012761 RGM domain family, member B isoform 1 precursor RGPD5 NM_005054 RANBP2-like and GRIP domain containing 5 isoform RGS11 NM_003834 regulator of G-protein signalling 11 isoform 2 RGS12 NM_002926 regulator of G-protein signalling 12 isoform 2 RGS22 NM_015668 regulator of G-protein signalling 22 RGS3 NM_017790 regulator of G-protein signalling 3 isoform 3 RGS5 NM_003617 regulator of G-protein signalling 5 RGS9BP NM_207391 RGS9 anchor protein RHBDL3 NM_138328 rhomboid, veinlet-like 3 RHBG NM_020407 Rhesus blood group, B glycoprotein RHOB NM_004040 ras homolog gene family, member B RHOBTB2 NM_015178 Rho-related BTB domain containing 2 RHOD NM_014578 ras homolog D RHOJ NM_020663 TC10-like Rho GTPase RHOU NM_021205 ras homolog gene family, member U RHPN2 NM_033103 rhophilin-like protein RIC8A NM 021932 resistance to inhibitors of cholinesterase 8 RICTOR NM_152756 rapamycin-insensitive companion of mTOR RIFI NM_018151 RAP1 interacting factor 1 RIMBP2 NM_015347 RIM-binding protein 2 RIMS3 NM_014747 regulating synaptic membrane exocytosis 3 RIPK4 NM_020639 ankyrin repeat domain 3 RIPK5 NM_015375 receptor interacting protein kinase 5 isoform 1 RKHD2 NM_016626 ring finger and KH domain containing 2 RKHD3 NM_032246 ring finger and KH domain containing 3 RNASEH1 NM_002936 ribonuclease HI RNF1O NM_014868 ring finger protein 10 RNF111 NM 017610 ring finger protein 111 RNF125 NM_017831 ring finger protein 125 RNF138 NM_016271 ring finger protein 138 isoform 1 RNF144 NM_014746 ring finger protein 144 RNF149 NM_173647 ring finger protein 149 RNF165 NM_152470 ring finger protein 165 RNF166 NM_178841 ring finger protein 166 RNF183 NM_145051 ring finger protein 183 RNF190 NM_152598 hypothetical protein LOC162333 RNF24 NM_007219 ring finger protein 24 RNF31 NM 017999 ring finger protein 31 RNF38 NM_022781 ring finger protein 38 isoform 1 RNF39 NM_025236 HZFwl protein isoform 1 RNF41 NM_005785 ring finger protein 41 isoform 1 WO 2008/085797 PCT/US2007/089206 RNF43 NM_017763 ring finger protein 43 RNF44 NM_014901 ring finger protein 44 RNF8 NM_003958 ring finger protein 8 isoform 1 RNGTT NM_003800 RNA guanylyltransferase and 5'-phosphatase RNH1 NM_002939 ribonuclease/angiogenin inhibitor RNMT NM_003799 RNA (guanine-7-) methyltransferase RNPCl NM_017495 RNA-binding region containing protein 1 isoform RNPS1 NM_006711 RNA-binding protein Si, serine-rich domain ROBO4 NM_019055 roundabout homolog 4, magic roundabout ROGDI NM_024589 leucine zipper domain protein RP13-15M17.2 NM_001010866 hypothetical protein LOC199953 RP1-32F7.2 NM 173698 hypothetical protein LOC286499 RP3-473B4.1 NM_138819 hypothetical protein LOC159091 RPH3AL NM_006987 rabphilin 3A-like (without C2 domains) RPL10 NM_006013 ribosomal protein L10 RPL28 NM_000991 ribosomal protein L28 RPL32 NM 000994 ribosomal protein L32 RPP14 NM 007042 ribonuclease P l4kDa subunit RPP25 NM 017793 ribonuclease P 25kDa subunit RPRM NM 019845 reprimo, TP53 dependant G2 arrest mediator RPRML NM 203400 reprimo-like RPS23 NM_001025 ribosomal protein S23 RPS6KA3 NM_004586 ribosomal protein S6 kinase, 90kDa, polypeptide RPS6KA5 NM_004755 ribosomal protein S6 kinase, 90kDa, polypeptide RPS6KB1 NM_003161 ribosomal protein S6 kinase, 70kDa, polypeptide RPS6KB2 NM_001007071 ribosomal protein S6 kinase, 70kDa, polypeptide RPUSD1 NM_058192 RNA pseudouridylate synthase domain containing RPUSD4 NM_032795 RNA pseudouridylate synthase domain containing RRAGA NM_006570 Ras-related GTP binding A RRAGC NM_022157 Ras-related GTP binding C RREB1 NM_001003698 ras responsive element binding protein 1 isoform RRH NM_006583 peropsin RRP22 NM_001007279 RAS-related on chromosome 22 isoform b RS1 NM_000330 X-linked juvenile retinoschisis protein RSBN1 NM_018364 round spermatid basic protein 1 RSNL2 NM_024692 restin-like 2 RSPO2 NM_178565 R-spondin family, member 2 RSPO3 NM_032784 thrombospondin, type I, domain containing 2 RSU1 NM_012425 ras suppressor protein 1 isoform 1 RTEL1 NM 032957 regulator of telomere elongation helicase 1 RTF1 NM_015138 Pafl/RNA polymerase II complex component RTN2 NM_206902 reticulon 2 isoform D RTN3 NM_006054 reticulon 3 isoform a RTN4 NM 007008 reticulon 4 isoform C RTN4RL1 NM_178568 reticulon 4 receptor-like 1 RUNX1 NM_001001890 runt-related transcription factor 1 isoform b RUNX1T1 NM_004349 acute myelogenous leukemia 1 translocation I RUTBC1 NM_014853 RUN and TBCI domain containing 1 RXRA NM_002957 retinoid X receptor, alpha RYBP NM_012234 RING 1 and YYl binding protein S100A5 NM_002962 S100 calcium binding protein A5 S100A7Ll NM 176823 S100 calcium binding protein A7-like 1 SACMlL NM_014016 suppressor of actin 1 WO 2008/085797 PCT/US2007/089206 SAE1 NM_005500 SUMO-1 activating enzyme subunit 1 SALL2 NM_005407 sal-like 2 SALL3 NM 171999 sal-like 3 SALL4 NM_020436 sal-like 4 SAMD10 NM_080621 sterile alpha motif domain containing 10 SAPS2 NM_014678 hypothetical protein LOC9701 SAPS3 NM_018312 SAPS domain family, member 3 SARMI NM_015077 sterile alpha and TIR motif containing 1 SAT NM_002970 spermidine/spermine Ni -acetyltransferase SATB2 NM_015265 SATB family member 2 SAVI NM_021818 WW45 protein SBF1 NM_002972 SET binding factor 1 isoform a SCAMP1 NM_004866 secretory carrier membrane protein 1 isoform 1 SCAMP4 NM_079834 secretory carrier membrane protein 4 SCAMP5 NM_138967 secretory carrier membrane protein 5 SCAND2 NM_022050 SCAN domain-containing protein 2 isoform 1 SCARBI NM_005505 scavenger receptor class B, member I SCARF1 NM_145349 scavenger receptor class F, member 1 isoform 2 SCCPDH NM_016002 saccharopine dehydrogenase (putative) SCG3 NM_013243 secretogranin III SCMH1 NM 001031694 sex comb on midleg homolog 1 isoform 1 SCML4 NM_198081 sex comb on midleg-like 4 SCN2B NM_004588 sodium channel, voltage-gated, type II, beta SCN3A NM_006922 sodium channel, voltage-gated, type III, alpha SCN4A NM_000334 voltage-gated sodium channel type 4 alpha SCN4B NM_174934 sodium channel, voltage-gated, type IV, beta SCN5A NM 000335 voltage-gated sodium channel type V alpha SCOC NM_032547 short coiled-coil protein SCOTIN NM 016479 scotin SCRN1 NM_014766 secernin 1 SDC1 NM_001006946 syndecan 1 precursor SDCBP2 NM_015685 syndecan binding protein 2 isoform b SDHC NM_003001 succinate dehydrogenase complex, subunit C SEC14L1 NM 003003 SEC14 (S. cerevisiae)-like 1 isoform a SEC14L4 NM_174977 SEC l4p-like protein TAP3 SEC22C NM_004206 SEC22 vesicle trafficking protein homolog C SEC61A1 NM_013336 Sec6l alpha I subunit SECISBP2 NM_024077 SECIS binding protein 2 SEH1L NM_001013437 sec 13-like protein isoform 1 SEL1L NM_005065 sel-1 suppressor of lin-12-like SELE NM_000450 selectin E precursor SELENBP1 NM_003944 selenium binding protein 1 SELI NM 033505 selenoprotein I SELO NM_031454 selenoprotein 0 SELPLG NM_003006 selectin P ligand SELS NM_018445 selenoprotein S SEMA3B NM_001005914 semaphorin 3B isoform 2 precursor SEMA3D NM_152754 semaphorin 3D SEMA3E NM_012431 semaphorin 3E SEMA3G NM_020163 semaphorin sem2 SEMA4B NM 020210 semaphorin 4B precursor SEMA4F NM 004263 semaphorin W SEMA5A NM 003966 semaphorin 5A WO 2008/085797 PCT/US2007/089206 SEMA5B NM_001031702 semaphorin 5B isoform 1 SEMA6A NM 020796 sema domain, transmembrane domain (TM), and SEMA6B NM 032108 semaphorin 6B isoform 3 precursor SEMA6D NM_020858 semaphorin 6D isoform 1 precursor SEMA7A NM_003612 semaphorin 7A SENPI NM_014554 sentrin/SUMO-specific protease 1 SENP2 NM_021627 SUMOl/sentrin/SMT3 specific protease 2 SEPN1 NM_020451 selenoprotein N, 1 isoform 1 precursor SEPT11 NM_018243 septin 1I SEPT2 NM 001008491 septin 2 SEPT3 NM_019106 septin 3 isoform B SEPT9 NM_006640 septin 9 SEPW1 NM_003009 selenoprotein W, 1 SERACI NM_032861 serine active site containing 1 SERBP1 NM_001018067 SERPINE1 mRNA binding protein 1 isoform 1 SERHL NM_170694 serine hydrolase-like SERINC2 NM_178865 tumor differentially expressed 2-like SERPINA10 NM_016186 serine (or cysteine) proteinase inhibitor, clade SERPINB13 NM_012397 serine (or cysteine) proteinase inhibitor, clade SERPINB2 NM_002575 serine (or cysteine) proteinase inhibitor, clade SERPINB7 NM_003784 serine (or cysteine) proteinase inhibitor, clade SERPINB9 NM_004155 serine (or cysteine) proteinase inhibitor, clade SERPINE1 NM_000602 plasminogen activator inhibitor-I SERPINF2 NM_000934 alpha-2-plasmin inhibitor SERPING1 NM_000062 complement component 1 inhibitor precursor SESNI NM_014454 sestrin 1 SESN2 NM_031459 sestrin 2 SETD3 NM_032233 hypothetical protein LOC84193 isoform a SETD4 NM_001007258 hypothetical protein LOC54093 isoform b SF1 NM_201997 splicing factor 1 isoform 4 SF3A1 NM_001005409 splicing factor 3a, subunit 1, 120kDa isoform 2 SF3A3 NM_006802 splicing factor 3a, subunit 3 SF4 NM_021164 splicing factor 4 isoform b SFRS 11 NM_004768 splicing factor p54 SFRS12 NM 139168 splicing factor, arginine/serine-rich 12 SFRS16 NM_007056 splicing factor, arginine/serine-rich 16 SFRS2 NM_003016 splicing factor, arginine/serine-rich 2 SFRS2IP NM_004719 splicing factor, arginine/serine-rich 2, SFRS5 NM_006925 splicing factor, arginine/serine-rich 5 SFRS8 NM_152235 splicing factor, arginine/serine-rich 8 isoform SFT2D3 NM 032740 SFT2 domain containing 3 SFTPB NM_000542 surfactant, pulmonary-associated protein B SFXN1 NM_022754 sideroflexin 1 SFXN2 NM_178858 sideroflexin 2 SFXN3 NM 030971 sideroflexin 3 SFXN5 NM 144579 sideroflexin 5 SGCA NM_000023 sarcoglycan, alpha (50kDa dystrophin-associated SGCD NM_000337 delta-sarcoglycan isoform 1 SGK NM_005627 serum/glucocorticoid regulated kinase SGK2 NM_016276 serum/glucocorticoid regulated kinase 2 isoform SGK3 NM_001033578 serum/glucocorticoid regulated kinase 3 isoform SH2D2A NM_003975 SH2 domain protein 2A SH2D3C NM_170600 SH2 domain containing 3C isoform 2 WO 2008/085797 PCT/US2007/089206 SH3BGRL2 NM_031469 SH3 domain binding glutamic acid-rich protein SH3BP2 NM_003023 SH3-domain binding protein 2 SH3BP4 NM_014521 SH3-domain binding protein 4 SH3BP5L NM_030645 SH3-binding domain protein 5-like SH3GL2 NM 003026 SH3-domain GRB2-like 2 SH3PX3 NM_153271 SH3 and PX domain containing 3 SH3PXD2B NM_001017995 SH3 and PX domains 2B SHANK2 NM_012309 SH3 and multiple ankyrin repeat domains 2 SHC3 NM_016848 src homology 2 domain containing transforming SHF NM_138356 hypothetical protein LOC90525 SHOC2 NM_007373 soc-2 suppressor of clear homolog SHOX NM_006883 short stature homeobox isoform b SHOX2 NM_003030 short stature homeobox 2 isoform b SHRM NM_020859 shroom SIAH1 NM 001006610 seven in absentia homolog 1 isoform b SIAHBP1 NM 014281 fuse-binding protein-interacting repressor SIDT1 NM_017699 SID1 transmembrane family, member 1 SIM2 NM_005069 single-minded homolog 2 long isoform SIPA1L2 NM_020808 signal-induced proliferation-associated 1 