CA2671302A1 - Mirna regulated genes and pathways as targets for therapeutic intervention - Google Patents

Abstract

The present invention concerns methods and compositions for identifying genes or genetic pathways modulated by miR-16, using miR-16 to modulate a gene or gene pathway, using this profile in assessing the condition of a patient and/or treating the patient with an appropriate miRNA.

Description

DESCRIPTION
miRNA REGULATED GENES AND PATHWAYS AS TARGETS FOR
THERAPEUTIC INTERVENTION

[0001] This application is related to U.S. Patent Applications serial number 11/141,707 filed May 31, 2005 and serial number 11/273,640 filed November 14, 2005, each of which is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION
1. FIELD OF THE INVENTION

[0002] The present invention relates to the fields of molecular biology and medicine.
More specifically, the invention relates to methods and compositions for the treatment of diseases or conditions that are affected by miR-16 microRNAs, microRNA
expression, and genes and cellular pathways directly and indirectly modulated by such.

II. BACKGROUND

[0003] In 2001, several groups used a cloning method to isolate and identify a large group of "microRNAs" (miRNAs) from C. elegans, Drosophila, and humans (Lagos-Quintana et al., 2001; Lau et al., 2001; Lee and Ambros, 2001). Several hundreds of miRNAs have been identified in plants and animals - including humans - which do not appear to have endogenous siRNAs. Thus, while similar to siRNAs, miRNAs are distinct.

[0004] miRNAs thus far observed have been approximately 21-22 nucleotides in length and they arise from longer precursors, which are transcribed from non-protein-encoding genes. See review of Carrington et al. (2003). The precursors form structures that fold back on themselves in self-complementary regions; they are then processed by the nuclease Dicer in animals or DCL 1 in plants. miRNA molecules interrupt translation through precise or imprecise base-pairing with their targets.

[0005] Many miRNAs are conserved among diverse organisms, and this has led to the suggestion that miRNAs are involved in essential biological processes throughout the life span of an organism (Esquela-Kerscher and Slack, 2006). In particular, miRNAs have been implicated in regulating cell growth, and cell and tissue differentiation;
cellular processes that are associated with the development of cancer. For instance, lin-4 and miR- 16 both regulate passage from one larval state to another during C. elegans development (Ambros, 2001).
mir-14 and bantam are Drosophila miRNAs that regulate cell death, apparently by regulating the expression of genes involved in apoptosis (Brennecke et al., 2003, Xu et al., 2003).

[0006] Research on miRNAs is increasing as scientists are beginning to appreciate the broad role that these molecules play in the regulation of eukaryotic gene expression. In particular, several recent studies have shown that expression levels of numerous miRNAs are associated with various cancers (reviewed in Esquela-Kerscher and Slack, 2006). Reduced expression of two miRNAs correlates strongly with chronic lymphocytic leukemia in humans, providing a possible link between miRNAs and cancer (Calin et al., 2002). Others have evaluated the expression patterns of large numbers of miRNAs in multiple human cancers and observed differential expression of almost all miRNAs across numerous cancer types (Lu et al., 2005). Most studies link miRNAs to cancer only by indirect evidence.
However, He et al. (2005) has provided more direct evidence that miRNAs may contribute directly to causing cancer by forcing the over-expression of six miRNAs in mice that resulted in a significant increase in B cell lymphomas.

[0007] Others have shown that miR-16 is down-regulated in B-cells from patients with chronic lymphocytic leukemia (Calin et al., 2002). Reduced expression of these miRNAs in B cell lymphomas results in overexpression of a miR-16 target gene, BCL2, and subsequent inhibition of apoptosis by the BCL2 gene product. This results in uncontrolled cellular proliferation and B cell malignancy (reviewed in Calin and Croce, 2006).
Together these data suggest that miR-16-1 appears to function as a tumor suppressor in human B cells.

[0008] The inventors previously demonstrated that hsa-miR-16 is involved with the regulation of numerous cell activities that represent intervention points for cancer therapy and for therapy of other diseases and disorders (U.S. Patent Applications serial number 11/141,707 filed May 31, 2005 and serial number 11/273,640 filed November 14, 2005).
Expression of miR- 16 was reduced in lung tumors from numerous lung cancer patients when compared to its expression in normal adjacent lung tissues from the same patients. The inventors observed increased expression of miR-16 in breast and prostate tumors as compared to expression in adjacent normal cells from the same cancer patients. In human foreskin fibroblasts, hsa-miR-16 activated the hTert gene that encodes the catalytic domain of telomerase. Over 90% of human cancer samples have active telomerase (reviewed in Dong et al., 2005). Hsa-miR-16 also induces cells to enter the S phase of the cell cycle and decreases the proliferation of lung cancer cells (A549 and HTB-57 lung carcinoma cells), prostate cancer cells (22Rvl), and human basal cell carcinomas (TE354T). Anti-miR
inhibitors of hsa-miR- 16 increased the proliferation of non-malignant human breast epithelial cells and basal cell carcinoma cells (TE354T). In addition, the inventors previously observed that hsa-miR-16 is up-regulated in patients with prion disease and Alzheimer's disease when compared to patients without those diseases. As is the case for cancer therapy, genes and pathways that are altered by expression of hsa-miR-16 represent targets for therapeutic intervention in the treatment of certain diseases like Alzheimer's Disease and prion diseases, in which hsa-miR- 16 likely plays a role.

[0009] In animals, most miRNAs are thought to interact with target genes through imprecise base pairing within the 3' untranslated regions of their gene targets. Regulation of target genes by miRNAs is thought to occur primarily by translation inhibition, but mRNA
instability may also be a mechanism (Reinhart et al., 2000; Bagga et al., 2005).
Bioinformatics analyses suggest that any given miRNA may bind to and alter the expression of up to several hundred different genes. In addition, a single gene may be regulated by several miRNAs. Thus, each miRNA may regulate a complex interaction among genes, gene pathways, and gene networks. Mis-regulation or alteration of these regulatory pathways and networks, involving miRNAs, are likely to contribute to the development of disorders and diseases such as cancer. Although bioinformatics tools are helpful in predicting miRNA
binding targets, all have limitations. Because of the imperfect complementarity with their target binding sites, it is difficult to accurately predict miRNA targets with bioinformatics tools alone. Furthermore, the complicated interactive regulatory networks among miRNAs and target genes make it difficult to accurately predict which genes will actually be mis-regulated in response to a given miRNA.

[0010] Correcting gene expression errors by manipulating miRNA expression or by repairing miRNA mis-regulation represent promising methods to repair genetic disorders and cure diseases like cancer. A current, disabling limitation of this approach is that, as mentioned above, the details of the regulatory pathways and networks that are affected by any given miRNA remain largely unknown. Besides BCL2, the genes, gene pathways, and gene networks that are regulated by miR-16 in cancerous cells remain largely unknown.
Currently, this represents a significant limitation for treatment of cancers in which miR-16 may play a role. A need exists to identify the genes, genetic pathways, and genetic networks that are regulated by or that may regulate hsa-miR- 16 expression.

SUMMARY OF THE INVENTION

[0011] The present invention provides additional compositions and methods to address problems in the art by identifying genes in cancer cells that are direct targets for hsa-miR-16 regulation or that are downstream targets of regulation following the hsa-miR-16-mediated modification of upstream gene expression. Furthermore, the invention describes gene, disease, and/or physiologic pathways and networks that are influenced by hsa-miR-16. Many of these genes and pathways are associated with various cancers and other diseases. The altered expression of miR-16 in cells would lead to changes in the expression of these key genes and contribute to the development of disease. Introducing miR- 16 (for diseases where the miRNA is down-regulated) or a miR- 16 inhibitor (for diseases where the miRNA is up-regulated) into disease cells or tissues would result in a therapeutic response. The identities of key genes that are regulated directly or indirectly by miR-16 and the disease with which they are associated are provided herein. In certain aspects a cell may be an epithelial, stromal, or mucosal cell. The cell can be, but is not limited to brain, a neuronal, a blood, an esophageal, a lung, a cardiovascular, a liver, a breast, a bone, a thyroid, a glandular, an adrenal, a pancreatic, a stomach, a intestinal, a kidney, a bladder, a prostate, a uterus, an ovarian, a testicular, a splenic, a skin, a smooth muscle, a cardiac muscle, or a striated muscle cell. In certain aspects, the cell, tissue, or target may not be defective in miRNA expression yet may still respond therapeutically to expression or over expression of a miRNA. miR-16 could be used as a therapeutic target for any of these diseases. In certain aspects, compositions of the invention are administered to a subject having, suspected of having, or at risk of developing a metabolic, an immunologic, an infectious, a cardiovascular, a digestive, an endocrine, an ocular, a genitourinary, a blood, a musculoskeletal, a nervous system, a congenital, a respiratory, a skin, or a cancerous disease or condition.

[0012] In particular aspects, a subject or patient may be selected for treatment based on expression and/or aberrant expression of one or more miRNA or mRNA. In a further aspect, a subject or patient may be selected for treatment based on aberrations in one or more biologic or physiologic pathway(s), including aberrant expression of one or more gene associated with a pathway, or the aberrant expression of one or more protein encoded by one or more gene associated with a pathway. In still a further aspect, a subject or patient may be selected based on aberrations in miRNA expression, or biologic and/or physiologic pathway(s). A subject may be assessed for sensitivity, resistance, and/or efficacy of a therapy or treatment regime based on the evaluation and/or analysis of miRNA or mRNA
expression or lack thereof. A subject may be evaluated for amenability to certain therapy prior to, during, or after administration of one or therapy to a subject or patient.
Typically, evaluation or assessment may be done by analysis of miRNA and/or mRNA, as well as combination of other assessment methods that include but are not limited to histology, immunohistochemistry, blood work, etc.

[0013] In some embodiments, an infectious disease or condition includes a bacterial, viral, parasite, or fungal infection. Many of these genes and pathways are associated with various cancers and other diseases. Cancerous conditions include, but are not limited to anaplastic large cell lymphoma, B-cell lymphoma, chronic lymphoblastic leukemia, multiple myeloma, testicular tumor, astrocytoma, acute myelogenous leukemia, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, esophageal squamous cell carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, leukemia, lipoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, multiple myeloma, neuroblastoma, non-Hodgkin lymphoma, lung carcinoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, urothelial carcinoma wherein the modulation of one or more gene is sufficient for a therapeutic response. Typically a cancerous condition is an aberrant hyperproliferative condition associated with the uncontrolled growth or inability to undergo cell death, including apoptosis.

[0014] A cell, tissue, or subject may be a cancer cell, a cancerous tissue, harbor cancerous tissue, or be a subject or patient diagnosed or at risk of developing a disease or condition.. In certain aspects a cancer cell is a neuronal, glial, lung, liver, brain, breast, bladder, blood, leukemic, colon, endometrial, stomach, skin, ovarian, fat, bone, cervical, esophageal, pancreatic, prostate, kidney, testicular or thyroid cell. In still a further aspect cancer includes, but is not limited to anaplastic large cell lymphoma, B-cell lymphoma, chronic lymphoblastic leukemia, multiple myeloma, testicular tumor, astrocytoma, acute myelogenous leukemia, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, esophageal squamous cell carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, leukemia, lipoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, multiple myeloma, neuroblastoma, non-Hodgkin lymphoma, lung carcinoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, urothelial carcinoma.

[0015] In certain aspects, the gene or genes modulated comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200 or more genes or any combination of genes identified in Table 1, 2, 4 and 5. In certain aspects the expression of a gene is down-regulated or up-regulated. In a particular aspect the gene modulated comprises or is selected from (and may even exclude) 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or all of genes identified in Table 1, 2, 4 and 5, in various combinations and permutations. In particular embodiments, the invention may exclude or choose not to include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200 or more genes or any combination of genes identified in Table 1, 2, 4 and 5, e.g., BCL2, RARS (arginyl-tRNA synthetase), BTG2, WTI, PPM1D, PAK7, and/or RAB9B. In one particular aspect the gene modulated or selected to modulate includes one or more genes of Table 1, 2, 4 and/or 5 provided that RARS (arginyl-tRNA
synthetase), BTG2, WT1, PPM1D, PAK7, and/or RAB9B is not included.

[0016] Embodiments of the invention include methods of modulating gene expression, or biologic or physiologic pathways in a cell, a tissue, or a subject comprising administering to the cell, tissue, or subject an amount of an isolated nucleic acid or mimetic thereof comprising a miR- 16 nucleic acid, mimetic, or inhibitor sequence in an amount sufficient to modulate the expression of a gene positively or negatively modulated by a miR-16 miRNA.
A"miR-16 nucleic acid sequence" or "miR-16 inhibitor" includes the full length precursor of miR-16, or complement thereof or processed (i.e., mature) sequence of miR-16 and related sequences set forth herein, as well as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or more nucleotides of a precursor miRNA or its processed sequence, or complement thereof, including all ranges and integers there between. In certain embodiments, the miR- 16 nucleic acid sequence or miR- 16 inhibitor contains the full-length processed miRNA sequence or complement thereof and is referred to as the "miR-16 full-length processed nucleic acid sequence" or "miR-16 full-length processed inhibitor sequence." In still further aspects, the miR-16 nucleic acid comprises at least one 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50 nucleotide (including all ranges and integers there between) segment or complementary segment of a miR-16 that is at least 75, 80, 85, 90, 95, 98, 99 or 100% identical to SEQ ID NOs provided herein. The general tenn miR-16 includes all members of the miR-16 family that share at least part of a mature miR-16 sequence. In still further aspects, the miR-16 nucleic acid comprises at least one 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 232, 24, 25, 50 nucleotide (including all ranges and integers there between) segment of miR-16 that is at least 75, 80, 85, 90, 95, 98, 99 or 100% identical to SEQ ID NOs:1-3 (SEQ ID NO:1 uagcagcacguaaauauuggcg (accession - MIMAT0000069), SEQ ID NO:2 (hsa-mir-16-1, accession - M10000070) gucagcagugccuuagcagcacguaaauauuggcguuaagauucuaaaauuau cuccaguauuaacugugcugcugaaguaagguugac; SEQ ID NO:3 (hsa-mir-16-2, accession MI0000115) guuccacucuagcagcacguaaauauuggcguagugaaauauauauuaaacaccaauauuacug ugcugcuuuagugugac). In certain embodiments the gene modulated or selected to modulate is from Table 1. In further embodiments the gene modulated or selected to modulate is from Table 2. In still further embodiments the gene modulated or selected to modulate is from Table 4. In yet further embodiments the gene modulated or selected to modulate is from Table 5. Embodiments of the invention may also include obtaining or assessing a gene expression profile or miRNA profile of a target cell prior to selecting the mode of treatment, e.g., administration of a miR- 16 nucleic acid.

[0017] In certain aspects, a miR-16 nucleic acid, or a segment or a mimetic thereof, will comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or more nucleotides of the precursor miRNA or its processed sequence, including all ranges and integers there between. In certain embodiments, the miR-16 nucleic acid sequence contains the full-length processed miRNA sequence and is referred to as the "miR-16 full-length processed nucleic acid sequence." In still further aspects, a miR-16 comprises at least one 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50 nucleotide (including all ranges and integers there between) segment of miR-16 that is at least 75, 80, 85, 90, 95, 98, 99 or 100% identical to SEQ ID NOs provided herein.

[0018] In specific embodiments, a miR-16 or miR- 16 inhibitor containing nucleic acid is a hsa-miR-16 or hsa-miR-16 inhibitor, or a variation thereof. In a further aspect, a miR-16 nucleic acid or miR-16 inhibitor can be administered with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more miRNAs or miRNA inhibitors. miRNAs or their complements can be administered concurrently, sequentially, or in an ordered progression. In certain aspects, a miR- 16 or miR-16 inhibitor can be administered in combination with one or more of let-7, miR-15, miR-126, miR-20, miR-21, miR-26a, miR-34a, miR-143, miR-147, miR-188, miR-200, miR-215, miR-216, miR-292-3p, and/or miR-33 1. All or combinations of miRNAs or inhibitors thereof may be administered in a single formulation. Administration may be before, during or after a second therapy.

[0019] miR-16 nucleic acids or complement thereof may also include various heterologous nucleic acid sequences, i.e., those sequences not typically found operatively coupled with miR-16 in nature, such as promoters, enhancers, and the like. The miR-16 nucleic acid is a recombinant nucleic acid, and can be a ribonucleic acid or a deoxyribonucleic acid. The recombinant nucleic acid may comprise a miR-16 or miR-16 inhibitor expression cassette, i.e., a nucleic acid segment that expresses a nucleic acid when introduce into an environment containing components for nucleic acid synthesis. In a further aspect, the expression cassette is comprised in a viral vector, or plasmid DNA
vector or other therapeutic nucleic acid vector or delivery vehicle, including liposomes and the like. In a particular aspect, the miR-16 nucleic acid is a synthetic nucleic acid.
Moreover, nucleic acids of the invention may be fully or partially synthetic. In certain aspects, viral vectors can be administered at 1x102, 1x103, 1x104 1x105, 1x106, 1x107, 1x10g, 1x109, 1x101 , 1x10ll, 1x1012, 1x10r3, 1x1014 pfu or viral particle (vp).

[0020] In a particular aspect, the miR- 16 nucleic acid or miR- 16 inhibitor is a synthetic nucleic acid. Moreover, nucleic acids of the invention may be fully or partially synthetic. In still further aspects, a nucleic acid of the invention or a DNA encoding such a nucleic acid of the invention can be administered at 0.001, 0.01, 0.1, 1, 10, 20, 30, 40, 50, 100, 200, 400, 600, 800, 1000, 2000, to 4000 g or mg, including all values and ranges there between. In yet a further aspect, nucleic acids of the invention, including synthetic nucleic acid, can be administered at 0.001, 0.01, 0.1, 1, 10, 20, 30, 40, 50, 100, to 200 g or mg per kilogram (kg) of body weight. Each of the amounts described herein may be administered over a period of time, including 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, minutes, hours, days, weeks, months or years, including all values and ranges there between.

[00211 In certain embodiments, administration of the composition(s) can be enteral or parenteral. In certain aspects, enteral administration is oral. In further aspects, parenteral administration is intralesional, intravascular, intracranial, intrapleural, intratumoral, intraperitoneal, intramuscular, intralymphatic, intraglandular, subcutaneous, topical, intrabronchial, intratracheal, intranasal, inhaled, or instilled. Compositions of the invention may be administered regionally or locally and not necessarily directly into a lesion.

[0022] A cell, tissue, or subject may be or suffer from an abnormal or pathologic condition, or in the case of a cell or tissue, the component of a pathological condition. In certain aspects, a cell, tissue, or subject is a cancer cell, a cancerous tissue or harbor cancerous tissue, or a cancer patient. In a particular aspect the cancer is neuronal, glial, lung, liver, brain, breast, bladder, blood, leukemic, colon, endometrial, stomach, skin, ovarian, esophageal, pancreatic, prostate, kidney, or thyroid cancer. The database content related to all nucleic acids and genes designated by an accession number or a database submission are incorporated herein by reference as of the filing date of this application.

[0023] A further embodiment of the invention is directed to methods of modulating a cellular pathway comprising administering to the cell an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence in an amount sufficient to modulate the expression, function, status, or state of a cellular pathway, in particular those pathways described in Table 2 or the pathways known to include one or more genes from Table 1, 3, 4, and/or 5. Modulation of a cellular pathway includes, but is not limited to modulating the expression of one or more gene. Modulation of a gene can include inhibiting the function of an endogenous miRNA or providing a functional miRNA to a cell, tissue, or subject.
Modulation refers to the expression levels or activities of a gene or its related gene product or protein, e.g., the mRNA levels may be modulated or the translation of an mRNA
may be modulated, etc. Modulation may increase or up regulate a gene or gene product or it may decrease or down regulate a gene or gene product.

[0024] Still a further embodiment includes methods of treating a patient with a pathological condition comprising one or more of step (a) administering to the patient an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence in an amount sufficient to modulate the expression of a cellular pathway; and (b) administering a second therapy, wherein the modulation of the cellular pathway sensitizes the patient to the second therapy. A cellular pathway may include, but is not limited to one or more pathway described in Table 2 below or a pathway that is known to include one or more gene of Table 1, 3, 4, and/or S. A second therapy can include a second miRNA or other nucleic acid therapy or one or more standard therapies, such as chemotherapy, drug therapy, radiation therapy, immunotherapy, thermal therapy, and the like.

[0025] Embodiments of the invention include methods of treating a subject with a pathological condition comprising one or more of the steps of (a) determining an expression profile of one or more genes selected from Table 1, 3, 4, and/or 5; (b) assessing the sensitivity of the subject to therapy based on the expression profile; (c) selecting a therapy based on the assessed sensitivity; and (d) treating the subject using selected therapy.
Typically, the pathological condition will have as a component, indicator, or result the mis-regulation of one or more gene of Table 1, 3, 4, and/or 5.

[0026] Further embodiments include the identification and assessment of an expression profile indicative of miR-16 status in a cell or tissue comprising expression assessment of one or more gene from Table 1, 3, 4, and/or 5, or any combination thereof.

[0027] The term "miRNA" is used according to its ordinary and plain meaning and refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation.
See, e.g., Carrington et al., 2003, which is hereby incorporated by reference.
The term can be used to refer to the single-stranded RNA molecule processed from a precursor or in certain instances the precursor itself.

[0028] In some embodiments, it may be useful to know whether a cell expresses a particular miRNA endogenously or whether such expression is affected under particular conditions or when it is in a particular disease state. Thus, in some embodiments of the invention, methods include assaying a cell or a sample containing a cell for the presence of one or more marker gene or mRNA or other analyte indicative of the expression level of a gene of interest. Consequently, in some embodiments, methods include a step of generating an RNA profile for a sample. The term "RNA profile" or "gene expression profile" refers to a set of data regarding the expression pattern for one or more gene or genetic marker in the sample (e.g., a plurality of nucleic acid probes that identify one or more markers from Table 1, 3, 4, and/or 5); it is contemplated that the nucleic acid profile can be obtained using a set of RNAs, using for example nucleic acid amplification or hybridization techniques well known to one of ordinary skill in the art. The difference in the expression profile in the sample from the patient and a reference expression profile, such as an expression profile from a normal or non-pathologic sample, is indicative of a pathologic, disease, or cancerous condition. A

nucleic acid or probe set comprising or identifying a segment of a corresponding mRNA can include all or part of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 100, 200, 500, or more, including any integer or range derivable there between, of a gene or genetic marker, or a nucleic acid, mRNA or a probe representative thereof that is listed in Table 1, 3, 4, and/or 5, or identified by the methods described herein.

[0029] Certain embodiments of the invention are directed to compositions and methods for assessing, prognosing, or treating a pathological condition in a patient comprising measuring or determining an expression profile of one or more marker(s) in a sample from the patient, wherein a difference in the expression profile in the sample from the patient and an expression profile of a normal sample or reference expression profile is indicative of pathological condition and particularly cancer. In certain aspects of the invention, the cellular pathway, gene, or genetic marker is or is representative of one or more pathway or marker described in Table 1, 3, 4, and/or 5, including any combination thereof and excluding 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more genes.

[0030] Aspects of the invention include treating, diagnosing, or prognosing a pathologic condition or preventing a pathologic condition from manifesting. For example, the methods can be used to screen for a pathological condition; assess prognosis of a pathological condition; stage a pathological condition; assess response of a pathological condition to therapy; or to modulate the expression of a gene, genes, or related pathway as a first therapy or to render a subject sensitive or more responsive to a second therapy. In particular aspects, assessing the pathological condition of the patient can be assessing prognosis of the patient.
Prognosis may include, but is not limited to an estimation of the time or expected time of survival, assessment of response to a therapy, and the like. In certain aspects, the altered expression of one or more gene or marker is prognostic for a patient having a pathologic condition, wherein the marker is one or more of Table 1, 3, 4, and/or 5, including any combination thereof.

[00311 Certain embodiments of the invention include determining expression of one or more marker, gene, or nucleic acid representative thereof, by using an amplification assay, a hybridization assay, or protein assay, a variety of which are well known to one of ordinary skill in the art. In certain aspects, an amplification assay can be a quantitative amplification assay, such as quantitative RT-PCR or the like. In still further aspects, a hybridization assay can include array hybridization assays or solution hybridization assays. The nucleic acids from a sample may be labeled from the sample and/or hybridizing the labeled nucleic acid to one or more nucleic acid probes. Nucleic acids, mRNA, and/or nucleic acid probes may be coupled to a support. Such supports are well known to those of ordinary skill in the art and include, but are not limited to glass, plastic, metal, or latex. In particular aspects of the invention, the support can be planar or in the form of a bead or other geometric shapes or configurations known in the art. Proteins are typically assayed by immunoblotting, chromatography, mass spectrometry or other methods known to those of ordinary skill in the art.

[0032] A further embodiment of the invention is directed to methods of modulating a cellular pathway comprising administering to the cell an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence or a miR-16 inhibitor. A cell, tissue, or subject may be a cancer cell, a cancerous tissue or harbor cancerous tissue, or a cancer patient. The database content related to all nucleic acids and genes designated by an accession number or a database submission are incorporated herein by reference as of the filing date of this application.

[0033] A further embodiment of the invention is directed to methods of modulating a cellular pathway comprising administering to the cell an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence in an amount sufficient to modulate the expression, function, status, or state of a cellular pathway, in particular those pathways described or the pathways known to include one or more genes described herein.
Modulation of a cellular pathway includes, but is not limited to modulating the expression of one or more gene(s). Modulation of a gene can include inhibiting the function of an endogenous miRNA
or providing a functional miRNA to a cell, tissue, or subject. Modulation refers to the expression levels or activities of a gene or its related gene product (e.g., mRNA) or protein, e.g., the mRNA levels may be modulated or the translation of an mRNA may be modulated.
Modulation may increase or up regulate a gene or gene product or it may decrease or down regulate a gene or gene product (e.g., protein levels or activity).

[0034] Still a further embodiment includes methods of administering an miRNA
or mimic thereof, and/or treating a subject or patient having, suspected of having, or at risk of developing a pathological condition comprising one or more of step (a) administering to a patient or subject an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence or a miR-16 inhibitor in an amount sufficient to modulate expression of a cellular pathway; and (b) administering a second therapy, wherein the modulation of the cellular pathway sensitizes the patient or subject, or increases the efficacy of a second therapy. An increase in efficacy can include a reduction in toxicity, a reduced dosage or duration of the second therapy, or an additive or synergistic effect. A cellular pathway may include, but is not limited to one or more pathway described herein or a pathway that is know to include one or more genes in the tables herein. The second therapy may be administered before, during, and/or after the isolated nucleic acid or miRNA or inhibitor is administered [0035] A second therapy can include administration of a second miRNA or therapeutic nucleic acid such as a siRNA or antisense oligonucleotide, or may include various standard therapies, such as pharmaceuticals, chemotherapy, radiation therapy, drug therapy, immunotherapy, and the like. Embodiments of the invention may also include the determination or assessment of gene expression or gene expression profile for the selection of an appropriate therapy. In a particular aspect, a second therapy is chemotherapy. A
chemotherapy can include, but is not limited to paclitaxel, cisplatin, carboplatin, doxorubicin, oxaliplatin, larotaxel, taxol, lapatinib, docetaxel, methotrexate, capecitabine, vinorelbine, cyclophosphamide, gemcitabine, amrubicin, cytarabine, etoposide, camptothecin, dexamethasone, dasatinib, tipifarnib, bevacizumab, sirolimus, temsirolimus, everolimus, lonafarnib, cetuximab, erlotinib, gefitinib, imatinib mesylate, rituximab, trastuzumab, nocodazole, sorafenib, sunitinib, bortezomib, alemtuzumab, gemtuzumab, tositumomab or ibritumomab.

[0036] Embodiments of the invention include methods of treating a subject with a disease or condition comprising one or more of the steps of (a) determining an expression profile of one or more genes selected from the tables; (b) assessing the sensitivity of the subject to therapy based on the expression profile; (c) selecting a therapy based on the assessed sensitivity; and (d) treating the subject using a selected therapy. Typically, the disease or condition will have as a component, indicator, or resulting mis-regulation of one or more gene described herein.

[0037] In certain aspects, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more miRNA may be used in sequence or in combination. For instance, any combination of miR-16 or a miR-16 inhibitor with another miRNA. Further embodiments include the identification and assessment of an expression profile indicative of miR-16 status in a cell or tissue comprising expression assessment of one or more gene from the tables, or any combination thereof.

[0038] The term "miRNA" is used according to its ordinary and plain meaning and refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation.
See, e.g., Carrington et al., 2003, which is hereby incorporated by reference.
The term can be used to refer to the single-stranded RNA molecule processed from a precursor or in certain instances the precursor itself.

[0039] In some embodiments, it may be useful to know whether a cell expresses a particular miRNA endogenously or whether such expression is affected under particular conditions or when it is in a particular disease state. Thus, in some embodiments of the invention, methods include assaying a cell or a sample containing a cell for the presence of one or more marker gene or mRNA or other analyte indicative of the expression level of a gene of interest. Consequently, in some embodiments, methods include a step of generating an RNA profile for a sample. The term "RNA profile" or "gene expression profile" refers to a set of data regarding the expression pattern for one or more gene or genetic marker or miRNA in the sample (e.g., a plurality of nucleic acid probes that identify one or more markers from the tables; it is contemplated that the nucleic acid profile can be obtained using a set of RNAs, using for example nucleic acid amplification or hybridization techniques well know to one of ordinary skill in the art. The difference in the expression profile in the sample from the patient and a reference expression profile, such as an expression profile of one or more genes or miRNAs, are indicative of which miRNAs to be administered.

[0040] In certain aspects, miR-16 or miR-16 inhibitor and let-7 or let-7 inhibitor are administered to patients with astrocytoma, breast carcinoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, melanoma, medulloblastoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

[0041] Further aspects include administering miR-16 or miR-16 inhibitor and miR-10 or miR- 10 inhibitor to patients with astrocytoma, breast carcinoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, melanoma, mantle cell lymphoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma [0042] In yet another aspect, miR- 16 or miR- 16 inhibitor and miR-15 or miR-15 inhibitor can be administered to patients with astrocytoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, laryngeal squamous cell carcinoma, melanoma, medulloblastoma, mantle cell lymphoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

[0043] In still further aspects, miR-16 or miR-16 inhibitor and miR-20 or miR-inhibitor are administered to patients with astrocytoma, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

[0044] In certain aspects, miR-16 or miR-16 inhibitor and miR-21 or miR-21 inhibitor are administered to patients with astrocytoma, breast carcinoma, bladder carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, melanoma, mantle cell lymphoma, myeloid leukemia, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck.

[0045] Aspects of the invention include methods where miR-16 or miR-16 inhibitor and miR-26 or miR-26 inhibitor are administered to patients with anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, lung carcinoma, melanoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, rhabdomyosarcoma, testicular tumor.

[0046] In still further aspects, miR-16 or miR-16 inhibitor and miR-34 or miR-inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, laryngeal squamous cell carcinoma, melanoma, medulloblastoma, mantle cell lymphoma, myeloid leukemia, multiple myeloma, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0047] In still a further aspect, miR-16 or miR-16 inhibitor and miR-124 or miR-124 inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, laryngeal squamous cell carcinoma, melanoma, medulloblastoma, mantle cell lymphoma, myxofibrosarcoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0048] In yet further aspects, miR-16 or miR-16 inhibitor and miR-126 or miR-inhibitor are administered to patients with astrocytoma, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, melanoma, mantle cell lymphoma, myeloid leukemia, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

[0049] In yet further aspects, miR-16 or miR-16 inhibitor and miR-143 or miR-inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, melanoma, medulloblastoma, mantle cell lymphoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0050] In a further aspect, miR-].6 or miR- 16 inhibitor and miR-147 or miR-147 inhibitor are administered to patients with astrocytoma, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

[0051] In still a fiuther aspect, miR-16 or miR-16 inhibitor and miR-188 or miR-188 inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, lung carcinoma, melanoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0052] In a further aspect, miR- 16 or miR- 16 inhibitor and miR-200 or miR-200 inhibitor are administered to patients with anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, lung carcinoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0053] In yet another aspect, miR-16 or miR-16 inhibitor and miR-215 or miR-inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0054] In yet a further aspect, miR-16 or miR-16 inhibitor and miR-216 or miR-inhibitor are administered to patients with astrocytoma, breast carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, lung carcinoma, myeloid leukemia, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, prostate carcinoma, pheochromocytoma, squamous cell carcinoma of the head and neck, testicular tumor.

[0055] In other aspects, miR-16 or miR-16 inhibitor and miR-292-3p or miR-292-3p inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, lung carcinoma, laryngeal squamous cell carcinoma, melanoma, myxofibrosarcoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0056] In certain aspects, miR-16 or miR-16 inhibitor and miR-331 or miR-331 inhibitor are administered to patients with astrocytoma, anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, lung carcinoma, laryngeal squamous cell carcinoma, melanoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, neurofibroma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0057] It is contemplated that when miR-16 or a miR-16 inhibitor is given in combination with one or more other miRNA molecules, the two different miRNAs or inhibitors may be given at the same time or sequentially. In some embodiments, therapy proceeds with one miRNA or inhibitor and that therapy is followed up with therapy with the other miRNA or inhibitor 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, 1, 2, 3, 4, 5, 6, 7 days, 1, 2, 3, 4, 5 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months or any such combination later.

[0058] Further embodiments include the identification and assessment of an expression profile indicative of miR- 16 status in a cell or tissue comprising expression assessment of one or more gene from the tables herein, or any combination thereof.

[0059] The term "miRNA" is used according to its ordinary and plain meaning and refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation.
See, e.g., Carrington et aZ., 2003, which is hereby incorporated by reference.
The term can be used to refer to the single-stranded RNA molecule processed from a precursor or in certain instances the precursor itself or a mimetic thereof.

[0060] In some embodiments, it may be useful to know whether a cell expresses a particular miRNA endogenously or whether such expression is affected under particular conditions or when it is in a particular disease state. Thus, in some embodiments of the invention, methods include assaying a cell or a sample containing a cell for the presence of one or more miRNA marker gene or mRNA or other analyte indicative of the expression level of a gene of interest. Consequently, in some embodiments, methods include a step of generating an RNA profile for a sample. The term "RNA profile" or "gene expression profile" refers to a set of data regarding the expression pattern for one or more gene or genetic marker in the sample (e.g., a plurality of nucleic acid probes that identify one or more markers or genes from the tables); it is contemplated that the nucleic acid profile can be obtained using a set of RNAs, using for example nucleic acid amplification or hybridization techniques well know to one of ordinary skill in the art. The difference in the expression profile in the sample from a patient and a reference expression profile, such as an expression profile from a normal or non-pathologic sample, or a digitized reference, is indicative of a pathologic, disease, or cancerous condition. In certain aspects the expression profile is an indicator of a propensity to or probability of (i.e., risk factor for a disease or condition) developing such a condition(s). Such a risk or propensity may indicate a treatment, increased monitoring, prophylactic measures, and the like. A nucleic acid or probe set may comprise or identify a segment of a corresponding mRNA and may include all or part of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 ,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 100, 200, 500, or more segments, including any integer or range derivable there between, of a gene or genetic marker, or a nucleic acid, mRNA or a probe representative thereof that is listed in tables or identified by the methods described herein.
[0061] Certain embodiments of the invention are directed to compositions and methods for assessing, prognosing, or treating a pathological condition in a patient comprising measuring or determining an expression profile of one or more miRNA or marker(s) in a sample from the patient, wherein a difference in the expression profile in the sample from the patient and an expression profile of a normal sample or reference expression profile is indicative of pathological condition and particularly cancer (e.g., In certain aspects of the invention, the miRNAs, cellular pathway, gene, or genetic marker is or is representative of one or more pathway or marker described in the tables, including any combination thereof.
[0062] Aspects of the invention include diagnosing, assessing, or treating a pathologic condition or preventing a pathologic condition from manifesting. For example, the methods can be used to screen for a pathological condition; assess prognosis of a pathological condition; stage a pathological condition; assess response of a pathological condition to therapy; or to modulate the expression of a gene, genes, or related pathway as a first therapy or to render a subject sensitive or more responsive to a second therapy. In particular aspects, assessing the pathological condition of the patient can be assessing prognosis of the patient.
Prognosis may include, but is not limited to an estimation of the time or expected time of survival, assessment of response to a therapy, and the like. In certain aspects, the altered expression of one or more gene or marker is prognostic for a patient having a pathologic condition, wherein the marker is one or more of the tables, including any combination thereof.

[0063] The present invention also concerns kits containing compositions of the invention or compositions to implement methods of the invention. In some embodiments, kits can be used to evaluate one or more marker molecules, and/or express one or more miRNA or miRNA inhibitor. In certain embodiments, a kit contains, contains at least or contains at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 100, 150, 200 or more probes, recombinant nucleic acid, or synthetic nucleic acid molecules related to the markers to be assessed or an miRNA or miRNA inhibitor to be expressed or modulated, and may include any range or combination derivable therein. Kits may comprise components, which may be individually packaged or placed in a container, such as a tube, bottle, vial, syringe, or other suitable container means.
Individual components may also be provided in a kit in concentrated amounts;
in some embodiments, a component is provided individually in the same concentration as it would be in a solution with other components. Concentrations of components may be provided as lx, 2x, 5x, lOx, or 20x or more. Kits for using probes, synthetic nucleic acids, recombinant nucleic acids, or non-synthetic nucleic acids of the invention for therapeutic, prognostic, or diagnostic applications are included as part of the invention. Specifically contemplated are any such molecules corresponding to any miRNA reported to influence biological activity or expression of one or more marker gene or gene pathway described herein. In certain aspects, negative and/or positive controls are included in some kit embodiments. The control molecules can be used to verify transfection efficiency and/or control for transfection-induced changes in cells. .

[0064] Certain embodiments are directed to a kit for assessment of a pathological condition or the risk of developing a pathological condition in a patient by nucleic acid profiling of a sample comprising, in suitable container means, two or more nucleic acid hybridization or amplification reagents. The kit can comprise reagents for labeling nucleic acids in a sample and/or nucleic acid hybridization reagents. The hybridization reagents typically comprise hybridization probes. Amplification reagents include, but are not limited to amplification primers, reagents, and enzymes.

[0065] In some embodiments of the invention, an expression profile is generated by steps that include: (a) labeling nucleic acid in the sample; (b) hybridizing the nucleic acid to a number of probes, or amplifying a number of nucleic acids, and (c) determining and/or quantitating nucleic acid hybridization to the probes or detecting and quantitating amplification products, wherein an expression profile is generated. See U.S.
Provisional Patent Application 60/575,743 and the U.S. Provisional Patent Application 60/649,584, and U.S. Patent Application Serial No. 11/141,707 and U.S. Patent Application Serial No.
11/273,640, all of which are hereby incorporated by reference.

[0066] Methods of the invention involve diagnosing and/or assessing the prognosis of a patient based on a miRNA and/or a marker nucleic acid expression profile. In certain embodiments, the elevation or reduction in the level of expression of a particular gene or genetic pathway or set of nucleic acids in a cell is correlated with a disease state or pathological condition compared to the expression level of the same in a normal or non-pathologic cell or tissue sample. This correlation allows for diagnostic and/or prognostic methods to be carried out when the expression level of one or more nucleic acid is measured in a biological sample being assessed and then compared to the expression level of a normal or non-pathologic cell or tissue sample. It is specifically contemplated that expression profiles for patients, particularly those suspected of having or having a propensity for a particular disease or condition such as cancer, can be generated by evaluating any of or sets of the miRNAs and/or nucleic acids discussed in this application. The expression profile that is generated from the patient will be one that provides information regarding the particular disease or condition. In many embodiments, the profile is generated using nucleic acid hybridization or amplification, (e.g., array hybridization or RT-PCR). In certain aspects, an expression profile can be used in conjunction with other diagnostic and/or prognostic tests, such as histology, protein profiles in the serum and/or cytogenetic assessment.

[0067] The methods can further comprise one or more of the steps including:
(a) obtaining a sample from the patient, (b) isolating nucleic acids from the sample, (c) labeling the nucleic acids isolated from the sample, and (d) hybridizing the labeled nucleic acids to one or more probes. Nucleic acids of the invention include one or more nucleic acid comprising at least one segment having a sequence or complementary sequence of to a nucleic acid representative of one or more of genes or markers in the tables.