like SIRPA NM 080792 signal-regulatory protein alpha precursor SIRPB1 NM_006065 signal-regulatory protein beta 1 precursor SIRT4 NM_012240 sirtuin 4 SIRT5 NM_031244 sirtuin 5 isoform 2 SIX4 NM_017420 sine oculis homeobox homolog 4 SKI NM_003036 v-ski sarcoma viral oncogene homolog SKIP NM_030623 sphingosine kinase type 1-interacting protein SLC11A2 NM_000617 solute carrier family 11 (proton-coupled SLC12A2 NM_001046 solute carrier family 12 SLC12A5 NM_020708 solute carrier family 12 member 5 SLC12A7 NM_006598 solute carrier family 12 (potassium/chloride SLC12A8 NM_024628 solute carrier family 12, member 8 SLC13AI NM_022444 solute carrier family 13 (sodium/sulfate SLC13A3 NM_001011554 solute carrier family 13 member 3 isoform b SLC13A5 NM 177550 solute carrier family 13 (sodium-dependent SLC15A4 NM_145648 solute carrier family 15, member 4 SLC16A14 NM_152527 solute carrier family 16 (monocarboxylic acid SLC16A3 NM_004207 solute carrier family 16, member 3 SLC16A8 NM_013356 solute carrier family 16, member 8 SLC18Al NM 003053 solute carrier family 18 (vesicular monoamine), SLC18A3 NM_003055 solute carrier family 18 (vesicular SLC19A2 NM_006996 solute carrier family 19, member 2 SLC1A2 NM_004171 solute carrier family 1, member 2 SLC20A2 NM_006749 solute carrier family 20, member 2 SLC22A13 NM_004256 organic cation transporter like 3 SLC22A15 NM 018420 solute carrier family 22 (organic cation SLC22A17 NM_016609 solute carrier family 22 (organic cation SLC22A2 NM_003058 solute carrier family 22 member 2 isoform a SLC22A7 NM_153320 solute carrier family 22 member 7 isoform b SLC24A1 NM_004727 solute carrier family 24 SLC24A3 NM_020689 solute carrier family 24 SLC24A4 NM_153646 solute carrier family 24 member 4 isoform I SLC24A6 NM_024959 solute carrier family 24 member 6 SLC25A12 NM 003705 solute carrier family 25 (mitochondrial carrier, WO 2008/085797 PCT/US2007/089206 SLC25A15 NM_014252 solute carrier family 25 (mitochondrial carrier; SLC25A19 NM_021734 solute carrier family 25 (mitochondrial SLC25A2 NM_031947 solute carrier family 25 member 2 SLC25A22 NM_024698 mitochondrial glutamate carrier 1 SLC25A29 NM_152333 solute carrier family 25, member 29 isoform a SLC25A3 NM_213612 solute carrier family 25 member 3 isoform c SLC25A34 NM_207348 solute carrier family 25, member 34 SLC25A35 NM_201520 solute carrier family 25, member 35 SLC26AI NM_022042 solute carrier family 26, member I isoform a SLC26A10 NM_001018084 solute carrier family 26, member 10 isoform 1 SLC26A2 NM 000112 solute carrier family 26 member 2 SLC26A4 NM_000441 pendrin SLC28Al NM_201651 solute carrier family 28 (sodium-coupled SLC29A2 NM_001532 solute carrier family 29 (nucleoside SLC2A14 NM_153449 glucose transporter 14 SLC2A3 NM_006931 solute carrier family 2 (facilitated glucose SLC2A4 NM_001042 glucose transporter 4 SLC2A8 NM_014580 solute carrier family 2, (facilitated glucose SLC30A10 NM_001004433 solute carrier family 30 (zinc transporter), SLC3OA4 NM_013309 solute carrier family 30 (zinc transporter), SLC30A8 NM_173851 solute carrier family 30 member 8 SLC31A1 NM_001859 solute carrier family 31 (copper transporters), SLC35A4 NM_080670 solute carrier family 35, member A4 SLC35B2 NM_178148 solute carrier family 35, member B2 SLC35C1 NM_018389 solute carrier family 35, member C1 SLC35E1 NM_024881 solute carrier family 35, member E l SLC36A1 NM_078483 solute carrier family 36 member 1 SLC36A2 NM_181776 solute carrier family 36 (proton/amino acid SLC37A2 NM_198277 solute carrier family 37 (glycerol-3-phosphate SLC38A3 NM_006841 solute carrier family 38, member 3 SLC38A4 NM_018018 solute carrier family 38, member 4 SLC39Al NM_014437 solute carrier family 39 (zinc transporter), SLC39AlO NM_020342 solute carrier family 39 (zinc transporter), SLC39A7 NM_006979 solute carrier family 39 (zinc transporter), SLC39A9 NM_018375 solute carrier family 39 (zinc transporter), SLC3A1 NM_000341 solute carrier family 3, member 1 SLC41A2 NM_032148 solute carrier family 41, member 2 SLC41A3 NM_001008487 solute carrier family 41, member 3 isoform 4 SLC43A1 NM_003627 solute carrier family 43, member 1 SLC44A1 NM_080546 CDW92 antigen isoform 2 SLC44A2 NM_020428 CTL2 protein SLC45A2 NM_001012509 membrane-associated transporter protein isoform SLC45A3 NM_033102 prostein SLC4A4 NM_003759 solute carrier family 4, sodium bicarbonate SLC4A7 NM_003615 solute carrier family 4, sodium bicarbonate SLC6A1 NM_003042 solute carrier family 6 (neurotransmitter SLC6A14 NM_007231 solute carrier family 6 (amino acid SLC6A17 NM_001010898 solute carrier family 6, member 17 SLC6A2 NM_001043 solute carrier family 6 member 2 SLC6A4 NM_001045 solute carrier family 6 member 4 SLC6A6 NM_003043 solute carrier family 6 (neurotransmitter SLC6A8 NM 005629 solute carrier family 6 (neurotransmitter SLC6A9 NM_001024845 solute carrier family 6 member 9 isoform 3 WO 2008/085797 PCT/US2007/089206 SLC7A1 NM_003045 solute carrier family 7 (cationic amino acid SLC7A2 NM 001008539 solute carrier family 7, member 2 isoform 1 SLC7A5 NM_003486 solute carrier family 7 (cationic amino acid SLC7A6 NM_003983 solute carrier family 7 (cationic amino acid SLC8A3 NM_182933 solute carrier family 8 member 3 isoform E SLC9Al NM_003047 solute carrier family 9, isoform Al SLC9A3R2 NM_004785 solute carrier family 9 isoform 3 regulator 2 SLC9A5 NM_004594 solute carrier family 9 (sodium/hydrogen SLC9A6 NM_006359 solute carrier family 9 (sodium/hydrogen SLC9A8 NM_015266 Na+/H+ exchanger isoform 8 SLCO2A1 NM_005630 solute carrier organic anion transporter family, SLCO4C1 NM_180991 solute carrier organic anion transporter family, SLFN11 NM_152270 schlafen family member 11 SLFN13 NM_144682 schlafen family member 13 SLFNL1 NM_144990 hypothetical protein LOC200172 SLITRK1 NM_052910 slit and trk like 1 protein SLITRK2 NM_032539 SLIT and NTRK-like family, member 2 SLITRK6 NM_032229 slit and trk like 6 SLN NM_003063 sarcolipin SLURP1 NM 020427 ARS component B precursor SMAD2 NM_001003652 Sma- and Mad-related protein 2 SMAD3 NM_005902 MAD, mothers against decapentaplegic homolog 3 SMAD5 NM 001001419 SMAD, mothers against DPP homolog 5 SMAD7 NM_005904 MAD, mothers against decapentaplegic homolog 7 SMAFI NM_001018082 small adipocyte factor 1 SMAP1 NM_021940 stromal membrane-associated protein SMAP1L NM_022733 stromal membrane-associated protein 1-like SMARCA1 NM 003069 SWI/SNF-related matrix-associated SMARCD2 NM 003077 SWI/SNF-related matrix-associated SMC1L1 NM 006306 SMC1 structural maintenance of chromosomes SMC6L1 NM_024624 SMC6 protein SMCR8 NM_144775 Smith-Magenis syndrome chromosome region, SMG5 NM_015327 Estl p-like protein B SMG6 NM_017575 Smg-6 homolog, nonsense mediated mRNA decay SMPD1 NM_000543 sphingomyelin phosphodiesterase 1, acid SMPD3 NM_018667 sphingomyelin phosphodiesterase 3, neutral SMURFI NM_020429 Smad ubiquitination regulatory factor 1 isoform SMURF2 NM_022739 SMAD specific E3 ubiquitin protein ligase 2 SMYD1 NM_198274 SET and MYND domain containing 1 SMYD4 NM_052928 SET and MYND domain containing 4 SMYD5 NM_006062 SMYD family member 5 SNAP23 NM 003825 synaptosomal-associated protein 23 isoform SNAP25 NM_003081 synaptosomal-associated protein 25 isoform SNCG NM_003087 synuclein, gamma (breast cancer-specific protein SNFILK NM_173354 SNF1-like kinase SNF1LK2 NM 015191 SNF1-like kinase 2 SNIP1 NM_024700 Smad nuclear interacting protein SNN NM 003498 Stannin SNPH NM_014723 syntaphilin SNRK NM 017719 SNF related kinase SNRPA1 NM_003090 small nuclear ribonucleoprotein polypeptide A' SNRPC NM_003093 small nuclear ribonucleoprotein polypeptide C SNRPD1 NM_006938 small nuclear ribonucleoprotein D1 polypeptide WO 2008/085797 PCT/US2007/089206 SNTB2 NM_130845 basic beta 2 syntrophin isoform b SNURF NM_005678 SNRPN upstream reading frame protein SNX1 NM_003099 sorting nexin 1 isoform a SNX11 NM 013323 sorting nexin 11 SNX16 NM_022133 sorting nexin 16 isoform a SNX19 NM_014758 sorting nexin 19 SNX6 NM_021249 sorting nexin 6 isoform a SNX9 NM_016224 sorting nexin 9 SOCS5 NM_014011 suppressor of cytokine signaling 5 SOCS6 NM_004232 suppressor of cytokine signaling 6 SOD3 NM 003102 superoxide dismutase 3, extracellular SON NM_032195 SON DNA-binding protein isoform B SORBS1 NM_015385 sorbin and SH3 domain containing 1 isoform 2 SORBS2 NM_003603 sorbin and SH3 domain containing 2 isoform 1 SORCS1 NM_001013031 SORCS receptor 1 isoform b SORCS2 NM020777 VPS10 domain receptor protein SORCS 2 SORTI NM_002959 sortilin 1 preproprotein SOST NM_025237 sclerostin precursor SOX1 NM_005986 SRY (sex determining region Y)-box 1 SOXi NM003108 SRY-box 11 SOX13 NM005686 SRY-box 13 SOX3 NM_005634 SRY (sex determining region Y)-box 3 SOX4 NM 003107 SRY (sex determining region Y)-box 4 SOX5 NM_006940 SRY (sex determining region Y)-box 5 isoform a SOX9 NM_000346 transcription factor SOX9 SP5 NM_001003845 Sp5 transcription factor SP8 NM_182700 Sp8 transcription factor isoform 1 SPATA18 NM_145263 spermatogenesis associated 18 homolog SPATA21 NM_198546 spermatogenesis associated 21 SPATA3 NM_139073 testis and spermatogenesis cell apoptosis SPDEF NM_012391 SAM pointed domain containing ets transcription SPEN NM_015001 spen homolog, transcriptional regulator SPFH2 NM_007175 SPFH domain family, member 2 isoform 1 SPG20 NM_015087 spartin SPG7 NM_199367 paraplegin isoform 2 SPHK2 NM_020126 sphingosine kinase type 2 isoform SPINT2 NM_021102 serine protease inhibitor, Kunitz type, 2 SPIRE2 NM_032451 spire homolog 2 SPN NM_001030288 sialophorin SPOCK2 NM_014767 sparc/osteonectin, cwcv and kazal-like domains SPON2 NM_012445 spondin 2, extracellular matrix protein SPP2 NM_006944 secreted phosphoprotein 2, 24kDa SPPL2B NM_152988 signal peptide peptidase-like 2B isoform 2 SPPL3 NM_139015 SPPL3 protein SPREDI NM_152594 sprouty-related protein 1 with EVH-1 domain SPRN NM_001012508 shadow of prion protein SPRR1B NM_003125 small proline-rich protein lB SPRY3 NM_005840 sprouty homolog 3 SPRY4 NM_030964 sprouty homolog 4 SPRYD3 NM_032840 hypothetical protein LOC84926 SPSB2 NM_032641 SPRY domain-containing SOCS box protein SSB-2 SPSB3 NM_080861 SPRY domain-containing SOCS box protein SSB-3 SPSB4 NM 080862 SPRY domain-containing SOCS box protein SSB-4 WO 2008/085797 PCT/US2007/089206 SPTAN1 NM_003127 spectrin, alpha, non-erythrocytic 1 SPTB NM 001024858 spectrin beta isoform a SPTBN2 NM_006946 spectrin, beta, non-erythrocytic 2 SPTLCl NM 006415 serine palmitoyltransferase subunit 1 isoform a SPTY2D1 NM_194285 hypothetical protein LOC144108 SRC NM_005417 proto-oncogene tyrosine-protein kinase SRC SRD5A2 NM_000348 3-oxo-5 alpha-steroid 4-dehydrogenase 2 SREBF1 NM_001005291 sterol regulatory element binding transcription SRP72 NM_006947 signal recognition particle 72kDa SRPK1 NM_003137 SFRS protein kinase 1 SRPR NM_003139 signal recognition particle receptor ('docking SRPRB NM_021203 signal recognition particle receptor, beta SRPX NM_006307 sushi-repeat-containing protein, X-linked SRXN1 NM_080725 sulfiredoxin 1 homolog SSH3 NM_017857 slingshot homolog 3 isoform 1 SSR1 NM_003144 signal sequence receptor, alpha SSRP1 NM 003146 structure specific recognition protein 1 SSU72 NM_014188 Ssu72 RNA polymerase II CTD phosphatase homolog ST3GAL4 NM_006278 ST3 beta-galactoside alpha-2,3-sialyltransferase ST3GAL5 NM_003896 sialyltransferase 9 ST5 NM_005418 suppression of tumorigenicity 5 isoform 1 ST6GAL1 NM_003032 sialyltransferase 1 isoform a ST7L NM_017744 suppression of tumorigenicity 7-like isoform 1 ST8SIA3 NM_015879 ST8 alpha-N-acetyl-neuraminide ST8SIA5 NM_013305 ST8 alpha-N-acetyl-neuraminide STAC2 NM_198993 SH3 and cysteine rich domain 2 STARD13 NM_052851 START domain containing 13 isoform gamma STARD3 NM_006804 steroidogenic acute regulatory protein related STAT3 NM_003150 signal transducer and activator of transcription STAT5B NM 012448 signal transducer and activator of transcription STCl NM_003155 stanniocalcin 1 precursor STEAP2 NM_152999 six transmembrane epithelial antigen of the STEAP3 NM_001008410 dudulin 2 isoform b STIMI NM_003156 stromal interaction molecule 1 precursor STIM2 NM_020860 stromal interaction molecule 2 STIP 1 NM_006819 stress-induced-phosphoprotein 1 STK10 NM_005990 serine/threonine kinase 10 STK 1I NM_000455 serine/threonine protein kinase 11 STK17A NM_004760 serine/threonine kinase 17a STK19 NM_004197 serine/threonine kinase 19 isoform 1 STK32B NM_018401 serine/threonine kinase 32B STK32C NM_173575 serine/threonine kinase 32C STK33 NM_030906 serine/threonine kinase 33 STK35 NM_080836 serine/threonine kinase 35 STK38 NM 007271 serine/threonine kinase 38 STK38L NM_015000 serine/threonine kinase 38 like STOMLI NM_004809 stomatin (EPB72)-like I STONI NM_006873 stonin 1 STOX2 NM 020225 storkhead box 2 STX16 NM_001001433 syntaxin 16 isoform a STX17 NM_017919 syntaxin 17 STX1A NM_004603 syntaxin 1A (brain) STX3 NM 004177 syntaxin 3A WO 2008/085797 PCT/US2007/089206 STX5 NM_003164 syntaxin 5 STX6 NM_005819 syntaxin 6 STXBP1 NM_001032221 syntaxin binding protein 1 isoform b STXBP3 NM 007269 syntaxin binding protein 3 STXBP4 NM_178509 syntaxin binding protein 4 STXBP5 NM_139244 tomosyn SUFU NM_016169 suppressor of fused SUHW3 NM_017666 suppressor of hairy wing homolog 3 SUHW4 NM_001002843 suppressor of hairy wing homolog 4 isoform 2 SULT4A1 NM_014351 sulfotransferase family 4A, member 1 SUMO3 NM_006936 small ubiquitin-like modifier protein 3 SUPT16H NM 007192 chromatin-specific transcription elongation SUPT6H NM_003170 suppressor of Ty 6 homolog SUPT7L NM_014860 SPTF-associated factor 65 gamma SURF4 NM_033161 surfeit 4 SURF5 NM_133640 surfeit 5 isoform b SUSDI NM 022486 sushi domain containing 1 SUV420H1 NM_016028 suppressor of variegation 4-20 homolog 1 isoform SUV420H2 NM_032701 suppressor of variegation 4-20 homolog 2 SUZ12 NM_015355 joined to JAZF1 SVH NM 031905 SVH protein SVIL NM 003174 supervillin isoform 1 SWAP70 NM_015055 SWAP-70 protein SYBLI NM_005638 synaptobrevin-like I SYDE1 NM_033025 synapse defective 1, Rho GTPase, homolog 1 SYN2 NM_003178 synapsin II isoform IIb SYNE1 NM_015293 nesprin 1 isoform beta SYNGRI NM_004711 synaptogyrin 1 isoform la SYNGR3 NM_004209 synaptogyrin 3 SYNJl NM_003895 synaptojanin 1 isoform a SYPLI NM_006754 synaptophysin-like 1 isoform a SYT1O NM_198992 synaptotagmin 10 SYT12 NM_177963 synaptotagmin XII SYT15 NM 031912 synaptotagmin XV isoform a SYT3 NM_032298 synaptotagmin 3 SYT4 NM 020783 synaptotagmin IV SYT6 NM_205848 synaptotagmin VI SYT8 NM_138567 synaptotagmin VIII SYTL2 NM_032379 synaptotagmin-like 2 isoform b SYTL4 NM 080737 synaptotagmin-like 4 (granuphilin-a) TAB3 NM_152787 TAKI-binding protein 3 isoform I TACC1 NM_006283 transforming, acidic coiled-coil containing TAF15 NM_003487 TBP-associated factor 15 isoform 2 TAFIC NM_005679 TBP-associated factor 1C isoform 1 TAF5 NM 006951 TBP-associated factor 5 TAF7 NM 005642 TATA box-binding protein-associated factor 2F TAF7L NM_024885 TATA box binding protein-associated factor, RNA TAF9B NM_015975 transcription associated factor 9B TAGLN2 NM_003564 transgelin 2 TAL1 NM_ 003189 T-cell acute lymphocytic leukemia 1 TAOK1 NM 020791 TAO kinase 1 TAP2 NM_000544 transporter 2, ATP-binding cassette, sub-family TAPBP NM_003190 tapasin isoform 1 precursor WO 2008/085797 PCT/US2007/089206 TARBP1 NM_005646 TAR RNA binding protein 1 TARBP2 NM_004178 TAR RNA binding protein 2 isoform b TASPI NM_017714 taspase 1 TAT NM_000353 tyrosine aminotransferase TAX1BP3 NM_014604 TaxI (human T-cell leukemia virus type I) TAZ NM_000116 tafazzin isoform 1 TBClD1 NM_015173 TBC1 (tre-2/USP6, BUB2, cdc16) domain family, TBC1D10B NM_015527 TBC1 domain family, member 1OB TBC1D13 NM_018201 TBC1 domain family, member 13 TBC1D14 NM_020773 TBC1 domain family, member 14 TBC1D19 NM_018317 TBC1 domain family, member 19 TBC1D22A NM_014346 TBC1 domain family, member 22A TBClD22B NM_017772 TBC1 domain family, member 22B TBClD2B NM_015079 TBC1 domain family, member 2B TBC1D3C NM_001001418 TBC1 domain family member 3C TBC1D8 NM 007063 TBC1 domain family, member 8 TBC1D9 NM_015130 hypothetical protein LOC23158 TBCC NM 003192 beta-tubulin cofactor C TBCCD1 NM_018138 TBCC domain containing 1 TBK1 NM_013254 TANK-binding kinase 1 TBLIX NM 005647 transducin beta-like IX TBLIXR1 NM 024665 nuclear receptor co-repressor/HDAC3 complex TBL2 NM_012453 transducin (beta)-like 2 TBP NM_003194 TATA box binding protein TBPL1 NM_004865 TBP-like 1 TBRG1 NM_032811 transforming growth factor beta regulator 1 TBX1 NM_005992 T-box 1 isoform B TBX2 NM_005994 T-box 2 TBX6 NM 004608 T-box 6 isoform 1 TCAP NM_003673 telethonin TCEB2 NM_007108 elongin B isoform a TCF1 NM_000545 transcription factor 1, hepatic TCF21 NM_198392 transcription factor 21 TCF3 NM_003200 transcription factor 3 TCF7 NM_003202 transcription factor 7 (T-cell specific, TCFL5 NM 006602 transcription factor-like 5 protein TCHP NM_032300 trichoplein TCL6 NM_014418 T-cell leukemia/lymphoma 6 isoform TCL6a2 TDGF1 NM_003212 teratocarcinoma-derived growth factor I TEADI NM_021961 TEA domain family member 1 TEDDM1 NM_172000 putative membrane protein HE9 TES NM_015641 testin isoform I TEX261 NM_144582 testis expressed sequence 261 TFAP2A NM_001032280 transcription factor AP-2 alpha isoform b TFAP2C NM 003222 transcription factor AP-2 gamma TFAP2D NM_172238 transcription factor AP-2 beta-like 1 TFAP2E NM_178548 transcription factor AP-2 epsilon (activating TFAP4 NM_003223 transcription factor AP-4 (activating enhancer TFCP2L1 NM_014553 LBP-9 TFEC NM_001018058 transcription factor EC isoform b TFG NM_001007565 TRK-fused gene TFPI2 NM_006528 tissue factor pathway inhibitor 2 TGFBR1 NM_004612 transforming growth factor, beta receptor I WO 2008/085797 PCT/US2007/089206 TGFBR3 NM_003243 transforming growth factor, beta receptor III TGIF2 NM 021809 TGFB-induced factor 2 TGIF2LY NM_139214 TGFB-induced factor 2-like, Y-linked TGOLN2 NM_006464 trans-golgi network protein 2 THAP2 NM_031435 THAP domain containing, apoptosis associated THAP6 NM 144721 THAP domain containing 6 THBS2 NM_003247 thrombospondin 2 precursor THEM4 NM_053055 thioesterase superfamily member 4 isoform a THSD3 NM_182509 thrombospondin, type I domain containing 3 THSD4 NM_024817 hypothetical protein LOC79875 THUMPD1 NM 017736 THUMP domain containing 1 THYNI NM_014174 thymocyte nuclear protein 1 isoform 1 TIAF1 NM_004740 TGFB 1 -induced anti-apoptotic factor 1 TIGA1 NM_053000 hypothetical protein LOCI 14915 TIGD6 NM_030953 hypothetical protein LOC81789 TIMM13 NM_012458 translocase of inner mitochondrial membrane 13 TIMM22 NM_013337 translocase of inner mitochondrial membrane 22 TIMM50 NM_001001563 translocase of inner mitochondrial membrane 50 TIMP2 NM_003255 tissue inhibitor of metalloproteinase 2 TK2 NM_004614 thymidine kinase 2, mitochondrial TKTL1 NM 012253 transketolase-like I TLE4 NM 007005 transducin-like enhancer protein 4 TLK1 NM_012290 tousled-like kinase 1 TLK2 NM 006852 tousled-like kinase 2 TLL1 NM_012464 tolloid-like 1 TLL2 NM_012465 tolloid-like 2 TLN1 NM 006289 talin 1 TLOC1 NM 003262 translocation protein 1 TLR1 NM_003263 toll-like receptor 1 TLR4 NM 138554 toll-like receptor 4 precursor TLR7 NM_016562 toll-like receptor 7 TLX2 NM_016170 T-cell leukemia, homeobox 2 TM2D2 NM_001024380 TM2 domain containing 2 isoform b TM4SF1 NM_014220 transmembrane 4 superfamily member 1 TM9SF4 NM 014742 transmembrane 9 superfamily protein member 4 TMCC1 NM 001017395 transmembrane and coiled-coil domains 1 isoform TMCC3 NM_020698 transmembrane and coiled-coil domains 3 TMED3 NM_007364 transmembrane emp24 domain containing 3 TMED9 NM_017510 transmembrane emp24 protein transport domain TMEM1O NM_033207 transmembrane protein 10 isoform a TMEM100 NM_018286 hypothetical protein LOC55273 TMEM101 NM_032376 hypothetical protein LOC84336 TMEM104 NM_017728 hypothetical protein LOC54868 TMEM105 NM_178520 hypothetical protein LOC284186 TMEM106A NM_145041 hypothetical protein LOCI 13277 TMEM109 NM_024092 transmembrane protein 109 TMEM 113 NM_025222 hypothetical protein PR02730 TMEM 119 NM_181724 hypothetical protein LOC338773 TMEM123 NM_052932 pro-oncosis receptor inducing membrane injury TMEM127 NM_017849 hypothetical protein LOC55654 TMEM134 NM 025124 hypothetical protein LOC80194 TMEM135 NM_022918 hypothetical protein LOC65084 TMEM138 NM_016464 hypothetical protein LOC51524 WO 2008/085797 PCT/US2007/089206 TMEM139 NM_153345 hypothetical protein LOC135932 TMEM143 NM_018273 hypothetical protein LOC55260 TMEM16C NM_031418 transmembrane protein 16C TMEM16F NM 001025356 transmembrane protein 16F TMEM16G NM 001001891 transmembrane protein 16G isoform NGEP long TMEM16K NM_018075 hypothetical protein LOC55129 TMEM18 NM_152834 transmembrane protein 18 TMEM20 NM_153226 transmembrane protein 20 TMEM26 NM_178505 transmembrane protein 26 TMEM30B NM_001017970 transmembrane protein 30B TMEM33 NM_018126 transmembrane protein 33 TMEM35 NM_021637 transmembrane protein 35 TMEM43 NM_024334 transmembrane protein 43 TMEM45B NM_138788 transmembrane protein 45B TMEM47 NM 031442 transmembrane 4 superfamily member 10 TMEM49 NM 030938 transmembrane protein 49 TMEM50B NM 006134 transmembrane protein 50B TMEM52 NM_178545 transmembrane protein 52 TMEM55A NM_018710 transmembrane protein 55A TMEM55B NM_144568 transmembrane protein 55B TMEM63C NM_020431 transmembrane protein 63C TMEM79 NM_032323 hypothetical protein LOC84283 TMEM8 NM_021259 transmembrane protein 8 (five membrane-spanning TMEM85 