[0068] It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein and that different embodiments may be combined. It is specifically contemplated that any methods and compositions discussed herein with respect to miRNA molecules, miRNA, genes and nucleic acids representative of genes may be implemented with respect to synthetic nucleic acids. In some embodiments the synthetic nucleic acid is exposed to the proper conditions to allow it to become a processed or mature nucleic acid, such as a miRNA under physiological circumstances. The claims originally filed are contemplated to cover claims that are multiply dependent on any filed claim or combination of filed claims.

[0069] Also, any embodiment of the invention involving specific genes (including representative fragments thereof), mRNA, or miRNAs by name is contemplated also to cover embodiments involving miRNAs whose sequences are at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% identical to the sequence or mature sequence of the specified miRNA, mRNA, gene, or representative nucleic acid.

[0070] It will be further understood that shorthand notations are employed such that a generic description of a gene or marker thereof, or of a miRNA refers to any of its gene famity members (distinguished by a number) or representative fragments thereof, unless otherwise indicated. It is understood by those of skill in the art that a "gene family" refers to a group of genes having the same or similar coding sequence or miRNA coding sequence.
Typically, miRNA members of a gene family are identified by a number following the initial designation. For example, miR-16-1 and miR-16-2 are members of the miR-16 gene family and "mir-7" refers to miR-7-1, miR-7-2 and miR-7-3. Moreover, unless otherwise indicated, a shorthand notation refers to related miRNAs (distinguished by a letter).
Thus, "let-7," for example, refers to let-7a, let-7b, let-7c, etc. Exceptions to this shorthand notation will be otherwise identified.

[0071] Other embodiments of the invention are discussed throughout this application.
Any embodiment discussed with respect to one aspect of the invention applies to other aspects of the invention as well and vice versa. The embodiments in the Example and Detailed Description section are understood to be embodiments of the invention that are applicable to all aspects of the invention.

[0072] The terms "inhibiting," "reducing," or "prevention," or any variation of these terms, when used in the claims and/or the specification includes any measurable decrease or complete inhibition to achieve a desired result.

[0073] The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one."

[0074] Throughout this application, the term "about" is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.

[0075] The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or."

[0076] As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
[0077] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

DETAILED DESCRIPTION OF THE INVENTION

[0078] The present invention is directed to compositions and methods relating to the identification and characterization of genes and biological pathways related to these genes as represented by the expression of the identified genes, as well as use of miRNAs related to such, for therapeutic, prognostic, and diagnostic applications. In particular, the present invention is directed to those methods and compositions related to assessing and/or identifying pathological conditions directly or indirectly related to miR- 16 expression or the aberrant expression thereof. The mature sequence of miR-16 is typically comprised of uagcagcacguaaauauuggcg SEQ ID NO:1 (MIMAT0000069).

[0079] In certain aspects, the invention is directed to methods for the assessment, analysis, and/or therapy of a cell or subject where certain genes have a reduced expression (relative to normal) as a result of an increased or decreased expression of miR-16 and/or genes with an increased expression (relative to normal) as a result of an increased or decreased expression of miR-16. The expression profile and/or response to miR-expression or lack of expression are indicative of an individual with a pathological condition, e.g., cancer.

[0080] Prognostic assays featuring any one or combination of the miRNAs listed or the markers listed (including nucleic acids representative thereof) could be used to assess a patient to determine what if any treatment regimen is justified. As with the diagnostic assays mentioned above, the absolute values that define low expression will depend on the platform used to measure the miRNA(s). The same methods described for the diagnostic assays could be used for a prognostic assays.

1. THERAPEUTIC METHODS

[00811 Embodiments of the invention concern nucleic acids that perform the activities of or inhibit endogenous miRNAs when introduced into cells. In certain aspects, nucleic acids are synthetic or non-synthetic miRNA. Sequence-specific miRNA inhibitors can be used to inhibit sequentially or in combination the activities of one or more endogenous miRNAs in cells, as well those genes and associated pathways modulated by the endogenous miRNA.
[0082] The present invention concerns, in some embodiments, short nucleic acid molecules that function as miRNAs or as inhibitors of miRNA in a cell. The term "short"
refers to a length of a single polynucleotide that is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50, 100, or 150 nucleotides or fewer, including all integers or ranges range derivable there between. The nucleic acid molecules are typically synthetic. The term "synthetic" refers to a nucleic acid molecule that is isolated and not produced naturally in a cell.
In certain aspects the sequence (the entire sequence) and/or chemical structure deviates from a naturally-occurring nucleic acid molecule, such as an endogenous precursor miRNA or miRNA
molecule or complement thereof. While in some embodiments, nucleic acids of the invention do not have an entire sequence that is identical or complementary to a sequence of a naturally-occurring nucleic acid, such molecules may encompass all or part of a naturally-occurring sequence or a complement thereof.. It is contemplated, however, that a synthetic nucleic acid administered to a cell may subsequently be modified or altered in the cell such that its structure or sequence is the same as non-synthetic or naturally occurring nucleic acid, such as a mature miRNA sequence. For example, a synthetic nucleic acid may have a sequence that differs from the sequence of a precursor miRNA, but that sequence may be altered once in a cell to be the same as an endogenous, processed miRNA or an inhibitor thereof.. The term "isolated" means that the nucleic acid molecules of the invention are initially separated from different (in terms of sequence or structure) and unwanted nucleic acid molecules such that a population of isolated nucleic acids is at least about 90%
homogenous, and may be at least about 95, 96, 97, 98, 99, or 100% homogenous with respect to other polynucleotide molecules. In many embodiments of the invention, a nucleic acid is isolated by virtue of it having been synthesized in vitro separate from endogenous nucleic acids in a cell. It will be understood, however, that isolated nucleic acids may be subsequently mixed or pooled together. In certain aspects, synthetic miRNA of the invention are RNA or RNA analogs. miRNA inhibitors may be DNA or RNA, or analogs thereof.
miRNA and miRNA inhibitors of the invention are collectively referred to as "synthetic nucleic acids."

[0083] In some embodiments, there is a miRNA or a synthetic miRNA having a length of between 17 and 130 residues. The present invention concerns miRNA or synthetic miRNA
molecules that are, are at least, or are at most 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 140, 145, 150, 160, 170, 180, 190, 200 or more residues in length, including any integer or any range there between.

[0084] In certain embodiments, synthetic miRNA have (a) a"miRNA region" whose sequence or binding region from 5' to 3' is identical or complementary to all or a segment of a mature miRNA sequence, and (b) a "complementary region" whose sequence from 5' to 3' is between 60% and 100% complementary to the miRNA sequence in (a). In certain embodiments, these synthetic miRNA are also isolated, as defined above. The term "miRNA

region" refers to a region on the synthetic miRNA that is at least 75, 80, 85, 90, 95, or 100%
identical, including all integers there between, to the entire sequence of a mature, naturally occurring miRNA sequence or a complement thereof. In certain embodiments, the miRNA
region is or is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% identical to the sequence of a naturally-occurring miRNA or complement thereof.

[0085] The term "complementary region" or "complement" refers to a region of a nucleic acid or mimetic that is or is at least 60% complementary to the mature, naturally occurring miRNA sequence. The complementary region is or is at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100%
complementary, or any range derivable therein. With single polynucleotide sequences, there may be a hairpin loop structure as a result of chemical bonding between the miRNA region and the complementary region. In other embodiments, the complementary region is on a different nucleic acid molecule than the miRNA region, in which case the complementary region is on the complementary strand and the miRNA region is on the active strand.

[0086] In other embodiments of the invention, there are synthetic nucleic acids that are miRNA inhibitors. A miRNA inhibitor is between about 17 to 25 nucleotides in length and comprises a 5' to 3' sequence that is at least 90% complementary to the 5' to 3' sequence of a mature miRNA. In certain embodiments, a miRNA inhibitor molecule is 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, or any range derivable therein.
Moreover, an miRNA
inhibitor may have a sequence (from 5' to 3') that is or is at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100%
complementary, or any range derivable therein, to the 5' to 3' sequence of a mature miRNA, particularly a mature, naturally occurring miRNA. One of skill in the art could use a portion of the miRNA sequence that is complementary to the sequence of a mature miRNA
as the sequence for a miRNA inhibitor. Moreover, that portion of the nucleic acid sequence can be altered so that it is still comprises the appropriate percentage of complementarity to the sequence of a mature miRNA.

[0087] In some embodiments, of the invention, a synthetic miRNA or inhibitor contains one or more design element(s). These design elements include, but are not limited to: (i) a replacement group for the phosphate or hydroxyl of the nucleotide at the 5' terminus of the complementary region; (ii) one or more sugar modifications in the first or last 1 to 6 residues of the complementary region; or, (iii) noncomplementarity between one or more nucleotides in the last 1 to 5 residues at the 3' end of the complementary region and the corresponding nucleotides of the miRNA region. A variety of design modifications are known in the art, see below.

[0088] In certain embodiments, a synthetic miRNA has a nucleotide at its 5' end of the complementary region in which the phosphate and/or hydroxyl group has been replaced with another chemical group (referred to as the "replacement design"). In some cases, the phosphate group is replaced, while in others, the hydroxyl group has been replaced. In particular embodiments, the replacement group is biotin, an amine group, a lower alkylamine group, an acetyl group, 2'O-Me (2'oxygen-methyl), DMTO (4,4'-dimethoxytrityl with oxygen), fluoroscein, a thiol, or acridine, though other replacement groups are well known to those of skill in the art and can be used as well. This design element can also be used with a miRNA inhibitor.

[0089] Additional embodiments concern a synthetic miRNA having one or more sugar modifications in the first or last 1 to 6 residues of the complementary region (referred to as the "sugar replacement design"). In certain cases, there is one or more sugar modifications in the first 1, 2, 3, 4, 5, 6 or more residues of the complementary region, or any range derivable therein. In additional cases, there are one or more sugar modifications in the last 1, 2, 3, 4, 5, 6 or more residues of the complementary region, or any range derivable therein, have a sugar modification. It will be understood that the terms "first" and "last" are with respect to the order of residues from the 5' end to the 3' end of the region. In particular embodiments, the sugar modification is a 2'0-Me modification. In further embodiments, there are one or more sugar modifications in the first or last 2 to 4 residues of the complementary region or the first or last 4 to 6 residues of the complementary region. This design element can also be used with a miRNA inhibitor. Thus, a miRNA inhibitor can have this design element and/or a replacement group on the nucleotide at the 5' terminus, as discussed above.

[0090] In other embodiments of the invention, there is a synthetic miRNA or inhibitor in which one or more nucleotides in the last I to 5 residues at the 3' end of the complementary region are not complementary to the corresponding nucleotides of the miRNA
region ("noncomplementarity") (referred to as the "noncomplementarity design"). The noncomplementarity may be in the last 1, 2, 3, 4, and/or 5 residues of the complementary miRNA. In certain embodiments, there is noncomplementarity with at least 2 nucleotides in the complementary region.

[0091] It is contemplated that synthetic miRNA of the invention have one or more of the replacement, sugar modification, or noncomplementarity designs. In certain cases, synthetic RNA molecules have two of them, while in others these molecules have all three designs in place.

[0092] The miRNA region and the complementary region may be on the same or separate polynucleotides. In cases in which they are contained on or in the same polynucleotide, the miRNA molecule will be considered a single polynucleotide. In embodiments in which the different regions are on separate polynucleotides, the synthetic miRNA will be considered to be comprised of two polynucleotides.

[0093] When the RNA molecule is a single polynucleotide, there can be a linker region between the miRNA region and the complementary region. In some embodiments, the single polynucleotide is capable of forming a hairpin loop structure as a result of bonding between the miRNA region and the complementary region. The linker constitutes the hairpin loop. It is contemplated that in some embodiments, the linker region is, is at least, or is at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 residues in length, or any range derivable therein. In certain embodiments, the linker is between 3 and 30 residues (inclusive) in length.

[0094] In addition to having a miRNA or inhibitor region and a complementary region, there may be flanking sequences as well at either the 5' or 3' end of the region. In some embodiments, there is or is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides or more, or any range derivable therein, flanking one or both sides of these regions.

[0095] Methods of the invention include reducing or eliminating activity of one or more miRNAs in a cell comprising introducing into a cell a miRNA inhibitor (which may be described generally herein as an miRNA, so that a description of miRNA, where appropriate, also will refer to a miRNA inhibitor); or supplying or enhancing the activity of one or more miRNAs in a cell. The present invention also concerns inducing certain cellular characteristics by providing to a cell a particular nucleic acid, such as a specific synthetic miRNA molecule or a synthetic miRNA inhibitor molecule. However, in methods of the invention, the miRNA molecule or miRNA inhibitor need not be synthetic. They may have a sequence that is identical to a naturally occurring miRNA or they may not have any design modifications. In certain embodiments, the miRNA molecule and/or the miRNA
inhibitor are synthetic, as discussed above.

[0096] The particular nucleic acid molecule provided to the cell is understood to correspond to a particular miRNA in the cell, and thus, the miRNA in the cell is referred to as the "corresponding miRNA." In situations in which a named miRNA molecule is introduced into a cell, the corresponding miRNA will be understood to be the induced or inhibited miRNA or induced or inhibited miRNA function.. It is contemplated, however, that the miRNA molecule introduced into a cell is not a mature miRNA but is capable of becoming or functioning as a mature miRNA under the appropriate physiological conditions.
In cases in which a particular corresponding miRNA is being inhibited by a miRNA
inhibitor, the particular miRNA will be referred to as the "targeted miRNA." It is contemplated that multiple corresponding miRNAs may be involved. In particular embodiments, more than one miRNA molecule is introduced into a cell. Moreover, in other embodiments, more than one miRNA inhibitor is introduced into a cell. Furthermore, a combination of miRNA
molecule(s) and miRNA inhibitor(s) may be introduced into a cell. The inventors contemplate that a combination of miRNA may act at one or more points in cellular pathways of cells with aberrant phenotypes and that such combination may have increased efficacy on the target cell while not adversely effecting normal cells. Thus, a combination of miRNA
may have a minimal adverse effect on a subject or patient while supplying a sufficient therapeutic effect, such as amelioration of a condition, growth inhibition of a cell, death of a targeted cell, alteration of cell phenotype or physiology, slowing of cellular growth, sensitization to a second therapy, sensitization to a particular therapy, and the like.

[0097] Methods include identifying a cell or patient in need of inducing those cellular characteristics. Also, it will be understood that an amount of a synthetic nucleic acid that is provided to a cell or organism is an "effective amount," which refers to an amount needed (or a sufficient amount) to achieve a desired goal, such as inducing a particular cellular characteristic(s).

[0098] In certain embodiments of the methods include providing or introducing to a cell a nucleic acid molecule corresponding to a mature miRNA in the cell in an amount effective to achieve a desired physiological result.

[0099] Moreover, methods can involve providing synthetic or nonsynthetic miRNA
molecules. It is contemplated that in these embodiments, that the methods may or may not be limited to providing only one or more synthetic miRNA molecules or only one or more nonsynthetic miRNA molecules. Thus, in certain embodiments, methods may involve providing both synthetic and nonsynthetic miRNA molecules. In this situation, a cell or cells are most likely provided a synthetic miRNA molecule corresponding to a particular miRNA
and a nonsynthetic miRNA molecule corresponding to a different miRNA.
Furthermore, any method articulated using a list of miRNAs using Markush group language may be articulated without the Markush group language and a disjunctive article (i.e., or) instead, and vice versa.
[00100] In some embodiments, there is a method for reducing or inhibiting cell proliferation comprising introducing into or providing to the cell an effective amount of (i) a miRNA inhibitor molecule or (ii) a synthetic or nonsynthetic miRNA molecule that corresponds to a miRNA sequence. In certain embodiments the methods involves introducing into the cell an effective amount of (i) an miRNA inhibitor molecule having a 5' to 3' sequence that is at least 90% complementary to the 5' to 3' sequence of one or more mature miRNA.

[001011 Certain embodiments of the invention include methods of treating a pathologic condition, in particular cancer, e.g., lung or liver cancer. In one aspect, the method comprises contacting a target cell with one or more nucleic acid, synthetic miRNA, or miRNA
comprising at least one nucleic acid segment having all or a portion of a miRNA sequence.
The segment may be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides or nucleotide analog; including all integers there between. An aspect of the invention includes the modulation of gene expression, miRNA expression or function or mRNA expression or function within a target cell, such as a cancer cell.

[00102] Typically, an endogenous gene, miRNA or mRNA is modulated in the cell.
In particular embodiments, the nucleic acid sequence comprises at least one segment that is at least 70, 75, 80, 85, 90, 95, or 100% identical in nucleic acid sequence to one or more miRNA or gene sequence. Modulation of the expression or processing of an endogenous gene, miRNA, or mRNA can be through modulation of the processing of a mRNA, such processing including transcription, transportation and/or translation with in a cell.
Modulation may also be effected by the inhibition or enhancement of miRNA
activity with a cell, tissue, or organ. Such processing may affect the expression of an encoded product or the stability of the mRNA. In still other embodiments, a nucleic acid sequence can comprise a modified nucleic acid sequence. In certain aspects, one or more miRNA sequence may include or comprise a modified nucleobase or nucleic acid sequence.

[00103] It will be understood in methods of the invention that a cell or other biological matter such as an organism (including patients) can be provided a miRNA or miRNA
molecule corresponding to a particular miRNA by administering to the cell or organism a nucleic acid molecule that functions as the corresponding miRNA once inside the cell. The form of the molecule provided to the cell may not be the form that acts a miRNA once inside the cell. Thus, it is contemplated that in some embodiments, a synthetic miRNA
or a nonsynthetic miRNA is provided a synthetic miRNA or a nonsynthetic miRNA, such as one that becomes processed into a mature and active miRNA once it has access to the cell's miRNA processing machinery. In certain embodiments, it is specifically contemplated that the miRNA molecule provided to the biological matter is not a mature miRNA
molecule but a nucleic acid molecule that can be processed into the mature miRNA once it is accessible to miRNA processing machinery. The term "nonsynthetic" in the context of miRNA
means that the miRNA is not "synthetic," as defined herein. Furthermore, it is contemplated that in embodiments of the invention that concern the use of synthetic miRNAs, the use of corresponding nonsynthetic miRNAs is also considered an aspect of the invention, and vice versa. It will be understand that the term "providing" an agent is used to include "administering" the agent to a patient.

[00104] In certain embodiments, methods also include targeting a miRNA to modulate in a cell or organism. The term "targeting a miRNA to modulate" means a nucleic acid of the invention will be employed so as to modulate the selected miRNA. In some embodiments the modulation is achieved with a synthetic or non-synthetic miRNA that corresponds to the targeted miRNA, which effectively provides the targeted miRNA to the cell or organism (positive modulation). In other embodiments, the modulation is achieved with a miRNA
inhibitor, which effectively inhibits the targeted miRNA in the cell or organism (negative modulation).

[00105] In some embodiments, the miRNA targeted to be modulated is a miRNA
that affects a disease, condition, or pathway. In certain embodiments, the miRNA is targeted because a treatment can be provided by negative modulation of the targeted miRNA. In other embodiments, the miRNA is targeted because a treatment can be provided by positive modulation of the targeted miRNA or its targets.

[00106] In certain methods of the invention, there is a further step of administering the selected miRNA modulator to a cell, tissue, organ, or organism (collectively "biological matter") in need of treatment related to modulation of the targeted miRNA or in need of the physiological or biological results discussed herein (such as with respect to a particular cellular pathway or result like decrease in cell viability). Consequently, in some methods of the invention there is a step of identifying a patient in need of treatment that can be provided by the miRNA modulator(s). It is contemplated that an effective amount of a miRNA
modulator can be administered in some embodiments. In particular embodiments, there is a therapeutic benefit conferred on the biological matter, where a "therapeutic benefit" refers to an improvement in the one or more conditions or symptoms associated with a disease or condition or an improvement in the prognosis, duration, or status with respect to the disease.
It is contemplated that a therapeutic benefit includes, but is not limited to, a decrease in pain, a decrease in morbidity, a decrease in a symptom. For example, with respect to cancer, it is contemplated that a therapeutic benefit can be inhibition of tumor growth, prevention of metastasis, reduction in number of metastases, inhibition of cancer cell proliferation, induction of cell death in cancer cells, inhibition of angiogenesis near cancer cells, induction of apoptosis of cancer cells, reduction in pain, reduction in risk of recurrence, induction of chemo- or radiosensitivity in cancer cells, prolongation of life, and/or delay of death directly or indirectly related to cancer.

[00107] Furthermore, it is contemplated that the miRNA compositions may be provided as part of a therapy to a patient, in conjunction with traditional therapies or preventative agents.
Moreover, it is contemplated that any method discussed in the context of therapy may be applied as preventatively, particularly in a patient identified to be potentially in need of the therapy or at risk of the condition or disease for which a therapy is needed.

[00108] In addition, methods of the invention concern employing one or more nucleic acids corresponding to a miRNA and a therapeutic drug. The nucleic acid can enhance the effect or efficacy of the drug, reduce any side effects or toxicity, modify its bioavailability, and/or decrease the dosage or frequency needed. In certain embodiments, the therapeutic drug is a cancer therapeutic. Consequently, in some embodiments, there is a method of treating cancer in a patient comprising administering to the patient the cancer therapeutic and an effective amount of at least one miRNA molecule that improves the efficacy of the cancer therapeutic or protects non-cancer cells. Cancer therapies also include a variety of combination therapies with both chemical and radiation based treatments.
Combination chemotherapies include but are not limited to, for example, 5-fluorouracil, alemtuzumab, amrubicin, bevacizumab, bleomycin, bortezomib, busulfan, camptothecin, capecitabine, cisplatin (CDDP), carboplatin, cetuximab, chlorambucil, cisplatin (CDDP), EGFR
inhibitors (gefitinib and cetuximab), procarbazine, mechlorethamine, cyclophosphamide, camptothecin, COX-2 inhibitors (e.g., celecoxib), cyclophosphamide, cytarabine, ) ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, dasatinib, daunorubicin, dexamethasone, docetaxel, doxorubicin (adriamycin), EGFR inhibitors (gefitinib and cetuximab), erlotinib, estrogen receptor binding agents, bleomycin, plicomycin, mitomycin, etoposide (VP16), everolimus, tamoxifen, raloxifene, estrogen receptor binding agents, taxol, taxotere, gemcitabien, navelbine, farnesyl-protein transferase inhibitors, gefitinib, gemcitabine, gemtuzumab, ibritumomab, ifosfamide, imatinib mesylate, larotaxel, lapatinib, lonafamib, mechlorethamine, melphalan, transplatinum, 5-fluorouracil, vincristin, vinblastin and methotrexate, mitomycin, navelbine, nitrosurea, nocodazole, oxaliplatin, paclitaxel, plicomycin, procarbazine, raloxifene, rituximab, sirolimus, sorafenib, sunitinib, tamoxifen, taxol, taxotere, temsirolimus, tipifamib, tositumomab, transplatinum, trastuzumab, vinblastin, vincristin, or vinorelbine or any analog or derivative variant of the foregoing.

[00109] Generally, inhibitors of miRNAs can be given to decrease the activity of an endogenous miRNA. For example, inhibitors of miRNA molecules that increase cell proliferation can be provided to cells to increase proliferation or inhibitors of such molecules can be provided to cells to decrease cell proliferation. The present invention contemplates these embodiments in the context of the different physiological effects observed with the different miRNA molecules and miRNA inhibitors disclosed herein. These include, but are not limited to, the following physiological effects: increase and decreasing cell proliferation, increasing or decreasing apoptosis, increasing transformation, increasing or decreasing cell viability, activating or inhibiting a kinase (e.g., Erk)ERK, activating/inducing or inhibiting hTert, inhibit stimulation of growth promoting pathway (e.g., Stat 3 signaling), reduce or increase viable cell number, and increase or decrease number of cells at a particular phase of the cell cycle. Methods of the invention are generally contemplated to include providing or introducing one or more different nucleic acid molecules corresponding to one or more different miRNA molecules. It is contemplated that the following, at least the following, or at most the following number of different nucleic acid or miRNA molecules may be provided or introduced: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or any range derivable therein. This also applies to the number of different miRNA
molecules that can be provided or introduced into a cell.

II. PHARMACEUTICAL FORMULATIONS AND DELIVERY

[00110] Methods of the present invention include the delivery of an effective amount of a miRNA or an expression construct encoding the same. An "effective amount" of the pharmaceutical composition, generally, is defined as that amount sufficient to detectably and repeatedly to achieve the stated desired result, for example, to ameliorate, reduce, minimize or limit the extent of the disease or its symptoms. Other more rigorous definitions may apply, including elimination, eradication or cure of disease.

A. Administration [00111] In certain embodiments, it is desired to kill cells, inhibit cell growth, inhibit metastasis, decrease tumor or tissue size, and/or reverse or reduce the malignant or disease phenotype of cells. The routes of administration will vary, naturally, with the location and nature of the lesion or site to be targeted, and include, e.g., intradermal, subcutaneous, regional, parenteral, intravenous, intramuscular, intranasal, systemic, and oral administration and formulation. Direct injection, intratumoral injection, or injection into tumor vasculature is specifically contemplated for discrete, solid, accessible tumors, or other accessible target areas. Local, regional, or systemic administration also may be appropriate.
For tumors of >4 cm, the volume to be administered will be about 4-10 ml (preferably 10 ml), while for tumors of <4 cm, a volume of about 1-3 ml will be used (preferably 3 ml).

[00112] Multiple injections delivered as a single dose comprise about 0.1 to about 0.5 ml volumes. Compositions of the invention may be administered in multiple injections to a tumor or a targeted site. In certain aspects, injections may be spaced at approximately 1 cm intervals.

[00113] In the case of surgical intervention, the present invention may be used preoperatively, to render an inoperable tumor subject to resection.
Alternatively, the present invention may be used at the time of surgery, and/or thereafter, to treat residual or metastatic disease. For example, a resected tumor bed may be injected or perfused with a formulation comprising a miRNA or combinations thereof. Administration may be continued post-resection, for example, by leaving a catheter implanted at the site of the surgery. Periodic post-surgical treatment also is envisioned. Continuous perfusion of an expression construct or a viral construct also is contemplated.

[00114] Continuous administration also may be applied where appropriate, for example, where a tumor or other undesired affected area is excised and the tumor bed or targeted site is treated to eliminate residual, microscopic disease. Delivery via syringe or catherization is contemplated. Such continuous perfusion may take place for a period from about 1-2 hours, to about 2-6 hours, to about 6-12 hours, to about 12-24 hours, to about 1-2 days, to about 1-2 wk or longer following the initiation of treatment. Generally, the dose of the therapeutic composition via continuous perfusion will be equivalent to that given by a single or multiple injections, adjusted over a period of time during which the perfusion occurs.

[00115] Treatment regimens may vary as well and often depend on tumor type, tumor location, immune condition, target site, disease progression, and health and age of the patient.
Certain tumor types will require more aggressive treatment. The clinician will be best suited to make such decisions based on the known efficacy and toxicity (if any) of the therapeutic formulations.

[00116] In certain embodiments, the tumor or affected area being treated may not, at least initially, be resectable. Treatments with compositions of the invention may increase the resectability of the tumor due to shrinkage at the margins or by elimination of certain particularly invasive portions. Following treatments, resection may be possible. Additional treatments subsequent to resection may serve to eliminate microscopic residual disease at the tumor or targeted site.

[00117] Treatments may include various "unit doses." A unit dose is defined as containing a predetermined quantity of a therapeutic composition(s). The quantity to be administered, and the particular route and formulation, are within the skill of those in the clinical arts. A
unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. With respect to a viral component of the present invention, a unit dose may conveniently be described in terms of g or mg of miRNA or miRNA

mimetic. Alternatively, the amount specified may be the amount administered as the average daily, average weekly, or average monthly dose.

[00118] miRNA can be administered to the patient in a dose or doses of about or of at least about 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000 g or mg, or more, or any range derivable therein. Alternatively, the amount specified may be the amount administered as the average daily, average weekly, or average monthly dose, or it may be expressed in terms of mg/kg, where kg refers to the weight of the patient and the mg is specified above. In other embodiments, the amount specified is any number discussed above but expressed as mg/mZ (with respect to tumor size or patient surface area).

B. Injectable Compositions and Formulations [00119] In some embodiments, the method for the delivery of a miRNA or an expression construct encoding such or combinations thereof is via systemic administration. However, the pharmaceutical compositions disclosed herein may also be administered parenterally, subcutaneously, directly, intratracheally, intravenously, intradermally, intramuscularly, or even intraperitoneally as described in U.S. Patents 5,543,158; 5,641,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety).

[00120] Injection of nucleic acids may be delivered by syringe or any other method used for injection of a solution, as long as the nucleic acid and any associated components can pass through the particular gauge of needle required for injection. A syringe system has also been described for use in gene therapy that permits multiple injections of predetennined quantities of a solution precisely at any depth (U.S. Patent 5,846,225).

[00121] Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[00122] In certain formulations, a water-based formulation is employed while in others, it may be lipid-based. In particular embodiments of the invention, a composition comprising a tumor suppressor protein or a nucleic acid encoding the same is in a water-based formulation.
In other embodiments, the formulation is lipid based.

[00123] For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intratumoral, intralesional, and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCI solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580).
Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologics standards.

[00124] As used herein, a"carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

[00125] The phrase "pharmaceuticatty acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human.

[00126] The nucleic acid(s) are administered in a manner compatible with the dosage formulation, and in such amount as will be therapeutically effective. The quantity to be administered depends on the subject to be treated, including, e.g., the aggressiveness of the disease or cancer, the size of any tumor(s) or lesions, the previous or other courses of treatment. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner. Suitable regimes for initial administration and subsequent administration are also variable, but are typified by an initial administration followed by other administrations. Such administration may be systemic, as a single dose, continuous over a period of time spanning 10, 20, 30, 40, 50, 60 minutes, and/or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more hours, and/or 1, 2, 3, 4, 5, 6, 7, days or more. Moreover, administration may be through a time release or sustained release mechanism, implemented by formulation and/or mode of administration.

C. Combination Treatments [00127] In certain embodiments, the compositions and methods of the present invention involve a miRNA, or expression construct encoding such. These miRNA
compositions can be used in combination with a second therapy to enhance the effect of the miRNA therapy, or increase the therapeutic effect of another therapy being employed. These compositions would be provided in a combined amount effective to achieve the desired effect, such as the killing of a cancer cell and/or the inhibition of cellular hyperproliferation.
This process may involve contacting the cells with the miRNA or second therapy at the same or different time.
This may be achieved by contacting the cell with one or more compositions or pharmacological formulation that includes or more of the agents, or by contacting the cell with two or more distinct compositions or formulations, wherein one composition provides (1) miRNA; and/or (2) a second therapy. A second composition or method may be administered that includes a chemotherapy, radiotherapy, surgical therapy, immunotherapy, or gene therapy.

[00128] It is contemplated that one may provide a patient with the miRNA
therapy and the second therapy within about 12-24 h of each other and, more preferably, within about 6-12 h of each other. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations.

[00129] In certain embodiments, a course of treatment will last 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 days or more. It is contemplated that one agent may be given on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, any combination thereof, and another agent is given on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, or any combination thereof. Within a single day (24-hour period), the patient may be given one or multiple administrations of the agent(s). Moreover, after a course of treatment, it is contemplated that there is a period of time at which no treatment is administered. This time period may last 1, 2, 3, 4, 5, 6, 7 days, and/or 1, 2, 3, 4, 5 weeks, and/or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months or more, depending on the condition of the patient, such as their prognosis, strength, health, etc.

[00130] Various combinations may be employed, for example miRNA therapy is "A"
and a second therapy is "B":

[00131] A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/BB
[00132] B/B/B/A B/B/A/B A/A/B/B A/B/AB A/B/B/A B/B/A/A
[00133] B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A
[00134] Administration of any compound or therapy of the present invention to a patient will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the vector or any protein or other agent. Therefore, in some embodiments there is a step of monitoring toxicity that is attributable to combination therapy.
It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the described therapy.

[00135] In specific aspects, it is contemplated that a second therapy, such as chemotherapy, radiotherapy, immunotherapy, surgical therapy or other gene therapy, is employed in combination with the miRNA therapy, as described herein.

1. Chemotherapy [00136] A wide variety of chemotherapeutic agents may be used in accordance with the present invention. The term "chemotherapy" refers to the use of drugs to treat cancer. A
"chemotherapeutic agent" is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis. Most chemotherapeutic agents fall into the following categories:
alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas.

a. Alkylating agents [00137] Alkylating agents are drugs that directly interact with genomic DNA to prevent the cancer cell from proliferating. This category of chemotherapeutic drugs represents agents that affect all phases of the cell cycle, that is, they are not phase-specific. Alkylating agents can be implemented to treat chronic leukemia, non-Hodgkin's lymphoma, Hodgkin's disease, multiple myeloma, and particular cancers of the breast, lung, and ovary. They include:
busulfan, chlorambucil, cisplatin, cyclophosphamide (cytoxan), dacarbazine, ifosfamide, mechlorethamine (mustargen), and melphalan. Troglitazaone can be used to treat cancer in combination with any one or more of these alkylating agents.

b. Antimetabolites [00138] Antimetabolites disrupt DNA and RNA synthesis. Unlike alkylating agents, they specifically influence the cell cycle during S phase. They have been used to combat chronic leukemias in addition to tumors of breast, ovary and the gastrointestinal tract.
Antimetabolites include 5-fluorouracil (5-FU), cytarabine (Ara-C), fludarabine, gemcitabine, and methotrexate.

[00139] 5-Fluorouracil (5-FU) has the chemical name of 5-fluoro-2,4(1H,3H)-pyrimidinedione. Its mechanism of action is thought to be by blocking the methylation reaction of deoxyuridylic acid to thymidylic acid. Thus, 5-FU interferes with the synthesis of deoxyribonucleic acid (DNA) and to a lesser extent inhibits the formation of ribonucleic acid (RNA). Since DNA and RNA are essential for cell division and proliferation, it is thought that the effect of 5-FU is to create a thymidine deficiency leading to cell death. Thus, the effect of 5-FU is found in cells that rapidly divide, a characteristic of metastatic cancers.

c. Antitumor Antibiotics [00140] Antitumor antibiotics have both antimicrobial and cytotoxic activity.
These drugs also interfere with DNA by chemically inhibiting enzymes and mitosis or altering cellular membranes. These agents are not phase specific so they work in all phases of the cell cycle.
Thus, they are widely used for a variety of cancers. Examples of antitumor antibiotics include bleomycin, dactinomycin, daunorubicin, doxorubicin (Adriamycin), and idarubicin, some of which are discussed in more detail below. Widely used in clinical setting for the treatment of neoplasms, these compounds are administered through bolus injections intravenously at doses ranging from 25-75 mg/m2 at 21 day intervals for adriamycin, to 35-100 mg/m2 for etoposide intravenously or orally.

d. Mitotic Inhibitors [00141] Mitotic inhibitors include plant alkaloids and other natural agents that can inhibit either protein synthesis required for cell division or mitosis. They operate during a specific phase during the cell cycle. Mitotic inhibitors comprise docetaxel, etoposide (VP16), paclitaxel, taxol, taxotere, vinblastine, vincristine, and vinorelbine.

e. Nitrosureas [00142] Nitrosureas, like alkylating agents, inhibit DNA repair proteins. They are used to treat non-Hodgkin's lymphomas, multiple myeloma, malignant melanoma, in addition to brain tumors. Examples include carmustine and lomustine.

2. Radiotherapy [00143] Radiotherapy, also called radiation therapy, is the treatment of cancer and other diseases with ionizing radiation. Ionizing radiation deposits energy that injures or destroys cells in the area being treated by damaging their genetic material, making it impossible for these cells to continue to grow. Although radiation damages both cancer cells and normal cells, the latter are able to repair themselves and function properly.
Radiotherapy may be used to treat localized solid tumors, such as cancers of the skin, tongue, larynx, brain, breast, or cervix. It can also be used to treat leukemia and lymphoma (cancers of the blood-forming cells and lymphatic system, respectively).

[00144] Radiation therapy used according to the present invention may include, but is not limited to, the use of y-rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves, proton beam irradiation (U.S. Patents 5,760,395 and 4,870,287) and UV-irradiation. It is most likely that all of these factors affect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
Radiotherapy may comprise the use of radiolabeled antibodies to deliver doses of radiation directly to the cancer site (radioimmunotherapy). Once injected into the body, the antibodies actively seek out the cancer cells, which are destroyed by the cell-killing (cytotoxic) action of the radiation. This approach can minimize the risk of radiation damage to healthy cells.

[00145] Stereotactic radio-surgery (gamma knife) for brain and other tumors does not use a knife, but very precisely targeted beams of gamma radiotherapy from hundreds of different angles. Only one session of radiotherapy, taking about four to five hours, is needed. For this treatment a specially made metal frame is attached to the head. Then, several scans and x-rays are carried out to find the precise area where the treatment is needed.
During the radiotherapy for brain tumors, the patient lies with their head in a large helmet, which has hundreds of holes in it to allow the radiotherapy beams through. Related approaches permit positioning for the treatment of tumors in other areas of the body.

3. Immunotherapy [00146] In the context of cancer treatment, immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells.
Trastuzumab (HerceptinTM) is such an example. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually affect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent.
Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK
cells. The combination of therapeutic modalities, i.e., direct cytotoxic activity and inhibition or reduction of ErbB2 would provide therapeutic benefit in the treatment of ErbB2 overexpressing cancers.

[00147) In one aspect of immunotherapy, the tumor or disease cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present invention. Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase (p97), gp68, TAG-72, HMFG, Sialy] Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B and p155. An alternative aspect of immunotherapy is to combine anticancer effects with immune stimulatory effects. Immune stimulating molecules also exist including:
cytokines such as IL-2, IL-4, IL-12, GM-CSF, gamma-IFN, and chemokines such as MIP-1, MCP-1, IL-8 and growth factors such as FLT3 ligand. Combining immune stimulating molecules, either as proteins or using gene delivery in combination with a tumor suppressor such as MDA-7 has been shown to enhance anti-tumor effects (Ju et al., 2000).
Moreover, antibodies against any of these compounds can be used to target the anti-cancer agents discussed herein.
[00148] Examples of immunotherapies currently under investigation or in use are immune adjuvants e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene and aromatic compounds (U.S. Patents 5,801,005 and 5,739,169; Hui and Hashimoto, 1998;
Christodoulides et al., 1998), cytokine therapy e.g., interferons a, [3 and y;
IL-1, GM-CSF
and TNF (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al., 1998) gene therapy e.g., TNF, IL-1, IL-2, p53 (Qin et al., 1998; Austin-Ward and Villaseca, 1998;
U.S. Patents 5,830,880 and 5,846,945) and monoclonal antibodies e.g., anti-ganglioside GM2, anti-HER-2, anti-p185; Pietras et al., 1998; Hanibuchi et al., 1998; U.S. Patent 5,824,311). Herceptin (trastuzumab) is a chimeric (mouse-human) monoclonal antibody that blocks the HER2-neu receptor. It possesses anti-tumor activity and has been approved for use in the treatment of malignant tumors (Dillman, 1999). A non-limiting list of several known anti-cancer immunotherapeutic agents and their targets includes, but is not limted to (Generic Name (Target)) Cetuximab (EGFR), Panitumumab (EGFR), Trastuzumab (erbB2 receptor), Bevacizumab (VEGF), Alemtuzumab (CD52), Gemtuzumab ozogamicin (CD33), Rituximab (CD20), Tositumomab (CD20), Matuzumab (EGFR), Ibritumomab tiuxetan (CD20), Tositumomab (CD20), HuPAM4 (MUC1), MORAb-009 (Mesothelin), G250 (carbonic anhydrase IX), mAb 8H9 (8H9 antigen), M195 (CD33), Ipilimumab (CTLA4), HuLuc63 (CS1), Alemtuzumab (CD53), Epratuzumab (CD22), BC8 (CD45), HuJ591 (Prostate specific membrane antigen), hA20 (CD20), Lexatumumab (TRAIL receptor-2), Pertuzumab (HER-2 receptor), Mik-beta-1 (IL-2R), RAV12 (RAAG12), SGN-30 (CD30), AME-133v (CD20), HeFi-1 (CD30), BMS-663513 (CD137), Volociximab (anti-a5[31 integrin), GC1008 (TGF(3), HCD122 (CD40), Siplizumab (CD2), MORAb-003 (Folate receptor alpha), CNTO 328 (IL-6), MDX-060 (CD30), Ofatumumab (CD20), or SGN-33 (CD33). It is contemplated that one or more of these therapies may be employed with the miRNA therapies described herein.
[00149] A number of different approaches for passive immunotherapy of cancer exist.
They may be broadly categorized into the following: injection of antibodies alone; injection of antibodies coupled to toxins or chemotherapeutic agents; injection of antibodies coupled to radioactive isotopes; injection of anti-idiotype antibodies; and finally, purging of tumor cells in bone marrow.