NM_016454 hypothetical protein LOC51234 TMEM86A NM_153347 hypothetical protein LOC144110 TMEM86B NM_173804 hypothetical protein LOC255043 TMEM87A NM_015497 hypothetical protein LOC25963 TMEM87B NM 032824 hypothetical protein LOC84910 TMEPAI NM_020182 transmembrane prostate androgen-induced protein TMIE NM_147196 transmembrane inner ear protein TMOD1 NM_003275 tropomodulin 1 TMPRSS13 NM_032046 transmembrane protease, serine 13 TMPRSS3 NM_024022 transmembrane protease, serine 3 isoform 1 TMPRSS4 NM_019894 transmembrane protease, serine 4 isoform 1 TMTC2 NM_152588 hypothetical protein LOC 160335 TNFAIP1 NM 021137 tumor necrosis factor, alpha-induced protein 1 TNFAIP8L1 NM_152362 tumor necrosis factor, alpha-induced protein TNFAIP8L3 NM_207381 tumor necrosis factor, alpha-induced protein TNFRSF1OB NM_003842 tumor necrosis factor receptor superfamily, TNFRSF1OD NM_003840 tumor necrosis factor receptor superfamily, TNFRSF13B NM_012452 tumor necrosis factor receptor 13B TNFRSF14 NM_003820 tumor necrosis factor receptor superfamily, TNFRSF19 NM_148957 tumor necrosis factor receptor superfamily, TNFRSF19L NM_032871 tumor necrosis factor receptor superfamily, TNFSF7 NM_001252 tumor necrosis factor ligand superfamily, member TNFSF9 NM_003811 tumor necrosis factor (ligand) superfamily, TNIP1 NM 006058 Nef-associated factor 1 TNIP2 NM_024309 A20-binding inhibitor of NF-kappaB activation 2 TNK2 NM_001010938 tyrosine kinase, non-receptor, 2 isoform 2 TNNIl NM_003281 troponin I, skeletal, slow TNRC6B NM_001024843 trinucleotide repeat containing 6B isoform 2 TNS1 NM 022648 tensin TNS3 NM_022748 tensin-like SH2 domain containing 1 WO 2008/085797 PCT/US2007/089206 TNT NM 182831 hypothetical protein LOC162083 TOB2 NM_0 16272 transducer of ERBB2, 2 TOLLIP NM_019009 toll interacting protein TOM1 NM_005488 target of mybI TOMlL2 NM_001033551 target of mybl-like 2 isoform 1 TOMM20 NM 014765 translocase of outer mitochondrial membrane 20 TOMM34 NM_006809 translocase of outer mitochondrial membrane 34 TORIB NM_014506 torsin family 1, member B (torsin B) TOR3A NM_022371 torsin family 3, member A TP53I1 1 NM_006034 p53-induced protein TP531NP2 NM_021202 tumor protein p53 inducible nuclear protein 2 TP53TG3 NM_016212 hypothetical protein LOC24150 TP73L NM_003722 tumor protein p73-like TPCN2 NM_139075 two pore segment channel 2 TPD52L3 NM_033516 protein kinase NYD-SP25 isoform 1 TPM1 NM_001018004 tropomyosin 1 alpha chain isoform 3 TPM2 NM_003289 tropomyosin 2 (beta) isoform 1 TPM3 NM_153649 tropomyosin 3 isoform 2 TPPP NM_007030 brain-specific protein p25 alpha TPRX1 NM_198479 tetra-peptide repeat homeobox TRAF NM_005658 TNF receptor-associated factor 1 TRAF4 NM_004295 TNF receptor-associated factor 4 isoform 1 TRAF5 NM 001033910 TNF receptor-associated factor 5 TRAF7 NM_032271 ring finger and WD repeat domain 1 isoform 1 TRAFD1 NM 006700 FLN29 gene product TRAKl NM_014965 OGT(O-Glc-NAc transferase)-interacting protein TRAM1 NM_014294 translocating chain-associating membrane TRAM2 NM 012288 translocation-associated membrane protein 2 TREML2 NM_024807 triggering receptor expressed on myeloid TRIAD3 NM 207111 TRIAD3 protein isoform a TRIM10 NM_006778 tripartite motif-containing 10 isoform 1 TRIM 11 NM 145214 tripartite motif-containing 11 TRIM14 NM 014788 tripartite motif protein TRIM14 isoform alpha TRIM2 NM_015271 tripartite motif-containing 2 TRIM29 NM_012101 tripartite motif protein TRIM29 isoform alpha TRIM35 NM_015066 tripartite motif-containing 35 isoform 1 TRIM36 NM_018700 tripartite motif-containing 36 isoform 1 TRIM37 NM_015294 tripartite motif-containing 37 protein TRIM56 NM 030961 tripartite motif-containing 56 TRIM6 NM_001003818 tripartite motif-containing 6 isoform I TRIM62 NM_018207 tripartite motif-containing 62 TRIM68 NM_018073 ring finger protein 137 TRIM7 NM_203293 tripartite motif-containing 7 isoform 1 TRIM9 NM_015163 tripartite motif protein 9 isoform 1 TRIP10 NM_004240 thyroid hormone receptor interactor 10 TRIT1 NM_017646 tRNA isopentenyltransferase 1 TRMT5 NM_020810 tRNA-(N1G37) methyltransferase TRMU NM_001008568 tRNA 5-methylaminomethyl-2-thiouridylate TRPCl NM_003304 transient receptor potential cation channel, TRPC4AP NM_015638 TRPC4-associated protein isoform a TRPM2 NM_001001188 transient receptor potential cation channel, TRPV1 NM_018727 transient receptor potential cation channel, TSC1 NM_000368 tuberous sclerosis 1 protein isoform 1 WO 2008/085797 PCT/US2007/089206 TSC22DI NM_006022 TSC22 domain family 1 isoform 2 TSC22D2 NM 014779 TSC22 domain family 2 TSC22D3 NM_001015881 TSC22 domain family, member 3 isoform 3 TSGA13 NM_052933 testis specific, 13 TSHR NM 001018036 thyroid stimulating hormone receptor isoform 2 TSN NM_004622 translin TSPAN14 NM_030927 tetraspanin 14 TSPAN15 NM_012339 transmembrane 4 superfamily member 15 TSPAN17 NM_001006616 transmembrane 4 superfamily member 17 isoform c TSPAN18 NM_130783 tetraspanin 18 isoform 2 TSPAN3 NM_005724 transmembrane 4 superfamily member 8 isoform 1 TSPAN33 NM_178562 penumbra TSPAN5 NM_005723 transmembrane 4 superfamily member 9 TSPAN9 NM_006675 tetraspanin 9 TSPYL2 NM 022117 TSPY-like 2 TSPYL4 NM 021648 TSPY-like 4 TSPYL5 NM 033512 TSPY-like 5 TSPYL6 NM_001003937 TSPY-like 6 TSSK6 NM_032037 serine/threonine protein kinase SSTK TTBK1 NM_032538 tau tubulin kinase 1 TTCl NM_003314 tetratricopeptide repeat domain 1 TTC13 NM_024525 tetratricopeptide repeat domain 13 TTC21B NM 024753 tetratricopeptide repeat domain 2 1B TTC23 NM_001018029 tetratricopeptide repeat domain 23 isoform 1 TTC25 NM_031421 hypothetical protein LOC83538 TTLL12 NM 015140 hypothetical protein LOC23170 TTLL5 NM_015072 tubulin tyrosine ligase-like family, member 5 TTLL9 NM_001008409 tubulin tyrosine ligase-like family, member 9 TTYH3 NM_025250 tweety 3 TUB NM_003320 tubby isoform a TUBA2 NM_006001 tubulin, alpha 2 isoform 1 TUBA3 NM_006009 tubulin, alpha 3 TUBB NM_178014 tubulin, beta polypeptide TUBB3 NM_006086 tubulin, beta, 4 TUFT1 NM 020127 tuftelin 1 TULP3 NM 003324 tubby like protein 3 TUSC5 NM 172367 LOST TXLNA NM_175852 taxilin TXN2 NM_012473 thioredoxin 2 precursor TXNDC5 NM_022085 thioredoxin domain containing 5 isoform 2 TXNIP NM_006472 thioredoxin interacting protein TXNL4A NM 006701 thioredoxin-like 4A TYRO3 NM_006293 TYRO3 protein tyrosine kinase TYSND1 NM 173555 trypsin domain containing 1 isoform a UAPIL1 NM_207309 UDP-N-acteylglucosamine pyrophosphorylase 1-like UBADC1 NM_016172 ubiquitin associated domain containing 1 UBAP1 NM_016525 ubiquitin associated protein 1 UBASH3A NM 001001895 ubiquitin associated and SH3 domain containing, UBE2A NM_003336 ubiquitin-conjugating enzyme E2A isoform 1 UBE2B NM 003337 ubiquitin-conjugating enzyme E2B UBE2H NM_003344 ubiquitin-conjugating enzyme E2H isoform 1 UBE2I NM_003345 ubiquitin-conjugating enzyme E21 UBE2JI NM_016021 ubiquitin-conjugating enzyme E2, JI WO 2008/085797 PCT/US2007/089206 UBE2J2 NM_058167 ubiquitin conjugating enzyme E2, J2 isoform 2 UBE20 NM_022066 ubiquitin-conjugating enzyme E20 UBE2Q1 NM_017582 ubiquitin-conjugating enzyme E2Q UBE2Q2 NM_173469 ubiquitin-conjugating enzyme E2Q (putative) 2 UBE2R2 NM_017811 ubiquitin-conjugating enzyme UBC3B UBE2V1 NM_001032288 ubiquitin-conjugating enzyme E2 variant 1 UBE2Z NM_023079 ubiquitin-conjugating enzyme E2Z (putative) UBE3C NM_014671 ubiquitin protein ligase E3C UBE4A NM_004788 ubiquitination factor E4A UBE4B NM_006048 ubiquitination factor E4B UBL3 NM_007106 ubiquitin-like 3 UBL4A NM_014235 ubiquitin-like 4 UBL4B NM_203412 hypothetical protein LOC164153 UBN1 NM_016936 ubinuclein 1 UBOX5 NM_014948 U-box domain containing 5 isoform a UBP1 NM_014517 upstream binding protein 1 (LBP-l a) UBTD1 NM_024954 ubiquitin domain containing 1 UBXD2 NM_014607 UBX domain containing 2 UBXD3 NM_152376 UBX domain containing 3 UBXD8 NM_014613 UBX domain containing 8 UCP2 NM_003355 uncoupling protein 2 UHMK1 NM_175866 kinase interacting stathmin ULKI NM_003565 unc-5 1-like kinase 1 UMOD NM_001008389 uromodulin precursor UNC13D NM_199242 unc-13 homolog D UNC5D NM_080872 netrin receptor Unc5h4 UNC84A NM_025154 unc-84 homolog A UNC84B NM_015374 unc-84 homolog B UNG NM_003362 uracil-DNA glycosylase isoform UNG1 precursor UNG2 NM_001024592 uracil-DNA glycosylase 2 isoform b UNQ9370 NM_207447 hypothetical protein LOC400454 UPF1 NM_002911 regulator of nonsense transcripts 1 UQCR NM_006830 ubiquinol-cytochrome c reductase, 6.4kDa URG4 NM_017920 hypothetical protein LOC55665 UROS NM_000375 uroporphyrinogen III synthase USH2A NM_206933 usherin isoform B USP14 NM_005151 ubiquitin specific protease 14 isoform a USP15 NM_006313 ubiquitin specific protease 15 USP18 NM_017414 ubiquitin specific protease 18 USP19 NM 006677 ubiquitin specific protease 19 USP2 NM_004205 ubiquitin specific protease 2 isoform a USP20 NM_001008563 ubiquitin specific protease 20 USP25 NM_013396 ubiquitin specific protease 25 USP3 NM_006537 ubiquitin specific protease 3 USP32 NM_032582 ubiquitin specific protease 32 USP36 NM_025090 ubiquitin specific protease 36 UTX NM_021140 ubiquitously transcribed tetratricopeptide VAC14 NM_018052 Vac14 homolog VAMP1 NM_014231 vesicle-associated membrane protein 1 isoform 1 VAMP2 NM_014232 vesicle-associated membrane protein 2 VAMP8 NM_003761 vesicle-associated membrane protein 8 VAPB NM_004738 VAMP-associated protein B/C VASH1 NM_014909 vasohibin 1 WO 2008/085797 PCT/US2007/089206 VATI NM_006373 vesicle amine transport protein 1 VAV2 NM_003371 vav 2 oncogene VAXI NM_199131 ventral anterior homeobox 1 VCL NM 003373 vinculin isoform VCL VDR NM 000376 vitamin D (1,25-dihydroxyvitamin D3) receptor VEGF NM_001025366 vascular endothelial growth factor isoform a VEZT NM_017599 transmembrane protein vezatin VGLL2 NM_153453 vestigial-like 2 isoform 2 VGLL3 NM_016206 colon carcinoma related protein VIL2 NM_003379 villin 2 VIPR2 NM_003382 vasoactive intestinal peptide receptor 2 VISA NM 020746 virus-induced signaling adapter VIT NM_053276 vitrin VMD2L2 NM_153274 vitelliform macular dystrophy 2-like 2 VMD2L3 NM_152439 vitelliform macular dystrophy 2-like 3 VPS13B NM_017890 vacuolar protein sorting 13B isoform 5 VPS13D NM_015378 vacuolar protein sorting 13D isoform 1 VPS24 NM_001005753 vacuolar protein sorting 24 isoform 2 VPS33B NM_018668 vacuolar protein sorting 33B (yeast homolog)) VPS36 NM_016075 vacuolar protein sorting 36 VPS37B NM_024667 vacuolar protein sorting 37B VPS37C NM_017966 vacuolar protein sorting 37C VPS41 NM_014396 vacuolar protein sorting 41 (yeast homolog) VPS4A NM_013245 vacuolar protein sorting factor 4A VSIG4 NM_007268 V-set and immunoglobulin domain containing 4 VTIIB NM_006370 vesicle transport through interaction with VWF NM_000552 von Willebrand factor