4. Gene Therapy [00150] In yet another embodiment, a combination treatment involves gene therapy in which a therapeutic polynucleotide is administered before, after, or at the same time as one or more therapeutic miRNA. Delivery of a therapeutic polypeptide or encoding nucleic acid in conjunction with a miRNA may have a combined therapeutic effect on target tissues. A
variety of proteins are encompassed within the invention, some of which are described below.
Various genes that may be targeted for gene therapy of some form in combination with the present invention include, but are not limited to inducers of cellular proliferation, inhibitors of cellular proliferation, regulators of programmed cell death, cytokines and other therapeutic nucleic acids or nucleic acid that encode therapeutic proteins.

[00151] The tumor suppressor oncogenes function to inhibit excessive cellular proliferation. The inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation. The tumor suppressors (e.g., therapeutic polypeptides) p53, FHIT, p16 and C-CAM can be employed.

[00152] In addition to p53, another inhibitor of cellular proliferation is p16. The major transitions of the eukaryotic cell cycle are triggered by cyclin-dependent kinases, or CDK's.
One CDK, cyclin-dependent kinase 4 (CDK4), regulates progression through the Gi. The activity of this enzyme may be to phosphorylate Rb at late G1. The activity of CDK4 is controlled by an activating subunit, D-type cyclin, and by an inhibitory subunit, the pI6INK4 has been biochemically characterized as a protein that specifically binds to and inhibits CDK4, and thus may regulate Rb phosphorylation (Serrano et al., 1993; Serrano et al., 1995).
Since the p16INK4 protein is a CDK4 inhibitor (Serrano, 1993), deletion of this gene may increase the activity of CDK4, resulting in hyperphosphorylation of the Rb protein. p16 also is known to regulate the function of CDK6.

[00153] p16INK4 belongs to a newly described class of CDK-inhibitory proteins that also includes p16B, p19, p21WAFl, and p27KIP1. The p16INK4 gene maps to 9p2l, a chromosome region frequently deleted in many tumor types. Homozygous deletions and mutations of the p161NK4 gene are frequent in human tumor cell lines. This evidence suggests that the p161NK4 gene is a tumor suppressor gene. This interpretation has been WO 2008/073923 PCT/iJS2007/087038 challenged, however, by the observation that the frequency of the p16INK4 gene alterations is much lower in primary uncultured tumors than in cultured cell lines (Caldas et al., 1994;
Cheng et al., 1994; Hussussian et al., 1994; Kamb et al., 1994; Mori et al., 1994; Okamoto et al., 1994; Nobori et al., 1995; Orlow et al., 1994; Arap et al., 1995).
Restoration of wild-type p16INK4 function by transfection with a plasmid expression vector reduced colony formation by some human cancer cell lines (Okamoto, 1994; Arap, 1995).

[00154] Other genes that may be employed according to the present invention include Rb, APC, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, zacl, p73, VHL, MMAC1 / PTEN, DBCCR-1, FCC, rsk-3, p27, p27/pl6 fusions, p21/p27 fusions, anti-thrombotic genes (e.g., COX-1, TFPI), PGS, Dp, E2F, ras, myc, neu, raf, erb, fms, trk, ret, gsp, hst, abl, EIA, p300, genes involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-1, GDAIF, or their receptors) and MCC.

5. Surgery [00155] Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative and palliative surgery. Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies.

[00156] Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery). It is further contemplated that the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue.

[00157] Upon excision of part of all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.

6. Other Agents [00158] It is contemplated that other agents may be used in combination with the present invention to improve the therapeutic efficacy of treatment. These additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers, or other biological agents. Immunomodulatory agents include tumor necrosis factor;
interferon alpha, beta, and gamma; IL-2 and other cytokines; F42K and other cytokine analogs; or MIP-1, MIP-lbeta, MCP-1, RANTES, and other chemokines. It is further contemplated that the upregulation of cell surface receptors or their ligands such as Fas / Fas ligand, DR4 or DR5 /
TRAIL (Apo-2 ligand) would potentiate the apoptotic inducing abilities of the present invention by establishment of an autocrine or paracrine effect on hyperproliferative cells.
Increases intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with the present invention to improve the anti-hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present invention. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is ftu ther contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with the present invention to improve the treatment efficacy.

[00159] Apo2 ligand (Apo2L, also called TRAIL) is a member of the tumor necrosis factor (TNF) cytokine family. TRAIL activates rapid apoptosis in many types of cancer cells, yet is not toxic to normal cells. TRAIL mRNA occurs in a wide variety of tissues.
Most normal cells appear to be resistant to TRAIL's cytotoxic action, suggesting the existence of mechanisms that can protect against apoptosis induction by TRAIL. The first receptor described for TRAIL, called death receptor 4 (DR4), contains a cytoplasmic "death domain";
DR4 transmits the apoptosis signal carried by TRAIL. Additional receptors have been identified that bind to TRAIL. One receptor, called DR5, contains a cytoplasmic death domain and signals apoptosis much like DR4. The DR4 and DR5 mRNAs are expressed in many normal tissues and tumor cell lines. Recently, decoy receptors such as DcRI and DcR2 have been identified that prevent TRAIL from inducing apoptosis through DR4 and DR5.
These decoy receptors thus represent a novel mechanism for regulating sensitivity to a pro-apoptotic cytokine directly at the cell's surface. The preferential expression of these inhibitory receptors in normal tissues suggests that TRAIL may be useful as an anticancer agent that induces apoptosis in cancer cells while sparing normal cells. (Marsters et al., 1999).

[00160] There have been many advances in the therapy of cancer following the introduction of cytotoxic chemotherapeutic drugs. However, one of the consequences of chemotherapy is the development/acquisition of drug-resistant phenotypes and the development of multiple drug resistance. The development of drug resistance remains a major obstacle in the treatment of such tumors and therefore, there is an obvious need for alternative approaches such as gene therapy.

[00161] Another form of therapy for use in conjunction with chemotherapy, radiation therapy or biological therapy includes hyperthermia, which is a procedure in which a patient's tissue is exposed to high temperatures (up to 106 F). External or internal heating devices may be involved in the application of local, regional, or whole-body hyperthermia.
Local hyperthermia involves the application of heat to a small area, such as a tumor. Heat may be generated externally with high-frequency waves targeting a tumor from a device outside the body. Internal heat may involve a sterile probe , including thin, heated wires or hollow tubes filled with warm water, implanted microwave antennae, or radiofrequency electrodes.

[00162] A patient's organ or a limb is heated for regional therapy, which is accomplished using devices that produce high energy, such as magnets. Alternatively, some of the patient's blood may be removed and heated before being perfused into an area that will be internally heated. Whole-body heating may also be implemented in cases where cancer has spread throughout the body. Warm-water blankets, hot wax, inductive coils, and thermal chambers may be used for this purpose.

[00163] Hormonal therapy may also be used in conjunction with the present invention or in combination with any other cancer therapy previously described. The use of hormones may be employed in the treatment of certain cancers such as breast, prostate, ovarian, or cervical cancer to lower the level or block the effects of certain hormones such as testosterone or estrogen. This treatment is often used in combination with at least one other cancer therapy as a treatment option or to reduce the risk of metastases.

[00164] This application incorporates U.S. Application Serial No. 11/349,727 filed on February 8, 2006 claiming priority to U.S. Provisional Application Serial No.
60/650,807 filed February 8, 2005 herein by references in its entirety.

III. MIRNA MOLECULES

[00165] MicroRNA molecules ("miRNAs") are generally 21 to 22 nucleotides in length, though lengths of 19 and up to 23 nucleotides have been reported. The miRNAs are each processed from a longer precursor RNA molecule ("precursor miRNA"). Precursor miRNAs are transcribed from non-protein-encoding genes. The precursor miRNAs have two regions of complementarity that enables them to form a stem-loop- or fold-back-like structure, which is cleaved in animals by a ribonuclease III-like nuclease enzyme called Dicer.
The processed miRNA is typically a portion of the stem.

[00166] The processed miRNA (also referred to as "mature miRNA") becomes part of a large complex to down-regulate a particular target gene or its gene product.
Examples of animal miRNAs include those that imperfectly basepair with the target, which halts translation (Olsen et al., 1999; Seggerson et al., 2002). siRNA molecules also are processed by Dicer, but from a long, double-stranded RNA molecule. siRNAs are not naturally found in animal cells, but they can direct the sequence-specific cleavage of an mRNA
target through a RNA-induced silencing complex (RISC) (Denli et al., 2003).

A. Array Preparation [00167] Certain embodiments of the present invention concerns the preparation and use of mRNA or nucleic acid arrays, miRNA or nucleic acid arrays, and/or miRNA or nucleic acid probe arrays, which are macroarrays or microarrays of nucleic acid molecules (probes) that are fully or nearly complementary (over the length of the prove) or identical (over the length of the prove) to a plurality of nucleic acid, mRNA or miRNA molecules, precursor miRNA
molecules, or nucleic acids derived from the various genes and gene pathways modulated by miR-16 miRNAs and that are positioned on a support or support material in a spatially separated organization. Macroarrays are typically sheets of nitrocellulose or nylon upon which probes have been spotted. Microarrays position the nucleic acid probes more densely such that up to 10,000 nucleic acid molecules can be fit into a region typically 1 to 4 square centimeters. Microarrays can be fabricated by spotting nucleic acid molecules, e.g., genes, oligonucleotides, etc., onto substrates or fabricating oligonucleotide sequences in situ on a substrate. Spotted or fabricated nucleic acid molecules can be applied in a high density matrix pattern of up to about 30 non-identical nucleic acid molecules per square centimeter or higher, e.g. up to about 100 or even 1000 per square centimeter. Microarrays typically use coated glass as the solid support, in contrast to the nitrocellulose-based material of filter arrays. By having an ordered array of marker RNA and/or miRNA-complementing nucleic acid samples, the position of each sample can be tracked and linked to the original sample.
[00168] A variety of different array devices in which a plurality of distinct nucleic acid probes are stably associated with the surface of a solid support are known to those of skill in the art. Useful substrates for arrays include nylon, glass, metal, plastic, latex, and silicon.
Such arrays may vary in a number of different ways, including average probe length, sequence or types of probes, nature of bond between the probe and the array surface, e.g.
covalent or non-covalent, and the like. The labeling and screening methods of the present invention and the arrays are not limited in its utility with respect to any parameter except that the probes detect miRNA, or genes or nucleic acid representative of genes;
consequently, methods and compositions may be used with a variety of different types of nucleic acid arrays.

[00169] Representative methods and apparatus for preparing a microarray have been described, for example, in U.S. Patents 5,143,854; 5,202,231; 5,242,974;
5,288,644;
5,324,633; 5,384,261; 5,405,783; 5,412,087; 5,424,186; 5,429,807; 5,432,049;
5,436,327;
5,445,934; 5,468,613; 5,470,710; 5,472,672; 5,492,806; 5,525,464; 5,503,980;
5,510,270;
5,525,464; 5,527,681; 5,529,756; 5,532,128; 5,545,531; 5,547,839; 5,554,501;
5,556,752;
5,561,071; 5,571,639; 5,580,726; 5,580,732; 5,593,839; 5,599,695; 5,599,672;
5,610;287;
5,624,711; 5,631,134; 5,639,603; 5,654,413; 5,658,734; 5,661,028; 5,665,547;
5,667,972;
5,695,940; 5,700,637; 5,744,305; 5,800,992; 5,807,522; 5,830,645; 5,837,196;
5,871,928;
5,847,219; 5,876,932; 5,919,626; 6,004,755; 6,087,102; 6,368,799; 6,383,749;
6,617,112;
6,638,717; 6,720,138, as well as WO 93/17126; WO 95/11995; WO 95/21265; WO
95/21944; WO 95/35505; WO 96/31622; WO 97/10365; WO 97/27317; WO 99/35505; WO
09923256; WO 09936760; W00138580; WO 0168255; WO 03020898; WO 03040410; WO
03053586; WO 03087297; WO 03091426; W003100012; WO 04020085; WO 04027093;
EP 373 203; EP 785 280; EP 799 897 and UK 8 803 000; the disclosures of which are all herein incorporated by reference.

[00170] It is contemplated that the arrays can be high density arrays, such that they contain 2, 20, 25, 50, 80, 100 or more different probes. It is contemplated that they may contain 1000, 16,000, 65,000, 250,000 or 1,000,000 or more different probes. The probes can be directed to mRNA and/or miRNA targets in one or more different organisms or cell types.
The oligonucleotide probes range from 5 to 50, 5 to 45, 10 to 40, 9 to 34, or 15 to 40 nucleotides in length in some embodiments. In certain embodiments, the oligonucleotide probes are 5, 10, 15, 20 to 20, 25, 30, 35, 40 nucleotides in length including all integers and ranges there between.

[00171] The location and sequence of each different probe sequence in the array are generally known. Moreover, the large number of different probes can occupy a relatively small area providing a high density array having a probe density of generally greater than about 60, 100, 600, 1000, 5,000, 10,000, 40,000, 100,000, or 400,000 different oligonucleotide probes per cmZ. The surface area of the array can be about or less than about 1, 1.6, 2, 3, 4, 5, 6, 7, 8, 9, or 10 cm2.

[00172] Moreover, a person of ordinary skill in the art could readily analyze data generated using an array. Such protocols are disclosed above, and include information found in WO 9743450; WO 03023058; WO 03022421; WO 03029485; WO 03067217; WO
03066906; WO 03076928; WO 03093810; WO 03100448A1, all of which are specifically incorporated by reference.

B. Sample Preparation [00173] It is contemplated that the RNA and/or miRNA of a wide variety of samples can be analyzed using the arrays, index of probes, or array technology of the invention. While endogenous miRNA is contemplated for use with compositions and methods of the invention, recombinant miRNA - including nucleic acids that are complementary or identical to endogenous miRNA or precursor miRNA - can also be handled and analyzed as described herein. Samples may be biological samples, in which case, they can be from biopsy, fine needle aspirates, exfoliates, blood, tissue, organs, semen, saliva, tears, other bodily fluid, hair follicles, skin, or any sample containing or constituting biological cells, particularly cancer or hyperproliferative cells. In certain embodiments, samples may be, but are not limited to, biopsy, or cells purified or enriched to some extent from a biopsy or other bodily fluids or tissues. Alternatively, the sample may not be a biological sample, but be a chemical mixture, such as a cell-free reaction mixture (which may contain one or more biological enzymes).

C. Hybridization [00174] After an array or a set of probes is prepared and/or the nucleic acid in the sample or probe is labeled, the population of target nucleic acids is contacted with the array or probes under hybridization conditions, where such conditions can be adjusted, as desired, to provide for an optimum level of specificity in view of the particular assay being performed. Suitable hybridization conditions are well known to those of skill in the art and reviewed in Sambrook et al. (2001) and WO 95/21944. Of particular interest in many embodiments is the use of stringent conditions during hybridization. Stringent conditions are known to those of skill in the art.

[00175] It is specifically contemplated that a single array or set of probes may be contacted with multiple samples. The samples may be labeled with different labels to distinguish the samples. For example, a single array can be contacted with a tumor tissue sample labeled with Cy3, and normal tissue sample labeled with Cy5. Differences between the samples for particular miRNAs corresponding to probes on the array can be readily ascertained and quantified.

[00176] The small surface area of the array permits uniform hybridization conditions, such as temperature regulation and salt content. Moreover, because of the small area occupied by the high density arrays, hybridization may be carried out in extremely small fluid volumes (e.g., about 250 l or less, including volumes of about or less than about 5, 10, 25, 50, 60, 70, 80, 90, 100 1, or any range derivable therein). In small volumes, hybridization may proceed very rapidly.

D. Differential Expression Analyses [00177] Arrays of the invention can be used to detect differences between two samples.
Specifically contemplated applications include identifying and/or quantifying differences between miRNA or gene expression from a sample that is normal and from a sample that is not normal, between a disease or condition and a cell not exhibiting such a disease or condition, or between two differently treated samples. Also, miRNA or gene expression may be compared between a sample believed to be susceptible to a particular disease or condition and one believed to be not susceptible or resistant to that disease or condition. A sample that is not normal is one exhibiting phenotypic or genotypic trait(s) of a disease or condition, or one believed to be not normal with respect to that disease or condition. It may be compared to a cell that is normal with respect to that disease or condition. Phenotypic traits include symptoms of, or susceptibility to, a disease or condition of which a component is or may or may not be genetic, or caused by a hyperproliferative or neoplastic cell or cells.

[00178] An array comprises a solid support with nucleic acid probes attached to the support. Arrays typically comprise a plurality of different nucleic acid probes that are coupled to a surface of a substrate in different, known locations. These arrays, also described as "microarrays" or colloquially "chips" have been generally described in the art, for example, U.S. Patents 5,143,854, 5,445,934, 5,744,305, 5,677,195, 6,040,193, 5,424,186 and Fodor et al., (1991), each of which is incorporated by reference in its entirety for all purposes.
Techniques for the synthesis of these arrays using mechanical synthesis methods are described in, e.g., U.S. Patent 5,384,261, incorporated herein by reference in its entirety for all purposes. Although a planar array surface is used in certain aspects, the array may be fabricated on a surface of virtually any shape or even a multiplicity of surfaces. Arrays may be nucleic acids on beads, gels, polymeric surfaces, fibers such as fiber optics, glass or any other appropriate substrate, see U.S. Patents 5,770,358, 5,789,162, 5,708,153, 6,040,193 and 5,800,992, which are hereby incorporated in their entirety for all purposes.
Arrays may be packaged in such a manner as to allow for diagnostics or other manipulation of an all inclusive device, see for example, U.S. Patents 5,856,174 and 5,922,591 incorporated in their entirety by reference for all purposes. See also U.S. patent application Ser.
No. 09/545,207, filed April, 7, 2000 for additional information concerning arrays, their manufacture, and their characteristics, which is incorporated by reference in its entirety for all purposes.

[00179] Particularly, arrays can be used to evaluate samples with respect to pathological condition such as cancer and related conditions. It is specifically contemplated that the invention can be used to evaluate differences between stages or sub-classifications of disease, such as between benign, cancerous, and metastatic tissues or tumors.

[00180] Phenotypic traits to be assessed include characteristics such as longevity, morbidity, expected survival, susceptibility or receptivity to particular drugs or therapeutic treatments (drug efficacy), and risk of drug toxicity. Samples that differ in these phenotypic traits may also be evaluated using the compositions and methods described.

[00181] In certain embodiments, miRNA and/or expression profiles may be generated to evaluate and correlate those profiles with pharmacokinetics or therapies. For example, these profiles may be created and evaluated for patient tumor and blood samples prior to the patient's being treated or during treatment to determine if there are miRNA or genes whose expression correlates with the outcome of the patient's treatment.
Identification of differential miRNAs or genes can lead to a diagnostic assay for evaluation of tumor and/or blood samples to determine what drug regimen the patient should be provided.
In addition, it can be used to identify or select patients suitable for a particular clinical trial. If an expression profile is determined to be correlated with drug efficacy or drug toxicity, that profile is relevant to whether that patient is an appropriate patient for receiving a drug, for receiving a combination of drugs, or for receiving a particular dosage of the drug.

[00182] In addition to the above prognostic assay, samples from patients with a variety of diseases can be evaluated to determine if different diseases can be identified based on miRNA and/or related gene expression levels. A diagnostic assay can be created based on the profiles that doctors can use to identify individuals with a disease or who are at risk to develop a disease. Alternatively, treatments can be designed based on miRNA
profiling.
Examples of such methods and compositions are described in the U.S.
Provisional Patent Application entitled "Methods and Compositions Involving miRNA and miRNA
Inhibitor Molecules" filed on May 23, 2005 in the names of David Brown, Lance Ford, Angie Cheng and Rich Jarvis, which is hereby incorporated by reference in its entirety.

E. Other Assays [00183] In addition to the use of arrays and microarrays, it is contemplated that a number of different assays could be employed to analyze miRNAs or related genes, their activities, and their effects. Such assays include, but are not limited to, nucleic acid amplification, polymerase chain reaction, quantitative PCR, RT-PCR, in situ hybridization, Northern hybridization, hybridization protection assay (HPA)(GenProbe), branched DNA
(bDNA) assay (Chiron), rolling circle amplification (RCA), single molecule hybridization detection (US Genomics), Invader assay (ThirdWave Technologies), and/or Bridge Litigation Assay (Genaco).

IV. NUCLEIC ACIDS

[00184] The present invention concerns nucleic acids, modified or mimetic nucleic acids, miRNAs, mRNAs, genes, and representative fragments thereof that can be labeled, used in array analysis, or employed in diagnostic, therapeutic, or prognostic applications, particularly those related to pathological conditions such as cancer. The molecules may have been endogenously produced by a cell, or been synthesized or produced chemically or recombinantly. They may be isolated and/or purified. Each of the miRNAs described herein and includes the corresponding SEQ ID NO and accession numbers for these miRNA
sequences. The name of a miRNA is often abbreviated and referred to without a "hsa-"
prefix and will be understood as such, depending on the context. Unless otherwise indicated, miRNAs referred to in the application are, human sequences identified as miR-X
or let-X, where X is a number and/or letter.

[00185] In certain aspects, a miRNA probe designated by a suffix "5P" or "3P"
can be used. "5P" indicates that the mature miRNA derives from the 5' end of the precursor and a corresponding "3P" indicates that it derives from the 3' end of the precursor, as described on the world wide web at sanger.ac.uk. Moreover, in some embodiments, a miRNA
probe is used that does not correspond to a.known human miRNA. It is contemplated that these non-human miRNA probes may be used in embodiments of the invention or that there may exist a human miRNA that is homologous to the non-human miRNA. In other embodiments, any mammalian cell, biological sample, or preparation thereof may be employed.

[00186] In some embodiments of the invention, methods and compositions involving miRNA may concern miRNA, markers (e.g., mRNAs), and/or other nucleic acids.
Nucleic acids may be, be at least, or be at most 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 nucleotides, or any range derivable therein, in length. Such lengths cover the lengths of processed miRNA, miRNA
probes, precursor miRNA, miRNA containing vectors, mRNA, mRNA probes, control nucleic acids, and other probes and primers.

[00187] In many embodiments, miRNA are 19-24 nucleotides in length, while miRNA
probes are 19-35 nucleotides in length, depending on the length of the processed miRNA and any flanking regions added. miRNA precursors are generally between 62 and 110 nucleotides in humans.

[00188] Nucleic acids of the invention may have regions of identity or complementarity to another nucleic acid. It is contemplated that the region of complementarity or identity can be at least 5 contiguous residues, though it is specifically contemplated that the region is, is at least, or is at most 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 contiguous nucleotides. It is further understood that the length of complementarity within a precursor miRNA or other nucleic acid or between a miRNA probe and a miRNA or a miRNA gene are such lengths. Moreover, the complementarity may be expressed as a percentage, meaning that the complementarity between a probe and its target is 90% or greater over the length of the probe. In some embodiments, complementarity is or is at least 90%, 95% or 100%. In particular, such lengths may be applied to any nucleic acid comprising a nucleic acid sequence identified in any of SEQ ID NOs described herein, accession number, or any other sequence disclosed herein. Typically, the commonly used name of the miRNA is given (with its identifying source in the prefix, for example, "hsa" for human sequences) and the processed miRNA sequence. Unless otherwise indicated, a miRNA without a prefix will be understood to refer to a human miRNA. Moreover, a lowercase letter in a miRNA name may or may not be lowercase; for example, hsa-mir-130b can also be referred to as miR-130B. The term "miRNA probe" refers to a nucleic acid probe that can identify a particular miRNA or structurally related miRNAs.

[00189] It is understood that some nucleic acids are derived from genomic sequences or a gene. In this respect, the term "gene" is used for simplicity to refer to the genomic sequence encoding the precursor nucleic acid or miRNA for a given miRNA or gene.
However, embodiments of the invention may involve genomic sequences of a miRNA that are involved in its expression, such as a promoter or other regulatory sequences.

[00190] The term "recombinant" may be used and this generally refers to a molecule that has been manipulated in vitro or that is a replicated or expressed product of such a molecule.
[00191] The term "nucleic acid" is well known in the art. A "nucleic acid" as used herein will generally refer to a molecule (one or more strands) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A," a guanine "G," a thymine "T" or a cytosine "C") or RNA (e.g., an A, a G, an uracil "U" or a C).
The term "nucleic acid" encompasses the terms "oligonucleotide" and "polynucleotide,"
each as a subgenus of the term "nucleic acid."

[00192] The term "miRNA" generally refers to a single-stranded molecule, but in specific embodiments, molecules implemented in the invention will also encompass a region or an additional strand that is partially (between 10 and 50% complementary across length of strand), substantially (greater than 50% but less than 100% complementary across length of strand) or fully complementary to another region of the same single-stranded molecule or to another nucleic acid. Thus, miRNA nucleic acids may encompass a molecule that comprises one or more complementary or self-complementary strand(s) or "complement(s)"
of a particular sequence. For example, precursor miRNA may have a self-complementary region, which is up to 100% complementary. miRNA probes or nucleic acids of the invention can include, can be or can be at least 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100%
complementary to their target.

[00193] It is understood that a "synthetic nucleic acid" of the invention means that the nucleic acid does not have all or part of a chemical structure or sequence of a naturally occurring nucleic acid. Consequently, it will be understood that the term "synthetic miRNA"
refers to a "synthetic nucleic acid" that functions in a cell or under physiological conditions as a naturally occurring miRNA.

[00194] While embodiments of the invention may involve synthetic miRNAs or synthetic nucleic acids, in some embodiments of the invention, the nucleic acid molecule(s) need not be "synthetic." In certain embodiments, a non-synthetic nucleic acid or miRNA
employed in methods and compositions of the invention may have the entire sequence and structure of a naturally occurring mRNA or miRNA precursor or the mature mRNA or miRNA. For example, non-synthetic miRNAs used in methods and compositions of the invention may not have one or more modified nucleotides or nucleotide analogs. In these embodiments, the non-synthetic miRNA may or may not be recombinantly produced. In particular embodiments, the nucleic acid in methods and/or compositions of the invention is specifically a synthetic miRNA and not a non-synthetic miRNA (that is, not a miRNA that qualifies as "synthetic"); though in other embodiments, the invention specifically involves a non-synthetic miRNA and not a synthetic miRNA. Any embodiments discussed with respect to the use of synthetic miRNAs can be applied with respect to non-synthetic miRNAs, and vice versa.

[00195] It will be understood that the term "naturally occurring" refers to something found in an organism without any intervention by a person; it could refer to a naturally-occurring wildtype or mutant molecule. In some embodiments a synthetic miRNA molecule does not have the sequence of a naturally occurring miRNA molecule. In other embodiments, a synthetic miRNA molecule may have the sequence of a naturally occurring miRNA
molecule, but the chemical structure of the molecule, particularly in the part unrelated specifically to the precise sequence (non-sequence chemical structure) differs from chemical structure of the naturally occurring miRNA molecule with that sequence. In some cases, the synthetic miRNA has both a sequence and non-sequence chemical structure that are not found in a naturally-occurring miRNA. Moreover, the sequence of the synthetic molecules will identify which miRNA is effectively being provided or inhibited; the endogenous miRNA will be referred to as the "corresponding miRNA." Corresponding miRNA
sequences that can be used in the context of the invention include, but are not limited to, all or a portion of those sequences in the SEQ IDs provided herein, as well as any other miRNA
sequence, miRNA precursor sequence, or any sequence complementary thereof. In some embodiments, the sequence is or is derived from or contains all or part of a sequence identified herein to target a particular miRNA (or set of miRNAs) that can be used with that sequence. Any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260 or any number or range of sequences there between may be selected to the exclusion of all non-selected sequences.

[00196] As used herein, "hybridization", "hybridizes" or "capable of hybridizing" is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature. The term "anneal" as used herein is synonymous with "hybridize." The term "hybridization", "hybridize(s)" or "capable of hybridizing"
encompasses the terms "stringent condition(s)" or "high stringency" and the terms "low stringency" or "low stringency condition(s)."

[00197] As used herein "stringent condition(s)" or "high stringency" are those conditions that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but preclude hybridization of random sequences.
Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are well known to those of ordinary skill in the art, and are preferred for applications requiring high selectivity. Non-limiting applications include isolating a nucleic acid, such as a gene or a nucleic acid segment thereof, or detecting at least one specific mRNA transcript or a nucleic acid segment thereof, and the like.

[00198] Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.5 M NaCI at temperatures of about 42 C to about 70 C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and to the presence or concentration of formamide, tetramethylammonium chloride or other solvent(s) in a hybridization mixture.

[00199] It is also understood that these ranges, compositions and conditions for hybridization are mentioned by way of non-limiting examples only, and that the desired stringency for a particular hybridization reaction is often determined empirically by comparison to one or more positive or negative controls. Depending on the application envisioned it is preferred to employ varying conditions of hybridization to achieve varying degrees of selectivity of a nucleic acid towards a target sequence. In a non-limiting example, identification or isolation of a related target nucleic acid that does not hybridize to a nucleic acid under stringent conditions may be achieved by hybridization at low temperature and/or high ionic strength. Such conditions are termed "low stringency" or "low stringency conditions," and non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCI at a temperature range of about 20 C to about 50 C. Of course, it is within the skill of one in the art to further modify the low or high stringency conditions to suite a particular application.

A. Nucleobase, Nucleoside, Nucleotide, and Modified Nucleotides [00200] As used herein a "nucleobase" refers to a heterocyclic base, such as for example a naturally occurring nucleobase (i.e., an A, T, G, C or U) found in at least one naturally occurring nucleic acid (i.e., DNA and RNA), and naturally or non-naturally occurring derivative(s) and analogs of such a nucleobase. A nucleobase generally can form one or more hydrogen bonds ("anneal" or "hybridize") with at least one naturally occurring nucleobase in a manner that may substitute for naturally occurring nucleobase pairing (e.g., the hydrogen bonding between A and T, G and C, and A and U).

[00201] "Purine" and/or "pyrimidine" nucleobase(s) encompass naturally occurring purine and/or pyrimidine nucleobases and also derivative(s) and analog(s) thereof, including but not limited to, those a purine or pyrimidine substituted by one or more of an alkyl, caboxyalkyl, amino, hydroxyl, halogen (i.e., fluoro, chloro, bromo, or iodo), thiol or alkylthiol moiety.
Preferred alkyl (e.g., alkyl, carboxyalkyl, etc.) moieties comprise of from about 1, about 2, about 3, about 4, about 5, to about 6 carbon atoms. Other non-limiting examples of a purine or pyrimidine include a deazapurine, a 2,6-diaminopurine, a 5-fluorouracil, a xanthine, a hypoxanthine, a 8-bromoguanine, a 8-chloroguanine, a bromothymine, a 8-aminoguanine, a 8-hydroxyguanine, a 8-methylguanine, a 8-thioguanine, an azaguanine, a 2-aminopurine, a 5-ethylcytosine, a 5-methylcyosine, a 5-bromouracil, a 5-ethyluracil, a 5-iodouracil, a 5-chlorouracil, a 5-propyluracil, a thiouracil, a 2-methyladenine, a methylthioadenine, a N,N-diemethyladenine, an azaadenines, a 8-bromoadenine, a 8-hydroxyadenine, a 6-hydroxyaminopurine, a 6-thiopurine, a 4-(6-aminohexyl/cytosine), and the like.
Other examples are well known to those of skill in the art.

[00202] As used herein, a "nucleoside" refers to an individual chemical unit comprising a nucleobase covalently attached to a nucleobase linker moiety. A non-limiting example of a "nucleobase linker moiety" is a sugar comprising 5-carbon atoms (i.e., a "5-carbon sugar"), including but not limited to a deoxyribose, a ribose, an arabinose, or a derivative or an analog of a 5-carbon sugar. Non-limiting examples of a derivative or an analog of a 5-carbon sugar include a 2'-fluoro-2'-deoxyribose or a carbocyclic sugar where a carbon is substituted for an oxygen atom in the sugar ring. Different types of covalent attachment(s) of a nucleobase to a nucleobase linker moiety are known in the art (Kornberg and Baker, 1992).

[00203] As used herein, a "nucleotide" refers to a nucleoside further comprising a "backbone moiety". A backbone moiety generally covalently attaches a nucleotide to another molecule comprising a nucleotide, or to another nucleotide to form a nucleic acid. The "backbone moiety" in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5-carbon sugar. The attachment of the backbone moiety typically occurs at either the 3'- or 5'-position of the 5-carbon sugar. However, other types of attachments are known in the art, particularly when a nucleotide comprises derivatives or analogs of a naturally occurring 5-carbon sugar or phosphorus moiety.

[00204] A nucleic acid may comprise, or be composed entirely of, a derivative or analog of a nucleobase, a nucleobase linker moiety and/or backbone moiety that may be present in a naturally occurring nucleic acid. RNA with nucleic acid analogs may also be labeled according to methods of the invention. As used herein a "derivative" refers to a chemically modified or altered form of a naturally occurring molecule, while the terms "mimic" or "analog" refer to a molecule that may or may not structurally resemble a naturally occurring molecule or moiety, but possesses similar functions. As used herein, a "moiety" generally refers to a smaller chemical or molecular component of a larger chemical or molecular structure. Nucleobase, nucleoside and nucleotide analogs or derivatives are well known in the art, and have been described (see for example, Scheit, 1980, incorporated herein by reference).

[00205] Additional non-limiting examples of nucleosides, nucleotides or nucleic acids include those in: U.S. Patents 5,681,947, 5,652,099 and 5,763,167, 5,614,617, 5,670,663, 5,872,232, 5,859,221, 5,446,137, 5,886,165, 5,714,606, 5,672,697, 5,466,786, 5,792,847, 5,223,618, 5,470,967, 5,378,825, 5,777,092, 5,623,070, 5,610,289, 5,602,240, 5,858,988, 5,214,136, 5,700,922, 5,708,154, 5,728,525, 5,637,683, 6,251,666, 5,480,980, and 5,728,525, each of which is incorporated herein by reference in its entirety.

[00206] Labeling methods and kits of the invention specifically contemplate the use of nucleotides that are both modified for attachment of a label and can be incorporated into a miRNA molecule. Such nucleotides include those that can be labeled with a dye, including a fluorescent dye, or with a molecule such as biotin. Labeled nucleotides are readily available;
they can be acquired commercially or they can be synthesized by reactions known to those of skill in the art.

[00207] Modified nucleotides for use in the invention are not naturally occurring nucleotides, but instead, refer to prepared nucleotides that have a reactive moiety on them.
Specific reactive functionalities of interest include: amino, sulfhydryl, sulfoxyl, aminosulfhydryl, azido, epoxide, isothiocyanate, isocyanate, anhydride, monochlorotriazine, dichlorotriazine, mono-or dihalogen substituted pyridine, mono- or disubstituted diazine, maleimide, epoxide, aziridine, sulfonyl halide, acid halide, alkyl halide, aryl halide, alkylsulfonate, N-hydroxysuccinimide ester, imido ester, hydrazine, azidonitrophenyl, azide, 3-(2-pyridyl dithio)-propionamide, glyoxal, aldehyde, iodoacetyl, cyanomethyl ester, p-nitrophenyl ester, o-nitrophenyl ester, hydroxypyridine ester, carbonyl imidazole, and the other such chemical groups. In some embodiments, the reactive functionality may be bonded directly to a nucleotide, or it may be bonded to the nucleotide through a linking group. The functional moiety and any linker cannot substantially impair the ability of the nucleotide to be added to the miRNA or to be labeled. Representative linking groups include carbon containing linking groups, typically ranging from about 2 to 18, usually from about 2 to 8 carbon atoms, where the carbon containing linking groups may or may not include one or more heteroatoms, e.g. S, 0, N etc., and may or may not include one or more sites of unsaturation. Of particular interest in many embodiments is alkyl linking groups, typically lower alkyl linking groups of 1 to 16, usually 1 to 4 carbon atoms, where the linking groups may include one or more sites of unsaturation. The functionalized nucleotides (or primers) used in the above methods of functionalized target generation may be fabricated using known protocols or purchased from commercial vendors, e.g., Sigma, Roche, Ambion, Biosearch Technologies and NEN. Functional groups may be prepared according to ways known to those of skill in the art, including the representative information found in U.S. Patents 4,404,289; 4,405,711; 4,337,063 and 5,268,486, and U.K.. Patent 1,529,202, which are all incorporated by reference.

[00208] Amine-modified nucleotides are used in several embodiments of the invention.
The amine-modified nucleotide is a nucleotide that has a reactive amine group for attachment of the label. It is contemplated that any ribonucleotide (G, A, U, or C) or deoxyribonucleotide (G, A, T, or C) can be modified for labeling. Examples include, but are not limited to, the following modified ribo- and deoxyribo-nucleotides: 5-(3-aminoallyl)-UTP; 8-[(4-amino)butyl]-amino-ATP and 8-[(6-amino)butyl]-amino-ATP; N6-(4-amino)butyl-ATP, N6-(6-amino)butyl-ATP, N4-[2,2-oxy-bis-(ethylamine)]-CTP; N6-(6-Amino)hexyl-ATP; 8-[(6-Amino)hexyl]-amino-ATP; 5-propargylamino-CTP, 5-propargylamino-UTP; 5-(3-aminoallyl)-dUTP; 8-[(4-amino)butyl]-amino-dATP and 8-[(6-amino)butyl]-amino-dATP; N6-(4-amino)butyl-dATP, N6-(6-amino)butyl-dATP, N4-[2,2-oxy-bis-(ethylamine)]-dCTP; N6-(6-Amino)hexyl-dATP; 8-[(6-Amino)hexyl]-amino-dATP;
5-propargylamino-dCTP, and 5-propargylamino-dUTP. Such nucleotides can be prepared according to methods known to those of skill in the art. Moreover, a person of ordinary skill in the art could prepare other nucleotide entities with the same amine-modification, such as a 5-(3-aminoallyl)-CTP, GTP, ATP, dCTP, dGTP, dTTP, or dUTP in place of a 5-(3-aminoallyl)-UTP.

B. Preparation of Nucleic Acids [00209] A nucleic acid may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production, or biological production. It is specifically contemplated that miRNA probes of the invention are chemically synthesized.

[00210] In some embodiments of the invention, miRNAs are recovered or isolated from a biological sample. The miRNA may be recombinant or it may be natural or endogenous to the cell (produced from the cell's genome). It is contemplated that a biological sample may be treated in a way so as to enhance the recovery of small RNA molecules such as miRNA.
U.S. Patent Application Serial No. 10/667,126 describes such methods and it is specifically incorporated by reference herein. Generally, methods involve lysing cells with a solution having guanidinium and a detergent.

[00211] Alternatively, nucleic acid synthesis is performed according to standard methods.
See, for example, Itakura and Riggs (1980) and U.S. Patents 4,704,362, 5,221,619, and 5,583,013, each of which is incorporated herein by reference. Non-limiting examples of a synthetic nucleic acid (e.g., a synthetic oligonucleotide), include a nucleic acid made by in vitro chemically synthesis using phosphotriester, phosphite, or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., 1986 and U.S. Patent 5,705,629, each incorporated herein by reference.
Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Patents 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.

[00212] A non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCRTM (see for example, U.S.
Patents 4,683,202 and 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Patent 5,645,897, incorporated herein by reference. See also Sambrook et al., 2001, incorporated herein by reference).