preproprotein WAPAL NM_015045 wings apart-like homolog WARS2 NM_015836 mitochondrial tryptophanyl tRNA synthetase 2 WASF2 NM_006990 WAS protein family, member 2 WASL NM_003941 Wiskott-Aldrich syndrome gene-like protein WASPIP NM_003387 WASP-interacting protein WBP 11 NM_016312 WW domain binding protein 11 WBP2 NM 012478 WW domain binding protein 2 WBSCR17 NM_022479 UDP-GalNAc:polypeptide WBSCR18 NM_032317 Williams Beuren syndrome chromosome region 18 WBSCR19 NM_175064 Williams Beuren syndrome chromosome region 19 WDFY3 NM_178583 WD repeat and FYVE domain containing 3 isoform WDHD1 NM_001008396 WD repeat and HMG-box DNA binding protein 1 WDR13 NM_017883 WD repeat domain 13 protein WDR20 NM_181291 WD repeat domain 20 isoform 1 WDR21A NM_015604 WD repeat domain 21A isoform 1 WDR21C NM_152418 hypothetical protein LOC 138009 WDR22 NM_003861 Breakpoint cluster region protein, uterine WDR31 NM_001006615 WD repeat domain 31 isoform 2 WDR33 NM_001006623 WD repeat domain 33 isoform 3 WDR37 NM_014023 WD repeat domain 37 WDR4 NM_018669 WD repeat domain 4 protein WDR41 NM_018268 WD repeat domain 41 WDR42A NM 015726 H326 WDR47 NM 014969 WD repeat domain 47 WDR59 NM_030581 WD repeat domain 59 WDR62 NM_173636 WD repeat domain 62 WO 2008/085797 PCT/US2007/089206 WDR68 NM_005828 WD-repeat protein WDR7 NM_015285 rabconnectin-3 beta isoform 1 WDR73 NM_032856 WD repeat domain 73 WDTCl NM 015023 WD and tetratricopeptide repeats 1 WEEl NM_003390 weel tyrosine kinase WFDC5 NM_145652 WAP four-disulfide core domain 5 precursor WFIKKN2 NM_175575 WFIKKN2 protein WHSCl NM_007331 Wolf-Hirschhom syndrome candidate 1 protein WHSC2 NM_005663 Wolf-Hirschhom syndrome candidate 2 protein WIBG NM_032345 within bgcn homolog WIF1 NM_007191 Wnt inhibitory factor-i precursor WIPI2 NM_001033518 hypothetical protein LOC26100 isoform c WIRE NM_133264 WIRE protein WISPI NM_003882 WNT1 inducible signaling pathway protein 1 WNK3 NM 001002838 WNK lysine deficient protein kinase 3 isoform 2 WNT2B NM 004185 wingless-type MMTV integration site family, WNT3A NM_033131 wingless-type MMTV integration site family, WNT5A NM 003392 wingless-type MMTV integration site family, WNT5B NM_030775 wingless-type MMTV integration site family, WNT7A NM_004625 wingless-type MMTV integration site family, WNT8A NM_058244 wingless-type MMTV integration site family, WNT9A NM 003395 wingless-type MMTV integration site family, WSB1 NM_015626 WD repeat and SOCS box-containing I isoform 1 WTI NM_000378 Wilms tumor 1 isoform A WWC1 NM_015238 KIBRA protein WWP1 NM 007013 WW domain containing E3 ubiquitin protein ligase WWP2 NM 007014 WW domain containing E3 ubiquitin protein ligase XAB1 NM_007266 XPA binding protein 1 XKR5 NM_207411 XK-related protein 5a XKR8 NM_018053 X Kell blood group precursor-related family, XPC NM_004628 xeroderma pigmentosum, complementation group C XPO4 NM_022459 exportin 4 XPO5 NM_020750 exportin 5 XPO6 NM_015171 exportin 6 XPR1 NM_004736 xenotropic and polytropic retrovirus receptor XRN1 NM 019001 5'-3' exoribonuclease 1 XTP7 NM_138568 protein 7 transactivated by hepatitis B virus X YAF2 NM_001012424 YYI associated factor 2 isoform b YAP1 NM_006106 Yes-associated protein 1, 65 kD YARS2 NM_015936 tyrosyl-tRNA synthetase 2 (mitochondrial) YEATS2 NM_018023 YEATS domain containing 2 YIF1B NM_033557 Yip1 interacting factor homolog B isoform 2 YIPF7 NM_182592 Yip 1 domain family, member 7 YKT6 NM_006555 YKT6 v-SNARE protein YOD1 NM_018566 hypothetical protein LOC55432 YPEL1 NM_013313 yippee-like 1 YPEL4 NM_145008 yippee-like 4 YRDC NM_024640 ischemia/reperfusion inducible protein YTHDC1 NM_001031732 splicing factor YT52 1-B isoform 1 YTHDF1 NM_017798 YTH domain family, member 1 YWHAG NM_012479 tyrosine 3-monooxygenase/tryptophan YWHAH NM 003405 tyrosine 3/tryptophan 5 -monooxygenase YWHAQ NM_006826 tyrosine 3/tryptophan 5 -monooxygenase WO 2008/085797 PCT/US2007/089206 ZA20D2 NM_006007 zinc finger protein 216 ZA20D3 NM_019006 zinc finger, A20 domain containing 3 ZADH2 NM_175907 zinc binding alcohol dehydrogenase, domain ZAK NM 133646 MLK-related kinase isoform 2 ZBED1 NM_004729 Ac-like transposable element ZBP1 NM_030776 tumor stroma and activated macrophage protein ZBTB1O NM_023929 zinc finger and BTB domain containing 10 ZBTB11 NM_014415 zinc finger protein ZNF-U69274 ZBTB2 NM_020861 zinc finger and BTB domain containing 2 ZBTB24 NM_014797 zinc finger and BTB domain containing 24 ZBTB3 NM 024784 zinc finger and BTB domain containing 3 ZBTB32 NM_014383 testis zinc finger protein ZBTB33 NM_006777 kaiso ZBTB39 NM_014830 zinc finger and BTB domain containing 39 ZBTB40 NM_014870 zinc finger and BTB domain containing 40 ZBTB41 NM_194314 zinc finger and BTB domain containing 41 ZBTB43 NM_014007 zinc finger protein 297B ZBTB5 NM_014872 zinc finger and BTB domain containing 5 ZBTB8 NM_144621 zinc finger and BTB domain containing 8 ZBTB9 NM_152735 zinc finger and BTB domain containing 9 ZC3H l1A NM_014827 hypothetical protein LOC9877 ZC3H12B NM_001010888 hypothetical protein LOC340554 ZC3H6 NM_198581 zinc finger CCCH-type domain containing 6 ZCCHC2 NM_017742 zinc finger, CCHC domain containing 2 ZCCHC3 NM_033089 zinc finger, CCHC domain containing 3 ZCCHC5 NM_152694 zinc finger, CCHC domain containing 5 ZCSL3 NM_181706 zinc finger, CSL domain containing 3 ZDHHC 11 NM 024786 zinc finger, DHHC domain containing 11 ZDHHC12 NM 032799 zinc finger, DHHC domain containing 12 ZDHHC14 NM_024630 NEWI domain containing protein isoform 1 ZDHHC15 NM_144969 zinc finger, DHHC domain containing 15 ZDHHC16 NM_032327 Abl-philin 2 isoform 1 ZDHHC17 NM_015336 huntingtin interacting protein 14 ZDHHC18 NM_032283 zinc finger, DHHC domain containing 18 ZDHHC22 NM_174976 zinc finger, DHHC domain containing 22 ZDHHC23 NM_173570 zinc finger, DHHC domain containing 23 ZDHHC9 NM_001008222 zinc finger, DHHC domain containing 9 ZFAND3 NM_021943 testis expressed sequence 27 ZFP106 NM_022473 zinc finger protein 106 homolog ZFP28 NM_020828 zinc finger protein 28 ZFP41 NM_173832 zinc finger protein 41 homolog ZFP95 NM_014569 zinc finger protein 95 homolog ZFYVE1 NM_021260 zinc finger, FYVE domain containing 1 isoform 1 ZFYVE20 NM_022340 FYVE-finger-containing Rab5 effector protein ZFYVE28 NM_020972 zinc finger, FYVE domain containing 28 ZHX1 NM_001017926 zinc fingers and homeoboxes 1 ZHX3 NM_015035 zinc fingers and homeoboxes 3 ZICl NM_003412 zinc finger protein of the cerebellum 1 ZKSCANI NM_003439 zinc finger protein 36 ZMYM6 NM_007167 zinc finger protein 258 ZMYND1O NM_015896 zinc finger, MYND domain-containing 10 ZNF10 NM 015394 zinc finger protein 10 ZNF134 NM_003435 zinc finger protein 134 WO 2008/085797 PCT/US2007/089206 ZNF135 NM_003436 zinc finger protein 135 (clone pHZ-17) ZNF187 NM_001023560 zinc finger protein 187 ZNF192 NM_006298 zinc finger protein 192 ZNF193 NM 006299 zinc finger protein 193 ZNF198 NM_003453 zinc finger protein 198 ZNF212 NM_012256 zinc finger protein 212 ZNF213 NM_004220 zinc finger protein 213 ZNF215 NM_013250 zinc finger protein 215 ZNF236 NM_007345 zinc finger protein 236 ZNF259 NM_003904 zinc finger protein 259 ZNF264 NM_003417 zinc finger protein 264 ZNF267 NM_003414 zinc finger protein 267 ZNF282 NM_003575 zinc finger protein 282 ZNF285 NM_152354 zinc finger protein 285 ZNF289 NM_032389 zinc finger protein 289, IDI regulated ZNF295 NM_020727 zinc finger protein 295 ZNF304 NM_020657 zinc finger protein 304 ZNF306 NM_024493 zinc finger protein 306 ZNF307 NM_019110 zinc finger protein 307 ZNF313 NM_018683 zinc finger protein 313 ZNF317 NM_020933 zinc finger protein 317 ZNF319 NM_020807 zinc finger protein 319 ZNF323 NM_030899 zinc finger protein 323 isoform 1 ZNF326 NM_181781 zinc finger protein 326 isoform 2 ZNF329 NM_024620 zinc finger protein 329 ZNF343 NM_024325 zinc finger protein 343 ZNF346 NM_012279 zinc finger protein 346 ZNF365 NM_014951 zinc finger protein 365 isoform A ZNF367 NM_153695 zinc finger protein 367 ZNF395 NM_018660 zinc finger protein 395 ZNF406 NM_001029939 zinc finger protein 406 isoform TR-ZFAT ZNF417 NM_152475 zinc finger protein 417 ZNF423 NM_015069 zinc finger protein 423 ZNF436 NM_030634 zinc finger protein 436 ZNF445 NM_181489 zinc finger protein 445 ZNF449 NM_152695 zinc finger protein 449 ZNF454 NM_182594 zinc finger protein 454 ZNF488 NM_153034 zinc finger protein 488 ZNF497 NM_198458 zinc finger protein 497 ZNF498 NM_145115 zinc finger protein 498 ZNF500 NM_021646 zinc finger protein 500 ZNF501 NM_145044 zinc finger protein 501 ZNF503 NM_032772 zinc finger protein 503 ZNF512 NM_032434 zinc finger protein 512 ZNF532 NM_018181 zinc finger protein 532 ZNF536 NM_014717 zinc finger protein 536 ZNF548 NM_152909 zinc finger protein 548 ZNF569 NM_152484 zinc finger protein 569 ZNF572 NM_152412 zinc finger protein 572 ZNF592 NM_014630 zinc finger protein 592 ZNF600 NM_198457 zinc finger protein 600 ZNF609 NM_015042 zinc finger protein 609 ZNF621 NM_198484 zinc finger protein 621 WO 2008/085797 PCT/US2007/089206 ZNF622 NM_033414 zinc finger protein 622 ZNF623 NM_014789 zinc finger protein 623 ZNF626 NM_145297 zinc finger protein 626 ZNF627 NM_145295 zinc finger protein 627 ZNF650 NM_172070 zinc finger protein 650 ZNF651 NM_145166 zinc finger protein 651 ZNF660 NM_173658 zinc finger protein 660 ZNF691 NM_015911 zinc finger protein 691 ZNF694 NM_001012981 zinc finger protein 694 ZNF695 NM_020394 zinc finger protein SBZF3 ZNF696 NM_030895 zinc finger protein 696 ZNF701 NM_018260 zinc finger protein 701 ZNF704 NM_001033723 zinc finger protein 704 ZNF705A NM_001004328 hypothetical protein LOC440077 ZNF71 NM_021216 zinc finger protein 71 ZNF74 NM_003426 zinc finger protein 74 (Cos52) ZNF747 NM 023931 hypothetical protein LOC65988 ZNF76 NM 003427 zinc finger protein 76 (expressed in testis) ZNF81 NM_007137 zinc finger protein 81 (HFZ20) ZNFN1A1 NM_006060 zinc finger protein, subfamily 1A, 1 (Ikaros) ZNFN1A4 NM_022465 zinc finger protein, subfamily 1A, 4 ZNHIT3 NM_004773 thyroid hormone receptor interactor 3 isoform 2 ZNRF1 NM_032268 zinc and ring finger protein 1 ZNRF2 NM_147128 zinc finger/RING finger 2 ZPLD1 NM_175056 hypothetical protein LOCl3 1368 ZSWIM3 NM_080752 zinc finger, SWIM domain containing 3 ZSWIM4 NM_023072 zinc finger, SWIM domain containing 4 ZW10 NM_004724 centromere/kinetochore protein zwl0 ZYGI1A NM_001004339 hypothetical protein LOC440590 ZYGI1BL NM_006336 zyg-1 1 homolog B (C. elegans)-like ZYX NM_001010972 zyxin ZZEF1 NM_015113 zinc finger, ZZ type with EF hand domain 1 ZZZ3 NM_015534 zinc finger, ZZ domain containing 3 [00254] The predicted gene targets that exhibited altered mRNA expression levels in human cancer cells, following transfection with pre-miR hsa-miR-16, are shown in Table 4 below.