[00213] Oligonucleotide synthesis is well known to those of skill in the art.
Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S.
Patents 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.

[00214] Recombinant methods for producing nucleic acids in a cell are well known to those of skill in the art. These include the use of vectors (viral and non-viral), plasmids, cosmids, and other vehicles for delivering a nucleic acid to a cell, which may be the target cell (e.g., a cancer cell) or simply a host cell (to produce large quantities of the desired RNA
molecule). Alternatively, such vehicles can be used in the context of a cell free system so long as the reagents for generating the RNA molecule are present. Such methods include those described in Sambrook, 2003, Sambrook, 2001 and Sambrook, 1989, which are hereby incorporated by reference.

C. Isolation of Nucleic Acids [00215] Nucleic acids may be isolated using techniques well known to those of skill in the art, though in particular embodiments, methods for isolating small nucleic acid molecules, and/or isolating RNA molecules can be employed. Chromatography is a process often used to separate or isolate nucleic acids from protein or from other nucleic acids.
Such methods can involve electrophoresis with a gel matrix, filter columns, alcohol precipitation, and/or other chromatography. If miRNA from cells is to be used or evaluated, methods generally involve lysing the cells with a chaotropic (e.g., guanidinium isothiocyanate) and/or detergent (e.g., N-lauroyl sarcosine) prior to implementing processes for isolating particular populations of RNA.

[00216] In particular methods for separating miRNA from other nucleic acids, a gel matrix is prepared using polyacrylamide, though agarose can also be used. The gels may be graded by concentration or they may be unifonn. Plates or tubing can be used to hold the gel matrix for electrophoresis. Usually one-dimensional electrophoresis is employed for the separation of nucleic acids. Plates are used to prepare a slab gel, while the tubing (glass or rubber, typically) can be used to prepare a tube gel. The phrase "tube electrophoresis" refers to the use of a tube or tubing, instead of plates, to form the gel. Materials for implementing tube electrophoresis can be readily prepared by a person of skill in the art or purchased, such as from C.B.S. Scientific Co., Inc. or Scie-Plas.

[00217] Methods may involve the use of organic solvents and/or alcohol to isolate nucleic acids, particularly miRNA used in methods and compositions of the invention.
Some embodiments are described in U.S. Patent Application Serial No. 10/667,126, which is hereby incorporated by reference. Generally, this disclosure provides methods for efficiently isolating small RNA molecules from cells comprising: adding an alcohol solution to a cell lysate and applying the alcohol/lysate mixture to a solid support before eluting the RNA
molecules from the solid support. In some embodiments, the amount of alcohol added to a cell lysate achieves an alcohol concentration of about 55% to 60%. While different alcohols can be employed, ethanol works well. A solid support may be any structure, and it includes beads, filters, and columns, which may include a mineral or polymer support with electronegative groups. A glass fiber filter or column has worked particularly well for such isolation procedures.

[00218] In specific embodiments, miRNA isolation processes include: a) lysing cells in the sample with a lysing solution comprising guanidinium, wherein a lysate with a concentration of at least about 1 M guanidinium is produced; b) extracting miRNA molecules from the lysate with an extraction solution comprising phenol; c) adding to the lysate an alcohol solution for forming a lysate/alcohol mixture, wherein the concentration of alcohol in the mixture is between about 35% to about 70%; d) applying the lysate/alcohol mixture to a solid support; e) eluting the miRNA molecules from the solid support with an ionic solution; and, f) capturing the miRNA molecules. Typically the sample is dried and resuspended in a liquid and volume appropriate for subsequent manipulation.

V. LABELS AND LABELING TECHNIQUES

[00219] In some embodiments, the present invention concerns miRNA that are labeled. It is contemplated that miRNA may first be isolated and/or purified prior to labeling. This may achieve a reaction that more efficiently labels the miRNA, as opposed to other RNA in a sample in which the miRNA is not isolated or purified prior to labeling. In many embodiments of the invention, the label is non-radioactive. Generally, nucleic acids may be labeled by adding labeled nucleotides (one-step process) or adding nucleotides and labeling the added nucleotides (two-step process).

A. Labeling Techniques [00220] In some embodiments, nucleic acids are labeled by catalytically adding to the nucleic acid an already labeled nucleotide or nucleotides. One or more labeled nucleotides can be added to miRNA molecules. See U.S. Patent 6,723,509, which is hereby incorporated by reference.

[00221] In other embodiments, an unlabeled nucleotide or nucleotides is catalytically added to a miRNA, and the unlabeled nucleotide is modified with a chemical moiety that enables it to be subsequently labeled. In embodiments of the invention, the chemical moiety is a reactive amine such that the nucleotide is an amine-modified nucleotide.
Examples of amine-modified nucleotides are well known to those of skill in the art, many being commercially available such as from Ambion, Sigma, Jena Bioscience, and TriLink.

[00222] In contrast to labeling of cDNA during its synthesis, the issue for labeling miRNA
is how to label the already existing molecule. The present invention concerns the use of an enzyme capable of using a di- or tri-phosphate ribonucleotide or deoxyribonucleotide as a substrate for its addition to a miRNA. Moreover, in specific embodiments, it involves using a modified di- or tri-phosphate ribonucleotide, which is added to the 3' end of a miRNA.
Enzymes capable of adding such nucleotides include, but are not limited to, poly(A) polymerase, terminal transferase, and polynucleotide phosphorylase. In specific embodiments of the invention, a ligase is contemplated as not being the enzyme used to add the label, and instead, a non-ligase enzyme is employed. Terminal transferase catalyzes the addition of nucleotides to the 3' terminus of a nucleic acid. Polynucleotide phosphorylase can polymerize nucleotide diphosphates without the need for a primer.

B. Labels [00223] Labels on miRNA or miRNA probes may be colorimetric (includes visible and UV spectrum, including fluorescent), luminescent, enzymatic, or positron emitting (including radioactive). The label may be detected directly or indirectly. Radioactive labels include 125I332P, 33P, and 35S. Examples of enzymatic labels include alkaline phosphatase, luciferase, horseradish peroxidase, and [i-galactosidase. Labels can also be proteins with luminescent properties, e.g., green fluorescent protein and phycoerythrin.

[00224] The colorimetric and fluorescent labels contemplated for use as conjugates include, but are not limited to, Alexa Fluor dyes, BODIPY dyes, such as BODIPY
FL;
Cascade Blue; Cascade Yellow; coumarin and its derivatives, such as 7-amino-4-methylcoumarin, aminocoumarin and hydroxycoumarin; cyanine dyes, such as Cy3 and Cy5;
eosins and erythrosins; fluorescein and its derivatives, such as fluorescein isothiocyanate;
macrocyclic chelates of lanthanide ions, such as Quantum DyeTM; Marina Blue;
Oregon Green; rhodamine dyes, such as rhodamine red, tetramethylrhodamine and rhodamine 6G;
Texas Red; , fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer;
and, TOTAB.

[00225] Specific examples of dyes include, but are not limited to, those identified above and the following: Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500. Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, and, Alexa Fluor 750; amine-reactive BODIPY dyes, such as BODIPY 493/503, BODIPY 530/550, BODIPY 558/568, BODIPY
564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/655, BODIPY FL, BODIPY R6G, BODIPY TMR, and, BODIPY-TR; Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, 2',4',5',7'-Tetrabromosulfonefluorescein, and TET.

[00226] Specific examples of fluorescently labeled ribonucleotides are available from Molecular Probes, and these include, Alexa Fluor 488-5-UTP, Fluorescein-l2-UTP, BODIPY
FL-14-UTP, BODIPY TMR-I4-UTP, Tetramethylrhodamine-6-UTP, Alexa Fluor 546-14-UTP, Texas Red-5-UTP, and BODIPY TR-14-UTP. Other fluorescent ribonucleotides are available from Amersham Biosciences, such as Cy3-UTP and Cy5-UTP.

[00227] Examples of fluorescently labeled deoxyribonucleotides include Dinitrophenyl (DNP)-11-dUTP, Cascade Blue-7-dUTP, Alexa Fluor 488-5-dUTP, Fluorescein-I2-dUTP, Oregon Green 488-5-dUTP, BODIPY FL-14-dUTP, Rhodamine Green-5-dUTP, Alexa Fluor 532-5-dUTP, BODIPY TMR-14-dUTP, Tetramethylrhodamine-6-dUTP, Alexa Fluor 546-14-dUTP, Alexa Fluor 568-5-dUTP, Texas Red-12-dUTP, Texas Red-5-dUTP, BODIPY
TR-14-dUTP, Alexa Fluor 594-5-dUTP, BODIPY 630/650-14-dUTP, BODIPY 650/665-14-dUTP; Alexa Fluor 488-7-OBEA-dCTP, Alexa Fluor 546-16-OBEA-dCTP, Alexa Fluor 7-OBEA-dCTP, Alexa Fluor 647-12-OBEA-dCTP.

[00228] It is contemplated that nucleic acids may be labeled with two different labels.
Furthermore, fluorescence resonance energy transfer (FRET) may be employed in methods of the invention (e.g., Klostermeier et al., 2002; Emptage, 2001; Didenko, 2001, each incorporated by reference).

[00229] Alternatively, the label may not be detectable per se, but indirectly detectable or allowing for the isolation or separation of the targeted nucleic acid. For example, the label could be biotin, digoxigenin, polyvalent cations, chelator groups and the other ligands, include ligands for an antibody.

C. Visualization Techniques [00230] A number of techniques for visualizing or detecting labeled nucleic acids are readily available. Such techniques include, microscopy, arrays, Fluorometry, Light cyclers or other real time PCR machines, FACS analysis, scintillation counters, Phosphoimagers, Geiger counters, MRI, CAT, antibody-based detection methods (Westerns, immunofluorescence, immunohistochemistry), histochemical techniques, HPLC
(Griffey et al., 1997), spectroscopy, capillary gel electrophoresis (Cummins et al., 1996), spectroscopy;
mass spectroscopy; radiological techniques; and mass balance techniques.

[00231] When two or more differentially colored labels are employed, fluorescent resonance energy transfer (FRET) techniques may be employed to characterize association of one or more nucleic acid. Furthermore, a person of ordinary skill in the art is well aware of ways of visualizing, identifying, and characterizing labeled nucleic acids, and accordingly, such protocols may be used as part of the invention. Examples of tools that may be used also include fluorescent microscopy, a BioAnalyzer, a plate reader, Storm (Molecular Dynamics), Array Scanner, FACS (fluorescent activated cell sorter), or any instrument that has the ability to excite and detect a fluorescent molecule.

VI. KITS

[00232] Any of the compositions described herein may be comprised in a kit. In a non-limiting example, reagents for isolating miRNA, labeling miRNA, and/or evaluating a miRNA population using an array, nucleic acid amplification, and/or hybridization can be included in a kit, as well reagents for preparation of samples from blood samples. The kit may further include reagents for creating or synthesizing miRNA probes. The kits will thus comprise, in suitable container means, an enzyme for labeling the miRNA by incorporating labeled nucleotide or unlabeled nucleotides that are subsequently labeled. In certain aspects, the kit can include amplification reagents. In other aspects, the kit may include various supports, such as glass, nylon, polymeric beads, and the like, and/or reagents for coupling any probes and/or target nucleic acids. It may also include one or more buffers, such as reaction buffer, labeling buffer, washing buffer, or a hybridization buffer, compounds for preparing the miRNA probes, and components for isolating miRNA. Other kits of the invention may include components for making a nucleic acid array comprising miRNA, and thus, may include, for example, a solid support.

[00233] Kits for implementing methods of the invention described herein are specifically contemplated. In some embodiments, there are kits for preparing miRNA for multi-labeling and kits for preparing miRNA probes and/or miRNA arrays. In these embodiments, kit comprise, in suitable container means, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more of the following: (1) poly(A) polymerase; (2) unmodified nucleotides (G, A, T, C, and/or U); (3) a modified nucleotide (labeled or unlabeled); (4) poly(A) polymerase buffer;
and, (5) at least one microfilter; (6) label that can be attached to a nucleotide; (7) at least one miRNA probe;
(8) reaction buffer; (9) a miRNA array or components for making such an array;
(10) acetic acid; (11) alcohol; (12) solutions for preparing, isolating, enriching, and purifying miRNAs or miRNA probes or arrays. Other reagents include those generally used for manipulating RNA, such as formamide, loading dye, ribonuclease inhibitors, and DNase.

[00234] In specific embodiments, kits of the invention include an array containing miRNA
probes, as described in the application. An array may have probes corresponding to all known miRNAs of an organism or a particular tissue or organ in particular conditions, or to a subset of such probes. The subset of probes on arrays of the invention may be or include those identified as relevant to a particular diagnostic, therapeutic, or prognostic application.
For example, the array may contain one or more probes that is indicative or suggestive of (1) a disease or condition (acute myeloid leukemia), (2) susceptibility or resistance to a particular drug or treatment; (3) susceptibility to toxicity from a drug or substance;
(4) the stage of development or severity of a disease or condition (prognosis); and (5) genetic predisposition to a disease or condition.

WO 2008/073923 PCTlUS2007/087038 [00235] For any kit embodiment, including an array, there can be nucleic acid molecules that contain or can be used to amplify a sequence that is a variant of, identical to or complementary to all or part of any of SEQ IDs described herein. In certain embodiments, a kit or array of the invention can contain one or more probes for the miRNAs identified by the SEQ IDs described herein. Any nucleic acid discussed above may be implemented as part of a kit.

[00236] The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit (labeling reagent and label may be packaged together), the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing the nucleic acids, and any other reagent containers in close confinement for commercial sale.
Such containers may include injection or blow molded plastic containers into which the desired vials are retained.

[00237] When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.

[00238] However, the components of the kit may be provided as dried powder(s).
When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means. In some embodiments, labeling dyes are provided as a dried power.
It is contemplated that 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 g or at least or at most those amounts of dried dye are provided in kits of the invention. The dye may then be resuspended in any suitable solvent, such as DMSO.

[00239] Such kits may also include components that facilitate isolation of the labeled miRNA. It may also include components that preserve or maintain the miRNA or that protect against its degradation. Such components may be RNAse-free or protect against RNAses.

Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution.

[00240] A kit will also include instructions for employing the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.

[002411 Kits of the invention may also include one or more of the following:
Control RNA; nuclease-free water; RNase-free containers, such as 1.5 ml tubes; RNase-free elution tubes; PEG or dextran; ethanol; acetic acid; sodium acetate; ammonium acetate;
guanidinium;
detergent; nucleic acid size marker; RNase-free tube tips; and RNase or DNase inhibitors.
[00242] It is contemplated that such reagents are embodiments of kits of the invention.
Such kits, however, are not limited to the particular items identified above and may include any reagent used for the manipulation or characterization of miRNA.

VII. EXAMPLES

[00243] The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion.
One skilled in the art will appreciate readily that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those objects, ends and advantages inherent herein. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art. Unless otherwise designated, catalog numbers refer to products available by that number from Ambion, Inc. , The RNA Company.

EXAMPLE 1:

GENE EXPRESSION ANALYSIS FOLLOWING TRANSFECTION WITH HSA-[00244] miRNAs are believed to primarily influence gene expression at the level of translation. Translational regulation leading to an up or down change in protein expression may lead to changes in activity and expression of downstream gene products and genes that are in turn regulated by those proteins. These regulatory effects would be revealed as changes in the global mRNA expression profile. Furthermore, it has recently been reported that, in some instances, miRNAs may reduce the mRNA levels of their direct targets (Bagga et al., 2005; Lim et al., 2005), and such changes can be observed upon microarray gene expression analysis. Microarray gene expression analyses were performed to identify genes that are mis-regulated by hsa-miR-16.

[00245] Synthetic Pre-miR-16 (Ambion) was reverse transfected into quadruplicate samples of A549 cells for each of three time points. Cells were transfected using siPORT
NeoFX (Ambion) according to the manufacturer's recommendations using the following parameters: 200,000 cells per well in a 6 well plate, 5.0 l of NeoFX, 30 nM
final concentration of miRNA in 2.5 ml. Cells were harvested at 4 h, 24 h, and 72 h post transfection. Total RNA was extracted using RNAqueous-4PCR (Ambion) according to the manufacturer's recommended protocol.

[00246] mRNA array analyses were performed by Asuragen Services (Austin,TX), according to the company's standard operating procedures. Using the MessageAmpTM 11-96 aRNA Amplification Kit (Ambion, cat #1819) 2 g of total RNA were used for target preparation and labeling with biotin. cRNA yields were quantified using an Agilent Bioanalyzer 2100 capillary electrophoresis protocol. Labeled target was hybridized to Affymetrix mRNA arrays (Human HG-U133A 2.0 arrays) using the manufacturer's recommendations and the following parameters. Hybridizations were carried out at 45 C for 16 hr in an Affymetrix Model 640 hybridization oven. Arrays were washed and stained on an Affymetrix FS450 Fluidics station, running the wash script Midi_euk2v3 450.
The arrays were scanned on a Affymetrix GeneChip Scanner 3000. Summaries of the image signal data, group mean values, p-values with significance flags, log ratios and gene annotations for every gene on the array were generated using the Affymetrix Statistical Algorithm MAS 5.0 (GCOS v1.3). Data were reported in a file (cabinet) containing the Affymetrix data and result files and in files (.cel) containing the primary image and processed cell intensities of the arrays. Data were normalized for the effect observed by the average of two negative control microRNA sequences and then were averaged together for presentation. A
list of genes whose expression levels varied by at least 0.7 log2 from the average negative control was assembled. Results of the microarray gene expression analysis are shown in Table 1.

PAGE NOT FURNISHED UPON FILING

Table 1. Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miR hsa-miR- 16.

Gene Symbol RefSeg Transcript ID A lo Z
ABCB6 //l ATG9A NM 005689 /// NM 024085 -0.774183 ACOX2 NM 003500 -0.747677 ACTR2 NM 001005386 /1/ NM 005722 0.706621 NM001033049 !// NM_001112 ADARBI NM 015833 /// NM 015834 1.12042 ADRB2 NM 000024 0.822471 ANKRD12 NM 015208 0.920296 AOX1 NM 001159 0.71218 ARHGDIA NM 004309 -1.31009 ARHGDIB NM 001175 0.974886 ARL2 NM 001667 -1.26863 ARL2BP NM 012106 1.35222 ATP6VOE NM 003945 1.25179 AXL NM 001699 NM 021913 1.17272 BAMBI NM 012342 -0.890685 NM_000716 /// NM001017364 ///
C4BPB NM 001017365 /// NM 001017366 /// NM 001017367 1.48739 CA12 NM 001218///NM 206925 -1.09634 CCND1 NM 053056 -0.747979 CCNG2 NM 004354 0.94188 CDC37L1 NM 017913 -0.851037 CDHI NM 004360 -0.735543 CDH17 NM 004063 -0.805907 CDKN2C NM 001262 /// NM 078626 -0.77508 CDS2 NM 003818 -0.948554 CFH /// CFHLI NM 000 1 86 /// NM 001014975 /// NM 002113 -0.917773 CGI-48 NM 016001 1.48424 CHAFIA NM 005483 -0.704031 CHUK NM 001278 -1.05995 COL11A1 NM 00 1 854 /1/ NM 080629 /l/ NM 080630 0.7736 COL1A1 NM 000088 -0.705029 CPSI NM 001875 -0.713235 CTGF NM 001901 1.22906 CYP4F11 NM 021187 -0.829511 CYP4F3 NM 000896 -1.12563 DDAH1 NM 012137 0.822493 D102 NM 000793 /// NM 001007023 NM 013989 0.814143 DSU NM 018000 0.74556 DUSPI NM 004417 0.773277 E2F8 NM 024680 -0.773773 EEFID NM 00 1 960 ///NM 032378 0.95742 EFEMP1 NM 004105 ///NM 018894 0.882177 ENOI NM 001428 1.00751 FBXOI 1 NM 012167 /// NM 018693 /// NM 025133 0.924295 FGF2 NM 002006 -1.19115 FGFR4 NM 002011 /// NM 022963 /// NM 213647 -0.872234 FGG NM 000509 !// NM 021870 -0.813252 FLJ13910 NM 022780 0.846746 FNBPI NM 015033 0.743257 GALNT7 NM 017423 -1.01457 GBP1 NM 002053 0.807432 HAS2 NM 005328 -0.861488 HEG XM 087386 0.738182 IF116 NM 005531 0.829221 INHBC NM 005538 0.797435 INSL4 NM 002195 -0.916801 KCNJ2 NM 000891 0.857436 KIAA0485 --- 0.743897 KLF4 NM 004235 -0.992125 KRT7 NM 005556 1.17333 LCN2 NM 005564 -0.811381 LRP12 NM 013437 -0.882349 MAP7 NM 003980 -0.940371 MCLI NM 02 1 960 /// NM 182763 1.11653 MYL9 NM 006097 /// NM 181526 1.15849 NAB1 NM 005966 -0.724633 NM001033053 /// NM_014922 /// NM_033004 NALPI //! NM 03 3 006 /// NM 033007 0.914964 NFl NM 000267 -1.03572 NNMT NM 006169 0.997492 NPC1 NM 000271 0.911858 NUCKS NM 022731 2.31221 NUPLI NM 001008564 /// NM 001008565 /// NM 014089 -0.908999 PGKI NM 000291 1.70175 PHACTR2 NM 014721 -1.1275 PLA2G4A NM 024420 -0.878708 PLSCR4 NM 020353 -1.92309 PMCH NM 002674 1.09088 PODXL NM 001018111 /// NM 005397 0.927375 PPAP2C NM 003712 /// NM 177526 /// NM 177543 -0.792886 PRO 1843 --- 1.14274 PTENPI --- 0.952354 PTGS2 NM 000963 -1.72596 PTK9 NM 002822 /// NM 198974 0.970336 PTPN12 NM 002835 0.711122 NM_006775 /// NM_206853 ///
QKI NM 206854 ///NM 206855 0.795792 RAB2 NM 002865 1.24122 RAFTLIN NM 015150 1.16163 RBLI NM 002895 /// NM 183404 -0.766312 RDX NM 002906 0.704751 RHEB NM 005614 1.07577 RIP NM 001033002 /// NM 032308 1.34286 RPL14 NM 001034996 /// NM 003973 0.934016 RPL38 NM 000999 1.3638 RPS11 NM 001015 1.22134 R.PS6KA3 NM 004586 -0.875649 RPS6KA5 NM 004755 /// NM 182398 0.806899 S l00P NM 005980 -0.840949 SCARB2 NM 005506 0.857602 NM015129 /// NM_032569 /// NM145799 SEPT6 /JJ N-PAC lIl NM 145800 /// NM 145802 0.703914 SKP2 NM 005983 /// NM 032637 0.728768 SLC11A2 NM 000617 -1.01869 SLC4A7 NM 003615 -0.80415 SMARCA2 NM 003070 /// NM 139045 0.967136 SPARC NM 003118 1.07583 STCI NM 003155 0.787502 SULTICI NM 001056J//NM 176825 1.12689 SUMO2 NM 001005849 /JJ NM 006937 0.792739 NM_015293 /J/ NM_033071 IlI
SYNE1 NM 1336501//NM 182961 0.852103 TACC1 NM 006283 -1.02015 TAGLN NM 001001522 /// NM 003186 1.8698 TFG NM 001007565//J NM 006070 0.981989 THBD NM 000361 0.840966 THBS1 NM 003246 -0.872199 THUMPDI NM 017736 -0.721243 TMEM45A NM 018004 -0.874868 TNFSF9 NM 003811 -1.13877 TOX NM 014729 1.16189 NM_000366 /// NM_001018004 /// NM_001018005 TPM 1 /// NM 001018006 JJ/ NM 001018007 J/ 0.792231 TRA1 NM 003299 2.10346 TRIM22 NM 006074 1.24509 TXN NM 003329 1.37224 NM_003345 /// NM_194259 JJJ
UBE2I NM 194260 /JJ NM 194261 0.882609 UBE2L6 NM 004223 /JJ NM 198183 0.709343 USP34 NM 014709 0.818893 VDAC3 NM 005662 1.14436 VIL2 NM 003379 0.899532 WISP2 NM 003881 0.703121 XTP2 NM 015172 1.05499 ZBED2 NM 024508 0.770913 [00247] Manipulation of the expression levels of the genes listed in Table 1 represents a potentially useful therapy for cancer and other diseases in which increased or reduced expression of hsa-miR- 16 has a role in the disease.

EXAMPLE 2:

[00248] The mis-regulation of gene expression by hsa-miR-16 (Table 1) affects many cellular pathways that represent potential therapeutic targets for the control of cancer and other diseases and disorders. The inventors determined the identity and nature of the cellular genetic pathways affected by the regulatory cascade induced by hsa-miR-16 expression.

Cellular pathway analyses were performed using Ingenuity Pathways Analysis (Ingenuity Systems, Redwood City, CA). The most significantly affected pathways following over-expression of hsa-miR-16 in A549 cells are shown in Table 2.

Table 2. Significantly affected functional cellular pathways following hsa-miR-16 over-expression in human cancer cells.

Number of Genes Pathway Functions 15 Drug Metabolism, Lipid Metabolism, Small Molecule Biochemistry 14 Cancer, Cell Morphology, Cell Cycle 13 Cellular Growth and Proliferation, Cancer, Cellular Development 1 Molecular Transport, Protein Trafficking, Cell-To-Cell Signaling and Interaction 1 Cellular Assembly and Organization, Cell Morphology, Molecular Transport [00249] These data demonstrate that hsa-miR-16 directly or indirectly affects the expression of numerous metabolic-, cellular proliferation-, cellular development-, and cell cycle-related genes and thus primarily affects functional pathways related td cellular growth, development, and proliferation. Those cellular processes all have integral roles in the development and progression of various cancers. Manipulation of the expression levels of genes in the cellular pathways shown in Table 2 represents a potentially useful therapy for cancer and other diseases in which increased or reduced expression of hsa-miR-16 has a role in the disease.

EXAMPLE 3:

[00250] Gene targets for binding of and regulation by hsa-miR-16-1 were predicted using the proprietary algorithm miRNATargetTM (Asuragen) and are shown in Table 3.

Table 3. Predicted target genes of hsa-miR- 16.

Gene Symbol RefSeq Description Transcript ID
AAAI NM_207285 AAAI protein isoform III
AACS NM_023928 acetoacetyl-CoA synthetase AADAT NM016228 alpha-aminoadipate aminotransferase AASDHPPT NM015423 aminoadipate-semialdehyde AATF NM012138 apoptosis antagonizing transcription factor ABAT NM_000663 4-aminobutyrate aminotransferase precursor ABCAI NM005502 ATP-binding cassette, sub-family A member 1 ABCA3 NM_001089 ATP-binding cassette, sub-family A member 3 ABCB8 NM_007188 ATP-binding cassette, sub-family B, member 8 ABCB9 NM_203445 ATP-binding cassette, sub-family B(MDR/TAP), ABCC10 NM_033450 ATP-binding cassette, sub-family C, member 10 ABCC13 NM_138726 ATP-binding cassette protein C13 isoform a ABCC3 NM_020038 ATP-binding cassette, sub-family C, member 3 ABCC5 NM_005688 ATP-binding cassette, sub-family C, member 5 ABCFI NM_001025091 ATP-binding cassette, sub-family F, member I
ABCF2 NM005692 ATP-binding cassette, sub-family F, member 2 ABCF3 NM_018358 ATP-binding cassette, sub-family F(GCN20), ABCG4 NM_022169 ATP-binding cassette, subfamily G, member 4 ABHD11 NM_031295 abhydrolase domain containing 11 isoform 4 ABHD13 NM_032859 hypothetical protein LOC84945 ABHD2 NM007011 alpha/beta hydrolase domain containing protein ABI3 NM_016428 NESH protein ABLI NM_005157 v-abl Abelson murine leukemia viral oncogene ABLIMI NM_001003407 actin-binding LIM protein 1 isoform b ABTB2 NM_145804 ankyrin repeat and BTB (POZ) domain containing ACAAI NM_001607 acetyl-Coenzyme A acyltransferase 1 ACACA NM_198834 acetyl-Coenzyme A carboxylase alpha isoform 1 ACACB NM_001093 acetyl-Coenzyme A carboxylase beta ACAD9 NM_014049 acyl-Coenzyme A dehydrogenase family, member 9 ACCN4 NM018674 amiloride-sensitive cation channel 4 isoform 1 ACE NM_152831 angiotensin I converting enzyme isoform 3 ACOTI I NM147161 thioesterase, adipose associated isoform BFIT2 ACOT7 NM_007274 acyl-CoA thioesterase 7 isoform hBACHa ACOT8 NM 183385 peroxisomal acyl-CoA thioesterase 1 isoform b ACOX1 NM_004035 acyl-Coenzyme A oxidase isoform a ACOX3 NM003501 acyl-Coenzyme A oxidase 3, pristanoyl ACP2 NM_001610 lysosomal acid phosphatase 2 precursor ACPT NM_080789 testicular acid phosphatase isoform b precursor ACSBG 1 NM_015162 lipidosin ACSBG2 NM_030924 bubblegum related protein ACSLI NM_001995 acyl-CoA synthetase long-chain family member 1 ACSL4 NM 004458 acyl-CoA synthetase long-chain family member 4 ACSLS NM016234 acyl-CoA synthetase long-chain family member 5 ACSS2 NM018677 acyl-CoA synthetase short-chain family member 2 ACTRIA NM_005736 ARP1 actin-related protein I homolog A, ACTR2 NM_001005386 actin-related protein 2 isoform a ACTR3B NM_020445 actin-related protein 3-beta isoform 1 ACTR8 NM 022899 actin-related protein 8 ACVR2A NM_001616 activin A receptor, type IIA precursor ADAMIO NM_001110 ADAM metallopeptidase domain 10 ADAM11 NM_002390 ADAM metallopeptidase domain 11 preproprotein ADAM12 NM 021641 ADAM metallopeptidase domain 12 isoform 2 ADAMTSI NM006988 ADAM metallopeptidase with thrombospondin type I
ADAMTS13 NM_139028 ADAM metallopeptidase with thrombospondin type 1 ADAMTS18 NM_199355 ADAM metallopeptidase with thrombospondin type I
ADAMTS3 NM_014243 ADAM metallopeptidase with thrombospondin type 1 ADAMTS4 NM005099 ADAM metallopeptidase with thrombospondin type 1 ADAMTS5 NM007038 ADAM metallopeptidase with thrombospondin type 1 ADAMTS6 NM_197941 ADAM metallopeptidase with thrombospondin type I
ADAMTSLI NM139238 ADAMTS-like 1 isoform i ADAMTSL2 NM014694 ADAMTS-like 2 ADAMTSL3 NM_207517 ADAMTS-like 3 ADAR NM_00 1 02 5 1 07 adenosine deaminase, RNA-specific isoform d ADARBI NM_001033049 RNA-specific adenosine deaminase B I isoform 4 ADARB2 NM_018702 adenosine deaminase, RNA-specific, B2 ADCY1 NM021116 brain adenylate cyclase I
ADCY7 NM_001114 adenylate cyclase 7 ADCY9 NM_001116 adenylate cyclase 9 ADDI NIv1_001119 adducin 1(alpha) isoform a ADD2 NM 017482 adducin 2 isoform b ADM2 NM024866 adrenomedullin 2 precusor ADORAI NM_000674 adenosine Al receptor ADORA2A NM_000675 adenosine A2a receptor ADPRH NM001125 ADP-ribosylarginine hydrolase ADRAIB NM_000679 alpha-lB-adrenergic receptor ADRA2A NM_000681 alpha-2A-adrenergic receptor ADRA2B NM_000682 alpha-2B-adrenergic receptor ADRB2 NM000024 adrenergic, beta-2-, receptor, surface ADRBKI NM_001619 beta adrenergic receptor kinase 1 ADSS NM_001126 adenylosuccinate synthase AEBP2 NM_153207 AE binding protein 2 AFAP NM021638 actin filament associated protein AFF2 NM_002025 fragile X mental retardation 2 AFF4 NM_014423 ALLI fused gene from 5q31 AFM NM_001133 afamin precursor AGA NM_000027 aspartylglucosaminidase precursor AGPAT2 NM_001012727 1 -acylglycerol-3 -phosphate 0-acyltransferase 2 AGPAT4 NM001012733 1 -acylglycerol-3 -phosphate 0-acyltransferase 4 AGPAT5 NM_018361 1-acylglycerol-3-phosphate 0-acyltransferase 5 AGPAT6 NM 178819 lysophosphatidic acid acyltransferase zeta AGPAT7 NM_153613 PLSC domain containing protein AGRN NM_198576 agrin AGTR2 NM000686 angiotensin II receptor, type 2 AHCYLI NM_006621 S-adenosylhomocysteine hydrolase-like I
AHNAK NM_024060 AHNAK nucleoprotein isoform 2 AHSAI NM_012111 AHA1, activator of heat shock 90kDa protein AIM1 NM_001624 absent in melanoma I
AK3LI NM 001005353 adenylate kinase 3-like I
AKAPI NM_003488 A-kinase anchor protein I isoform I precursor AKAP i l NM 016248 A-kinase anchor protein 11 isoform I

AKAP12 NM005100 A-kinase anchor protein 12 isoform 1 AKAP13 NM_006738 A-kinase anchor protein 13 isoform 1 AKNA NM_030767 AT-hook transcription factor AKRICLI NM001007536 aldo-keto reductase family 1, member C-like 1 AKR1D1 NM005989 aldo-keto reductase family 1, member D1 AKT3 NM_005465 v-akt murine thymoma viral oncogene homolog 3 ALAD NM000031 delta-aminolevulinic acid dehydratase isoform b ALDHIA3 NM000693 aldehyde dehydrogenase lA3 ALDH3A2 NM_000382 aldehyde dehydrogenase 3A2 isoform 2 ALDH3BI NM000694 aldehyde dehydrogenase 3B1 isoform a ALDH5A1 NM001080 aldehyde dehydrogenase 5A1 precursor, isoform 2 ALKBH3 NM_139178 alkB, alkylation repair homolog 3 ALKBH5 NM_017758 hypothetical protein LOC54890 ALKBH6 NM_032878 hypothetical protein LOC84964 isoform 2 ALOX12 NM_000697 arachidonate 12-lipoxygenase ALPK3 NM_020778 alpha-kinase 3 ALPPL2 NM_031313 placental-like alkaline phosphatase ALS2 NM_020919 alsin ALS2CL NM147129 ALS2 C-terminal like isoform 1 ALS2CR16 NM_205543 amyotrophic lateral sclerosis 2(juvenile) ALS2CR2 NM_018571 amyotrophic lateral sclerosis 2(juvenile) AMIGO3 NM_198722 amphoterin-induced gene and ORF 3 AMMECRI NM_001025580 AMMECR1 protein isoform 2 AMOT NM 133265 angiomotin AMOTLI NM130847 angiomotin like 1 AMOTL2 NM_016201 angiomotin like 2 AMPD2 NM 004037 adenosine monophosphate deaminase 2 (isoform L) AMPD3 NM000480 erythrocyte adenosine monophosphate deaminase AMT NM_000481 aminomethyltransferase (glycine cleavage system ANAPCI l NM_001002244 APC11 anaphase promoting complex subunit 11 ANAPC13 NM_015391 anaphase promoting complex subunit 13 ANGELl NM015305 angel homolog 1 ANK1 NM 000037 ankyrin 1 isoform 3 ANK2 NM`_001148 ankyrin 2 isoform I
ANK3 NM_001149 ankyrin 3 isoform 2 ANKRDII NM_013275 ankyrin repeat domain 11 ANKRD12 NM_015208 ankyrin repeat domain 12 ANKRD13B NM_152345 hypothetical protein LOC124930 ANKRD13D NM_207354 ankyrin repeat domain 13 family, member D
ANKRDI5 NM_015158 ankyrin repeat domain protein 15 isoform a ANKRDI7 NM_032217 ankyrin repeat domain protein 17 isoform a ANKRDI9 NM_001010925 ankyrin repeat domain 19 ANKRD29 NM 173505 ankyrin repeat domain 29 ANKRD39 NM_016466 ankyrin repeat domain 39 ANKRD46 NM_198401 ankyrin repeat domain 46 ANKRD53 NM 024933 hypothetical protein LOC79998 ANKSIA NM_015245 ankyrin repeat and sterile alpha motif domain ANKS4B NM_145865 harmonin-interacting ankyrin-repeat containing ANKZFI NM_018089 ankyrin repeat and zinc finger domain containing ANLN NM018685 anillin, actin binding protein (scraps homolog, ANP32E NM_030920 acidic (leucine-rich) nuclear phosphoprotein 32 ANXAI 1 NM 001157 annexin Al l AP1G1 NM_001030007 adaptor-related protein complex 1, gamma 1 APIGBPI NM007247 API gamma subunit binding protein 1 isoform 1 AP1S1 NM_001283 adaptor-related protein complex 1, sigma 1 AP 1 S2 NM_003916 adaptor-related protein complex 1 sigma 2 AP2AI NM_014203 adaptor-related protein complex 2, alpha I
AP2A2 NM_012305 adaptor-related protein complex 2, alpha 2 AP2BI NM_001030006 adaptor-related protein complex 2, beta I
AP3B1 NM_003664 adaptor-related protein complex 3, beta I
AP3M1 NM_012095 adaptor-related protein complex 3, mu I subunit AP3S2 NM_005829 adaptor-related protein complex 3, sigma 2 APBA1 NM_001163 amyloid beta A4 precursor protein-binding, APBB3 NM_133175 amyloid beta precursor protein-binding, family APC2 NM_005883 adenomatosis polyposis coli 2 APLN NM 017413 apelin preproprotein APLP2 NMu001642 amyloid beta (A4) precursor-like protein 2 APOA4 NM_000482 apolipoprotein A-IV precursor APOA5 NM052968 apolipoprotein AV
APOBEC2 NM006789 apolipoprotein B mRNA editing enzyme, catalytic APOC3 NM000040 apolipoprotein C-II1 precursor APP NM000484 amyloid beta A4 protein precursor, isoform a APPBPI NM001018159 amyloid beta precursor protein-binding protein I
APPBP2 NM006380 amyloid beta precursor protein-binding protein APTX NM_017692 aprataxin isoform d AQP1 NM_198098 aquaporin 1 AQP11 NM_173039 aquaporin II
AQP2 NM_000486 aquaporin 2 AQP4 NM_001650 aquaporin 4 isoform a AQP8 NM_001169 aquaporin 8 ARC NM_015193 activity-regulated cytoskeleton-associated ARCN1 NM_001655 archain ARF3 NM_001659 ADP-ribosylation factor 3 ARFGAPI NM_018209 ADP-ribosylation factor GTPase activating ARFRP1 NM_003224 ADP-ribosylation factor related protein I
ARHGAPI NM_004308 Rho GTPase activating protein I
ARHGAP 10 NM_024605 Rho GTPase activating protein 10 ARHGAP12 NM_018287 Rho GTPase activating protein 12 ARHGAP18 NM_033515 Rho GTPase activating protein 18 ARHGAPI9 NM_032900 Rho GTPase activating protein 19 ARHGAP20 NM_020809 Rho GTPase activating protein 20 ARHGAP22 NM_021226 Rho GTPase activating protein 2 ARHGAP26 NM_015071 GTPase regulator associated with the focal ARHGAP27 NM_199282 Rho GTPase activating protein 27 ARHGAP28 NM001010000 Rho GTPase activating protein 28 isoform a ARHGAP4 NM_001666 Rho GTPase activating protein 4 ARHGAPS NM_001030055 Rho GTPase activating protein 5 isoform a ARHGDIA NM_004309 Rho GDP dissociation inhibitor (GDI) alpha ARHGDIG NM001176 Rho GDP dissociation inhibitor (GDI) gamma ARHGEFIO NM014629 Rho guanine nucteotide exchange factor 10 ARHGEF12 NM_015313 Rho guanine nucleotide exchange factor (GEF) 12 ARHGEF4 NM015320 Rho guanine nucleotide exchange factor 4 isoform ARHGEF5 NM 001002861 rho guanine nucleotide exchange factor 5 isoform ARHGEF7 NM_145735 Rho guanine nucleotide exchange factor 7 isoform ARHGEF9 NM015185 Cdc42 guanine exchange factor 9 ARIDSA NM006673 AT rich interactive domain 5A isoform 2 ARL1 NM_001177 ADP-ribosylation factor-like 1 ARL10 NM_173664 ADP-ribosylation factor-like 10 ARLI I NM_138450 ADP-ribosylation factor-like 11 ARL2 NM_001667 ADP-ribosylation factor-like 2 ARL3 NM 004311 ADP-ribosylation factor-like 3 ARL5B NM 178815 ADP-ribosylation factor-like 8 ARL6IP5 NM_006407 ADP-ribosylation-like factor 6 interacting ARL8B NM_018184 ADP-ribosylation factor-like l OC
ARMCI NM018120 armadillo repeat-containing protein ARMC5 NM_024742 armadillo repeat containing 5 ARMC6 NM033415 armadillo repeat containing 6 ARMCXI NM 016608 armadillo repeat containing, X-linked 1 ARMCX2 NM_014782 ALEX2 protein ARNT NM_001668 aryl hydrocarbon receptor nuclear translocator ARNT2 NM_014862 aryl hydrocarbon receptor nuclear translocator ARPCIB NM005720 actin related protein 2/3 complex subunit 1B
ARPP-19 NM_006628 cyclic AMP phosphoprotein, 19 kD
ARPP-21 NM_001025068 cyclic AMP-regulated phosphoprotein, 21 kD
ARRDC4 NM_183376 arrestin domain containing 4 ARSD NM_001669 arylsulfatase D isoform a precursor ARTS-1 NM016442 type 1 tumor necrosis factor receptor shedding ARVCF NM_001670 armadillo repeat protein AS3MT NM 020682 arsenic (+3 oxidation state) methyltransferase ASB 1 NM016114 ankyrin repeat and SOCS box-containing protein ASB 13 NM024701 ankyrin repeat and SOCS box-containing protein ASB15 NM_080928 ankyrin repeat and SOCS box-containing 15 ASB6 NM017873 ankyrin repeat and SOCS box-containing 6 isoform ASCC3 NM 022091 activating signal cointegrator 1 complex subunit ASCL2 NM_005170 achaete-scute complex homolog-like 2 ASNSDI NM_019048 asparagine synthetase domain containing 1 ASPH NM032466 aspartate beta-hydroxylase isoform c ASTN NM0043 i 9 astrotactin isoform 1 ASXLI NM015338 additional sex combs like 1 ASXL2 NM_018263 additional sex combs like 2 ATAD4 NM024320 ATPase family, AAA domain containing 4 ATF3 NM004024 activating transcription factor 3 isoform 2 ATF6 NM_007348 activating transcription factor 6 ATF7IP2 NM_024997 activating transcription factor 7 interacting ATG4B NM_013325 APG4 autophagy 4 homolog B isoform a ATG4D NM032885 APG4 autophagy 4 homolog D
ATG9A NM_024085 APG9 autophagy 9-like 1 ATG9B NM_173681 nitric oxide synthase 3 antisense ATHLI NM_025092 hypothetical protein LOC80162 ATNI NM_001007026 atrophin-1 ATOH8 NM_032827 atonal homolog 8 ATPI lA NM_015205 ATPase, Class VI, type 11A isoform a ATP 11 C NM_001010986 ATPase, Class VI, type 11 C isoform b ATP13A2 NM_022089 ATPase type 13A2 ATP 1 B2 NM_001678 Na+/K+ -ATPase beta 2 subunit ATP 1 B4 NM 012069 ATPase, (Na+)/K+ transporting, beta 4 ATP2A1 NM004320 ATPase, Ca++ transporting, fast twitch 1 isoform ATP2A3 NM_005173 sarco/endoplasmic reticulum Ca2+ -ATPase isoform ATP2B2 NM_001001331 plasma membrane calcium ATPase 2 isoform a ATP2B3 NM_001001344 plasma membrane calcium ATPase 3 isoform 3b ATP2B4 NM_001001396 plasma membrane calcium ATPase 4 isoform 4a ATP4B NM000705 ATPase, H+/K+ exchanging, beta polypeptide ATP6VOB NM_004047 ATPase, H+transporting, lysosoma121kDa, VO
ATP6VOE2L NM 145230 ATPase, H+ transporting, VO subunit ATP6V1B2 NM001693 vacuolar H+ATPase B2 ATP6V 1 C 1 NM_001007254 ATPase, H+ transporting, lysosomal 42kDa, V 1 ATP6VIC2 NM_144583 vacuolar H+ ATPase C2 isoform b ATP6 V I G 1 NM_004888 vacuolar H+ ATPase G I
ATP7A NM_000052 ATPase, Cu++ transporting, alpha polypeptide ATP7B NM000053 ATPase, Cu++ transporting, beta polypeptide ATP8B3 NM_138813 ATPase, Class I, type 8B, member 3 ATPBDIC NM_016301 ATP binding domain I family, member C
ATRNLI NM 207303 attractin-like 1 ATXN2 NM002973 ataxin 2 ATXN7L2 NM_153340 ataxin 7-like 2 AURKAIP] NM_017900 aurora-A kinase interacting protein AVEN NM_020371 cell death regulator aven AXIN2 NM004655 axin 2 AXUDI NM_033027 AXIN1 up-regulated 1 B3GALNTI NM003781 UDP-Gal:betaGlcNAc beta B3GALT5 NM_006057 UDP-Gal:betaGlcNAc beta B3GALT6 NM080605 UDP-Gal:betaGal beta 1,3-gaiactosyltransferase B3GATI NM_018644 beta-1,3-glucuronyltransferase 1 B3GAT3 NM 012200 beta-l,3-glucuronyltransferase 3 B3GNT2 NM_006577 UDP-GIcNAc:betaGal B3GNT3 NM_014256 UDP-GIcNAc:betaGal B3GNT4 NM_030765 UDP-G1cNAc:betaGal B4GALT1 NM001497 UDP-Gal:betaGlcNAc beta 1,4-B4GALT2 NM_001005417 UDP-Gal:betaGlcNAc beta 1,4-B4GALT4 NM003778 UDP-Gal:betaGlcNAc beta 1,4-B4GALT5 NM_004776 UDP-Gal:betaGlcNAc beta 1,4-bA16L21.2.1 NM_001015882 hypothetical protein LOC548645 BAAT NM_001701 bile acid Coenzyme A: amino acid BACEI NM012104 beta-site APP-cleaving enzyme 1 isoform A
BACE2 NM_138992 beta-site APP-cleaving enzyme 2 isoform B
BACH1 NM_001011545 BTB and CNC homology I isoform b BACH2 NM_021813 BTB and CNC homology 1, basic leucine zipper BAG3 NM_004281 BCL2-associated athanogene 3 BAG4 NM_004874 BCL2-associated athanogene 4 BAG5 NM001015048 BCL2-associated athanogene 5 isoform b BAHDI NM_014952 bromo adjacent homology domain containing 1 BAI1 NM_001702 brain-specific angiogenesis inhibitor 1 BAIAP2 NM_006340 BAI I -associated protein 2 isoform 3 BAPI NM_004656 BRCA1 associated protein-1 BAT2D1 NM_015172 HBxAg transactivated protein 2 BAT4 NM033177 HLA-B associated transcript 4 BAZ1B NM_032408 bromodomain adjacent to zinc finger domain, 1B
BAZ2A NM_013449 bromodomain adjacent to zinc finger domain, 2A

BBC3 NM_014417 BCL2 binding component 3 BCAP29 NM_001008406 B-cell receptor-associated protein BAP29 isoform BCAP31 NM_005745 B-cell receptor-associated protein 31 BCAS1 NM_003657 breast carcinoma amplified sequence 1 BCAS4 NM_001010974 breast carcinoma amplified sequence 4 isoform c BCLIIB NM_022898 B-cell CLL/lymphoma I 1B isoform 2 BCL2 NM_000633 B-cell lymphoma protein 2 alpha isoform BCL2LI NM_001191 BCL2-like 1 isoform 2 BCL2L11 NM_006538 BCL2-like 11 isoform 6 BCL2L12 NM052842 BCL2-like 12 isoform 2 BCL2L14 NM030766 BCL2-like 14 isoform 2 BCL2L2 NM_004050 BCL2-like 2 protein BCL7A NM_001024808 B-cell CLL/lymphoma 7A isoform b BCL7B NM001707 B-cell CLL/lymphoma 7B isoform 1 BCL9 NM_004326 B-cell CLL/lymphoma 9 BCL9L NM_182557 B-cell CLL/lymphoma 9-like BCOR NM_020926 BCL-6 interacting corepressor isoform 2 BCORLl NM_021946 BCL6 co-repressor-like 1 BCR NM_004327 breakpoint cluster region isoform 1 BDH2 NM020139 3-hydroxybutyrate dehydrogenase, type 2 BDKRB2 N1VI_000623 bradykinin receptor B2 BDNF NM001709 brain-derived neurotrophic factor isoform a BET1L NM_016526 blocked early in transport I homolog (S.
BHLHB2 NM_003670 basic helix-loop-helix domain containing, class BHLHB3 NM030762 basic helix-loop-helix domain containing, class BHMT2 NM_017614 betaine-homocysteine methyltransferase 2 BICD2 NM001003800 bicaudal D homolog 2 isoform 1 BIK NM_001197 BCL2-interacting killer BINI NM_004305 bridging integrator I isoform 8 BIRC5 NM001012270 baculoviral IAP repeat-containing protein 5 BLCAP NM_006698 bladder cancer associated protein BLMH NM_000386 bleomycin hydrolase BLR1 NM_001716 Burkitt lymphoma receptor 1 isoform 1 BMF NM_001003940 Bcl2 modifying factor isoform bmf-1 BMPER NM_133468 BMP-binding endothelial regulator precursor BMPRIA NM004329 bone morphogenetic protein receptor, type IA
BMPR2 NM 001204 bone morphogenetic protein receptor type II
BMS1L NM_014753 BMS1-like, ribosome assembly protein BMX NM_001721 BMX non-receptor tyrosine kinase BNIPI NM001205 BCL2/adenovirus E I B l9kD interacting protein 1 BOLA2 NM 001031833 BoIA-like protein 2 isoform b BOLA3 NM 212552 bolA-like 3 isoform I
BRCA1 NM_007306 breast cancer 1, early onset isoform BRD1 NM_014577 bromodomain containing protein I
BRD8 NM_139199 bromodomain containing 8 isoform 2 BRF2 NM_018310 RNA polymerase III transcription initiation BR13 NM_015379 brain protein 13 BRMSI NM_015399 breast cancer metastasis suppressor 1 isoform I
BRP44L NM_016098 brain protein 44-like BRPF3 NM_015695 bromodomain and PHD finger containing, 3 BRS3 NM_001727 bombesin-like receptor 3 BRWD1 NM 00 1007246 bromodomain and WD repeat domain containing 1 WO 2008/073923 PCTl11S2007/087038 BSDCI NM_018045 BSD domain containing 1 BSN NM003458 bassoon protein BSND NM_057176 barttin BSPRY NM_017688 B-box and SPRY domain containing BTAFI NM_003972 BTAF1 RNA polymerase 11, B-TFIID transcription BTBDI4B NM052876 transcriptional repressor NAC1 BTBD15 NM_014155 BTB (POZ) domain containing 15 BTBD2 NM_017797 BTB (POZ) domain containing 2 BTBD3 NM_014962 BTB/POZ domain containing protein 3 isoform a BTBD4 NM_025224 BTB (POZ) domain containing 4 BTBD7 NM_001002860 BTB (POZ) domain containing 7 isoform 1 BTF3 NM_001207 basic transcription factor 3 isoform B
BTG2 NM_006763 B-cell translocation gene 2 BTNIAI NM001732 butyrophilin, subfamily 1, member Al BTRC NM_003939 beta-transducin repeat containing protein BUB3 NM_004725 BUB3 budding uninhibited by benzimidazoles 3 BVES NM007073 blood vessel epicardial substance BZWI NM_014670 basic leucine zipper and W2 domains I
C10orfl08 NM_001012714 hypothetical protein LOC414235 ClOorf26 NM_017787 hypothetical protein LOC54838 C10orf39 NM194303 hypothetical protein LOC282973 Cl0orf4 NM145246 FRAlOAC1 protein isoform FRAIOACl-1 Cl0orf42 NM_138357 hypothetical protein LOC90550 Cl0orf46 NM_153810 hypothetical protein LOC143384 C10orf53 NM_182554 hypothetical protein LOC282966 C10orf54 NM_022153 hypothetical protein LOC64115 ClOorf56 NM_153367 hypothetical protein LOC219654 ClOorf6 NM_018121 hypothetical protein LOC55719 Cl0orf63 Nlvl_145010 enkurin Cl0orf67 NM_153714 hypothetical protein LOC256815 ClOorf7 NM_006023 D123 gene product Cl0orf72 NM_144984 hypothetical protein LOC196740 isoform 2 Cl0orf76 NM_024541 hypothetical protein LOC79591 ClOorf77 NM_024789 hypothetical protein LOC79847 C10orf81 NM_024889 hypothetical protein LOC79949 ClOorf83 NM_178832 hypothetical protein LOC118812 C10orf9 NM_145012 cyclin fold protein 1 isoform 1 CIOorP35 NM_024886 hypothetical protein LOC79946 C 1 I orfl0 NM_014206 hypothetical protein LOC746 Cl lorfl 1 NM 006133 neural stem cell-derived dendrite regulator Cl lorfl 7 NM182901 chromosome 11 open reading frame 17 Cl lorf24 NM_022338 hypothetical protein LOC53838 Cl lorf42 NM 173525 hypothetical protein LOC160298 Cl lorf45 NM_145013 hypothetical protein LOC219833 Cl 1 orf46 NM_152316 hypothetical protein LOC120534 Cl lorf49 NM_001003676 hypothetical protein LOC79096 isoform 1 Cl l orf53 NM_198498 hypothetical protein LOC341032 Cl lorf55 NM_207428 hypothetical protein LOC399879 Cl lorf68 NM_031450 basophilic leukemia expressed protein BLES03 C12orf22 NM_030809 TGF-beta induced apoptosis protein 12 C12orf30 NM_024953 hypothetical protein LOC80018 C12orf34 NM 032829 hypothetical protein LOC84915 C12orf38 NM024809 TECT2 C12orf4 NM_020374 hypothetical protein LOC57102 C12orf47 NM_016534 apoptosis-related protein PNAS-1 C12orf53 NM153685 hypothetical protein LOC196500 C13orfl NM_020456 hypothetical protein LOC57213 C13orfl8 NM_025113 hypothetical protein LOC80183 C14orfl NM007176 hypothetical protein LOCI 1161 C14orfl 11 NM_015962 hypothetical protein LOC51077 Cl4orf129 NM 016472 hypothetical protein LOC51527 C14orfl32 NM_020215 hypothetical protein LOC56967 C14orfl39 NM_024633 hypothetical protein LOC79686 C14orf143 NM_145231 hypothetical protein LOC90141 C14orf150 NM 001008726 hypothetical protein LOC112840 C14orf32 NM144578 MAPK-interacting and spindle-stabilizing C14orf37 NM 001001872 hypothetical protein LOC145407 C14orf4 NM_024496 chromosome 14 open reading frame 4 C14orf43 NM_194278 hypothetical protein LOC91748 C14orf45 NM 025057 hypothetical protein LOC80127 Cl4orf68 NMy_207117 chromosome 14 open reading frame 68 C14orf79 NM 174891 hypothetical protein LOC122616 Cl Sorf37 NM175898 hypothetical protein LOC283687 C15ort39 NM 015492 hypothetical protein LOC56905 C15orf40 NM~_144597 hypothetical protein LOC123207 C15orf41 NM 032499 hypothetical protein LOC84529 C15orf42 NM152259 leucine-rich repeat kinase I
C16orfl4 NM 138418 hypothetical protein LOC84331 C16orf34 NM144570 chromosome 16 open reading frame 34 C16orf55 NM_153025 hypothetical protein LOC124045 C16orf56 NM_025082 hypothetical protein LOC80152 C16orfS7 NM_024598 hypothetical protein LOC79650 C16orf58 NM_022744 hypothetical protein LOC64755 C16orf63 NM 144600 hypothetical protein LOC123811 C16orf7 NM004913 chromosome 16 open reading frame 7 C16orf10 NM 025187 lin-10 C17orf27 NM020914 chromosome 17 open reading frame 27 C17orf32 NM~152464 hypothetical protein LOC147007 C17orf39 NM~024052 hypothetical protein LOC79018 C17orf41 NM~024857 chromosome fragility associated gene 1 C17orf49 NM 174893 hypothetical protein LOC124944 C17orf54 NM^_182564 hypothetical protein LOC283982 C17orf56 NM_144679 hypothetical protein LOC146705 C17orf59 NM_017622 hypothetical protein LOC54785 C17orf62 NM_001033046 hypothetical protein LOC79415 C17orf81 NM_203413 S-phase 2 protein isoform 2 C17orf82 NM_203425 hypothetical protein LOC388407 Cl8orfl NM_001003674 hypothetical protein LOC753 isoform gamma I
Cl8orf25 NM001008239 chromosome 18 open reading frame 25 isoform b C18orf34 NM_198995 hypothetical protein LOC374864 C18orf4 NM_032160 hypothetical protein LOC92126 C18orf43 NM_006553 chromosome 18 open reading frame 43 C18orf45 NM_032933 hypothetical protein LOC85019 Cl8orf54 NM 173529 hypothetical protein LOC162681 C18orf58 NM_173817 hypothetical protein LOC284222 C19orfl2 NM 001031726 hypothetical protein LOC83636 isoform 1 C19orf23 NM152480 hypothetical protein LOC148046 C19orf25 NM_152482 hypothetical protein LOC148223 C19orf26 NM_152769 hypothetical protein LOC255057 C19orf36 NM_001031735 hypothetical protein LOC113177 isoform 1 C19orf6 NM_033420 membralin isoform 2 C 1 orfl01 NM_173807 hypothetical protein LOC257044 Clorfl02 NM_145047 oxidored-nitro domain-containing protein isoform Clorfl03 NM_001006945 receptor-interacting factor I isoform 2 Clorfl07 NM_014388 hypothetical protein LOC27042 Clorfl 13 NM_024676 hypothetical protein LOC79729 Clorfl 14 NM_021179 hypothetical protein LOC57821 CIorfl 15 NM_024709 hypothetical protein LOC79762 Clorfl 16 NM_023938 specifically androgen-regulated protein Cl orfl 19 NM 020141 hypothetical protein LOC56900 Clorf126 NM 182534 hypothetical protein LOC200197 C1orfl30 NM_001010980 hypothetical protein LOC400746 Clorfl42 NM_053052 hypothetical protein LOC116841 Clorfl5l NM_001032363 chromosome 1 open reading frame 151 protein Clorfl 73 NM 001002912 hypothetical protein LOC127254 Clorfl87 NM_198545 chromosome I open reading frame 187 Clorfl88 NM_173795 hypothetical protein LOC148646 Clorfl9 NM_052965 hypothetical protein LOC116461 C1orfl90 NM_001013615 hypothetical protein LOC541468 Clorf2 NM_006589 hypothetical protein LOC10712 isoform a Clorf2l NM_030806 chromosome I open reading frame 21 Clorf36 NM_183059 chromosome I open reading frame 36 Clorf38 NM_004848 basement membrane-induced gene isoform I
Cl orf54 NM_024579 hypothetical protein LOC79630 Clorf62 NM_152763 hypothetical protein LOC254268 Clorf69 NM_001010867 hypothetical protein LOC200205 Clorf84 NM001012960 RP11-506B15.1 protein isoform I
Clorfrl NM_014283 chromosome I open reading frame 9 protein CIort95 NM_001003665 hypothetical protein LOC375057 C1QA NM_015991 complement component 1, q subcomponent, A chain C1QB NM_000491 complement component 1, q subcomponent, B chain C1QL3 NM_001010908 complement component 1, q subcomponent-like 3 C1QL4 NM_001008223 hypothetical protein LOC338761 CIQTNF3 NM_030945 Clq and tumor necrosis factor related protein 3 CIQTNF5 NM 015645 Clq and tumor necrosis factor related protein 5 CIQTNF6 NM_031910 Clq and tumor necrosis factor related protein 6 CIQTNF8 NM_207419 hypothetical protein LOC390664 C20orfl I NM017896 chromosome 20 open reading frame 11 C20orfl 17 NM_080627 hypothetical protein LOC140710 isoform I
C20orfl21 NM_024331 hypothetical protein LOC79183 C20orfl60 NM_080625 hypothetical protein LOC140706 C20orf161 NM_033421 sorting nexin 21 isoform a C20orfl 66 NM 178463 hypothetical protein LOC128826 C20orfl 86 NM_182519 antimicrobial peptide RY2G5 C20orf23 NM 024704 kinesin-like motor protein C20orf23 C20orf29 NM_018347 hypothetical protein LOC55317 C20orf3 NM_020531 chromosome 20 open reading frame 3 C20orf39 NM_024893 hypothetical protein LOC79953 C20orf42 NM_017671 chromosome 20 open reading frame 42 C20orf43 NM_016407 hypothetical protein LOC51507 C20orf44 NM_018244 basic FGF-repressed Zic binding protein isoform C20orf45 NM_016045 hypothetical protein LOC51012 C20orf46 NM_018354 hypothetical protein LOC55321 C20orf58 NM_152864 hypothetical protein LOC128414 C20orf71 NM_178466 hypothetical protein LOC128861 isoform b C20orf77 NM021215 hypothetical protein LOC58490 C20orf96 NM_153269 hypothetical protein LOC140680 C21orfl23 NM_199175 hypothetical protein LOC378832 C21orfl25 NM_194309 hypothetical protein LOC284836 C21orf129 NM_152506 hypothetical protein LOC150135 C21 orf24 NM001001789 hypothetical protein LOC400866 C21orf25 NM_199050 hypothetical protein LOC25966 C21orf33 NM004649 esl protein isoform la precursor C21orf57 NM001006114 hypothetical protein LOC54059 isoform 2 C21orf58 NM_199071 hypothetical protein LOC54058 isoform 2 C21orf6 NM_016940 hypothetical protein LOCI 0069 C21orf62 NM_019596 hypothetical protein LOC56245 C21orf69 NM_058189 chromosome 21 open reading frame 69 C21orf84 NM_153752 hypothetical protein LOCI 14038 C21orf93 NM_145179 hypothetical protein LOC246704 C22orfl 3 NM_031444 chromosome 22 open reading frame 13 C22orf5 NM_012264 chromosome 22 open reading frame 5 C22orf9 NM_001009880 hypothetical protein LOC23313 isoform b C2orfl 7 NM_024293 hypothetical protein LOC79137 C2orfl9 NM_001024676 chromosome 2 open reading frame 19 C2orf26 NM_023016 hypothetical protein LOC65124 C3orfl 0 NM018462 chromosome 3 open reading frame 10 C3orf18 NM016210 hypothetical protein LOC51161 C3orf19 NM_016474 hypothetical protein LOC51244 C3orf23 NM_001029839 hypothetical protein LOC285343 isoform 2 C3orf27 NM_007354 putative GR6 protein C3orf37 NM_001006109 hypothetical protein LOC56941 C3orf56 NM_001007534 hypothetical protein LOC285311 C3orf5S NM_173552 hypothetical protein LOC205428 C4orfl 5 NM_024511 hypothetical protein LOC79441 C4orfl9 NM_018302 hypothetical protein LOC55286 C5orf21 NM_032042 hypothetical protein LOC83989 C5orf24 NM152409 hypothetical protein LOC134553 C6orfl 06 NM022758 chromosome 6 open reading frame 106 isoform b C6orfl28 NM 145316 hypothetical protein LOC221468 C6orfl42 NM_138569 hypothetical protein LOC90523 C6orfl45 NM_183373 hypothetical protein LOC221749 C6orfl 51 NM152551 U1I/U12 snRNP 48K
C6orfl52 NM 181714 hypothetical protein LOCI67691 C6orfl55 NM_024882 hypothetical protein LOC79940 C6orfl68 NM_032511 hypothetical protein LOC84553 C6orfl99 NM_145025 hypothetical protein LOC221264 C6orf35 NM 018452 hypothetical protein LOC55836 C6orf47 NM 021184 G4 protein C6orf49 NM 013397 over-expressed breast tumor protein C6orf51 NM_138408 hypothetical protein LOC112495 C6orf55 NM_016485 hypothetical protein LOC51534 C6orf57 NM 145267 hypothetical protein LOC135154 C6orf59 NM_024929 hypothetical protein LOC79992 C6orf64 NM_018322 hypothetical protein LOC55776 C6orf71 NM_203395 chromosome 6 open reading frame 71 C6orf85 NM_021945 ion transporter protein C7orfl6 NM_006658 G-substrate C7orfl 9 NM_032831 hypothetical protein LOC80228 C7orf2O NM_015949 hypothetical protein LOC51608 C7orf2I NM_031434 hypothetical protein LOC83590 C7orf29 NM_138434 hypothetical protein LOC113763 C8orf30A NM_016458 brain protein 16 C8orf38 NM 152416 hypothetical protein LOC137682 C8orf4 NM020130 chromosome 8 open reading frame 4 C8orf42 NM_175075 hypothetical protein LOC157695 C8orf49 NM 001031839 hypothetical protein LOC606553 C8orf58 NM_001013842 hypothetical protein LOC541565 C8orf70 NM_016010 hypothetical protein LOC51101 C9orf100 NM 032818 hypothetical protein LOC84904 C9orfl06 NMJ001012715 hypothetical protein LOC414318 C9orfl00S NMJ198841 hypothetical protein LOC158293 C9orfl 14 NMy_016390 hypothetical protein LOC51490 C9orfl 21 NM 145283 nucleoredoxin C9orfl23 NMT033428 hypothetical protein LOC90871 C9orf128 NM001012446 hypothetical protein LOC392307 C9orf150 NM_203403 hypothetical protein LOC286343 C9orf163 NM_152571 hypothetical protein LOC158055 C9orf164 NM 182635 hypothetical protein LOC349236 C9orf19 NM022343 chromosome 9 open reading frame 19 C9orf25 NM_147202 hypothetical protein LOC203259 C9orf26 NM 033439 interleukin 33 C9orf28 NM_001011703 hypothetical protein LOC89853 isoform 2 C9orf3 NM_032823 aminopeptidase 0 C9orf42 NM_138333 hypothetical protein LOC116224 C9orf48 NM 194313 hypothetical protein LOC347240 C9orf5 NM032012 h othetical protein LOC23731 C9orf61 NM004816 chromosome 9 open reading frame 61 C9orf66 NM 152569 hypothetical protein LOC157983 C9orf7 NM 017586 hypothetical protein LOCI 1094 C9orf74 NM030914 hypothetical protein LOC81605 C9orf82 NM_024828 hypothetical protein LOC79886 C9orf88 NM_022833 hypothetical protein LOC64855 C9orf89 NM 032310 chromosome 9 open reading frame 89 C9orf91 NM^153045 hypothetical protein LOC203197 CA12 NM001218 carbonic anhydrase XII isoform I precursor CA2 NM 000067 carbonic anhydrase II
CA8 NM^004056 carbonic anhydrase VIII
CAB39 NM^016289 calcium binding protein 39 CAB39L NM 030925 calcium binding protein 39-like isoform 2 CABCI NM_020247 chaperone, ABCI activity of bcl complex like CABLES2 NM031215 Cdk5 and Abl enzyme substrate 2 CABPI NM_001033677 calcium binding protein 1 isoform 3 CABP7 NM_182527 calcium binding protein 7 CACNAIE NM000721 calcium channel, voltage-dependent, alpha lE
CACNAII NM_001003406 voltage-dependent T-type calcium channel CACNA2D4 NM_001005737 voltage-gated calcium channel alpha(2)delta-4 CACNBI NM000723 calcium channel, voltage-dependent, beta 1 CACNB4 NM000726 calcium channel, voltage-dependent, beta 4 CAD NM_004341 carbamoylphosphate synthetase 2/aspartate CALB2 NM001740 calbindin 2 full length protein isoform CALMI NM006888 calmodulin I
CALML4 NM033429 calmodulin-like 4 isoform 2 CALML5 NM_017422 calmodulin-like skin protein CALML6 N1Vl 138705 calmodulin-like 6 CALN1 NM001017440 calneuron 1 CALU NM_001219 calumenin precursor CAMK2A NM015981 calcium/calmodulin-dependent protein kinase IIA
CAMK2G NM_001222 calcium/calmodulin-dependent protein kinase 11 CAMKK2 NM006549 calcium/calmodulin-dependent protein kinase CAMKV NM024046 CaM kinase-like vesicle-associated CAMSAPI NM015447 calmodulin regulated spectrin-associated protein CAMSAPILI NM203459 calmodulin regulated spectrin-associated protein CANX NM_001024649 calnexin precursor CAPI NM006367 adenylyl cyclase-associated protein CAP2 NM_006366 adenylyl cyclase-associated protein 2 CAPN 12 NM_ 144691 calpain 12 CAPN3 NM_212464 calpain 3 isoform g CAPN5 NM_004055 calpain 5 CAPN6 NM_014289 calpain 6 CAPS NM_004058 calcyphosine isoform a CAPZA2 NM_006136 capping protein (actin filament) muscle Z-line, CARD10 NM_014550 caspase recruitment domain protein 10 CARD14 NM 052819 caspase recruitment domain protein 14 isoform 2 CARD4 NM_006092 caspase recruitment domain family, member 4 CARM1 NM199141 coactivator-associated arginine CARS NM_001014437 cysteinyl-tRNA synthetase isoform c CASKINI NM_020764 CASK interacting protein 1 CASPIO NM001230 caspase 10 isoform a preproprotein CASP4 NM_033307 caspase 4 isoform delta CASQ2 NM_001232 cardiac calsequestrin 2 CASR NM 000388 calcium-sensing receptor CAST NM_173060 calpastatin isoform b CASTI NM_015576 cytomatrix protein p110 CASZI NM 017766 castor homolog 1, zinc finger CBARAI NM_006077 calcium binding atopy-related autoantigen 1 CBFA2T2 NM001032999 core-binding factor, runt domain, alpha subunit CBFA2T3 NM_005187 myeloid translocation gene-related protein 2 CBFB NM001755 core-binding factor, beta subunit isoform 2 CBL NM_005188 Cas-Br-M (murine) ecotropic retroviral CBLC NM_012116 Cas-Br-M (murine) ecotropic retroviral CBR3 NM 001236 carbonyl reductase 3 CBX2 NM_005189 chromobox homolog 2 isoform 1 CBX4 NM_003655 chromobox homolog 4 CC2D1B NM_032449 coiled-coil and C2 domain containing lB
CCDC18 NM_206886 sarcoma antigen NY-SAR-41 CCDC19 NM012337 nasopharyngeal epithelium specific protein I
CCDC21 NM_022778 coiled-coil domain containing 21 CCDC25 NM_001031708 coiled-coil domain containing 25 isoform 1 CCDC28A NM015439 hypothetical protein LOC25901 CCDC3 NM_031455 coiled-coil domain containing 3 CCDC32 NM052849 coiled-coil domain containing 32 CCDC4 NM_207406 hypothetical protein LOC389206 CCDC44 NM_016360 clone HQ0477 PRO0477p CCDC47 NM020198 hypothetical protein LOC57003 CCDC52 NM_144718 coiled-coil domain containing 52 CCDC55 NM_001033563 hypothetical protein LOC84081 isoform 2 CCDC6 NM005436 coiled-coil domain containing 6 CCDC68 NM_025214 CTCL tumor antigen se57-1 CCDC80 NM_199511 steroid-sensitive protein 1 CCDC81 NM_021827 hypothetical protein LOC60494 CCDC83 NM_173556 hypothetical protein LOC220047 CCDC88 NM_032251 hypothetical protein LOC283234 CCDC94 NM_018074 hypothetical protein LOC55702 CCDC95 NM_173618 coiled-coil domain containing 95 CCDC97 NM_052848 hypothetical protein LOC90324 CCL15 NM_004167 chemokine (C-C motif) ligand 15 precursor CCL22 NM002990 small inducible cytokine A22 precursor CCNDl NM_053056 cyclin D1 CCND2 NM_001759 cyclin D2 CCND3 NM_001760 cyclin D3 CCNEI NM_001238 cyclin El isoform 1 CCNE2 NM_057735 cyclin E2 isoform 2 CCNF NM_001761 cyclin F
CCNJ NM_019084 cyclin J
CCNT2 NM_001241 cyclin T2 isofonn a CCR7 NM_001838 chemokine (C-C motif) receptor 7 precursor CCR9 NM_006641 chemokine (C-C motif) receptor 9 isoform B
CCRK NM 012119 cell cycle related kinase isoform 2 CCS NM005125 copper chaperone for superoxide dismutase CD151 NM_004357 CD151 antigen CD163 NM_004244 CD163 antigen isoform a CD164 NM_006016 CD164 antigen, sialomucin CD180 NM_005582 CD180 antigen CD200RI NM_138806 CD200 receptor 1 isoform a CD209 NM_021155 CD209 antigen CD22 NM_001771 CD22 antigen CD274 NM_014143 CD274 antigen CD276 NM_001024736 CD276 antigen isoform a CD28 NM 006139 CD28 antigen CD300C NM_006678 CD300C antigen CD300LG NM_145273 triggering receptor expressed on myeloid cells CD302 NM_014880 CD302 antigen CD37 NM 00 1774 CD37 antigen isoform A