WO 2008/085797 PCT/US2007/089206 Table 4. Predicted hsa-miR-16 targets that exhibited altered mRNA expression levels in human cancer cells after transfection with pre-miR hsa-miR-16. Gene RefSeq Transcript Description Symbol ID ACTR2 NM 001005386 actin-related protein 2 isoform a ADARB1 NM 001033049 RNA-specific adenosine deaminase B 1 isoform 4 ADRB2 NM 000024 adrenergic, beta-2-, receptor, surface ANKRD12 NM 015208 ankyrin repeat domain 12 ARHGDIA NM_004309 Rho GDP dissociation inhibitor (GDI) alpha ARL2 NM 001667 ADP-ribosylation factor-like 2 CA12 NM_001218 carbonic anhydrase XII isoform 1 precursor CCND1 NM 053056 cyclin D1 CDC37L1 NM_017913 cell division cycle 37 homolog (S. CDH1 NM 004360 cadherin 1, type 1 preproprotein CDS2 NM 003818 phosphatidate cytidylyltransferase 2 CHUK NM_001278 conserved helix-loop-helix ubiquitous kinase CYP4F3 NM_000896 cytochrome P450, family 4, subfamily F, D102 NM 000793 deiodinase, iodothyronine, type II isoform a FGF2 NM 002006 fibroblast growth factor 2 FGFR4 NM_002011 fibroblast growth factor receptor 4 isoform 1 GALNT7 NM_017423 polypeptide N-acetylgalactosaminyltransferase 7 HAS2 NM_005328 hyaluronan synthase 2 KCNJ2 NM_000891 potassium inwardly-rectifying channel J2 LCN2 NM 005564 lipocalin 2 (oncogene 24p3) LRP12 NM 013437 suppression of tumorigenicity MAP7 NM_003980 microtubule-associated protein 7 PHACTR2 NM_014721 phosphatase and actin regulator 2 PLSCR4 NM_020353 phospholipid scramblase 4 PODXL NM 001018111 podocalyxin-like precursor isoform 1 PPAP2C NM_003712 phosphatidic acid phosphatase type 2C isoform 1 quaking homolog, KH domain RNA binding QKI NM 206853 isoform RPS6KA3 NM_004586 ribosomal protein S6 kinase, 90kDa, polypeptide RPS6KA5 NM 004755 ribosomal protein S6 kinase, 90kDa, polypeptide SLC11A2 NM_000617 solute carrier family 11 (proton-coupled SLC4A7 NM 003615 solute carrier family 4, sodium bicarbonate STCl NM 003155 stanniocalcin 1 precursor SYNE1 NM 015293 nesprin 1 isoform beta TACCI NM 006283 transforming, acidic coiled-coil containing TFG NM_001007565 TRK-fused gene THUMPD1 NM 017736 THUMP domain containing 1 TNFSF9 NM 003811 tumor necrosis factor (ligand) superfamily, TPM1 NM_001018004 tropomyosin 1 alpha chain isoform 3 UBE2I NM 003345 ubiquitin-conjugating enzyme E21 VIL2 NM 003379 villin 2 WO 2008/085797 PCT/US2007/089206 [00255] The predicted gene targets of hsa-miR-16 whose mRNA expression levels are affected by hsa-miR- 16 represent particularly useful candidate targets for cancer therapy and therapy of other diseases through manipulation of their expression levels. EXAMPLE 4: CANCER RELATED GENE EXPRESSION ALTERED BY HSA-MIR-16 [00256] Cell proliferation and survival pathways are commonly altered in tumors (Hanahan and Weinberg, 2000). The inventors have shown that hsa-miR-16 directly or indirectly regulates the transcripts of proteins that are critical in the regulation of these pathways. Many of these targets have inherent oncogenic or tumor suppressor activity. Hsa miR-16 targets that are associated with various cancer types are shown in Table 5. [00257] Among these targets are regulators of the cell cycle, including cyclin D1 (CCND1), cyclin G2 (CCNG2) and the transforming acidic coiled coil 1 protein (TACCI). While cyclin D1 forms a functional complex with the cyclin-dependent kinases 4 and 6 (CDK4/6) and is necessary to promote cells from the G1 phase into S phase, cyclin G2 unlike conventional cyclins - negatively regulates the cell cycle (Donnellan and Chetty, 1998; Home et al., 1997). The growth-promoting activity of cyclin Dl correlates with the observation that a broad roster of cancers show elevated levels of cyclin D1 (Donnellan and Chetty, 1998). In contrast, cyclin G2 is down-regulated in multiple cancers, such as oral cancer and papillary carcinomas (Alevizos et al., 2001; Ito et al., 2003). Since hsa-miR-16 over-expression leads to suppression of the cyclin D1 transcript and up regulation of cyclin G2, hsa-miR-16 may function as a tumor suppressor. This view is supported by the fact that hsa-miR-16 negatively regulates the TACCI message which encodes a putative oncogene located within a breast cancer amplicon on chromosome 8p1I (Cully et al., 2005). Over expression of TACCI induces oncogenic transformation of fibroblasts in culture and cooperates with Ras to form tumors in mice with a PTEN+/- background (Cully et al., 2005). [00258] Other hsa-miR-16 targets include the fibroblast growth factor 2 (FGF2), fibroblast growth factor receptor 4 (FGFR4) and IkappaB kinase alpha (IKKalpha, CHUK), all of which are components of the intracellular signaling network. FGF2 is a secretory protein with potent mitogenic and angiogenic activity that transmits the signal into cells via transmembrane receptors (FGFRs) composed of 2-3 extracellular immunoglobulin-like domains and an intracellular tyrosine kinase domain (Chandler et al., 1999). While FGF2 WO 2008/085797 PCT/US2007/089206 mRNAs levels are increased in renal, oral, and non-small lung cancer cells, FGFR4 is up regulated in numerous types of cancer (Chandler et al., 1999). Similarly, IKKalpha is a positive regulator of the intracellular signaling cascade and functions to activate the transcription factor nuclear factor kappa B (NFkappaB) (Karin et al. 2002). NFkappaB is constitutively activated in several cancer types and promotes anti-apoptotic and survival pathways. [00259] Based on our data, hsa-miR-16 negatively regulates these proteins and therefore is likely to function as a tumor-suppressor. In contrast, hsa-miR-16 may also have oncogenic activity. This view is supported by the observation that hsa-miR-16 negatively regulates the tumor-suppressor RBL-1 (p107) and induces an up-regulation of MCL1, thioredoxin (TXN) and the oncogenic E3 ubiquitin ligase Skp2 (Gstaiger et al., 2001; Huang et al., 2005; Jiang et al., 2005). Skp2 is a component of the multi-subunit E3 ubiquitin ligase complex that ear marks proteins for proteasomal degradation. A well characterized target is the CDK inhibitor p27 which offers an explanation for the cell cycle promoting activity of Skp2 (Carrano et al., 1999). Skp2 is inherently oncogenic and shows elevated levels in various cancer types (Gstaiger et al., 2001; Kamata et al., 2005; Saigusa et al., 2005; Einama et al., 2006). MCL1 is a member of the BCL-2 (B cell lymphoma 2) gene family. MCL1 gives rise to two alternatively spliced gene products with opposing functions (Bae et al., 2000). The predominant species is MCL1-L that has anti-apoptotic activity. High levels of MCL1 are correlated with poor prognosis of patients with ovarian carcinoma and is indicative for leukemic relapse (Kaufiann et al., 1998; Shigemasa et al., 2002). RNA interference against MCL1 induces a therapeutic response in gastric and hepatocellular carcinoma cells (Schulze Bergkamen et al., 2006; Zangemeister-Wittke and Huwiler, 2006). [00260] Thioredoxin (TXN) is a 12-kDa thiol reductase targeting various proteins and multiple pathways. Thioredoxin modulates the activity of transcription factors, induces the expression of angiogenic Hif-lalpha (hypoxia induced factor alpha) as well as VEGF (vascular endothelial growth factor) and can act as a proliferative and anti-apoptotic agent (Marks, 2006). In accord, carcinomas of the lung, pancreas, cervix and liver show increased levels of thioredoxin. Thioredoxin expression is also correlated with aggressive tumor growth, poor prognosis and chemoresistance (Marks, 2006). In addition, hsa-miR-16 regulates genes that may have either oncogenic or growth-inhibitory activity, depending on the cellular context: among these are connective tissue growth factor (CTGF) and neutrophil WO 2008/085797 PCT/US2007/089206 gelatinase-associated lipocalin (NGAL), also known as lipocalin-2 (LCN2) (Croci et al., 2004; Hishikawa et al., 1999; Lin et al., 2005; Yang et al., 2005; Fernandez et al., 2005; Lee et al., 2006). [00261] In summary, hsa-miR-16 governs the activity of proteins that are critical regulators of cell proliferation and survival. These targets are frequently deregulated in human cancer. Based on this review of the genes and related pathways that are regulated by miR- 16, introduction of hsa-miR- 16 or an anti-hsa-miR- 16 into a variety of cancer cell types would likely result in a therapeutic response. Table 5. Tumor associated mRNAs altered by hsa-miR-16 having prognostic or therapeutic value for the treatment of various malignancies. Gene Gene Title Cellular Process Cancer Type Reference [PMIDJ Symbol CCND1 cyclin D1 cell cycle MCL, BC, SCCHN, Donnellan and Chetty, 1998 OepC, HCC, CRC, BldC, EC, OC, M, AC, GB, GC, PaC CCNG2 cyclin G2 cell cycle TC, SCCHN Ito et al., 2003b; Alevizos et al., 2001 CDKN2C CDK cell cycle HB, MB, HCC, HL, MM Iolascon et al., 1998; Kulkarni et inhibitor 2C al., 2002; Morishita et al., 2004; Sanchez-Aguilera et al., 2004 CHUK IKK alpha signal LSCC, BC Cao et al., 2001; Nakayama et transduction al., 2001; Romieu-Mourez et al., 2001 CTGF CTGF/IGFB cell adhesion, BC, GB, OepC, RMS, Hishikawa et al., 1999; Shimo et P-8 migration CRC, PC al., 2001; Koliopanos et al., 2002; Pan et al., 2002; Croci et al., 2004; Lin et al., 2005; Yang et al., 2005 FGF2 FGF-2 signal BC, RCC, OC, M, Chandler et al., 1999 transduction NSCLC FGFR4 FGF-R4 signal TC, BC, OC, PaC Jaakkola et al., 1993; Shah et al., transduction 2002; Ezzat et al., 2005 LCN2 lipocalin 2 / cell adhesion PaC, CRC, HCC, BC, Bartsch and Tschesche, 1995; NGAL OC Furutani et al., 1998; Fernandez et al., 2005; Lee et al., 2006 MCL1 Mcl-i apoptosis HCC, MM, TT, CLL, Krajewska et al., 1996; Kitada et ALCL, BCL, PC al., 1998; Cho-Vega et al., 2004; Rust et al., 2005; Sano et al., 2005; Wuilleme-Toumi et al., 2005; Fleischer et al., 2006; Sieghart et al., 2006 NF1 NF-1 signal G, AC, NF, PCC, ML Rubin and Gutmann, 2005 transduction RBL1 p107 cell cycle BCL, PC, CRC, TC Takimoto et al., 1998; Claudio et al., 2002; Wu et al., 2002; Ito et al., 2003a; Rubin and Gutmann, 2005 SKP2 SKP-2 proteasomal PaC, OC, BC, MFS, GB, Kamata et al., 2005; Saigusa et degradation EC, NSCLC, PC al., 2005; Shibahara et al., 2005; WO 2008/085797 PCT/US2007/089206 Takanami, 2005; Einama et al., 2006; Huang et al., 2006; Sui et al., 2006; Traub et al., 2006 TACCl cell cycle BC, OC Cully et al., 2005; Lauffart et al., TACCI 2005 TXN thioredoxin thioredoxin redox LC, PaC, CeC, HCC Marks, 2006 (trx) system WISP2 WISP-2 signal CRC, BC Pennica et al., 1998; Saxena et transduction al., 2001 Abbreviations: AC, astrocytoma; ALCL, anaplastic large cell lymphoma; BC, breast carcinoma; BCL, B-cell lymphoma; BldC, bladder carcinoma; CeC, cervical carcinoma; CLL, chronic lymphoblastic leukemia; CRC, colorectal carcinoma; EC, endometrial carcinoma; G, glioma; GB, glioblastoma; GC, gastric carcinoma; HB, hepatoblastoma; HCC, hepatocellular carcinoma; HL, Hodgkin lymphoma; LC, lung carcinoma; LSCC, laryngeal squamous cell carcinoma; M, melanoma; MB, medulloblastoma; MCL, mantle cell lymphoma; MFS, myxofibrosarcoma; ML, myeloid leukemia; MM, multiple myeloma; NF, neurofibroma; NSCLC, non-small cell lung carcinoma; OC, ovarian carcinoma; OepC, oesophageal carcinoma; PaC, pancreatic carcinoma; PC, prostate carcinoma; PCC, pheochromocytoma; RCC, renal cell carcinoma; RMS, rhabdomyosarcoma; SCCHN, squamous cell carcinoma of the head and neck; TC, thyroid carcinoma; TT, testicular tumor. EXAMPLE 5: DELIVERY OF SYNTHETIC HSA-MIR-16 REDUCES CELLULAR PROLIFERATION OF PROSTATE CANCER CELLS [00262] The inventors have previously demonstrated that hsa-miR-16 is involved in the regulation of numerous cell activities that represent intervention points for cancer therapy and for therapy of other diseases and disorders (U.S. Patent Applications serial number 11/141,707 filed May 31, 2005 and serial number 11/273,640 filed November 14, 2005). For example, overexpression of hsa-miR- 16 decreases the proliferation and/or viability of certain normal or cancerous cell lines. [00263] The inventors assessed the therapeutic effect of hsa-miR- 16 for prostate cancer by using the prostate cancer cell lines PPC-1, Du145, and RWPE2. Synthetic hsa-miR-16 (Pre miRTM-hsa-miR-16, Ambion cat. no. AM17100) or negative control (NC) miRNA (Pre miRTM microRNA Precursor Molecule-Negative Control #2; Ambion cat. no. AM17111) was delivered via lipid-based reverse transfections in triplicate according to a published protocol and the following parameters: 6000-7000 cells per 96 well, 0.2 jl LipofectamineTM 2000 (cat. no. 11668-019, Invitrogen Corp., Carlsbad, CA, USA) in 20 tl OptiMEM (Invitrogen), 30 nM final concentration of miRNA in 100 1 .d (Ovcharenko et al., 2005). Proliferation of PPC-1 cells was assessed 4 days post transfection and profilferation of Du145 and RPWE2 cells was evaluated 6 days post transfection using Alamar Blue (Invitrogen) following the manufacturer's instructions. As a control for inhibition of cellular proliferation, siRNA against the motor protein kinesin 11, also known as Eg5, was used. Eg5 is essential for WO 2008/085797 PCT/US2007/089206 cellular survival of most eukaryotic cells and a lack thereof leads to reduced cell proliferation and cell death (Weil et al., 2002). siEg5 was used in lipid-based transfection following the same experimental parameters that apply to miRNA. Percent (%) proliferation values from the Alamar Blue assay were normalized to values from cells treated with negative control miRNA. Percent proliferation of hsa-miR-16 treated cells relative to cells treated with negative control miRNA (100%) is shown in Table 6 and in FIG. 1. Table 6. Proliferation of prostate cancer cells following transfection with hsa-miR-16, negative control miRNA (NC), or siRNA against Eg5 (siEg5). % SD, % standard deviation. % proliferation values are normalized to values obtained from cells transfected with negative control miRNA. hsa-miR-16 (30 Cells nM) siEg5 (30 nM) NC (30 nM) proliferation % SD proliferation % SD proliferation % SD PPC-1 63.09 7.00 52.90 6.97 100.00 5.82 Du145 70.00 3.70 17.26 4.23 100.00 4.12 RWPE2 93.03 4.72 36.96 6.56 100.00 12.28 [00264] Delivery of hsa-miR-16 inhibits cellular proliferation of prostate cancer cells PPC 1, Du145 and RWPE2 (Table 6 and FIG. 1). On average, hsa-miR-16 inhibits cellular proliferation by 25% (Table 6 and FIG. 1). Hsa-miR-16 has maximal inhibitory activity in PPC-1 cells, reducing proliferation by 37%. Since hsa-miR-16 induces a therapeutic response in all prostate cancer cells tested, hsa-miR-16 may provide therapeutic benefit to patients with prostate cancer and other malignancies. [00265] To evaluate the inhibitory phenotype of hsa-miR-16 over an extended period of time, the inventors conducted growth curve experiments in the presence of hsa-miR- 16 for up to 22 days in PPC-1 cells. Since in vitro transfections of naked interfering RNAs, such as synthetic miRNA, are transient by nature and compromised by the dilution of the oligonucleotide during ongoing cell divisions, hsa-miR- 16 was administered at multiple time points via electroporation (Bartlett et al., 2006, Bartlett et al., 2007). Equal numbers of PPC 1 cells were electroporated with 1.6 ptM synthetic hsa-miR-16 (Pre-miR

TM

-hsa-miR-16, Ambion cat. no. AM17100) or negative control miRNA (Pre-miR T M microRNA Precursor Molecule-Negative Control #2; Ambion cat. no. AM17111) in 200 ptl OptiMEM (Invitrogen) on days 0, 4, and 11 using the the BioRad GenePulserXcellTM instrument (BioRad Laboratories, Inc.; Hercules, CA, USA). One million cells were electroporated on day 0; WO 2008/085797 PCT/US2007/089206 however, to ensure similar treatment of both conditions as well as to accommodate exponential growth, the cell numbers used for the second and third electroporation were titrated down to the lowest count i.e. that of hsa-miR-16 treated cells. At each electroporation event, fifty-thousand cells were plated separately in multiple wells of a 6-well plate, and cells were harvested and counted every other day. The population doubling was calculated using the formula PD=ln(Nf/No)/ln 2, and cell numbers were extrapolated and plotted on a linear scale. [00266] As shown in FIG. 2, three equal doses of synthetic hsa-miR-16 miRNA over 22 days in 4-7 day intervals resulted in an approximate 94.3% inhibition of PPC-1 cell growth relative to cells that received negative control miRNA. The data suggest that multiple administrations of hsa-miR-16 enhance the therapeutic effect of miR-16 miRNA and reinforce previous data, indicating the therapeutic potential of hsa-miR- 16 miRNA.

WO 2008/085797 PCT/US2007/089206 REFERENCES The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. U.S. Patent 4,337,063 U.S. Patent 4,404,289 U.S. Patent 4,405,711 U.S. Patent 4,659,774 U.S. Patent 4,682,195 U.S. Patent 4,683,202 U.S. Patent 4,704,362 U.S. Patent 4,816,571 U.S. Patent 4,959,463 U.S. Patent 5,141,813 U.S. Patent 5,143,854 U.S. Patent 5,202,231 U.S. Patent 5,214,136 U.S. Patent 5,221,619 U.S. Patent 5,223,618 U.S. Patent 5,242,974 U.S. Patent 5,264,566 U.S. Patent 5,268,486 U.S. Patent 5,288,644 U.S. Patent 5,324,633 U.S. Patent 5,378,825 U.S. Patent 5,384,261 U.S. Patent 5,405,783 U.S. Patent 5,412,087 U.S. Patent 5,424,186 U.S. Patent 5,428,148 U.S. Patent 5,429,807 WO 2008/085797 PCT/US2007/089206 U.S. Patent 5,432,049 U.S. Patent 5,436,327 U.S. Patent 5,445,934 U.S. Patent 5,446,137 U.S. Patent 5,466,786 U.S. Patent 5,468,613 U.S. Patent 5,470,710 U.S. Patent 5,470,967 U.S. Patent 5,472,672 U.S. Patent 5,480,980 U.S. Patent 5,492,806 U.S. Patent 5,503,980 U.S. Patent 5,510,270 U.S. Patent 5,525,464 U.S. Patent 5,527,681 U.S. Patent 5,529,756 U.S. Patent 5,532,128 U.S. Patent 5,545,531 U.S. Patent 5,547,839 U.S. Patent 5,554,501 U.S. Patent 5,554,744 U.S. Patent 5,556,752 U.S. Patent 5,561,071 U.S. Patent 5,571,639 U.S. Patent 5,574,146 U.S. Patent 5,580,726 U.S. Patent 5,580,732 U.S. Patent 5,583,013 U.S. Patent 5,593,839 U.S. Patent 5,599,672 U.S. Patent 5,599,695 U.S. Patent 5,602,240 U.S. Patent 5,602,244 U.S. Patent 5,610,289 WO 2008/085797 PCT/US2007/089206 U.S. Patent 5,610;287 U.S. Patent 5,614,617 U.S. Patent 5,623,070 U.S. Patent 5,624,711 U.S. Patent 5,631,134 U.S. Patent 5,637,683 U.S. Patent 5,639,603 U.S. Patent 5,645,897 U.S. Patent 5,652,099 U.S. Patent 5,654,413 U.S. Patent 5,658,734 U.S. Patent 5,661,028 U.S. Patent 5,665,547 U.S. Patent 5,667,972 U.S. Patent 5,670,663 U.S. Patent 5,672,697 U.S. Patent 5,677,195 U.S. Patent 5,681,947 U.S. Patent 5,695,940 U.S. Patent 5,700,637 U.S. Patent 5,700,922 U.S. Patent 5,705,629 U.S. Patent 5,708,153 U.S. Patent 5,708,154 U.S. Patent 5,714,606 U.S. Patent 5,728,525 U.S. Patent 5,744,305 U.S. Patent 5,763,167 U.S. Patent 5,770,358 U.S. Patent 5,777,092 U.S. Patent 5,789,162 U.S. Patent 5,792,847 U.S. Patent 5,800,992 U.S. Patent 5,807,522 WO 2008/085797 PCT/US2007/089206 U.S. Patent 5,830,645 U.S. Patent 5,837,196 U.S. Patent 5,847,219 U.S. Patent 5,856,174 U.S. Patent 5,858,988 U.S. Patent 5,859,221 U.S. Patent 5,871,928 U.S. Patent 5,872,232 U.S. Patent 5,876,932 U.S. Patent 5,886,165 U.S. Patent 5,919,626 U.S. Patent 5,922,591 U.S. Patent 6,004,755 U.S. Patent 6,040,193 U.S. Patent 6,087,102 U.S. Patent 6,251,666 U.S. Patent 6,368,799 U.S. Patent 6,383,749 U.S. Patent 6,617,112 U.S. Patent 6,638,717 U.S. Patent 6,720,138 U.S. Patent 6,723,509 U.S. Patent Serial 09/545,207 U.S. Patent Serial 10/667,126 U.S. Patent Serial 11/141,707 U.S. Prov. Appln. 60/575,743 U.S. Prov. Appln. 60/649,584 U.S. Prov. Appln. Methods and Compositions Involving miRNA and miRNA Inhibitor Molecules, 2005 EP 266,032 EP 373 203 EP 785 280 EP 799 897 WO 2008/085797 PCT/US2007/089206 PCT Appln. WO 0168255 PCT Appln. WO 03020898 PCT Appln. WO 03022421 PCT Appln. WO 03023058 PCT Appln. WO 03029485 PCT Appln. WO 03040410 PCT Appln. WO 03053586 PCT Appln. WO 03066906 PCT Appln. WO 03067217 PCT Appln. WO 03076928 PCT Appln. WO 03087297 PCT Appln. WO 03091426 PCT Appln. WO 03093810 PCT Appln. WO 03100448A1 PCT Appln. WO 04020085 PCT Appln. WO 04027093 PCT Appln. WO 09923256 PCT Appln. WO 09936760 PCT Appln. WO 93/17126 PCT Appln. WO 95/11995 PCT Appln. WO 95/21265 PCT Appln. WO 95/21944 PCT Appln. WO 95/35505 PCT Appln. WO 96/31622 PCT Appln. WO 97/10365 PCT Appln. WO 97/27317 PCT Appln. WO 9743450 PCT Appln. WO 99/35505 PCT Appln. WOO138580 PCT Appln. W003100012 UK Patent 1,529,202 UK Patent 8 803 000 Alevizos et al., Oncogene, 20(43):6196-6204, 2001.

WO 2008/085797 PCT/US2007/089206 Ambros, Cell, 107(7):823-826, 2001. Bae et al., J. Biol. Chem., 275(33):25255-25261, 2000. Bagga et al., Cell, 122(4):553-563, 2005. Bartlett et al., Biotechnol. Bioeng., 97(4): 909-921, 2007. Bartlett et al., Nucleic Acids Res., 43(1):322-333, 2006. Bartsch and Tschesche, FEBS Lett., 357(3):255-259, 1995. Brennecke et al., Cell, 113(1):25-36, 2003. Calin and Croce, Nat. Rev. Cancer, 6(11):857-866, 2006. Calin et al., Proc. Natl. Acad. Sci. USA, 99(24):15524-15529, 2002. Cao et al., Cell, 107(6):763-775, 2001. Carrano et al., Nat. Cell Biol., 1(4):193-199, 1999. Carrington and Ambros, Science, 301(5631):336-338, 2003. Chandler et al., Int. J. Cancer, 81(3):451-458, 1999. Cho-Vega et al., Hum. Pathol., 35(9):1095-1100, 2004. Claudio et al., Clin. Cancer Res, 8(6):1808-1815, 2002. Croci et al., Cancer Res., 64(5):1730-1736, 2004. Cully et al., Cancer Res., 65(22):10363-10370, 2005. Cummins et al., In: IRT.: Nucleosides and nucleosides, La Jolla CA, 72, 1996. Denli et al., Trends Biochem. Sci., 28:196, 2003. Didenko, Biotechniques, 31(5):1106-1116, 1118, 1120-1121, 2001. Dong et al., Crit. Rev. Oncol. Hematol., 54(2):85-93, 2005. Donnellan and Chetty, Mol. Pathol., 51(1):1-7, 1998. Einama et al., Pancreas, 32(4):376-381, 2006. Emptage et al., Neuron., 29(1):197-208, 2001. Esquela-Kerscher and Slack, Nat. Rev. Cancer, 6(4):259-269, 2006. Ezzat et al., Clin. Cancer Res., 11(3):1336-1341, 2005. Fernandez et al., Clin. Cancer Res., 11(15):5390-5395, 2005. Fleischer et al., Int. J. Oncol., 28(1):25-32, 2006. Fodor et al., Science, 251:767-777, 1991. Froehler et al., Nucleic Acids Res., 14(13):5399-5407, 1986. Furutani et al., Cancer Lett., 122(1-2):209-214, 1998. Griffey et al., J. Mass Spectrom, 32(3):305-13, 1997. Gstaiger et al., Proc. Natl. Acad. Sci. USA, 98(9):5043-5048, 2001. Hanahan and Weinberg, Cell, 100(1):57-70, 2000.