CD3E NM 000733 CD3E antigen, epsilon polypeptide (TiT3 CD4 NM000616 CD4 antigen precursor CD40 NM_001250 CD40 antigen isoform 1 precursor CD47 NM001025079 CD47 molecule isoform 3 precursor CD4S NM 001778 CD48 antigen (B-cell membrane protein) CDS NM 014207 CD5 antigen (p56-62) CD6 NM 006725 CD6 antigen CD69 NM 001781 CD69 antigen (p60, early T-cell activation CD80 NM_005191 CD80 antigen (CD28 antigen ligand 1, B7-1 CD82 NM_001024844 CD82 antigen isoform 2 CD83 NM_004233 CD83 antigen isoform a CD93 NM012072 CD93 antigen precursor CD97 NM 001025160 CD97 antigen isoform 3 precursor CD99L2 NM_031462 CD99 antigen-like 2 isoform E3'-E4'-E3-E4 CDADCI NM_030911 cytidine and dCMP deaminase domain containing 1 CDC14A NM003672 CDC14 hamolog A isoform I
CDC14B NM_003671 CDC14 homolog B isoform I
CDC23 NM_004661 cell division cycle protein 23 CDC25A NM_001789 cell division cycle 25A isoform a CDC25B NM_004358 cell division cycle 25B isoform 2 CDC25C NM_001790 cell division cycle 25C protein isoform a CDC27 NM_O0I256 cell division cycle protein 27 CDC34 NM_004359 cell division cycle 34 CDC37L1 NM017913 cell division cycle 37 homolog (S.
CDC42 NM044472 cell division cycle 42 isoform 2 CDC42BPA NM_003607 CDC42-binding protein kinase alpha isoform B
CDC42BPB NM_006035 CDC42-binding protein kinase beta CDC42EP2 NM_006779 Cdc42 effector protein 2 CDC42EP4 NM012121 Cdc42 effector protein 4 CDC7 NM_003503 CDC7 cell division cycle 7 CDCA4 NM 017955 cell division cycle associated 4 CDCA5 NM080668 cell division cycle associated 5 CDCA7L NM_018719 transcription factor RAM2 CDCP2 NM201546 hypothetical protein LOC200008 CDHI NM_004360 cadherin 1, type 1 preproprotein CDH22 NM_021248 cadherin 22 precursor CDK10 NM_052988 cyclin-dependent kinase 10 isoform 3 CDK5R1 NM 003885 cyclin-dependent kinase 5, regulatory subunit 1 CDK5RAP1 NM016082 CDK5 regulatory subunit associated protein 1 CDK5RAP3 NM025197 CDK5 regulatory subunit associated protein 3 CDK6 NM001259 cyclin-dependent kinase 6 CDKNIA NM000389 cyclin-dependent kinase inhibitor lA
CDKN2A NM 058197 cyclin-dependent kinase inhibitor 2A isoform 3 CDKN2B NM078487 cyclin-dependent kinase inhibitor 2B isoform 2 CDKN2D NM001800 cyclin-dependent kinase inhibitor 2D
CDR2 NM_001802 cerebellar degeneration-related protein 2 CDS2 NM 003818 phosphatidate cytidylyltransferase 2 CDT1 NM~030928 DNA replication factor CDV3 NM017548 CDV3 homolog CDXI NM~001804 caudal type homeo box transcription factor I
CDX2 NM - 001265 caudal type homeo box transcription factor 2 CEACAMI9 NM020219 carcinoembryonic antigen-like 1 CEACAM6 NM002483 carcinoembryonic antigen-related cell adhesion CEACAM7 NM_006890 carcinoembryonic antigen-related cell adhesion CEBPG NMOOI806 CCAAT/enhancer binding protein gamma CECRI NM017424 cat eye syndrome critical region protein 1 CECR6 NM_031890 cat eye syndrome chromosome region, candidate 6 CENTAl NM006869 centaurin, alpha 1 CENTDI NM_015230 centaurin delta 1 isoform a CENTGI NM_014770 centaurin, gamma I
CEP152 NM_014985 hypothetical protein LOC22995 CEP170 NM_014812 centrosomal protein 170kDa CEP27 NM_018097 hypothetical protein LOC55142 CEP350 NM 014810 centrosome-associated protein 350 CEP55 NM_018131 centrosomal protein 55kDa CERK NM_022766 ceramide kinase isoform a CERKL NM 201548 ceramide kinase-like isoform a CGGBPI NM_001008390 CGG triplet repeat binding protein I
CGI-38 NM_015964 hypothetical protein LOC51673 CGI-69 NM_016016 hypothetical protein LOC51629 CGN NM_020770 cingulin CGNLI NM_032866 cingulin-like I
CHACI NM_024111 hypothetical protein LOC79094 CHD5 NM_015557 chromodomain helicase DNA binding protein 5 CHD6 NM 032221 chromodomain helicase DNA binding protein 6 CHD7 NM017780 chromodomain helicase DNA binding protein 7 CHD8 NM020920 chromodomain helicase DNA binding protein 8 CHD9 NM025134 chromodomain helicase DNA binding protein 9 CHDH NM_018397 choline dehydrogenase CHEKI NM_001274 CHKI checkpoint homolog CHERP NM 006387 calcium homeostasis endoplasmic reticulum CHFR NM_018223 checkpoint with forkhead and ring finger CHGA NM_001275 chromogranin A precursor CHID1 NM_023947 hypothetical protein LOC66005 CHKB NM_152253 choline/ethanolamine kinase isoform b CHMP4B NM_176812 chromatin modifying protein 4B
CHMP6 NM024591 chromatin modifying protein 6 CHORDCI NM_012124 cysteine and histidine-rich domain CHP NM 007236 calcium binding protein P22 CHPTI NM020244 choline phosphotransferase 1 CHRACI NM017444 chromatin accessibility complex 1 CHRD NM_177978 chordin isoform b CHRFAM7A NM139320 CHRNA7-FAM7A fusion isoform 1 CHRNA3 NM000743 cholinergic receptor, nicotinic, alpha CHRNA4 NM_000744 cholinergic receptor, nicotinic, alpha 4 subunit CHRNA5 NM000745 cholinergic receptor, nicotinic, alpha CHRNB2 NM_000748 cholinergic receptor, nicotinic, beta CHRNB3 NM_000749 cholinergic receptor, nicotinic, beta CHRNB4 NM 000750 cholinergic receptor, nicotinic, beta CHRNE NM^000080 nicotinic acetylcholine receptor epsilon CHST10 NM_004854 HNK-1 sulfotransferase CHST3 NM_004273 carbohydrate (chondroitin 6) sulfotransferase 3 CHST6 NM_021615 carbohydrate (N-acetylglucosamine 6-0) CHUK NM 001278 conserved helix-loop-helix ubiquitous kinase CHX10 NM 182894 ceh-10 homeo domain containing homolog CIAPINI NMy_020313 cytokine induced apoptosis inhibitor I
CIB2 NM006383 DNA-dependent protein kinase catalytic CIDEB NM_014430 cell death-inducing DFFA-like effector b CINP NM_032630 cyclin-dependent kinase 2-interacting protein CKAP5 NM_001008938 colonic and hepatic tumor over-expressed protein CKB NM 001823 brain creatine kinase CLASPI NM~015282 CLIP-associating protein I
CLASP2 NMu015097 CLIP-associating protein 2 CLCN3 NM-_001829 chloride channel 3 isoform b CLCN4 NM 001830 chloride channel 4 CLCN5 NM_000084 chloride channel 5 CLCN6 NM_001286 chloride channel 6 isoform CIC-6a CLCN7 NM_001287 chloride channel 7 CLDNI NM_021101 claudin 1 CLDN12 NM012129 claudin 12 CLDN14 NM_0I2130 claudin 14 CLDN2 NM_020384 claudin 2 CLDN4 NM001305 claudin 4 CLDN5 NM_003277 claudin 5 CLDN6 NM_021195 claudin 6 CLEC12A NM_201625 myeloid inhibitory C-type lectin-like receptor CLECI2B NM_205852 macrophage antigen h CLEC2D NM_001004419 osteoclast inhibitory lectin isoform 2 CLEC4F NM_173535 C-type lectin, superfamily member 13 CLEC4M NM_214677 CD299 antigen isoform 3 CLIC5 NM016929 chloride intracellular channel 5 CLKI NM001024646 CDC-like kinase 1 isoform 2 CLK4 NM020666 CDC-like kinase 4 CLLU1 NM 001025233 hypothetical protein LOC574028 CLN8 NM_018941 CLN8 protein CLOCK NM_004898 clock CLSTNI NM_001009566 calsyntenin 1 isoform I
CLTB NM_002834 clathrin, light polypeptide isoform a CLU NM001831 clusterin isoform I
CLUAPI NM_024793 clusterin associated protein I isoform 2 CMIP NM_030629 c-Maf-inducing protein Tc-mip isoform CMPK NM_016308 cytidylate kinase CMTM1 NM052999 chemokine-like factor superfamily 1 isoform 13 CMTM3 NM_144601 chemokine-like factor superfamily 3 isoform a CMTM4 NM 178818 chemokine-like factor superfamily 4 isoform 1 CMTM6 NM-017801 CKLF-like MARVEL transmembrane domain containing CNIH2 NM_182553 cornichon homolog 2 CNIH3 NM_152495 cornichon homolog 3 CNNI NM_001299 calponin 1, basic, smooth muscle CNNM2 NM_017649 cyclin M2 isoform 1 CNNM3 NM 017623 cyclin M3 isoform I
CNOT6 NM015455 CCR4-NOT transcription complex, subunit 6 CNTD2 NM_024877 hypothetical protein LOC79935 CNTN3 NM020872 contactin 3 CNTNAPI NM 003632 contactin associated protein 1 COBLLI NM_014900 COBL-like I
COG3 NM_031431 component of golgi transport complex 3 COG7 NM153603 component of oligomeric golgi complex 7 COL11A2 NM080679 collagen, type XI, alpha 2 isoform 3 COL12AI NM_004370 collagen, type XII, alpha 1 long isoform COL23AI NM_173465 collagen, type XXIII, alpha 1 COL24A1 NM_152890 collagen, type XXIV, alpha I
COL3A1 NM_000090 procollagen, type III, alpha 1 COL4A1 NM_001845 alpha I type IV collagen preproprotein COL6A1 NM_001848 collagen, type VI, alpha 1 precursor COL8A2 NM_005202 collagen, type VIII, alpha 2 COL9A2 NM_001852 alpha 2 type IX collagen COLECI2 NM_030781 collectin sub-family member 12 isoform II
COLQ NM005677 acetylcholinesterase collagen-like tail subunit COMMD5 NM_014066 hypertension-related calcium-regulated gene COMMD9 NM_014186 COMM domain containing 9 COPA NM_004371 coatomer protein complex, subunit alpha COPG2 NM_012133 coatomer protein complex, subunit gamma 2 COPS2 NM_004236 COP9 constitutive photomorphogenic homolog COPS7A NM_016319 COP9 complex subunit 7a COPS7B NM022730 COP9 constitutive photomorphogenic homolog COQIOB NM_025147 hypothetical protein LOC80219 COQ5 NM_032314 hypothetical protein LOC84274 COQ9 NM_020312 hypothetical protein LOC57017 CORO6 NM_032854 coronin 6 CORO7 NM_024535 coronin 7 COX10 NM_001303 heme A:farnesyltransferase COX15 NM_078470 COX15 homolog isoform I precursor CPD NM_001304 carboxypeptidase D precursor CPEB2 NM_182485 cytoplasmic polyadenylation element binding CPEB3 NM_014912 cytoplasmic polyadenylation element binding CPEB4 NM_030627 cytoplasmic polyadenylation element binding CPLXI NM_006651 complexin 1 CPLX3 NM_001030005 complexin 3 CPLX4 NM_181654 complexin 4 CPNEI NM_003915 copine I
CPSF3L NM032179 related to CPSF subunits 68 kDa isoform 2 CPT1B NM_004377 carnitine palmitoyltransferase 1B isoform a CPXM2 NM_198148 carboxypeptidase X (M14 family), member 2 CRAMPIL NM_020825 Crm, cramped-like CRB2 NM_173689 crumbs homolog 2 CREB3L1 NM052854 cAMP responsive element binding protein 3-like CREB5 NM_001011666 cAMP responsive element binding protein 5 CREBLI NM_004381 cAMP responsive element binding protein-like I
CREBL2 NM_001310 cAMP responsive element binding protein-like 2 CREGI NM_003851 cellular repressor of EIA-stimulated genes CREG2 NM_153836 cellular repressor of EIA-stimulated genes 2 CRELDI NM_001031717 cysteine-rich with EGF-like domains I isoform 1 CRHR1 NM_004382 corticotropin releasing hormone receptor I
CRIMI NM 016441 cysteine-rich motor neuron 1 CRISPLD2 NM031476 cysteine-rich secretory protein LCCL domain CRKL NM 005207 v-crk sarcoma virus CT10 oncogene homolog CRP NM_000567 C-reactive protein, pentraxin-related CRSP7 NM_004831 cofactor required for Spl transcriptional CRSP8 NM_004269 cofactor required for Spl transcriptional CRSP9 NM004270 cofactor required for Spl transcriptional CRTACI NM_018058 cartilage acidic protein 1 CRY2 NM_021117 cryptochrome 2 (photolyase-like) CRYM NM_001014444 crystallin, mu isoform 2 CRYZLI NM_145858 crystallin, zeta-like 1 CSDC2 NM_014460 RNA-binding protein pippin CSDEI NM_001007553 upstream of NRAS isoform I
CSF2 NM 000758 colony stimulating factor 2 precursor CSHI NM022640 chorionic somatomammotropin hormone I isoform 2 CSH2 NM022644 chorionic somatomammotropin hormone 2 isoform 2 CSNKIAI NM_001025105 casein kinase 1, alpha 1 isoform 1 CSNKIGI NM_022048 casein kinase 1, gamma 1 isoform S
CSNKIG2 NM_001319 casein kinase 1, gamma 2 CSNK2A1 NM_001895 casein kinase II alpha 1 subunit isoform a CSPG4 NM001897 melanoma-associated chondroitin sulfate CSPG5 NM_006574 chondroitin sulfate proteoglycan 5(neuroglycan CST6 NM_001323 cystatin M precursor CST9 NM_001008693 cystatin 9 CST9L NM_0806I0 cystatin 9-like precursor CSTA NM 005213 cystatin A
CTAGEI NM172241 cutaneous T-cell lymphoma-associated antigen 1 CTDP1 NM_004715 CTD (carboxy-terminal domain, RNA polymerase II, CTDSPI NM_021198 CTD (carboxy-terminal domain, RNA polymerase 11, CTDSP2 NM_005730 nuclear LIM interactor-interacting factor 2 CTDSPL NM 001008392 small CTD phosphatase 3 isoform I
CTH NM001902 cystathionase isoform I
CTNNAI NM 001903 catenin, alpha 1 CTNNBIPI NM001012329 catenin, beta interacting protein I
CTNNDI NM001331 catenin (cadherin-associated protein), delta I
CTSB NM_001908 cathepsin B preproprotein CTSC NM 148170 cathepsin C isoform b precursor CTSF NM_003793 cathepsin F
CTSO NM001334 cathepsin 0 preproprotein CTTN NM_005231 cortactin isoform a CUL2 NM 003591 cullin 2 CUL3 NM003590 cullin 3 CX3CLI NM_002996 chemokine (C-X3-C motif) ligand 1 CX3CRI NM_001337 chemokine (C-X3-C motif) receptor 1 CXCL10 NM_001565 small inducible cytokine B 10 precursor CXCR3 NM_001504 chemokine (C-X-C motif) receptor 3 CXCR6 NM_006564 G protein-coupled receptor TYMSTR
CXorfl NM 004709 hypothetical protein LOC9142 CXorf4OA NMi78124 chromosome X open reading frame 40 CXorf4OB NM_001013845 hypothetical protein LOC541578 CXorf6 NM_005491 hypothetical protein LOC10046 CYB561 NM_001017916 cytochrome b-561 isoform 1 CYB561DI NM_182580 cytochrome b-561 domain containing I
CYB5D1 NM_144607 hypothetical protein LOC124637 CYBASC3 NM 153611 cytochrome b, ascorbate dependent 3 CYBRDI NM024843 cytochrome b reductase 1 CYCS NM_018947 cytochrome c CYFIPI NM 001033028 cytoplasmic FMR1 interacting protein 1 isoform CYGB NM_134268 cytoglobin CYP1B1 NM_000104 cytochrome P450, family 1, subfamily B, CYP26BI NM_019885 cytochrome P450, family 26, subfamily b, CYP27AI NM_000784 cytochrome P450, family 27, subfamily A, CYP27B1 NM_000785 cytochrome P450, family 27, subfamily B, CYP2C8 NM 000770 cytochrome P450, family 2, subfamily C, CYP2C9 NMf_000771 cytochrome P450, family 2, subfamily C, CYP2S1 NM 030622 cytochrome P450, family 2, subfamily S, CYP2UI NM183075 cytochrome P450, family 2, subfamily U, CYP4F3 NM000896 cytochrome P450, family 4, subfamily F, D2HGDH NM152783 D-2-hydroxyglutarate dehydrogenase D4S234E NM014392 brain neuron cytoplasmic protein I
D4STI NM130468 dermatan 4 sulfotransferase 1 DAB2IP NM 032552 DAB2 interacting protein isoform I
DACHI NM004392 dachshund homolog 1 isoform c DACT2 NM 214462 dapper homolog 2, antagonist of beta-catenin DAPK3 NM001348 death-associated protein kinase 3 DBF4B NM_025104 DBF4 homolog B isoform 2 DBH NM000787 dopamine beta-hydroxylase precursor DBNDD2 NM 033542 SCF apoptosis response protein I isoform 2 DCAKD NM~024819 dephospho-CoA kinase domain containing DCAMKLI NM004734 doublecortin and CaM kinase-like I
DCBLD2 NM080927 discoidin, CUB and LCCL domain containing 2 DCTN3 NM 024348 dynactin 3 isoform 2 DCTN4 NM016221 dynactin 4 (p62) DCTN5 NM 032486 dynactin 4 DCUNIDI NM020640 RP42 homolog DCUNID2 NM^001014283 hypothetical protein LOC55208 isoform b DCUNID4 NM^015115 DCN1, defective in cullin neddylation 1, domain DCX NM000555 doublecortin isoform a DDEF1 NM018482 development and differentiation enhancing factor DDEF2 NM_003887 development- and differentiation-enhancing DDHD2 NM015214 DDHD domain containing 2 DDI1 NM_001001711 hypothetical protein LOC414301 DDX1I NM_030655 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 DDX17 NM_006386 DEAD box polypeptide 17 isoform p82 DDX19A NM_018332 DDX19-like protein DDX26B NM_182540 hypothetical protein LOC203522 DDX28 NM_018380 DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 DDX31 NM_138620 DEAD (Asp-Glu-Ala-Asp) box polypeptide 31 DDX3X NM 001356 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3 DDX3Y NM_004660 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, DDX52 NM_007010 ATP-dependent RNA helicase ROK1 isoform a DDX54 NM024072 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 DDX59 NM_031306 DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 DEADCI NM_182503 deaminase domain containing I
DECI NM_017418 deleted in esophageal cancer I
DEDD NM_032998 death effector domain-containing protein DEFB4 NM 004942 defensin, beta 4 precursor DENNDIA NM 020946 hypothetical protein LOC57706 isoform 1 DENND2C NM198459 DENN/MADD domain containing 2C
DENND4A NM005848 c-myc promoter binding protein DENR NM 003677 density-regulated protein DEPDC4 NM152317 DEP domain containing 4 DEPDCS NM014662 DEP domain containing 5 isoform I
DERL3 NM_001002862 derlin-3 protein isoform b DFFB NM001004285 DNA fragmentation factor, 40 kD, beta DGAT2IA NM 001002254 diacylglycerol 0-acyltransferase 2-like 4 DGCR13 NM001024733 DiGeorge syndrome gene H
DGCR2 NM_005137 integral membrane protein DGCR2 DGCR6 NM 005675 DiGeorge syndrome critical region protein 6 DGCR6L NM033257 DiGeorge syndrome critical region gene 6 like DGCR8 NM_022720 DiGeorge syndrome critical region gene 8 DGKD NM_003648 diacylglycerol kinase, delta 130kDa isoform I
DHDDS NM024887 dehydrodolichyl diphosphate synthase isoform a DHFR NM_000791 dihydrofolate reductase DHFRLI NM176815 dihydrofolate reductase-like I
DHTKDI NM_018706 dehydrogenase El and transketolase domain DHX30 NM138614 DEAH (Asp-Glu-Ala-His) box polypeptide 30 DHX33 NM_020162 DEAH (Asp-Glu-Ala-His) box polypeptide 33 DHX35 NM021931 DEAH (Asp-Glu-Ala-His) box polypeptide 35 DIAPHI NM_005219 diaphanous 1 DICERI NM_030621 dicerl DI02 NM000793 deiodinase, iodothyronine, type II isoform a DIP NM_015124 death-inducing-protein DIP2A NM_015151 DIP2-like protein isoform a DIRAS I NM_145173 small GTP-binding tumor suppressor 1 DIRAS2 NM_017594 Di-Ras2 DIRCI NM_052952 hypothetical protein LOC116093 DISC1 NM001012957 disrupted in schizophrenia 1 isoform Lv DISP2 NM_033510 dispatched B
DIXDCI NM033425 DIX domain containing 1 isoform b dJ341D10.1 NM001007535 hypothetical protein LOC286453 DKCI NM001363 dyskerin DKFZp434I1020 NM194295 hypothetical protein LOC196968 DKFZp434K191 NM001029950 hypothetical protein LOC29797 DKFZp434N035 NM_032262 hypothetical protein LOC84222 DKFZp451A211 NM001003399 hypothetical protein LOC400169 DKFZP56400823 NM_015393 DKFZP56400823 protein DKFZP586DO919 NM_206914 hypothetical protein LOC25895 isoform b DKFZp666G057 NM 001008226 hypothetical protein LOC283726 DKFZp667M2411 NMu207323 hypothetical protein LOC147172 DKFZp686115217 NM_207495 hypothetical protein LOC401232 DKFZp686O24166 NM_001009913 hypothetical protein LOC374383 DKFZp761E198 NM_138368 hypothetical protein LOC91056 DKFZP761H1710 NM_031297 hypothetical protein LOC83459 DKFZp76112123 NM_031449 hypothetical protein LOC83637 isoform I
DKFZp779B1540 NM_001010903 hypothetical protein LOC389384 DLEC1 NM_007335 deleted in lung and esophageal cancer 1 isoform DLEU7 NM 198989 deleted in lymphocytic leukemia, 7 DLGAP2 NM^004745 discs large-associated protein 2 DLGAP4 NM014902 disks large-associated protein 4 isoform a DLKI NM_001032997 delta-like 1 homolog isoform 2 DLLI NM 005618 delta-like 1 DLL4 NM_019074 delta-like 4 protein precursor DLST NM001933 dihydrolipoamide S-succinyltransferase (E2 DMAP1 NM_019100 DNA methyltransferase 1 associated protein 1 DMD NM_000109 dystrophin Dp427c isoform DMPK NM_004409 myotonic dystrophy protein kinase DMRT2 NM_006557 doublesex and mab-3 related transcription factor DMRTB 1 NM_033067 DMRT-like family B with proline-rich C-terminal, DMTFI NM021145 cyclin D binding myb-like transcription factor DNAJA2 NM 005880 DnaJ subfamily A member 2 DNAJA3 NM005147 DnaJ (Hsp40) homolog, subfamily A, member 3 DNAJA4 NM_018602 DnaJ (Hsp40) homolog, subfamily A, member 4 DNAJB12 NM001002762 DnaJ (Hsp40) homolog, subfamily B, member 12 DNAJB 14 NM024920 DnaJ (Hsp40) homolog, subfamily B, member 14 DNAJB4 NM007034 DnaJ (Hsp40) homolog, subfamily B, member 4 DNAJB5 NM012266 DnaJ (Hsp40) homolog, subfamily B, member 5 DNAJB6 NM_058246 DnaJ (Hsp40) homolog, subfamily B, member 6 DNAJC18 NM_152686 DnaJ (Hsp40) homolog, subfamily C, member 18 DNAJC5G NM_173650 DnaJ (Hsp40) homolog, subfamily C, member 5 DNAJC9 NM_015190 DnaJ homolog, subfamily C, member 9 DNAL4 NM005740 dynein light chain 4, axonemal DNALII NM003462 axonemal dynein light chain DNASEILI NM001009932 deoxyribonuclease I-like 1 precursor DNASEIL2 NM001374 deoxyribonuclease I-like 2 DNM1L NM 012062 dynamin I-like protein isoform I
DOCK2 NM_004946 dedicator of cytokinesis 2 DOCK3 NM_004947 dedicator of cytokinesis 3 DOCK5 NM024940 dedicator of cytokinesis 5 DOK2 NM_003974 docking protein 2 DOK4 NM_018110 downstream of tyrosine kinase 4 DOLPPI NM_020438 dolichyl pyrophosphate phosphatase 1 DPF3 NM012074 D4, zinc and double PHD fingers, family 3 DPH2 NM001384 diphthamide biosynthesis protein 2 isoform a DPP9 NM_139159 dipeptidylpeptidase 9 DPPA4 NM_018189 developmental pluripotency associated 4 DPT NM001937 dermatopontin precursor DPY19L4 NM_181787 hypothetical protein LOC286148 DPYSL2 NM_001386 dihydropyrimidinase-like 2 DPYSL3 NM_001387 dihydropyrimidinase-like 3 DRDI NM_000794 dopamine receptor DI
DRD2 NM_000795 dopamine receptor D2 isoform long DRD5 NM_000798 dopamine receptor D5 DREV 1 NM 0 16025 hypothetical protein LOC51108 DSC3 NMu_024423 desmocollin 3 isoform Dsc3b preproprotein DSCR10 NM 148676 hypothetical protein LOC259234 DSCR3 NM_006052 Down syndrome critical region protein 3 DTNA NM001390 dystrobrevin alpha isoform 1 DUOX2 NM_014080 dual oxidase 2 precursor DUSIL NM_022156 PP3111 protein DUSP10 NM 007207 dual specificity phosphatase 10 isoform a DUSP13 NM_001007271 muscle-restricted dual specificity phosphatase DUSP2 NM_004418 dual specificity phosphatase 2 DUSP26 NM_024025 dual specificity phosphatase 26 DUSP3 NM_004090 dual specificity phosphatase 3 DUSP9 NM_001395 dual specificity phosphatase 9 DUX1 NM_012146 double homeobox, I
DUXA NM_001012729 hypothetical protein LOC503835 DVLl NM004421 dishevelled 1 isoform a DVL2 NM 004422 dishevelled 2 DVL3 NM_004423 dishevelled 3 DXYS155E NM_005088 DNA segment on chromosome X and Y (unique) 155 DYNCIII NM_004411 dynein, cytoplasmic, intermediate polypeptide 1 DYNC1L12 NM 006141 dynein, cytoplasmic, light intermediate DYNLT3 NM 006520 t-complex-associated-testis-expressed I-like DYRK1 A NM101395 dual-specificity tyrosine-(Y)-phosphorylation DYRK1 B NM004714 dual-specificity tyrosine-(Y)-phosphorylation DZIPI NM 014934 DAZ interacting protein I isoform 1 DZIP3 NM_014648 zinc finger DAZ interacting protein 3 E2F3 NM_001949 E2F transcription factor 3 E2F7 NM_203394 E2F transcription factor 7 EBI3 NM_005755 Epstein-Barr virus induced gene 3 precursor ECE2 NM 014693 endothelin converting enzyme 2 isoform A
ECHDCI NMy_018479 enoyl Coenzyme A hydratase domain containing I
ECHS1 NM_004092 mitochondrial short-chain enoyl-coenzyme A
ECOP NM030796 EGFR-coamplified and overexpressed protein EDA NM_001005609 ectodysplasin A isoform EDA-A2 EDA2R NM_021783 X-linked ectodysplasin receptor EDAR NM_022336 ectodysplasin A receptor EDARADD NM080738 EDAR-associated death domain isoform B
EDG1 NM_001400 endothelial differentiation, sphingolipid EDN2 NM_001956 endothelin 2 EED NM 152991 embryonic ectoderm development isoform b EEFSEC NM_021937 elongation factor for selenoprotein translation EFCABI NM_024593 EF-hand calcium binding domain I
EFCAB4A NM_173584 hypothetical protein LOC283229 EFCAB5 NM_198529 EF-hand calcium binding domain 5 isoform I
EFNA3 NM_004952 ephrin A3 EFNB1 NM_004429 ephrin-Bl precursor EFNB2 NM_004093 ephrin B2 EFNB3 NM_001406 ephrin-B3 precursor EFTUDI NM_024580 elongation factor Tu GTP binding domain EGFL7 NM_016215 EGF-like-domain, multiple 7 EGLN1 NM_022051 egl nine homolog 1 EGLN2 NM_017555 EGL nine (C.elegans) homolog 2 isoform 2 EGR3 NM_004430 early growth response 3 EHDI NM_006795 EH-domain containing 1 EHMTI NM_024757 euchromatic histone methyltransferase 1 EHMT2 NM_006709 HLA-B associated transcript 8 isoform a EIFIAX NM_001412 X-linked eukaryotic translation initiation EIF2B2 NM014239 eukaryotic translation initiation factor 2B, EIF2B5 NM_003907 eukaryotic translation initiation factor 2B, EIF2C1 NM 012199 eukaryotic translation initiation factor 2C, 1 EIF2C2 NM012154 eukaryotic translation initiation factor 2C, 2 EIF2C4 NM_017629 eukaryotic translation initiation factor 2C, 4 EIF2S2 NM_003908 eukaryotic translation initiation factor 2 beta EIF3S10 NM003750 eukaryotic translation initiation factor 3, EIF3S8 NM003752 eukaryotic translation initiation factor 3, EIF4B NM_001417 eukaryotic translation initiation factor 4B
EIF4E NM_001968 eukaryotic translation initiation factor 4E
EIF4E3 NM_173359 eukaryotic translation initiation factor 4E
EIF4EBP2 NM_004096 eukaryotic translation initiation factor 4E
EIF4G1 NM 004953 eukaryotic translation initiation factor 4 EIF5A NM~001970 eukaryotic translation initiation factor SA
EIF5A2 NM020390 eIF-5A2 protein ELAC1 NM_018696 elaC homolog 1 ELAVLI NM 001419 ELAV-like I
ELF4 NM_001421 E74-like factor 4 (ets domain transcription ELL NM_006532 elongation factor RNA polymerase 11 ELL2 NM012081 elongation factor, RNA polymerase II, 2 Ellsi NM_152793 hypothetical protein LOC222166 ELM02 NM_133171 engulfment and cell motility 2 ELMODI NM 018712 ELMO domain containing I
ELOVLI NM022821 elongation of very long chain fatty acids ELOVL2 NM_017770 elongation of very long chain fatty acids ELOVL5 NM 021814 homolog of yeast long chain polyunsaturated ELOVL6 NM024090 ELOVL family member 6, elongation of long chain ELOVL7 NM024930 ELOVL family member 7, elongation of long chain ELP3 NM 018091 elongation protein 3 homolog EMCN NM016242 endomucin EMILIN3 NM052846 elastin microfibril interfacer 3 EML5 NM_183387 echinoderm microtubule associated protein like EMR2 NM_013447 egf-like module containing, mucin-like, hormone EMR3 NM_152939 egf-like module-containing mucin-like receptor 3 EMXI NM_004097 empty spiracles homolog I isoform 1 EN2 NM_001427 engrailed homolog 2 ENAH NM_001008493 enabled homolog isoform a ENC1 NM003633 ectodermal-neural cortex (with BTB-like domain) ENG NIVI_000118 endoglin precursor ENPP4 NM_014936 ectonucleotide pyrophosphatase/phosphodiesterase ENSA NM 207043 endosulfine alpha isoform 2 ENTPD6 NM001247 ectonucleoside triphosphate diphosphohydrolase ENTPD7 NM020354 ectonucleoside triphosphate diphosphohydrolase EPB41L1 NM_012156 erythrocyte membrane protein band 4.1-like 1 EPB41L4B NM018424 erythrocyte membrane protein band 4.1 like 4B
EPB41L5 NM_020909 erythrocyte membrane protein band 4.1 like 5 EPB49 NM_001978 erythrocyte membrane protein band 4.9 (dematin) EPHA1 NM_005232 ephrin receptor EphAl EPHA7 NM_004440 ephrin receptor EphA7 EPHB2 NM004442 ephrin receptor EphB2 isoform 2 precursor EPHB4 NM004444 ephrin receptor EphB4 precursor EPHX2 NM001979 epoxide hydrolase 2, cytoplasmic EPM2AIPI NM014805 EPM2A interacting protein I
EPS8L2 NM022772 epidermal growth factor receptor pathway ERGICI NM_001031711 endoplasmic reticulum-golgi intermediate ERN2 NM 033266 endoplasmic reticulum to nucleus signalling 2 ESAM NM138961 endothelial cell adhesion molecule ESPN NM_031475 espin ESRI NM 000125 estrogen receptor I
ESRRA NM004451 estrogen-related receptor alpha ESRRG NM001438 estrogen-related receptor gamma isoform 1 ET NM_024311 hypothetical protein LOC79157 ETSI NM 005238 v-ets erythroblastosis virus E26 oncogene ETS2 NM005239 v-ets erythroblastosis virus E26 oncogene ETVI NM_004956 ets variant gene I
ETV6 NM_001987 ets variant gene 6 EVI5 NM005665 ecotropic viral integration site 5 EVL NM_016337 Enah/Vasp-like EXOC2 NM_018303 Sec5 protein EXOC4 NM021807 SEC8 protein isoform a EXOC5 NM_006544 SEC10 protein EXOC7 NM001013839 exocyst complex component 7 isoform a EXOD1 NM_080663 hypothetical protein LOC112479 EXOSCI NM_016046 exosomal core protein CSL4 EXOSCIO NM001001998 exosome component 10 isoform I
EXT2 NM000401 exostosin 2 EXTL3 NM_001440 Reg receptor EYA1 NM_000503 eyes absent 1 isoform b EZHI NM_001991 enhancer of zeste homolog 1 F 11 R NM_016946 F 11 receptor isoform a precursor F2RLI NM005242 coagulation factor II (thrombin) receptor-like 1 F7 NM000131 coagulation factor VII precursor, isoform a FABP2 NM_000134 intestinal fatty acid binding protein 2 FADSI NM 013402 fatty acid desaturase 1 FADS2 NM_004265 fatty acid desaturase 2 FADS6 NM_178128 fatty acid desaturase domain family, member 6 FAIM2 NM012306 Fas apoptotic inhibitory molecule 2 FALZ NM_004459 fetal Alzheimer antigen isoform 2 FAM101A NM 181709 hypothetical protein LOC144347 FAM102A NM_203305 early estrogen-induced gene 1 protein isoform b FAM107A NM_007177 downregulated in renal cell carcinoma FAM107B NM 031453 hypothetical protein LOC83641 FAM111A NM022074 hypothetical protein LOC63901 FAM116A NM_152678 hypothetical protein LOC201627 FAM11A NM_032508 family with sequence similarity 11, member A
FAM18B NM_016078 hypothetical protein LOC51030 FAM20B NM_014864 family with sequence similarity 20, member B
FAM29A NM 017645 hypothetical protein LOC54801 FAM32A NM_014077 hypothetical protein LOC26017 FAM38A NM_014745 family with sequence similarity 38, member A
FAM3A NM_021806 family 3, member A protein FAM43B NM_207334 hypothetical protein LOC163933 FAM46C NM017709 hypothetical protein LOC54855 FAM50A NM_004699 XAP-5 protein FAM53A NM_001013622 dorsal neural-tube nuclear protein FAM54B NM_019557 hypothetical protein LOC56181 FAM55C NM_145037 hypothetical protein LOC91775 FAM57B NM_031478 hypothetical protein LOC83723 FAM58A NM 152274 hypothetical protein LOC92002 FAM59A NM_022751 hypothetical protein LOC64762 FAM60A NM_021238 family with sequence similarity 60, member A
FAM62A NM 015292 family with sequence similarity 62 (C2 domain FAM63A NM_018379 hypothetical protein LOC55793 isoform 1 FAM63B NM_019092 hypothetical protein LOC54629 FAM70A NM 017938 hypothetical protein LOC55026 FAM73A NM 198549 hypothetical protein LOC374986 FAM78A NM_033387 hypothetical protein LOC286336 FAM78B NM 001017961 hypothetical protein LOC149297 FAM79A NM 182752 hypothetical protein LOC127262 FAM79B NM_198485 hypothetical protein LOC285386 FAM81A NM_152450 hypothetical protein LOC145773 FAM84B NM_174911 breast cancer membrane protein 101 FAM86B1 NM_032916 hypothetical protein LOC85002 FAM86C NM_018172 hypothetical protein LOC55199 isoform I
FAM89A NM_198552 hypothetical protein LOC375061 FAM89B NM 152832 Mouse Mammary Turmor Virus Receptor homolog I
FAM91A1 NMy144963 hypothetical protein LOC157769 FAM98B NM_173611 hypothetical protein LOC283742 FAM99A NM 001014374 hypothetical protein LOC387742 FANCA NM000135 Fanconi anemia, complementation group A isoform FANCE NM_021922 Fanconi anemia, complementation group E
FARSLA NM004461 phenylalanine-tRNA synthetase-like protein FASN NM 004104 fatty acid synthase FAT2 NM 001447 FAT tumor suppressor 2 precursor FBLN1 NM_006487 fibulin I isoform A precursor FBXO17 NM_024907 F-box protein FBG4 isoform 2 FBXO21 NM_015002 F-box only protein 21 isoform 2 FBX022 NM_147188 F-box only protein 22 isoform a FBX024 NM_012172 F-box only protein 24 isoform 2 FBXO27 NM_178820 F-box protein 27 FBXO31 NM_024735 F-box protein 31 FBXO33 NM_203301 F-box protein 33 FBXO44 NM_001014765 F-box protein 44 isoform 1 FBXW11 NM_012300 F-box and WD-40 domain protein 1B isoform C
FBXW4 NM_022039 F-box and WD-40 domain protein 4 FBXW5 NM 018998 F-box and WD-40 domain protein 5 FBXW7 NM001013415 F-box protein FBW7 isoform 3 FCHO1 NM_015122 FCH domain only 1 FCHSDI NM 033449 FCH and double SH3 domains 1 FCHSD2 NM014824 FCH and double SH3 domains 2 FCMD NM_006731 fukutin FCRL2 NM_030764 Fc receptor-like 2 isoform b FCRL5 NM_031281 Fc receptor-like 5 FDFT1 NM_004462 farnesyl-diphosphate farnesyltransferase 1 FECH NM_000140 ferrochelatase isoform b precursor FEM1C NM_020177 feminization I homolog a FES NM_002005 V-FES feline sarcoma viralN-FPS fujinami avian FEZI NM_022549 zygin 1 isoform 2 FEZ2 NM_005102 zygin 2 FFAR3 NM 005304 G protein-coupled receptor 41 FGD3 NM_033086 FYVE, RhoGEF and PH domain containing 3 FGFI I NM 0041I2 fibroblast growth factor 11 FGF19 NM005117 fibroblast growth factor 19 precursor FGF2 NM_002006 fibroblast growth factor 2 FGF23 NM_020638 fibroblast growth factor 23 precursor FGF7 NM_002009 fibroblast growth factor 7 precursor FGFRI NM 023107 fibroblast growth factor receptor I isoform 5 FGFRI OP NM_007045 FGFRI oncogene partner isoform a FGFR2 NM_000141 fibroblast growth factor receptor 2 isoform 1 FGFR3 NM_000142 fibroblast growth factor receptor 3 isoform 1 FGFR4 NM_002011 fibroblast growth factor receptor 4 isoform 1 FGL1 NM_004467 fibrinogen-like I precursor FGR NM_005248 Gardner-Rasheed feline sarcoma viral (v-fgr) FHLI NM_001449 four and a half LIM domains 1 FHL2 NM001450 four and a half LIM domains 2 FIBCDI NM_032843 fibrinogen C domain containing I
FIGF NM004469 vascular endothelial growth factor D
FIS NM_175616 hypothetical protein LOC202299 FKBP10 NM021939 FK506 binding protein 10, 65 kDa FKBPIA NM_000801 FK506-binding protein lA
FKBPIB NM_004116 FK506-binding protein 1B isoform a FKBPS NM_004117 FK506 binding protein 5 FKBP9 NM007270 FK506 binding protein 9 FKBP9L NM182827 FK506 binding protein 9-like FKRP NM 024301 fukutin-related protein FKSG44 NM031904 FKSG44 protein FLCN NM_144997 folliculin isoform 1 FLJ10159 NM_018013 hypothetical protein LOC55084 FLJ10324 NM_018059 hypothetical protein LOC55698 FLJ10769 NM_018210 hypothetical protein LOC55739 FLJ10803 NM_018224 hypothetical protein LOC55744 FLJ10916 NM_018271 hypothetical protein LOC55258 FLJ10945 NM_018280 hypothetical protein LOC55267 FLJ11259 NM_018370 hypothetical protein LOC55332 FLJ11292 NM_018382 hypothetical protein LOC55338 FLJ 11506 NM024666 hypothetical protein LOC79719 FLJ11783 NM_024891 hypothetical protein LOC79951 FLJI 1806 NM024824 nuclear protein UKp68 isoform 1 FLJ12118 NM_024537 hypothetical protein LOC79587 FLJ12529 NM 024811 pre-mRNA cleavage factor 1, 59 kDa subunit FLJ 12700 NM_024910 hypothetical protein LOC79970 FL112716 NM_199053 hypothetical protein LOC60684 isoform b FLJ12788 NM_022492 hypothetical protein LOC64427 FLJ13841 NM_024702 hypothetical protein LOC79755 FLJ14001 NM_024677 hypothetical protein LOC79730 FLJ14107 NM_025026 hypothetical protein LOC80094 FLJ 14154 NM_024845 hypothetical protein LOC79903 FLJ14213 NM_024841 hypothetical protein LOC79899 FLJ14816 NM_032845 hypothetical protein LOC84931 FLJ16008 NM001001665 hypothetical protein LOC339761 FLJ16165 NM_001004318 hypothetical protein LOC390928 FLJ20032 NM_017628 hypothetical protein LOC54790 FLJ20186 NM_207514 differentially expressed in FDCP 8 isoform I
FLJ20232 NM_019008 hypothetical protein LOC54471 FLJ20298 NM 017752 hypothetical protein LOC54885 isoform a FLJ20487 NM017841 hypothetical protein LOC54949 FLJ20551 NM_017875 hypothetical protein LOC54977 FLJ20558 NM_017880 hypothetical protein LOC54980 FLJ20699 NM_017931 hypothetical protein LOC55020 FLJ20701 NM_017933 hypothetical protein LOC55022 FLJ20758 NM_017952 hypothetical protein LOC55037 FLJ20850 NM017967 hypothetical protein LOC55049 FLJ21125 NM_024627 hypothetical protein LOC79680 FLJ21687 NM_024859 PDZ domain containing, X chromosome FLJ21736 NM_024922 esterase 31 FLJ21742 NM_032207 hypothetical protein LOC84167 FLJ21945 NM_025203 hypothetical protein LOC80304 FLJ21986 NM_024913 hypothetical protein LOC79974 FLJ22349 NM_024821 hypothetical protein LOC79879 FLJ22374 NM_032222 hypothetical protein LOC84182 FLJ23436 NM_024671 hypothetical protein LOC79724 FLJ25102 NM_182626 hypothetical protein LOC348738 FLJ25143 NM 182500 hypothetical protein LOC130813 FLJ25169 NM152568 hypothetical protein LOC157848 FLJ25222 NM_199163 hypothetical protein LOC374666 FLJ25410 NM_144605 hypothetical protein LOC124404 FLJ25476 NM 152493 hypothetical protein LOC149076 FLJ27255 NM207501 hypothetical protein LOC401281 FLJ30294 N1V1_144632 hypothetical protein LOC130827 FLJ30313 NM152757 hypothetical protein LOC253868 FLJ31132 NM_001004355 hypothetical protein LOC441522 FLJ32011 NM 182516 hypothetical protein LOC148930 FLJ32028 NM_152680 hypothetical protein LOC201799 FLJ32063 NM_153031 hypothetical protein LOC150538 FLJ32252 NM_182510 hypothetical protein LOC146336 FLJ33708 NM_173675 hypothetical protein LOC285780 FLJ35220 NM_173627 hypothetical protein LOC284131 FLJ35424 NM 173661 hypothetical protein LOC285492 FLJ35429 NM_001003807 hypothetical protein LOC285830 FLJ35530 NM_207467 hypothetical protein LOC400798 FL335695 NM 207444 hypothetical protein LOC400359 FL335740 NM_147195 FLJ35740 protein FLJ35767 NM_207459 hypothetical protein LOC400629 FLJ35880 NM 153264 hypothetical protein LOC256076 FLJ36070 NM_182574 hypothetical protein LOC284358 FLJ36208 NM 176677 hypothetical protein LOC283948 FLJ36492 NM_182568 hypothetical protein LOC284047 FLJ36888 NM_178830 hypothetical protein LOC126526 FLJ37357 NM_173645 hypothetical protein LOC284944 FLJ37478 NM 178557 hypothetical protein LOC339983 FLJ37538 NM 173564 hypothetical protein FLJ37538 FLJ37543 NM173667 hypothetical protein LOC285668 FLJ38723 NM_173805 hypothetical protein FLJ38723 FLJ38973 NM 153689 hypothetical protein LOC205327 FLJ39237 NM_198571 hypothetical protein LOC375607 FLJ39827 NM_152424 hypothetical protein LOC139285 FLJ40142 NM`207435 hypothetical protein LOC400073 FLJ40172 NM 173649 hypothetical protein LOC285051 FLJ40288 NM_173682 hypothetical protein LOC286023 FLJ40432 NM152523 hypothetical protein LOC151195 FLJ40504 NM_173624 hypothetical protein LOC284085 FLJ41046 NM207479 hypothetical protein LOC400940 FLJ41423 NM001001679 hypothetical protein LOC399886 FLJ41821 NM_001001697 hypothetical protein LOC401011 FLJ41993 NM_001001694 hypothetical protein LOC400935 FLJ42102 NM_001001680 hypothetical protein LOC399923 FLJ42133 NM 001001690 hypothetical protein LOC400844 FLJ42289 NM207383 hypothetical protein LOC388182 FLJ42291 NM_207367 hypothetical protein LOC346547 FLJ43093 NM 207498 hypothetical protein LOC401258 FLJ43339 NM207380 hypothetical protein LOC388115 FLJ43582 NM207412 hypothetical protein LOC389649 FLJ43980 NM 001004299 hypothetical protein LOC124149 FLJ44385 NM207478 hypothetical protein LOC400934 FLJ44815 NM_207454 hypothetical protein LOC400591 FLJ44968 NM 198537 hypothetical protein LOC374887 FLJ45079 NM 001001685 hypothetical protein LOC400624 FLJ45121 NM_207451 hypothetical protein LOC400556 FLJ45248 NM_207505 hypothetical protein LOC401472 FLJ45300 NM001001681 hypothetical protein LOC399957 FLJ45422 NM 001004349 hypothetical protein LOC441140 FLJ45455 NM207386 hypothetical protein LOC388336 FLJ45537 NM001001709 hypothetical protein LOC401535 FLJ45645 NM 198557 hypothetical protein LOC375287 FLJ45684 NM207462 hypothetical protein LOC400666 FLJ45831 NM001001684 hypothetical protein LOC400576 FLJ45964 NM 207483 hypothetical protein LOC401040 FLJ45966 NM001001700 hypothetical protein LOC401120 FLJ45974 NM 001001707 hypothetical protein LOC401337 FLJ46020 NM 207472 hypothetical protein LOC400863 FLJ46026 NM207458 hypothetical protein LOC400627 FLJ46082 NM 207417 hypothetical protein LOC389799 FLJ46154 NM198462 FLJ46154 protein FLJ46210 NM001004315 hypothetical protein LOC389152 FLJ46230 NM_207463 hypothetical protein LOC400679 FLJ46257 NM001001693 hypothetical protein LOC400932 FLJ46347 NM_001005303 hypothetical protein LOC389064 FLJ46358 NM_207439 hypothetical protein LOC4001 10 FLJ46363 NM_207434 hypothetical protein LOC400002 FLJ46365 NM_207504 hypothetical protein LOC401459 FLJ46385 NM_001001675 hypothetical protein LOC390963 FLJ46481 NM_207405 hypothetical protein LOC389197 FI.J46831 NM_207426 forkhead box 12 FLJ46838 NM_001007546 hypothetical protein LOC440865 FLJ90166 NM_153360 hypothetical protein LOC164284 FLJ90579 NM_173591 hypothetical protein LOC283310 FLJ90650 NM173800 laeverin FLJ90709 NM_173514 hypothetical protein LOC153129 FLNA NM001456 filamin 1(actin-binding protein-280) FLNB NM_001457 filamin B, beta (actin binding protein 278) FLOT2 NM 004475 flotillin 2 WO 2008/073923 PCT[US2007/087038 FLRT2 NM 013231 fibronectin leucine rich transmembrane protein FLT3 NM004119 flns-related tyrosine kinase 3 FLYWCHI NM 032296 FLYWCH-type zinc finger 1 isoform a FMNLI NM 005892 formin-like I
FMNL3 NM 175736 formin-like 3 isoform 1 FN3KRP NM024619 fructosamine-3-kinase-related protein FNDC3A NM014923 fibronectin type III domain containing 3A
FNDC3B NM022763 fibronectin type III domain containing 3B
FNDC4 NM022823 fibronectin type III domain containing 4 FNDC5 NM 153756 fibronectin type III domain containing 5 FNDC7 NM_173532 hypothetical protein LOCI 63479 FNDC8 NM 017559 hypothetical protein LOC54752 FNTA NM001018676 farnesyltransferase, CAAX box, alpha isoform b FNTB NM 002028 farnesyltransferase, CAAX box, beta FOLR2 NM000803 folate receptor 2 precursor FOSB NM 006732 FBJ murine osteosarcoma viral oncogene homolog FOSLI NM_005438 FOS-like antigen I
FOSL2 NM_005253 FOS-like antigen 2 FOXA3 NM 004497 forkhead box A3 FOXFi NM_001451 forkhead box Fl FOXL2 NM_023067 forkhead box L2 FOXNI NM003593 forkhead box N]
FOXO1A NM_002015 forkhead box O1A
FOXP4 NM_001012426 forkhead box P4 isoform I
FOXREDI NM 017547 FAD-dependent oxidoreductase domain containing FRAGI NM_014489 FGF receptor activating protein I
FRASI NM032863 Fraser syndrome I isoform 4 FRATl NM_005479 GSK-3 binding protein FRATI
FREQ NM_014286 frequenin homolog FRMD4A NM 018027 FERM domain containing 4A
FRMD6 NM_152330 FERM domain containing 6 FRMPDI NM014907 FERM and PDZ domain containing 1 FRMPD2 NM_152428 FERM and PDZ domain containing 2 isoform 1 FRMPD4 NM_014728 PDZ domain containing 10 FRY NM023037 hypothetical protein CG003 FSDI NM024333 fibronactin type III and SPRY domain containing FSD2 NM001007122 SPRY domain containing 1 FSIP2 NM_173651 fibrous sheath interacting protein 2 FSTLI NM007085 follistatin-like 1 precursor FSTL3 NM005860 follistatin-like 3 glycoprotein precursor FSTL4 NM 015082 follistatin-like 4 FUBPI NM 003902 far upstream element-binding protein FUCAI NM000147 fucosidase, alpha-L- 1, tissue FUR1N NM_002569 furin preproprotein FUT1 NM_000148 fucosyltransferase 1 FUT2 NM_000511 fucosyltransferase 2 (secretor status included) FUT3 NM_000149 fucosyltransferase 3 (galactoside FUT4 NM_002033 fucosyltransferase 4 FVT1 NM_002035 follicular lymphoma variant translocation I
FXN NM_000144 frataxin isoform 1 preproprotein FXYD2 NM_001680 FXYD domain-containing ion transport regulator 2 FXYD6 NM022003 FXYD domain-containing ion transport regulator FYCOI NM 024513 FYVE and coiled-coil domain containing 1 FZD10 NM007197 fiizzled 10 FZD4 NM 012193 frizzled 4 FZD6 NM 003506 frizzled 6 FZD7 NM 003507 frizzled 7 FZD9 NM 003508 frizzled 9 GOS2 NM015714 putative lymphocyte GO/Gl switch gene G3BP2 NM 012297 Ras-GTPase activating protein SH3 domain-binding G6PD NM000402 glucose-6-phosphate dehydrogenase GAA NM 000152 acid alpha-glucosidase preproprotein GAB2 NM012296 GRB2-associated binding protein 2 isoform b GAB3 NM_080612 Gab3 protein GABARAPLI NM0314I2 GABA(A) receptor-associated protein like I
GABBRI NM_001470 gamma-aminobutyric acid (GABA) B receptor I
GABPA NM002040 GA binding protein transcription factor, alpha GABRAI NM 000806 gamma-aminobutyric acid (GABA) A receptor, alpha GABRE NM 004961 gamma-aminobutyric acid (GABA) A receptor, GABRP NM014211 gamma-aminobutyric acid (GABA) A receptor, pi GADD45G NM_006705 growth arrest and DNA-damage-inducible, gamma GAGE) NM_001468 G antigen 1 GAK NM005255 cyclin G associated kinase GALC NM 000153 galactosylceramidase isoform a precursor GALM NM 138801 galactose mutarotase (aldose 1-epimerase) GALNT] NM020474 polypeptide N-acetylgalactosaminyltransferase I
GALNTII NM_022087 GALNAC-TI I
GALNTI3 NM052917 UDP-N-acetyl-alpha-D-galactosamine:polypeptide GALNT2 NM_004481 polypeptide N-acetylgalactosaminyltransferase 2 GALNT4 NM_003774 polypeptide N-acetylgalactosaminyltransferase 4 GALNT7 NM017423 polypeptide N-acetylgalactosaminyltransferase 7 GALNT9 NM 021808 polypeptide N-acetylgalactosaminyltransferase 9 GAN NM022041 gigaxonin GANAB NM 198334 alpha glucosidase II alpha subunit isoform 2 GARNLI NMO]4990 GTPase activating Rap/RanGAP domain-like I
GARNL4 NMO] 5085 GTPase activating Rap/RanGAP domain-like 4 GAS2LI NM_152237 growth arrest-specific 2 like I isoform b GAS7 NM_003644 growth arrest-specific 7 isoform a GATA2 NM_032638 GATA binding protein 2 GATA4 NM002052 GATA binding protein 4 GATA5 NM_080473 GATA binding protein 5 GATAD2A NM_017660 GATA zinc finger domain containing 2A
GATAD2B NM_020699 GATA zinc finger domain containing 2B
GBA NM_000157 glucocerebrosidase precursor GBF1 NM004193 golgi-specific brefeldin A resistance factor I
GBL NM_022372 G protein beta subunit-like GCC1 NM_024523 Golgi coiled-coil protein I
GCC2 NM014635 GRIP and coiled-coil domain-containing 2 isoform GCK NM_000162 glucokinase isoform I
GCLC NM001498 glutamate-cysteine ligase, catalytic subunit GCMI NM_003643 glial cells missing homolog a GCNT3 NM_004751 lucosaminyl (N-acetyl) transferase 3, mucin GDI2 NM001494 GDP dissociation inhibitor 2 GDPD2 NM_017711 osteoblast differentiation promoting factor Gene_symbol hsa-miR-16 targets Gene name GFAP NM_002055 glial fibrillary acidic protein GFER NM_005262 ervl-like growth factor GFIIB NM_004188 growth factor independent 1B (potential GFM1 NM_024996 G elongation factor, mitochondrial 1 GFPT1 NM_002056 glucosamine-fructose-6-phosphate GFRA4 NM022139 GDNF family receptor alpha 4 isoform a GGA2 NM_015044 ADP-ribosylation factor binding protein 2 GGA3 NM_014001 ADP-ribosylation factor binding protein 3 GH1 NM_022562 growth hormone 1 isoform 5 GH2 NM_022557 growth hormone 2 isoform 2 GHR NM 000163 growth hormone receptor precursor GIMAP5 NM_018384 GTPase, IMAP family member 5 GIT1 NM_014030 G protein-coupled receptor kinase interactor I
GJA4 NM_002060 connexin 37 GLCE NM_015554 D-glucuronyl C5-epimerase GLIS3 NM_152629 GLIS family zinc finger 3 GLRX NM_002064 glutaredoxin (thioltransferase) GLS NM_014905 glutaminase C
GLS2 NM_013267 glutaminase GA isoform a GLTIDI NM_144669 hypothetical protein LOC144423 GLT25D2 NM015101 glycosyltransferase 25 domain containing 2 GLTP NM016433 glycolipid transfer protein GLUDI NM005271 glutamate dehydrogenase 1 GLUD2 NM_012084 glutamate dehydrogenase 2 GM2A NM_000405 GM2 ganglioside activator precursor GM632 NM_020713 hypothetical protein LOC57473 GMEB2 NM_012384 glucocorticoid modulatory element binding GNA12 NM_007353 guanine nucleotide binding protein (G protein) GNA15 NM_002068 guanine nucleotide binding protein (G protein), GNAI3 NM_006496 guanine nucleotide binding protein (G protein), GNAL NM_002071 guanine nucleotide binding protein (G protein), GNAOI NM_020988 guanine nucleotide binding protein, alpha GNAQ NM002072 guanine nucleotide binding protein (G protein), GNAS NM_016592 guanine nucleotide binding protein, alpha GNB 1 NM002074 guanine nucleotide-binding protein, beta-1 GNG12 NM_018841 G-protein gamma-12 subunit GNG2 NM053064 guanine nucleotide binding protein (G protein), GNG7 NM052847 guanine nucleotide binding protein (G protein), GNL3L NM_019067 guanine nucleotide binding protein-like 3 GOLGA NM_018652 golgin-like protein GOLGAI NM_002077 golgin 97 GOLGA2 NM_004486 Golgi autoantigen, golgin subfamily a, 2 GOLGA3 NM_005895 Golgi autoantigen, golgin subfamily a, 3 GOLGA4 NM 002078 golgi autoantigen, golgin subfamily a, 4 GOLGA7 NM001002296 golgi autoantigen, golgin subfamily a, 7 GOLPH4 NM_014498 golgi phosphoprotein 4 GOLTIB NM_016072 golgi transport 1 homolog B
GORASPI NM_031899 Golgi reassembly stacking protein 1 GORASP2 NM015530 golgi reassembly stacking protein 2 GOSRI NM_001007024 golgi SNAP receptor complex member 1 isoform 3 GOT2 NM_002080 aspartate aminotransferase 2 precursor GPA33 NM_005814 transmembrane glycoprotein A33 precursor GPAM NM_020918 mitochondrial glycerol 3-phosphate GPATC4 NM 015590 G patch domain containing 4 protein isoform 1 GPC1 NM 002081 glypican 1 precursor GPC3 NM 004484 glypican 3 GPDI NM 005276 glycerol-3-phosphate dehydrogenase I (soluble) GPIAPI NM 005898 membrane component chromosome 11 surface marker GPR109A NM 177551 G protein-coupled receptor 109A
GPRI09B NM006018 G protein-coupled receptor 109B
GPR114 NM 153837 G-protein coupled receptor 114 GPRI24 NM 032777 G protein-coupled receptor 124 GPRI26 NM 001032394 G protein-coupled receptor 126 alpha 2 GPRI32 NM 013345 G protein-coupled receptor 132 GPR146 NM 138445 G protein-coupled receptor 146 GPR171 NM013308 G protein-coupled receptor 171 GPR180 NM_180989 G protein-coupled receptor 180 precursor GPR23 NM_005296 G protein-coupled receptor 23 GPR26 NM_153442 G protein-coupled receptor 26 GPR30 NM_001505 G protein-coupled receptor 30 GPR55 NM_005683 G protein-coupled receptor 55 GPR6 NM 005284 G protein-coupled receptor 6 GPR63 NM_030784 G protein-coupled receptor 63 GPR68 NM_003485 G protein-coupled receptor 68 GPR78 NM_080819 G protein-coupled receptor 78 GPR83 NM 016540 G protein-coupled receptor 83 GPR88 NM_022049 G-protein coupled receptor 88 GPR92 NM_020400 putative G protein-coupled receptor 92 GPS 1 NM_004127 G protein pathway suppressor I isoform 2 GPSM3 NM_022107 G-protein signalling modulator 3(AGS3-like, C.
GPXI NM_000581 glutathione peroxidase I isoform I
GRAMD2 NM 001012642 h othetical protein LOC196996 GRAMD3 NM_023927 GRAM domain containing 3 GRB 10 NM_001001549 growth factor receptor-bound protein 10 isoform GRB2 NM_002086 growth factor receptor-bound protein 2 isoform GRB7 NM 001030002 growth factor receptor-bound protein 7 GREM2 NM 022469 gremlin 2 precursor GRIA3 NM 000828 glutamate receptor 3 isoform flop precursor GRIK3 NM_000831 glutamate receptor 7 precursor GRINI NM 000832 NMDA receptor I isoform NRl-1 precursor GRIN2B NM_000834 N-methyl-D-aspartate receptor subunit 2B
GRIN2C NM 000835 N-methyl-D-aspartate receptor subunit 2C
GRIN3A NM_133445 glutamate receptor, ionotropic, GRK6 NM 001004106 G protein-coupled receptor kinase 6 isoform A
GRMI NM`000838 glutamate receptor, metabotropic I
GRM7 NM`000844 glutamate receptor, metabotropic 7 isoform a GRPR NM005314 gastrin-releasing peptide receptor GRTP1 NM~024719 growth hormone regulated TBC protein I
GRWD1 NM~031485 glutamate-rich WD repeat containin1 GSDMDCI NM 024736 gasdermin domain containing I
GSGI NM_I53823 germ cell associated 1 isoform 2 GSTT2 NM 000854 glutathione S-transferase theta 2 GTDC1 NM 001006636 glycosyltransferase-like domain containing 1 GTF3C5 NM_012087 general transcription factor IIIC, polypeptide GTPBPI NM 004286 GTP bindin protein 1 GTPBP8 NM 001008235 hypothetical protein LOC29083 isoform 3 GUCAIB NM 002098 guanylate cyclase activator 1B (retina) GUSBL2 NM206910 hypothetical protein LOC375513 isoform 2 GYLTLIB NM_152312 glycosyltransferase-like 1B
GYS1 NM_002103 glycogen synthase 1(muscle) H2AFJ NM018267 H2A histone family, member J isoform 1 H2-ALPHA NM_080386 alpha-tubulin isotype H2-alpha H6PD NM_004285 hexose-6-phosphate dehydrogenase precursor HADHSC NM005327 L-3-hydroxyacyl-Coenzyme A dehydrogenase HAPLN4 NM_023002 brain link protein 2 HARSL NM_012208 histidyl-tRNA synthetase-like HASI NM_001523 hyaluronan synthase I
HAS2 NM 005328 hyaluronan synthase 2 HAS3 NM005329 hyaluronan synthase 3 isoform a HCCA2 NM_053005 HCCA2 protein HCFC1 NM_005334 host cell factor C1 (VP16-accessory protein) HD NM_002111 huntingtin HDGF NM004494 hepatoma-derived growth factor (high-mobility HECTDI NM_015382 HECT domain containing 1 HECWI NM_015052 NEDD4-like ubiquitin-protein ligase I
HELZ NM_014877 helicase with zinc finger domain HEMKI NM_016173 HemK methyltransferase family member I
HERC2 NM_004667 hect domain and RLD 2 HERC4 NM001017972 hect domain and RLD 4 isoform c HERC6 NM001013000 hect domain and RLD 6 isoform c HERV-FRD NM207582 HERV-FRD provirus ancestral Env polyprotein HES2 NM_019089 hairy and enhancer of split homolog 2 HES5 NM 001010926 hairy and enhancer of split 5 HEXA NM_000520 hexosaminidase A preproprotein HEYI NM012258 hairy/enhancer-of-split related with YRPW motif HEY2 NM_012259 hairy/enhancer-of-split related with YRPW motif HEYL NM014571 hairy/enhancer-of-split related with YRPW
HICI NM006497 hypermethylated in cancer 1 HIC2 NM_015094 hypermethylated in cancer 2 HIGDIA NM_014056 HIG1 domain family, member 1A
HIP1 NM_005338 huntingtin interacting protein 1 HIRA NM003325 HIR (histone cell cycle regulation defective, S.
HISTIH2AG NM021064 H2A histone family, member P
HIST2H2BE NM_003528 H2B histone family, member Q
HK1 NM_000188 hexokinase 1 isoform HKI
HK2 NM_000189 hexokinase 2 HKR2 NM_181846 GLI-Kruppel family member HKR2 HLA-DQA1 NM002122 major histocompatibility complex, class II, DQ
HMBOXI NM_024567 hypothetical protein LOC79618 HMBS NM_000190 hydroxymethylbilane synthase isoform 1 HMG20A NM_018200 high-mobility group 20A
HMG2LI NM_001003681 high-mobility group protein 2-like I isoform b HMGAI NM_002131 high mobility group AT-hook I isoform b HMGA2 NM001015886 high mobility group AT-hook 2 isoform c HMGB3 NM_005342 high-mobility group box 3 HMOX2 NM 002134 heme oxygenase (decyclizing) 2 HNF4A NM_000457 hepatocyte nuclear factor 4 alpha isoform b HNF4G NM_004133 hepatocyte nuclear factor 4, gamma HNRPAO NM_006805 heterogeneous nuclear ribonucleoprotein A0 HNRPAI NM 002136 heterogeneous nuclear ribonucleoprotein Al HNRPDL NM_005463 heterogeneous nuclear ribonucleoprotein D-like HNRPU NM_004501 heterogeneous nuclear ribonucleoprotein U
HOXA10 NM_018951 homeobox A10 isoform a HOXA3 NM 030661 homeobox A3 isoform a HOXB13 NM_006361 homeobox B 13 HOXB4 NM024015 homeobox B4 HOXB7 NM004502 homeobox B7 HOXCI l NM014212 homeobox C11 HOXC13 NM017410 homeobox C13 HOXC8 NM022658 homeobox C8 HOXD1 NM 024501 homeobox DI
HOXD9 NM_014213 homeobox D9 HPCAL4 NM_016257 hippocalcin-like protein 4 HPSI NM_l82637 Hermansky-Pudlak syndrome 1 protein isoform b HPS4 NM022081 light ear protein isoform a HPSE2 NM_021828 heparanase 2 HR NM_005144 hairless protein isoform a HRH2 NM_022304 histamine receptor H2 HRH3 NM_007232 histamine receptor H3 HS2ST1 NM_012262 heparan sulfate 2-0-sulfotransferase I
HS6STI NM_004807 heparan sulfate 6-0-sulfotransferase HS6ST2 NM_147175 heparan sulfate 6-0-sulfotransferase 2 HSDL2 NM_032303 hydroxysteroid dehydrogenase like 2 HSF2BP NM_007031 heat shock transcription factor 2 binding HSPA 1 B NM_005346 heat shock 70kDa protein 1 B
14SPA4L NM_014278 heat shock 70kDa protein 4-like HSPA8 NM006597 heat shock 70kDa protein 8 isoform 1 HSPB7 NM014424 heat shock 27kDa protein family, member 7 HSPBAPl NM_024610 Hspb associated protein 1 HSPCO49 NM 014149 HSPCO49 protein HSPC117 NM_014306 hypothetical protein LOC51493 HSPG2 NM_005529 heparan sulfate proteoglycan 2 HSU79303 NM 013301 hypothetical protein LOC29903 HTF9C NM_022727 Hpall tiny fragments locus 9C
HTR2A NM000621 5-hydroxytryptamine (serotonin) receptor 2A
HTR2C NM_000868 5-hydroxytryptamine (serotonin) receptor 2C
HTR4 NM 000870 serotonin 5-HT4 receptor isoform b HTRA2 NM013247 HtrA serine peptidase 2 isoform I preproprotein HTRA3 NM_053044 HtrA serine peptidase 3 HYOU1 NM_006389 oxygen regulated protein precursor IARS NM_002161 isoleucine-tRNA synthetase IBRDCI NM152553 IBR domain containing 1 IBRDC2 NM182757 IBR domain containing 2 ICAI NM_022307 islet cell autoantigen i ICMT NM_012405 isoprenylcysteine carboxyl methyltransferase ICOS NM_012092 inducible T-cell co-stimulator precursor ICOSLG NM015259 inducible T-cell co-stimulator ligand IDH3A NM005530 isocitrate dehydrogenase 3 (NAD+) alpha IER2 NM_004907 immediate early response 2 IFIT1 NM001548 interferon-induced protein with IFNARI NM000629 interferon-alpha receptor I precursor IFNGR2 NM005534 interferon-gamma receptor beta chain precursor IFT140 NM 014714 intraflagellar transport 140 IFT20 NM 174887 intraflagellar transport protein IFT20 IFT57 NM_018010 estrogen-related receptor beta like 1 IFT74 NM_025103 coiled-coil domain containing 2 IGFI NM_000618 insulin-like growth factor 1(somatomedin C) IGFIR NM000875 insulin-like growth factor I receptor precursor GF2BP1 NM_006546 insulin-like growth factor 2 mRNA binding GF2R NM 000876 insulin-like growth factor 2 receptor GFBP3 NM 000598 insulin-like growth factor binding protein 3 GSF22 NM173588 hypothetical protein LOC283284 GSF3 NM001007237 immunoglobulin superfamily, member 3 isoform 2 GSF4 NM014333 immunoglobulin superfamily, member 4D
HPK1 NM_001006115 inositol hexaphosphate kinase 1 isoform 2 IFIPK3 NM054111 inositol hexaphosphate kinase 3 IKBKAP NM_003640 inhibitor of kappa light polypeptide gene IKBKB NM_001556 inhibitor of kappa light polypeptide gene IKBKE NM_014002 IKK-related kinase epsilon IKBKG NM003639 inhibitor of kappa light polypeptide gene ILI ORA NM001558 interleukin 10 receptor, alpha precursor IL10RB NM_000628 interleukin 10 receptor, beta precursor IL13 NM_002188 interleukin 13 precursor IL15 NM_000585 interieukin 15 preproprotein IL16 NM_004513 interleukin 16 isoform i precursor IL17D NM138284 interleukin 17D precursor IL17E NM_022789 interleukin 17E isoform I precursor ILl7RB NM 172234 interleukin 17B receptor isoform 2 precursor IL17RC NM032732 interleukin 17 receptor C isoform 3 precursor IL17RD NM_017563 interleukin 17 receptor D
IL17RE NM_144640 interleukin 17 receptor E isoform 3 IL18BP NM_173042 interleukin 18 binding protein precursor IL18R1 NM_003855 interleukin 18 receptor 1 precursor IL1F5 NM012275 interleukin 1 family, member 5 IL1F8 NM_173178 interleukin 1 family, member 8 isoform 2 IL1F9 NM019618 interleukin 1 family, member 9 IL1R1 NM_000877 interleukin 1 receptor, type I precursor ILIRAP NM_134470 interleukin I receptor accessory protein isoform ILIRAPLl NM014271 interleukin I receptor accessory protein-like 1 IL1RL1 NM003856 interleukin I receptor-like I isoform 2 IL20 NM_018724 interleukin 20 precursor IL28RA NM_170743 interleukin 28 receptor, alpha isoform 1 IL2RA NM000417 interleukin 2 receptor, alpha chain precursor IL2RB NM000878 interleukin 2 receptor beta precursor IL3 NM_000588 interleukin 3 precursor IL3RA NM002183 interleukin 3 receptor, alpha precursor IL6R NM_000565 interleukin 6 receptor isoform I precursor IL9R NM_176786 nterleukin 9 receptor isoform 2 ILDR1 NM_175924 mmunoglobulin-like domain containing receptor ILF3 NM_004516 nterleukin enhancer binding factor 3 isoform b IMMP2L NM032549 MP2 inner mitochondrial membrane protease-like IMPA2 NM 014214 nositol(myo)-l(or 4)-monophosphatase 2 INCENP NM_020238 inner centromere protein antigens 135/155kDa ING5 NM032329 inhibitor of growth family, member 5 INPP5A NM005539 inositol polyphosphate-5-phosphatase A
INSM2 NM 032594 insulinoma-associated protein IA-6 INSR NM 000208 insulin receptor INVS NM 014425 inversin isoform a IPOB NM006390 importin 8 IPPK NM_022755 inositol 1,3,4,5,6-pentakisphosphate 2-kinase IQCE NM_152558 IQ motif containing E
IQGAPI NM003870 IQ motif containing GTPase activating protein 1 IQGAP3 NM_178229 IQ motif containing GTPase activating protein 3 IRAKI NM_001025242 interleukin-1 receptor-associated kinase I
IRAK2 NM_001570 interleukin-1 receptor-associated kinase 2 IRF2BP 1 NM_015649 interferon regulatory factor 2 binding protein IRF4 NM_002460 interferon regulatory factor 4 IRF5 NM002200 interferon regulatory factor 5 isoform a IRSI NM_005544 insulin receptor substrate I
IRS2 NM_003749 insulin receptor substrate 2 IRX3 NM_024336 iroquois homeobox protein 3 ISLR NM_005545 immunoglobulin superfamily containing ISOC1 NM_016048 isochorismatase domain containing 1 ISOC2 NM024710 isochorismatase domain containing 2 ITFG3 NM032039 integrin alpha FG-GAP repeat containing 3 ITGAIO NM003637 integrin, alpha 10 precursor TGA2 NM_002203 integrin alpha 2 precursor TGAM NM_000632 integrin alpha M precursor TGAX NM_000887 ntegrin alpha X precursor TGB4BP NM002212 ntegrin beta 4 binding protein isoform a TGBS NM_002213 ntegrin, beta 5 TGBLl NM_004791 ntegrin, beta-like 1(with EGF-like repeat TIH1 NM002215 inter-alpha (globulin) inhibitor HI
ITIH5 NM001001851 inter-alpha trypsin inhibitor heavy chain ITK NM005546 IL2-inducible T-cell kinase ITPKI NM014216 inositol 1,3,4-triphosphate 516 kinase ITPRI NM002222 inositol 1,4,5-triphosphate receptor, type I
ITSNI NM 001001132 intersectin 1 isoform ITSN-s IVNSIABP NM_006469 influenza virus NSIA binding protein isoform a JAGNI NM_032492 jagunal homolog I
JAK2 NM_004972 Janus kinase 2 JARIDIB NM_006618 Jumonji, AT rich interactive domain I B
JARID2 NM_004973 umonji, AT rich interactive domain 2 protein JMJD2D NM_018039 umonji domain containing 2D
JMJD4 NM023007 umonji domain containing 4 JMJD5 NM_024773 hypothetical protein LOC79831 JOSD1 NM014876 Josephin domain containing I
JPHl NM020647 unctophilin I
JPH2 NM 020433 unctophilin 2 isoform 1 JUB NM_032876 ub, ajuba homolog isoform 1 JUP NM002230 unction plakoglobin K6HF NM_004693 cytokeratin type 11 K61RS3 NM_175068 keratin 6 irs3 K6IRS4 NM175053 keratin 6 irs4 KALI NM_000216 Kalimann syndrome I protein KALRN NM001024660 kalirin, RhoGEF kinase isoform I
KARS NM_005548 Iysyl-tRNA synthetase KATNALl NM001014380 katanin p60 subunit A-like 1 KATNB 1 NM 005886 katanin p80 subunit B 1 KBTBD2 NM_015483 kelch repeat and BTB (POZ) domain containing 2 KBTBD4 NM016506 kelch repeat and BTB (POZ) domain containing 4 KBTBD5 NM152393 kelch repeat and BTB (POZ) domain containing 5 KCNA3 NM002232 potassium voltage-gated channel, shaker-related KCNAB 1 NM_003471 potassium voltage-gated channel, shaker-related KCNAB2 NM_003636 potassium voltage-gated channel, shaker-related KCNC2 NM 139136 Shaw-related voltage-gated potassium channel KCND3 NM 004980 potassium voltage-gated channel, Shal-related KCNEIL NMy012282 potassium voltage-gated channel, Isk-related KCNG3 NM 133329 potassium voltage-gated channel, subfamily G, KCNG4 NM133490 potassium voltage-gated channel, subfamily G, KCNH4 NM 012285 potassium voltage-gated channel, subfamily H, KCNIPI NMr014592 Kv channel interacting protein I isoform 2 KCNIP3 NM 013434 Kv channel interacting protein 3 isoform I
KCNJ11 NM 000525 potassium inwardly-rectifying channel J11 KCN316 NM018658 potassium inwardly-rectifying channel J16 KCNJ2 NM000891 potassium inwardly-rectifying channel J2 KCNJ9 NM004983 potassium inwardly-rectifying channel subfamily KCNKI NM 002245 potassium channel, subfamily K, member I
KCNK2 NM 001017424 potassium channel, subfamily K, member 2 isoform KCNK7 NM005714 potassium channel, subfamily K, member 7 isoform KCNMAI NM001014797 large conductance calcium-activated potassium KCNN4 NM002250 intermediate conductance calcium-activated KCNQI NM 000218 potassium voltage-gated channel, KQT-like KCNQ2 NM004518 potassium voltage-gated channel KQT-like protein KCNQ5 NM019842 potassium voltage-gated channel, KQT-like KCNRG NM173605 potassium channel regulator isoform I
KCNSI NM 002251 potassium voltage-gated channel KCNTI NM 020822 potassium channel, subfamily T, member I
KCNT2 NM198503 potassium channel, subfamily T, member 2 KCTD1 NM~198991 potassium channel tetramerisation domain KCTD12 NM 138444 potassium channel tetramerisation domain KCTD15 NM024076 potassium channel tetramerisation domain KCTD2 NM_015353 potassium channel tetramerisation domain KCTD3 NM016121 potassium channel tetramerisation domain KCTD5 NM 018992 potassium channel tetramerisation domain KCTD7 NM+153033 potassium channel tetramerisation domain KCTD8 NM198353 potassium channel tetramerisation domain KGFLPI NM174950 hypothetical protein LOC387628 KIAA0125 NM014792 hypothetical protein LOC9834 KIAA0143 NM 015137 hypothetical protein LOC23167 KIAA0152 NM014730 hypothetical protein LOC9761 KIAA0174 NM 014761 putative MAPK activating protein PM28 KIAA0179 NM015056 hypothetical protein LOC23076 KIAA0182 NM014615 hypothetical protein LOC23199 KLAA0232 NM 014743 hypothetical protein LOC9778 KIAA0240 NM015349 hypothetical protein LOC23506 KIAA0241 NM 015060 hypothetical protein LOC23080 KIAA0247 NM014734 hypothetical protein LOC9766 KIAA0251 NM_015027 hypothetical protein LOC23042 KIAA0265 NM_014997 hypothetical protein LOC23008 KIAA0284 NM_015005 hypothetical protein LOC283638 KIAA0286 NM 015257 hypothetical protein LOC23306 KIAA0319L NM_024874 polycystic kidney disease 1-like isoform a KIAA0323 NM_015299 hypothetical protein LOC23351 KIAA0329 NM_014844 hypothetical protein LOC9895 KIAA0350 NM015226 hypothetical protein LOC23274 KIAA0355 NM_014686 hypothetical protein LOC9710 KIAA0376 NM 015330 cytospin A
'K.IAA0423 NM_015091 hypothetical protein LOC23116 KIAA0427 NM_014772 hypothetical protein LOC9811 KIAA0446 NM_014655 hypothetical protein LOC9673 KIAA0494 NM 014774 hypothetical protein LOC9813 KIAA0495 NM207306 K1[AA0495 KIAA0513 NM 014732 hypothetical protein LOC9764 KIAA0523 NM`_015253 hypothetical protein LOC23302 KIAA0553 NM 001002909 hypothetical protein LOC23131 KIAA0556 NM 015202 hypothetical protein LOC23247 KIAA0562 NM 014704 glycine-, glutamate-, KIAA0564 NM 001009814 hypothetical protein LOC23078 isoform b KIAA0649 NM014811 1A6/DRIM (down-regulated in metastasis) KIAA0652 NM_014741 hypothetical protein LOC9776 KIAA0664 NM 015229 hypothetical protein LOC23277 KIAA0672 NM014859 hypothetical protein,LOC9912 KIAA0676 NM015043 hypothetical protein LOC23061 isoform b KIAA0683 NM 016111 hypothetical protein LOC9894 KIAA0746 NM^015187 hypothetical protein LOC23231 KIAA0773 NM_014690 hypothetical protein LOC9715 KIAA0789 NM 014653 hypothetical protein LOC9671 KIAA0804 NM001009921 hypothetical protein LOC23355 isoform a KIAA0828 NM_015328 KIAA0828 protein KIAA0831 NM_014924 hypothetical protein LOC22863 KIAA0859 NM_001007239 CGI-01 protein isoform 3 KIAA0863 NM_014913 hypothetical protein LOC22850 KIAA0895 NM_015314 hypothetical protein LOC23366 KIAA1161 NM_020702 hypothetical protein LOC57462 KIAA1166 NM_018684 hepatocellular carcinoma-associated antigen 127 KIAA1267 NM015443 hypothetical protein LOC284058 KIAA 1303 NM_020761 raptor KIAA1333 NM 017769 hypothetical protein LOC55632 KIAA1411 NM_020819 hypothetical protein LOC57579 KIAA1434 NM_019593 hypothetical protein LOC56261 KIAAl456 NM_020844 hypothetical protein LOC57604 KIAA1522 NM020888 hypothetical protein LOC57648 KIAA1530 NM_020894 hypothetical protein LOC57654 KIAA1542 NM_020901 CTD-binding SR-like protein rA9 KIAA1559 NM_020917 zinc finger protein 14-like KIAA1576 NM_020927 hypothetical protein LOC57687 KIAA1600 NM 020940 hypothetical protein LOC57700 KIAA1609 NM020947 hypothetical protein LOC57707 KIAA1618 NM020954 hypothetical protein LOC57714 KIAA1688 NM_025251 KIAA1688 protein KIAA1715 NM 030650 Lunapark WO 20081073923 PCT/i3S2007/087038 KIAA1727 NM033393 hypothetical protein LOC85462 KIAA1729 NM053042 hypothetical protein LOC85460 KIAA1737 NM 033426 KIAA1737 protein KIAA1772 NM 024935 hypothetical protein LOC80000 KIAA1804 NM 032435 mixed lineage kinase 4 KIAA1815 NM^024896 hypothetical protein LOC79956 KIAA1853 NM194286 KIAA1853 rotein KIAA1862 NM_032534 KIAA1862 protein KIAA1875 NM 032529 KIAA1875 protein KIAA1909 NM052909 hypothetical protein LOC153478 KIAA1920 NM052919 hypothetical protein LOCI 14817 KIAA1924 NM 145294 hypothetical protein LOC197335 KIAA1961 NM 001008738 hypothetical protein LOC96459 isoform 2 KIAA2022 NM_001008537 hypothetical protein LOC340533 KIF12 NM_138424 kinesin family member 12 KIF13B NM_015254 kinesin family member 13B
KIFIA NM 004321 axonal transport of synaptic vesicles KIFIB NM015074 kinesin family member 1B isoform b KIF1C NM_006612 kinesin family member IC
KIF2 NM004520 kinesin heavy chain member 2 KIF21A NM_017641 kinesin family member 21A
KIF23 NM_004856 kinesin family member 23 isoform 2 KIF2C NM_006845 kinesin family member 2C
KIF3B NM_004798 kinesin family member 3B
KIF5A NM_004984 kinesin family member 5A
KIF5B NM_004521 kinesin family member 5B
KIF6 NM_145027 kinesin family member 6 KIFC3 NM_005550 kinesin family member C3 KIR2DS4 NM_012314 killer cell immunoglobulin-like receptor, two KITLG NM_000899 KIT ligand isoform b precursor KL NM_004795 klotho isoform a KLC2 NM022822 likely ortholog of kinesin light chain 2 KLC4 NM_201521 kinesin-like 8 isoform a KLF12 NM_016285 Kruppel-like factor 12 isoform b KLF13 NM015995 Kruppel-like factor 13 KLHDC6 NM207335 hypothetical protein LOC166348 KLHDC8B NM_173546 hypothetical protein LOC200942 KLHL18 NM_025010 kelch-like 18 KLHL2 NM_007246 kelch-like 2, Mayven KLHL21 NM_014851 kelch-like 21 KLHL26 NM_018316 hypothetical protein LOC55295 KLHL3 NM_017415 kelch-like 3 (Drosophila) KLHL4 NM019117 kelch-like 4 isoform I
KLK2 NM_001002231 kallikrein 2, prostatic isoform 2 KLKBI NM_000892 plasma kallikrein BI precursor KNDCI NM 152643 kinase non-catalytic C-lobe domain (KIND) KNS2 NM005552 kinesin 2 60/7OkDa isoform 1 KPNA3 NM002267 karyopherin alpha 3 KPNA4 NM_002268 karyopherin alpha 4 KRAS NM_004985 c-K-ras2 protein isoform b KRTIB NM_175078 keratin IB
KRT20 NM019010 keratin 20 KRT2B NM 015848 cytokeratin 2 KRTAPIO-1 NM198691 keratin associated protein 10-1 KRTAPI0-12 NM_198699 keratin associated protein 10-12 KRTAPIO-8 NM_198695 keratin associated protein 10-8 KRTAPI1-1 NM175858 keratin associated protein 11-1 KRTAP26-1 NM_203405 hypothetical protein LOC388818 KRTAP4-4 NM_032524 keratin associated protein 4.4 KRTAP9-2 NM_031961 keratin associated protein 9.2 KRTAP9-3 NM031962 keratin associated protein 9.3 KRTAP9-4 NM_033191 keratin associated protein 9-4 KRTHA3B NM002279 type I hair keratin 3B
KRTHB4 NM_033045 keratin, hair, basic, 4 KSRI NM_014238 kinase suppressor of ras Kua-UEV NM_003349 ubiquitin-conjugating enzyme E2 Kua-UEV isoform KU-MEL-3 NM_001011540 KU-MEL-3 protein LAMCI NM002293 laminin, gamma I precursor LAMPI NM 005561 lysosomal-associated membrane protein I
LAMP2 NM013995 lysosomal-associated membrane protein 2 LAMP3 NM014398 lysosomal-associated membrane protein 3 LANCLI NM_006055 lanthionine synthetase C-like protein 1 LANCL2 NM_018697 LanC lantibiotic synthetase component C-like 2 LARP2 NM032239 La ribonucleoprotein domain family member 2 LASPI NM_006148 LIM and SH3 protein I
LASS1 NM_021267 longevity assurance gene 1 isoform 1 LASS3 NM_178842 hypothetical protein LOC204219 LASS6 NM_203463 longevity assurance homolog 6 LAT NM001014987 linker for activation of T cells isoform b LATS1 NM_004690 LATS homolog I
LATS2 NM014572 LATS, large tumor suppressor, homolog 2 LCE1E NM_178353 late cornified envelope 1E
LCN2 NM 005564 lipocalin 2 (oncogene 24p3) LCPI NM_002298 L-plastin LDB3 NM_007078 LIM domain binding 3 LDLRAD2 NM_001013693 hypothetical protein LOC401944 LDLRAPI NM 015627 low density lipoprotein receptor adaptor protein LDOC1 NM_012317 leucine zipper, down-regulated in cancer I
LDOCIL NM_032287 hypothetical protein LOC84247 LEMD1 NM_001001552 LEM domain containing 1 LENG12 NM_033206 hypothetical protein LOC90011 LEP NM_000230 leptin precursor LETMI NM012318 leucine zipper-EF-hand containing transmembrane LGALS8 NM_006499 galectin 8 isoform a LG12 NM_018176 leucine-rich repeat LGI family, member 2 LGI4 NM_139284 leucine-rich repeat LGI family, member 4 LGR6 NM001017403 leucine-rich repeat-containing G protein-coupled LHFPL5 NM_182548 lipoma HMGIC fusion partner-like 5 LHPP NM022126 phospholysine phosphohistidine inorganic LHX3 NM_014564 LIM homeobox protein 3 isoform b LIF NM_002309 leukemia inhibitory factor (cholinergic LIMD1 NM_014240 LIM domains containing I
LIMS3 NM_033514 LIM and senescent cell antigen-like domains 3 LIN28 NM_024674 lin-28 homolog LIN28B NM_001004317 lin-28 homolog B
LIPE NM 005357 hormone-sensitive lipase LIPG NM_006033 endothelial lipase precursor LIPH NM_139248 lipase, member H precursor LITAF NM004862 LPS-induced TNF-alpha factor LKAP NM014647 limkain bl LMAN2L NM030805 lectin, mannose-binding 2-like LMNA NM_170707 lamin A/C isoform 1 precursor LMO7 NM_005358 LIM domain only 7 LMOD1 NM012134 leiomodin 1(smooth muscle) LNX1 NM_032622 multi-PDZ-domain-containing protein LNX2 NM_153371 PDZ domain containing ring finger I
LOC112714 NM_207312 hypothetical protein LOC112714 LOC115648 NM_145326 hypothetical protein LOC115648 LOC116143 NM_138458 monad LOC133308 NM_178833 hypothetical protein LOC133308 LOC144233 NM_181708 hypothetical protein LOC144233 LOC144363 NM_001001660 hypothetical protein LOC144363 LOC144983 NM001011724 heterogeneous nuclear ribonucleoprotein AI-like LOC147650 NM 207324 hypothetical protein LOC147650 LOC147804 NM_001010856 hypothetical protein LOC147804 LOC150383 NM_001008917 hypothetical protein LOC150383 isoform 2 LOC151194 NM_145280 hypothetical protein LOC151194 LOC153222 NM_153607 hypothetical protein LOC153222 LOC155060 NM 001004302 hypothetical protein LOC155060 LOC158381 NM_001029857 hypothetical protein LOC158381 LOC159090 NM_145284 hypothetical protein LOC159090 LOC161931 NM_139174 hypothetical protein LOC161931 LOC162427 NM_178126 hypothetical protein LOC162427 LOC165186 NM_I99280 hypothetical protein LOC165186 LOC 196463 NM_173542 hypothetical protein LOC196463 LOC197322 NM_174917 hypothetical protein LOC197322 LOC201164 NM_178836 hypothetical protein LOC201164 LOC203427 NM145305 mitochondrial solute carrier protein LOC203547 NM 001017980 hypothetical protein LOC203547 LOC220594 NMv_145809 TL132 protein LOC221442 NM_001010871 hypothetical protein LOC221442 LOC255374 NM_203397 hypothetical protein LOC255374 LOC283487 NM_178514 hypothetical protein LOC283487 LOC283537 NM_181785 hypothetical protein LOC283537 LOC283849 NM_178516 hypothetical protein LOC283849 LOC284434 NM_001007525 hypothetical protein LOC284434 LOC284757 NM001004305 hypothetical protein LOC284757 LOC284861 NM_201565 hypothetical protein LOC284861 LOC285074 NM_001012626 hypothetical protein LOC285074 LOC285382 NM_001025266 hypothetical protein LOC285382 LOC285498 NM_194439 hypothetical protein LOC285498 LOC285636 NM_175921 hypothetical protein LOC285636 LOC286526 NM 001031834 Ras-like GTPase-like LOC317671 NM173362 hypothetical protein LOC317671 LOC339768 NM_194312 hypothetical protein LOC339768 LOC340156 NM_001012418 hypothetical protein LOC340156 LOC340529 NM001012977 hypothetical protein LOC340529 LOC348174 NM182619 secretory protein LOC348174 LOC348262 NM 207368 hypothetical protein LOC348262 LOC348840 NM_182631 hypothetical protein LOC348840 LOC352909 NM 00 1 03 1 802 hypothetical protein LOC352909 isoform 2 LOC387646 NMy_001006604 hypothetical protein LOC387646 LOC387720 NM_001013633 hypothetical protein LOC387720 LOC387758 NM203371 hypothetical protein LOC387758 LOC387856 NM001013635 hypothetical protein LOC387856 LOC388886 NM_207644 hypothetical protein LOC388886 LOC389541 NM_001008395 hypothetical protein LOC389541 LOC390980 NM_001023563 similar to Zinc finger protein 264 LOC391356 NM_001013663 hypothetical protein LOC391356 LOC399706 NM_001010910 hypothetical protein LOC399706 LOC399900 NM 001013667 hypothetical protein LOC399900 LOC400120 NM_203451 hypothetical protein LOC400120 LOC400145 NM_001013669 hypothetical protein LOC400145 LOC400258 NM_001008404 hypothetical protein I.OC400258 LOC400451 NM_207446 hypothetical protein LOC400451 LOC400464 NM_001013670 hypothetical protein LOC400464 LOC400696 NM_207646 hypothetical protein LOC400696 LOC400707 NM_001013673 hypothetical protein LOC400707 LOC400891 NM_001013675 hypothetical protein LOC400891 LOC400924 NM_001013676 hypothetical protein LOC400924 LOC400965 NM_001013677 hypothetical protein LOC400965 LOC401152 NM_001001701 hypothetical protein LOC401152 LOC401233 NM 001013680 hypothetical protein LOC401233 LOC401252 NM_001013681 hypothetical protein LOC401252 LOC401286 NM_001023565 hypothetical protein LOC401286 LOC401431 NM 001008745 hypothetical protein LOC401431 LOC401498 NM_212558 hypothetical protein LOC401498 LOC401589 NM 001013687 hypothetical protein LOC401589 LOC401720 NM_001013690 hypothetical protein LOC401720 LOC402055 NM001013694 hypothetical protein LOC402055 LOC405753 NM_207581 Numb-interacting protein LOC440157 NM_001013701 hypothetical protein LOC440157 LOC440248 NM_199045 hypothetical protein LOC440248 LOC440742 NM_001013710 hypothetical protein LOC440742 LOC440944 NM_001013713 hypothetical protein LOC440944 LOC441046 NM 001011539 hypothetical protein LOC441046 LOC441087 NM 001013716 hypothetical protein LOC441087 LOC441120 NM_001013718 hypothetical protein LOC441120 LOC441177 NM_001013720 hypothetical protein LOC441177 LOC441193 NM_001013722 hypothetical protein LOC441193 LOC441208 NM 001013723 hypothetical protein LOC441208 LOC441257 NM 001023562 hypothetical protein LOC441257 LOC441426 NM_001013727 hypothetical protein LOC441426 LOC442582 NM_001025202 STAG3-like LOC493856 NM 001008388 hypothetical protein LOC493856 LOC497190 NM 001011880 hypothetical protein LOC497190 LOC51057 NM015910 hypothetical protein LOC51057 LOC541469 NM_001013617 hypothetical protein LOC541469 LOC55565 NM_017530 hypothetical protein LOC55565 LOC56964 NM 020212 hypothetical protein LOC56964 LOC619208 NM_001033564 hypothetical protein LOC619208 LOC89944 NM 138342 hypothetical protein LOC89944 LOC90321 NM 001010851 hypothetical protein LOC90321 LOC90639 NM_001031617 hypothetical protein LOC90639 LOC90693 NM_138771 hypothetical protein LOC90693 LOC91461 NM_138370 hypothetical protein LOC91461 LOC91689 NM_033318 hypothetical protein LOC91689 LOC93349 NM_138402 hypothetical protein LOC93349 LOC93622 NM_138699 hypothetical protein LOC93622 LOXL2 NM_002318 lysyl oxidase-like 2 precursor LPHNI NM001008701 latrophilin 1 isoform 1 precursor LPHN2 NM 012302 latrophilin 2 precursor LPIN2 NM_014646 lipin 2 LPIN3 NM_022896 lipin 3 LPP NM_005578 LIM domain containing preferred translocation LPPR2 NM_022737 lipid phosphate phosphatase-related protein type LRCH1 NM_015116 leucine-rich repeats and calponin homology (CH) LRCH4 NM_002319 leucine-rich repeats and calponin homology (CH) LRIG1 NM_015541 leucine-rich repeats and immunoglobulin-like LRIG2 NM_014813 leucine-rich repeats and immunoglobulin-like LRP10 NM_014045 low density lipoprotein receptor-related protein LRP12 NM_013437 suppression of tumorigenicity LRP1B NM_018557 low density lipoprotein-related protein 1B
LRP6 NM002336 low density lipoprotein receptor-related protein LRP8 NM 001018054 low density lipoprotein receptor-related protein LRPPRC NM_133259 leucine-rich PPR motif-containing protein LRRCI NM_018214 leucine rich repeat containing 1 LRRC14 NM_014665 leucine rich repeat containing 14 LRRC15 NM_130830 leucine rich repeat containing 15 LRRC21 NM_015613 retina specific protein PAL
LRRC22 NM_001017924 leucine rich repeat containing 22 LRRC25 NM_145256 leucine rich repeat containing 25 LRRC27 NM_030626 leucine rich repeat containing 27 LRRC3 NM_030891 leucine-rich repeat-containing 3 precursor LRRC32 NM_005512 leucine rich repeat containing 32 precursor LRRC47 NM020710 leucine rich repeat containing 47 LRRC55 NM_001005210 hypothetical protein LOC219527 LRRC57 NM153260 hypothetical protein LOC255252 LRRC61 NM_023942 hypothetical protein LOC65999 LRRC8A NM_019594 leucine-rich repeat-containing 8 LRRFIP2 NM_017724 leucine rich repeat (in FLII) interacting LRRK1 NM_024652 leucine-rich repeat kinase 1 LRRN3 NM_018334 leucine rich repeat neuronal 3 LRRN6A NM_032808 leucine-rich repeat neuronal 6A
LRRTM2 NM015564 leucine rich repeat transmembrane neuronal 2 LRSAMI NM_001005373 leucine rich repeat and sterile alpha motif LSMI I NM 173491 LSM11, U7 small nuclear RNA associated LSM16 NM025083 LSM16 homolog (EDC3, S. cerevisiae) LSM4 NM012321 U6 snRNA-associated Sm-like protein 4 LSM7 NM_016199 U6 snRNA-associated Sm-like protein LSm7 LSPI NM_001013253 lymphocyte-specific protein 1 isoform 2 LSS NM_002340 lanosterol synthase LTB NM_009588 lymphotoxin-beta isoform b LTBP1 NM000627 latent transforming growth factor beta binding LTC4S NM 000897 leukotriene C4 synthase isoform 2 LUZP1 NM_033631 leucine zipper protein I
LY6E NM_002346 lymphocyte antigen 6 complex, locus E
LY6G5C NM_001002848 lymphocyte antigen 6 complex G5C isoform C
LY6K NM_017527 lymphocyte antigen 6 complex, locus K
LY86 NM004271 MD-l, RP105-associated LY9 NM_001033667 lymphocyte antigen 9 isoform b LYCAT NM_001002257 lysocardiolipin acyltransferase isoform 2 LYK5 NM 001003786 protein kinase LYK5 isoform 2 LYPD5 NM001031749 LY6/PLAUR domain containing 5 LYPLA2 NM_007260 lysophospholipase II
LYPLA3 NM012320 lysophospholipase 3 (lysosomal phospholipase LYSMD4 NM_152449 hypothetical protein LOC145748 LYST NM000081 lysosomal trafficking regulator isoform 1 LYZL4 NM_144634 lysozyme-like 4 LZTFLI NM_020347 leucine zipper transcription factor-like 1 LZTRI NM_006767 leucine-zipper-like transcription regulator, 1 LZTSI NM_021020 leucine zipper, putative tumor suppressor 1 LZTS2 NM_032429 leucine zipper, putative tumor suppressor 2 M6PR NM 002355 cation-dependent mannose-6-phosphate receptor MACF1 NM012090 microfilament and actin filament cross-linker MADD NM003682 MAP-kinase activating death domain-containing MAF NM_00 1 03 1 804 v-maf musculoaponeurotic fibrosarcoma oncogene MAFB NM_005461 transcription factor MAFB
MAFG NM002359 v-maf musculoaponeurotic fibrosarcoma oncogene MAG NM080600 myelin associated glycoprotein isoform b MAGEB4 NM_002367 melanoma antigen family B, 4 MAK NM_005906 male germ cell-associated kinase MAMDC2 NM 153267 MAM domain containing 2 MAN2A2 NM~006122 mannosidase, alpha, class 2A, member 2 MANBAL NM_001003897 mannosidase, beta A, lysosomal-like MAP1A NM002373 microtubule-associated protein IA
MAP2K1 NM_002755 mitogen-activated protein kinase kinase 1 MAP2K1IP1 NM_021970 mitogen-activated protein kinase kinase 1 MAP2K2 NM_030662 mitogen-activated protein kinase kinase 2 MAP2K3 NM_002756 mitogen-activated protein kinase kinase 3 MAP2K4 NM_003010 mitogen-activated protein kinase kinase 4 MAP2K7 NM 145185 mitogen-activated protein kinase kinase 7 MAP3K14 NM`003954 mitogen-activated protein kinase kinase kinase MAP3K3 NM_002401 mitogen-activated protein kinase kinase kinase 3 MAP3K4 NM_005922 mitogen-activated protein kinase kinase kinase 4 MAP3K7 NM_003188 mitogen-activated protein kinase kinase kinase 7 MAP3K9 NM_033141 mitogen-activated protein kinase kinase kinase MAP4 NM_002375 microtubule-associated protein 4 isoform I
MAP6 NM207577 microtubule-associated protein 6 isoform 2 MAP7 NM_003980 microtubule-associated protein 7 MAPKI NM_002745 mitogen-activated protein kinase 1 MAPK14 NM_001315 mitogen-activated protein kinase 14 isoform 1 MAPK3 NM_002746 mitogen-activated protein kinase 3 isoform 1 MAPK8 NM002750 mitogen-activated protein kinase 8 isoform 2 MAPK8IP1 NM005456 mitogen-activated protein kinase 8 interacting MAPK8IP2 NM_012324 mitogen-activated protein kinase 8 interacting MAPK8IP3 NM015133 mitogen-activated protein kinase 8 interacting MAPK9 NM 002752 mitogen-activated protein kinase 9 isoform I

MAPKAPI NM001006617 mitogen-activated protein kinase associated MAPKAPK2 NM_004759 mitogen-activated protein kinase-activated MAPKBPI NM014994 mitogen-activated protein kinase binding protein MAPREI NM012325 microtubule-associated protein, RP/EB family, MAPRE3 NM012326 microtubule-associated protein, RP/EB family, MARCH4 NM_020814 membrane-associated ring finger (C3HC4) 4 MARCH5 NM_017824 ring finger protein 153 MARCH9 NM138396 membrane-associated RING-CH protein IX
MARK4 NM031417 MAP/microtubule affinity-regulating kinase 4 MASP1 NM_001031849 mannan-binding lectin serine protease 1 isoform MATIA NM000429 methionine adenosyltransferase I, alpha MBDI NM_002384 methyl-CpG binding domain protein 1 isoform 4 MBD3 NM_003926 methyl-CpG binding domain protein 3 MBD6 NM_052897 methyl-CpG binding domain protein 6 MBNL2 NM144778 muscleblind-like 2 isoform I
MBP NM_001025100 Golli-mbp isoform 2 MCARTI NM033412 mitochondrial carrier triple repeat I
MCART6 NM001012755 hypothetical protein LOC401612 MCFD2 NM_139279 multiple coagulation factor deficiency 2 MCM2 NM_004526 minichromosome maintenance protein 2 MDGAI NM_153487 MAM domain containing MECP2 NM_004992 methyl CpG binding protein 2 MECR NM001024732 nuclear receptor-binding factor I isoform b MEDI 1 NM 001001683 hypothetical protein LOC400569 MED9 NM018019 mediator of RNA polymerase II transcription, MEFV NM_000243 Mediterranean fever protein MEOXI NM_004527 mesenchyme homeobox I isoform 1 MEOX2 NM_005924 mesenchyme homeobox 2 MESDC2 NM_015154 mesoderm development candidate 2 METTL4 NM_022840 methyltransferase like 4 MFAP5 NM003480 microfibrillar associated protein 5 MFN2 NM014874 mitofusin 2 MFSD2 NM032793 major facilitator superfamily domain containing MGAT5 NM002410 alpha- 1,3 (6)-mannosylglycoprotein MGC10911 NM_032302 hypothetical protein LOC84262 MGC11102 NM_032325 hypothetical protein LOC84285 MGC14289 NM_080660 hypothetical protein LOC92092 MGC16385 NM_145039 hypothetical protein LOC92806 MGC17330 NM_052880 HGFL protein MGC20470 NM_145053 hypothetical protein LOC143630 MGC21675 NM_052861 hypothetical protein LOC92070 MGC21830 NM_182563 hypothetical protein LOC283870 MGC24381 NM_001001410 hypothetical protein LOC115939 MGC26694 NM_178526 hypothetical protein LOC284439 MGC26718 NM 001029999 hypothetical protein LOC440482 MGC26885 NM_152339 hypothetical protein LOC124044 MGC29671 NM_182538 hypothetical protein LOC201305 MGC3123 NM_024107 hypothetical protein LOC79089 isoform 1 MGC3265 NM_024028 hypothetical protein LOC78991 MGC33214 NM_153354 hypothetical protein LOC153396 MGC33556 NM001004307 hypothetical protein LOC339541 MGC34761 NM_173619 hypothetical protein LOC283971 MGC35308 NM 175922 hypothetical protein MGC35308 MGC35361 NM_147194 hypothetical protein LOC222234 MGC3731 NM_024313 hypothetical protein LOC79159 MGC40405 NM 152789 hypothetical protein LOC257415 isoform 1 MGC4093 NM030578 hypothetical protein LOC80776 MGC42105 NM_153361 hypothetical protein LOC167359 MGC4268 NM031445 hypothetical protein LOC83607 MGC52000 NM 198943 CXYorfl-related protein MGC5242 NM_024033 hypothetical protein LOC78996 MGC57359 NM 001004351 hypothetical protein LOC441272 MGC87631 NM_001004306 hypothetical protein LOC339184 MGC9712 NM_152689 hypothetical protein LOC202915 MGC9850 NM 152705 hypothetical protein MGC9850 MGC99813 NM_001005209 hypothetical protein LOC130612 MGRN1 NM_015246 mahogunin, ring finger I
MIBI NM020774 mindbomb homolog 1 MICB NM005931 MHC class I polypeptide-related sequence B
MIDI NM000381 midline 1 isoform alpha MIER2 NM_017550 hypothetical protein LOC54531 MINKI NM 001024937 misshapenlNIK-related kinase isoform 4 MIOX NM~017584 myo-inositol oxygenase MKL2 NM014048 megakaryoblastic leukemia 2 protein MKNKI NM_003684 MAP kinase interacting serine/threonine kinase I
MKX NM173576 hypothetical protein LOC283078 MLCI NM 015166 megalencephalic leukoencephalopathy with MLCK NM 182493 MLCK protein MLRI NM_153686 transcription factor MLR1 MLXIPL NM 032951 Williams Beuren syndrome chromosome region 14 MLYCD NM_012213 malonyl-CoA decarboxylase MMAB NM 052845 cob(I)alamin adenosyltransferase MMACHC NM 015506 hypothetical protein LOC25974 MMD NM012329 monocyte to macrophage MMD2 NM198403 monocyte-to-macrophage differentiation factor 2 MME NM_000902 membrane metallo-endopeptidase MMP14 NM004995 matrix metalloproteinase 14 preproprotein MMP15 NM_002428 matrix metalloproteinase 15 preproprotein MMP19 NM 001032360 matrix metalloproteinase 19 isoform 2 precursor MMP24 NM006690 matrix metalloproteinase 24 preproprotein MMP3 NM 002422 matrix metalloproteinase 3 preproprotein MMS19L NM~022362 MMS19-like (MET18 homolog, S. cerevisiae) MNI NM_002430 meningioma 1 MNT NM_020310 MAX binding protein MOBKL2A NM_130807 MOB-LAK
MOBKL2B NM_024761 MOB1, Mps One Binder kinase activator-like 2B
MOCS1 NM_O0S942 molybdenum cofactor synthesis-step 1 protein MONIB NM_014940 MON1 homolog B
MORF4LI NM_006791 MORF-related gene 15 isoform 1 MOSC1 NM 022746 MOCO sulphurase C-terminal domain containing I
MOV10 NM_020963 Mov10, Moloney leukemia virus 10, homolog MOV10L1 NM_018995 MOVIO-like I
MPDUI NM_004870 mannose-P-dolichol utilization defect 1 MPL NM_005373 myeloproliferative leukemia virus oncogene MPP2 NM005374 palmitoylated membrane protein 2 MPPEDI NM 001585 hypothetical protein LOC758 MPZLI NM_003953 myelin protein zero-like I isoform a MRAS NM_012219 muscle RAS oncogene homolog MRPLI I NM_170739 mitochondrial ribosomal protein Ll l isoforrn c MRPL12 NM_002949 mitochondrial ribosomal protein L12 MRPL14 NM 032111 mitochondrial ribosomal protein L14 MRPL35 NM016622 mitochondrial ribosomal protein L35 isoform a MRPL37 NM_016491 mitochondrial ribosomal protein L37 MRPL4 NM_146388 mitochondrial ribosomal protein L4 isoform b MRPL40 NM_003776 mitochondrial ribosomal protein L40 MRPL45 NM_032351 mitochondrial ribosomal protein L45 MRPSIBA NM_018135 mitochondrial ribosomal protein S18A
MRPS2 NM_016034 mitochondrial ribosomal protein S2 MRPS25 NM_022497 mitochondrial ribosomal protein S25 MRRF NM138777 mitochondrial ribosome recycling factor isoform MS4A10 NM_206893 membrane-spanning 4-domains, subfamily A, member MS4A2 NM_000139 membrane-spanning 4-domains, subfamily A, member MS4A7 NM_02120I membrane-spanning 4-domains, subfamily A, member MSHS NM_002441 mutS homolog 5 isoform c MSRB2 NM_012228 methionine sulfoxide reductase B2 MST150 NM_032947 putative small membrane protein NID67 MTAP NM_002451 5'-methylthioadenosine phosphorylase MTCPI NM_001018024 mature T-cell proliferation 1 isoform p8 MTGI NM_138384 GTP binding protein MTHFR NM_005957 5, 1 0-methylenetetrahydrofolate reductase MTMI NM_000252 myotubularin MTMR11 NM_181873 myotubularin related protein 11 MTMR3 NM_021090 myotubularin-related protein 3 isoform c MTMR4 NM004687 myotubularin related protein 4 MTMR8 NM_017677 myotubularin related protein 8 MTMR9 NM_015458 myotubularin-related protein 9 MTNRIB NM 005959 melatonin receptor IB
MTPN NM_145808 myotrophin MTRR NM_002454 methionine synthase reductase isoform 1 MTSS1 NM_014751 metastasis suppressor 1 MUC1 NM_001018021 MUCI mucin isoform 4 precursor MUCDHL NM_031265 mu-protocadherin isoform 4 MULK NM_018238 multiple substrate lipid kinase MUM1 NM_032853 melanoma ubiquitous mutated protein MXD3 NM_031300 MAX dimerization protein 3 MXD4 NM_006454 MAD4 MYADM NM_001020818 myeloid-associated differentiation marker MYB NM_005375 v-myb myeloblastosis viral oncogene homolog MYBPCI NM_002465 myosin binding protein C, slow type isoform 1 MYCLI NM_001033081 1-myc-1 proto-oncogene isoform I
MYD88 NM_002468 myeloid differentiation primary response gene MYEF2 NM_016132 myelin gene expression factor 2 MYH14 NM_024729 myosin, heavy polypeptide 14 MYL1 NM_079420 fast skeletal myosin alkali light chain I
MYLK NM_005965 myosin light chain kinase isoform 6 MYO18A NM_078471 myosin 18A isoform a MYO1D NM_015194 myosin ID
MYOIE NM_004998 myosin IE
MYO5C NM 018728 myosin VC