WO 2008/085797 PCT/US2007/089206 He et al., Nature, 435(7043):828-833, 2005. He et al., Proc. Natl. Acad. Sci. USA, 102(52):19075-19080, 2005. Hishikawa et al., J. Biol. Chem., 274(52):37461-37466, 1999. Home et al., J. Biol. Chem., 272(19):12650-12661, 1997. Huang et al., Proc. Natl. Acad. Sci. USA, 102(5):1649-1654, 2005. Huang et al., Clin. Cancer Res., 12(2):487-498, 2006. Iolascon et al., Hepatology, 27(4):989-995, 1998. Itakura and Riggs, Science, 209:1401-1405, 1980. Ito et al., Anticancer Res., 23(3B):2335-2338, 2003b. Ito et al., Anticancer Res., 23(5A):3819-3824, 2003a. Jaakkola et al., Int. J. Cancer, 54(3):378-382, 1993. Jiang et al., Oncogene, 24(21):3409-3418, 2005. Kamata et al., J. Cancer Res. Clin. Oncol., 131(9):591-596, 2005. Karin et al., Nat. Rev. Cancer, 2(4):301-310, 2002. Kaufiann et al., Blood, 91(3):991-1000, 1998. Kitada et al., Blood, 91(9):3379-3389, 1998. Klostermeier and Millar, Biopolymers, 61(3):159-79, 2001-2002. Koliopanos et al., World J Surg., 26(4):420-427, 2002. Komberg and Baker, In: DNA Replication, 2 "d Ed., Freeman, San Francisco, 1992. Krajewska et al., Am. J. Pathol., 148(5):1567-1576, 1996. Kulkami et al., Leukemia, 16(1):127-134, 2002. Lagos-Quintana et al., Science, 294(5543):853-858, 2001. Lau et al., Science, 294(5543):858-862, 2001. Lauffart et al., BMC Womens Health, 5:8, 2005. Lee and Ambros, Science, 294(5543):862-864, 2001. Lee et al., Int. J. Cancer, 118(10):2490-2497, 2006. Lim et al., Nature, 433(7027):769-773, 2005. Lin et al., Gastroenterology, 128(1):9-23, 2005. Lu et al., Nature, 435(7043):834-838, 2005. Marks, Semin. Cancer Biol., 16(6):436-443, 2006. Morishita et al., Hepatology, 40(3):677-686, 2004. Mrozek et al., Blood, 06-001149v1, 2006. Nakayama et al., Cancer, 92(12):3037-3044, 2001. Olsen et al., Dev. Biol., 216:671, 1999.

WO 2008/085797 PCT/US2007/089206 Ovcharenko et al., RNA, 11(6):985-93, 2005. Pan et al., Neurol Res., 24(7):677-683, 2002. Pennica et al., Proc. Nat!. Acad. Sci. USA, 95(25):14717-14722, 1998. Reinhart et al., Nature, 403(6772):901-906, 2000. Romieu-Mourez et al., Cancer Res., 61(9):3810-3818, 2001. Rubin and Gutmann, Nat. Rev. Cancer, 5(7):557-564, 2005. Rust et al., J. Clin. Pathol., 58(5):520-524, 2005. Saigusa et al., Cancer Sci, 96(10):676-683, 2005. Sambrook et al., In: DNA microaarays: a molecular cloning manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, 2001, 2003. Sanchez-Aguilera et al., Blood, 103(6):2351-2357, 2004. Sano et al., Histopathology, 46(5):532-539, 2005. Saxena et al., Mol. Cell Biochem., 228(1-2):99-104, 2001. Scheit, In: Synthesis and Biological Function, Wiley-Interscience, New York, 171-172, 1980. Schulze-Bergkamen et al., BMC Cancer, 6:232, 2006. Seggerson et al., Dev. Biol., 243:215, 2002. Shah et al., Oncogene, 21(54):8251-8261, 2002. Shibahara et al., Anticancer Res., 25(3B): 1881-1888, 2005. Shigemasa et al., Jpn. J. Cancer Res., 93(5):542-550, 2002. Shimo et al., Cancer Lett., 174(1):57-64, 2001. Sieghart et al., J. Hepatol., 44(1):151-157, 2006. Sui et al., Oncol. Rep., 15(4):765-771, 2006. Takanami, Oncol. Rep., 13(4):727-731, 2005. Takimoto et al., Biochem. Biophys. Res. Commun., 251(1):264-268, 1998. Traub et al., Breast Cancer Res. Treat., 99(2):185-191, 2006. Weil et al., Biotechniques., 33(6):1244-8, 2002. Wu et al., Eur J Cancer, 38(14):1838-1848, 2002. Wuilleme-Toumi et al., Leukemia, 19(7):1248-1252, 2005. Xu et al., Curr. Biol., 13(9):790-795, 2003. Yang et al., Cancer Res., 65(19):8887-8895, 2005. Zangemeister-Wittke and Huwiler, Cancer Biol. Ther., 5(10):1355-1356, 2006.

Claims

1. A method of modulating gene expression in a cell comprising administering to the cell an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence in an amount sufficient to modulate the expression of one or more gene identified in Table 1, 3, 4, or 5.

2. The method of claim 1, wherein the cell is in a subject having, suspected of having, or at risk of developing a metabolic, an immunologic, an infectious, a cardiovascular, a digestive, an endocrine, an ocular, a genitourinary, a blood, a musculoskeletal, a nervous system, a congenital, a respiratory, a skin, or a cancerous disease or condition.

3. The method of claim 2, wherein the infectious disease or condition is a parasitic, bacterial, viral, or fungal infection.

4. The method of claim 2, wherein the cancerous condition is astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, laryngeal squamous cell carcinoma, lung carcinoma, melanoma, medulloblastoma, mantle cell lymphoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, testicular tumor or thyroid carcinoma, wherein the modulation of one or more gene is sufficient for a therapeutic response.

5. The method of claim 4, wherein the cancerous condition is prostate carcinoma.

6. The method of claim 5, wherein the prostate carcinoma is associated with detectable prostate specific antigen (PSA, PSMA).

7. The method of claim 5. wherein the prostate carcinoma is androgen independent.

8. The method of claim 1, wherein the expression of a gene is down-regulated.

9. The method of claim 1, wherein the expression of a gene is up-regulated.

10. The method of claim 1, wherein the miR-16 nucleic acid is one or more of hsa-miR

16-1, hsa-miR-16-2, or a segment thereof. - 176- WO 2008/085797 PCT/US2007/089206 11. The method of claim 1, wherein the miR-16 nucleic acid is an inhibitor of miR-16 function. 12. The method of claim 1, wherein the cell is a brain, a neuronal, a blood, a cervical, an esophageal, a glial, a lung, a cardiovascular, a liver, a lymphoid, a breast, a bone, a thyroid, a glandular, an adrenal, a pancreatic a stomach, an intestinal, a a kidney, a bladder, a prostate, a uterus, an ovarian, a testicular, a splenic, a skin, a smooth muscle, a cardiac muscle, a striated muscle cell. 13. The method of claim 12, wherein the cell is a cancer cell. 14. The method of claim 13, wherein the cancer cell is a neuronal, glial, lung, liver, brain, breast, bladder, blood, cervical, leukemic, lymphpoid, colon, endometrial, stomach, skin, ovarian, esophageal, pancreatic, prostate, kidney, testicular or thyroid cell. 15. The method of claim 1, wherein the isolated miR-16 nucleic acid is a recombinant nucleic acid. 16. The method of claim 15, wherein the recombinant nucleic acid is an RNA.

17. The method of claim 15, wherein the recombinant nucleic acid is DNA.

18. The method of claim 17, wherein the recombinant nucleic acid comprises a miR-16 expression cassette.

19. The method of claim 18, wherein the expression cassette is comprised in a viral, or plasmid DNA vector.

20. The method of claim 19, wherein the viral vector is administered at a dose of 1x10 5 to lx101 viral particles per dose or the plasmid DNA vector is administered at a dose of 100 mg per patient to 4000 mg per patient.

21. The method of claim 1, wherein the miR- 16 nucleic acid is a synthetic nucleic acid.

22. The method of claim 21, wherein the nucleic acid is administered at a dose of 0.01 mg/kg of body weight to 10 mg/kg of body weight.

23. The method of claim 1, wherein the nucleic acid is administered enterally or parenterally.

24. The method of claim 23, wherein enteral administration is orally. - 177 - WO 2008/085797 PCT/US2007/089206

25. The method of claim 23, wherein parenteral administration is intravascular, intracranial, intrapleural, intratumoral, intraperitoneal, intramuscular, intralymphatic, intraglandular, subcutaneous, topical, intrabronchial, intratracheal, intranasal, inhaled, or instilled.

26. The method of claim 1, wherein the nucleic acid is comprised in a pharmaceutical formulation.

27. The method of claim 26, wherein the pharmaceutical formulation is a lipid composition.

28. The method of claim 26, wherein the pharmaceutical formulation is a nanoparticle composition.

29. The method of claim 26, wherein the pharmaceutical formulation consists of biocompatible and/or biodegradable molecules.

30. A method of modulating a cellular pathway comprising administering to a cell an amount of an isolated nucleic acid comprising a miR- 16 nucleic acid sequence in an amount sufficient to modulate the expression of a gene associated with a cellular pathway that includes one or more gene identified in Table 1, 3, 4, or 5.

31. The method of claim 30, further comprising administering 2, 3, 4, 5, 6, or more miRNAs.

32. The method claim 31, wherein the miRNAs are comprised in a single composition.

33. The method of claim 30, wherein at least two cellular pathways or physiologic pathways are modulated.

34. The method of claim 31, wherein at least one gene is modulated by multiple miRNAs.

35. The method of claim 30, wherein the expression of a gene is down-regulated.

36. The method of claim 30, wherein the expression of a gene is up-regulated.

37. The method of claim 30, wherein the miR-16 nucleic acid is one or more of hsa-miR 16-1, hsa-miR-16-2, or a segment thereof.

38. The method of claim 30, wherein the cell is a cancer cell. -1 7R - WO 2008/085797 PCT/US2007/089206

39. The method of claim 30, wherein the modulation of a cellular pathway results in reduced viability, reduced proliferation, reduced metastasis, or increased sensitivity to therapy.

40. The method of claim 38, wherein the cancer cell is a neuronal, glial, lung, liver, brain, breast, cervical, bladder, blood, leukemic, lymphoid, colon, endometrial, stomach, skin, ovarian, esophageal, pancreatic, prostate, kidney, testicular or thyroid cell.

41. The method of claim 30, wherein the isolated miR-16 nucleic acid is a recombinant nucleic acid.

42. The method of claim 41, wherein the recombinant nucleic acid is DNA.

43. The method of claim 42, wherein the recombinant nucleic acid is a viral or a plasmid DNA vector.

44. The method of claim 30, wherein the miR-16 nucleic acid is a synthetic nucleic acid.

45. The method of claim 30, wherein the miR-16 nucleic acid is RNA.

46. A method of treating a patient diagnosed with or suspected of having or suspected of developing a pathological condition or disease related to a gene modulated by a miRNA comprising the steps of: (a) administering to the patient an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence in an amount sufficient to modulate a cellular pathway or a physiologic pathway; and (b) administering a second therapy, wherein the modulation of the cellular pathway or physiologic pathway sensitizes the patient to the second therapy.

47. The method of claim 46, wherein one or more cellular pathway or physiologic pathway includes one or more genes identified in Table 1, 3, 4, and 5.

48. A method of selecting a miRNA to be administered to a subject with, suspected of having, or having a propensity for developing a pathological condition or disease comprising: (a) determining an expression profile of one or more genes selected from Table 1, 3, 4, and 5; (b) assessing the sensitivity of the subject to miRNA therapy based on the expression profile; and -179- WO 2008/085797 PCT/US2007/089206 (c) selecting one or more miRNA based on the assessed sensitivity.

49. The method of claim 48 further comprising treating the subject with 1, 2, 4, 5, 6, 7, 8, 9, 10, or more miRNAs.

50. The method of claim 49, wherein each miRNA is administered individually or one or more combinations.

51. The method of claim 50, wherein the miRNAs are in a single composition.

52. A method of assessing a cell, tissue, or subject comprising assessing expression of miR-16 in combination with assessing expression of one or more gene from Table 1, 3, 4, or 5 in at least one sample.

53. A method of assessing miR-16 status in a sample comprising the steps of: (a) assessing expression of one or more genes from Table 1, 3, 4, or 5 in a sample; and (b) determining miR-16 status based on level of miR-16 expression in the sample. -1 kn