MYO9B NM_004145 myosin IXB
MYOHDI NM_001033579 myosin head domain containing 1 isoform 2 MYOM3 NM_152372 myomesin family, member 3 MYOZ3 NM_133371 myozenin 3 MYRIP NM_015460 myosin VIIA and Rab interacting protein MYT1L NM 015025 myelin transcription factor 1-like N4BP1 NM_153029 Nedd4 binding protein I
N4BP3 NM_015111 Nedd4 binding protein 3 NAALADL2 NM207015 N-acetylated alpha-linked acidic dipeptidase 2 NAG8 NM_014411 nasopharyngeal carcinoma associated gene NANOG NM_024865 Nanog homeobox NANOSI NM_001009553 nanos homolog 1 isoform 2 NAPIL4 NM_005969 nucleosome assembly protein 1-like 4 NAPA NM_003827 N-ethylmaleimide-sensitive factor attachment NAPE-PLD NM_198990 N-acyl-phosphatidylethanolamine-hydrolyzing NARF NM_012336 nuclear prelamin A recognition factor isoform a NARFL NM 022493 nuclear prelamin A recognition factor-like NARG1 NM_057175 NMDA receptor regulated 1 NARS NM004539 asparaginyl-tRNA synthetase NAT10 NM_024662 N-acetyltransferase-like protein NAT11 NM_024771 hypothetical protein LOC79829 NAV I NM_020443 neuron navigator I
NBEA NM015678 neurobeachin NBRI NM_005899 neighbor of BRCAI gene I
NCAMI NM_181351 neural cell adhesion molecule 1 isoform 2 NCF4 NM_013416 neutrophil cytosolic factor 4(40kD) isoform 2 NCKIPSD NM_016453 NCK interacting protein with SH3 domain isoform NCOA4 NM_005437 nuctear receptor coactivator 4 NCOR2 NM 006312 nuclear receptor co-repressor 2 NDNL2 NMu_138704 necdin-like 2 NDOR1 NM_014434 NADPH dependent diflavin oxidoreductase 1 NDP NM_000266 norrin NDRG2 NM_016250 N-myc downstream-regulated gene 2 isoform b NDRG4 NM_020465 NDRG family member 4 NDSTI NM_001543 N-deacetylase/N-sulfotransferase (heparan NDUFA4L2 NM_020142 NADH:ubiquinone oxidoreductase MLRQ subunit NEBL NM_006393 nebulette sarcomeric isoform NECAPI NM_015509 adaptin-ear-binding coat-associated protein 1 NEDD9 NM_182966 neural precursor cell expressed, developmentally NEK10 NM_001031741 NIMA (never in mitosis gene a)- related kinase NEK6 NM_014397 putative serine-threonine protein kinase NEK8 NM_178170 NIMA-related kinase 8 NELF NM_015537 nasal embryonic LHRH factor NEU4 NM080741 sialidase 4 NEURL NM004210 neuralized-like NEUROG3 NM_020999 neurogenin 3 NF2 NM000268 neurofibromin 2 isoform 1 NFASC NM_015090 neurofascin precursor NFAT5 NM 006599 nuclear factor of activated T-cells 5 isoform c NFATC3 NM_004555 cytoplasmic nuclear factor of activated T-cells NFATC4 NM_004554 cytoplasmic nuclear factor of activated T-cells NFE2L1 NM_003204 nuclear factor (erythroid-derived 2)-like 1 NFIC NM 005597 nuclear factor I/C isoform 1 NFKBI NM_003998 nuclear factor kappa-B, subunit 1 NFKBIB NM_001001716 nuclear factor of kappa light polypeptide gene NFKBILI NM005007 nuclear factor of kappa light polypeptide gene NFKBIL2 NM_013432 I-kappa-B-related protein NFSl NM021100 NFSI nitrogen fixation I isoform a precursor NFYC NM014223 nuclear transcription factor Y, gamma NGFR NM 002507 nerve growth factor receptor precursor NHEJI NM024782 XRCC4-like factor NHLHI NM 005598 nescient helix loop helix 1 NHS NM 198270 Nance-Horan syndrome protein NIBP NM_031466 NIK and IKK(beta) binding protein NIDI NM_002508 nidogen (enactin) NIN NM020921 ninein isoform 2 NISCH NM 007184 nischarin NKDI NM 033119 naked cuticle homolog 1 NKIRAS2 NM_001001349 NFKB inhibitor interacting Ras-like 2 NKX2-8 NM_014360 NK2 transcription factor related, locus 8 NKX3-1 NM_006167 NK3 transcription factor related, locus 1 NLGNI NM_014932 neuroligin 1 NMD3 NM 015938 NMD3 homolog NME3 NM 002513 nucleoside-diphosphate kinase 3 NMNAT2 NM015039 nicotinamide mononucleotide adenylyltransferase NMTI NM021079 N-myristoyltransferase 1 NMT2 NM004808 glycylpeptide N-tetradecanoyltransferase 2 NOBI NM_014062 nin one binding protein NOC2L NM 015658 nucleolar complex associated 2 homolog NOD9 NM024618 NOD9 protein isoform 1 NODAL NM_018055 mouse nodal homolog precursor NOL3 NM_003946 nucleolar protein 3 NOMOI NM014287 nodal modulator 1 NOMO2 NM_173614 nodal modulator 2 isoform 2 NOMO3 NM001004067 nodal modulator 3 NOSI NM000620 nitric oxide synthase 1(neuronal) NOSIAP NM_014697 nitric oxide synthase 1(neuronal) adaptor NOS2A NM_000625 nitric oxide synthase 2A isoform I
NOTCH2 NM_024408 notch 2 preproprotein NP NM_000270 purine nucleoside phosphorylase NPAL3 NM_020448 NIPA-like domain containing 3 NPC2 NM 006432 Niemann-Pick disease, type C2 precursor NPEPPS NM006310 aminopeptidase puromycin sensitive NPHP4 NIvI_015102 nephroretinin NPLOC4 NM_017921 nuclear protein localization 4 NPNT NM_001033047 nephronectin NPR2 NM003995 natriuretic peptide receptor B precursor NPTXR NM_014293 neuronal pentraxin receptor isoform I
NR2F6 NM005234 nuclear receptor subfamily 2, group F, member 6 NR4A1 NM_002135 nuclear receptor subfamily 4, group A, member I
NR4A3 NM 173199 nuclear receptor subfamily 4, group A, member 3 NR5A1 NM004959 nuclear receptor subfamily 5, group A, member 1 NRBPI NM_013392 nuclear receptor binding protein NRGI NM_013958 neuregulin 1 isoform HRG-beta3 NRIP2 NM031474 nuclear receptor interacting protein 2 NRN1 NM 016588 neuritin precursor WO 2008/073923 PCTiUS2007/087038 NRP2 NM003872 neuropilin 2 isoform 2 precursor NSF NM_006178 N-ethylmaleimide-sensitive factor NSUN4 NM_199044 NOL11NOP2/Sun domain family 4 protein NT5DC3 NM_016575 hypothetical protein LOC51559 isoform 2 NTE NM_006702 neuropathy target esterase NTN2L NM_006181 netrin 2-like NTNG2 NM_032536 netrin G2 NTRK2 NM001007097 neurotrophic tyrosine kinase, receptor, type 2 NTSRI NM002531 neurotensin receptor 1 NUAKI NM014840 AMPK-related protein kinase 5 NUAK2 NM_030952 NUAK family, SNF1-like kinase, 2 NUBP2 NM 012225 nucleotide binding protein 2 (MinD homolog, E.
NUCB1 NM006184 nucleobindin I
NUDCD3 NM_015332 NudC domain containing 3 NUDTI NM_002452 nudix-type motif I isoform p18 NUDTI I NM_018159 nudix-type motif 11 NUDTS NM_181843 nudix-type motif 8 NUP188 NM_015354 nucleoporin 188kDa NUP210 NM_024923 nucleoporin 210 NUP35 NM_001008544 nucleoporin 35kDa isoform b NUP50 NM_007172 nucleoporin 50kDa isoform b NUP98 NM_005387 nucleoporin 98kD isoform 3 NUTF2 NM_005796 nuclear transport factor 2 NXF5 NM_033153 nuclear RNA export factor 5 isoform c NXPH1 NM_152745 neurexophilin 1 precursor NXPH4 NM_007224 neurexophilin 4 OAF NM_178507 hypothetical protein LOC220323 OAS2 NM_001032731 2'-5'-oligoadenylate synthetase 2 isoform 3 OAS3 NM_006187 2'-5'oligoadenylate synthetase 3 OATLI NM_001006113 ornithine aminotransferase-like 1 isoform 1 OBSCN NM_052843 obscurin, cytoskeletal calmodulin and OCRL NM_000276 phosphatidylinositol polyphosphate 5-phosphatase ODF2 NM_153437 outer dense fiber of sperm tails 2 isoform 2 OGDH NM002541 oxoglutarate (alpha-ketoglutarate) dehydrogenase OGDHL NM_018245 oxoglutarate dehydrogenase-like OGFR NM 007346 opioid growth factor receptor OGT NMu_003605 O-linked GicNAc transferase isoform 3 OIP5 NM_007280 Opa interacting protein 5 OLFM2 NM_058164 olfactomedin 2 OMG NM002544 oligodendrocyte myelin glycoprotein OPHNI NM_002547 oligophrenin I
OPRL1 NM_000913 opiate receptor-like I
ORMDLI NM016467 ORMI-like 1 ORMDL3 NM_139280 ORM1-like 3 OS9 NM_001017956 amplified in osteosarcoma isoform 2 precursor OSBPL3 NM015550 oxysterol-binding protein-like protein 3 isoform OSCAR NM130771 osteoclast-associated receptor isoform 3 OSM NM_020530 oncostatin M precursor OSRI NM145260 odd-skipped related 1 OSTMI NM_014028 osteopetrosis associated transmembrane protein OTOF NM004802 otofertin isoform b OTUB I NM 017670 OTU domain, ubiquitin aldehyde binding 1 OTUB2 NM023112 OTU domain, ubiquitin aldehyde binding 2 OTUD4 NM_199324 OTU domain containing 4 protein isoform I
OTUD6A NM_207320 HIN-6 protease OTXI NM014562 orthodenticle I
OVOL1 NM_004561 OVO-like I binding protein P 15RS NM_018170 hypothetical protein FLJ 10656 P18SRP NM_173829 P18SR.P protein P2RX2 NM_012226 purinergic receptor P2X2 isoform I
P2RX7 NM 177427 purinergic receptor P2X7 isoform b P2RXLI NM_005446 purinergic receptor P2X-like 1, orphan receptor P2RY8 NM_178129 G-protein coupled purinergic receptor P2Y8 PA2G4 NM_006191 proliferation-associated 2G4, 38kDa PABPNI NM_004643 poly(A) binding protein, nuclear 1 PACRG NM_152410 PARK2 co-regulated PACSIN 1 NM_020804 protein kinase C and casein kinase substrate in PAEP N1V1_001018049 glycodelin precursor PAFAHIBI NM_000430 platelet-activating factor acetylhydrolase, PAFAH2 NM_000437 platelet-activating factor acetylhydrolase 2 PAGI NM_018440 phosphoprotein associated with glycosphingolipid PAGEI NM_003785 P antigen family, member I
PAICS NM006452 phosphoribosylaminoimidazole carboxylase PAK2 NM_002577 p21-activated kinase 2 PAK6 NM 020168 p21-activated kinase 6 PAK7 NM_020341 p21-activated kinase 7 PALM2-AKAP2 NM 007203 PALM2-AKAP2 protein isoform I
PAM NM_000919 peptidylglycine alpha-amidating monooxygenase PANKI NM_138316 pantothenate kinase 1 isoform gamma PANXI NM_015368 pannexin 1 PAPD1 NM 018109 PAP associated domain containing 1 PAPOLG NM_022894 poly(A) polymerase gamma PAPPA NM_002581 pregnancy-associated plasma protein A
PARD6B NM_032521 PAR-6 beta PARD6G NM_032510 PAR-6 gamma protein PARP11 NM_020367 poly (ADP-ribose) polymerase family, member 11 PARP12 NM022750 zinc finger CCCH-type domain containing 1 PARP14 NM017554 poly (ADP-ribose) polymerase family, member 14 PATE NM 138294 expressed in prostate and testis PAX2 NM_V000278 paired box protein 2 isoform b PAX8 NM_003466 paired box gene 8 isoform PAX8A
PAXIPI NM_007349 PAX interacting protein 1 PBX3 NM_006195 pre-B-cell leukemia transcription factor 3 PCBP4 NM_020418 poly(rC) binding protein 4 isoform a PCDHI NM_032420 protocadherin I isoform 2 precursor PCDH17 NM014459 protocadherin 17 PCDH19 NM 020766 protocadherin 19 PCDH21 NM033100 protocadherin 21 precursor PCDH9 NM_020403 protocadherin 9 isoform 2 precursor PCDHA 1 NM_018900 protocadherin alpha I isoform 1 precursor PCDHAIO N1V1_018901 protocadherin alpha 10 isoform I precursor PCDHAI I NM_018902 protocadherin alpha 11 isoform I precursor PCDHA12 NM018903 protocadherin alpha 12 isoform I precursor PCDHA 13 NM_018904 protocadherin alpha 13 isoform I precursor PCDHA2 NM 018905 protocadherin alpha 2 isoform I precursor PCDHA3 NM 018906 protocadherin alpha 3 isoform I precursor PCDHA4 NM_018907 protocadherin alpha 4 isoform I precursor PCDHA5 NM018908 protocadherin alpha 5 isoform 1 precursor PCDHA6 NM018909 protocadherin alpha 6 isoform 1 precursor PCDHA7 NM_018910 protocadherin alpha 7 isoform 1 precursor PCDHA8 NM018911 protocadherin alpha 8 isoform I precursor PCDHA9 NM031857 protocadherin alpha 9 isoform I precursor PCDHACI NM_018898 protocadherin alpha subfamily C, 1 isoform 1 PCDHAC2 NM_018899 protocadherin alpha subfamily C, 2 isoform 1 PCGF5 NM032373 polycomb group ring finger 5 PCID2 NM 018386 PCI domain containing 2 PCMT1 NM005389 protein-L-isoaspartate (D-aspartate) PCNXL2 NM_014801 pecanex-like 2 PCOLN3 NM_002768 procollagen (type III) N-endopeptidase PCQAP NM001003891 positive cofactor 2, glutamine/Q-rich-associated PCSK2 NM_002594 proprotein convertase subtilisin/kexin type 2 PCSK6 NM002570 paired basic amino acid cleaving system 4 PCSK9 NM_174936 proprotein convertase subtilisin/kexin type 9 PCTK2 NM_002595 PCTAIRE protein kinase 2 PCTP NM021213 phosphatidylcholine transfer protein PCYOXI NM_016297 prenylcysteine oxidase I
PDAP1 NM 014891 PDGFA associated protein I
PDCD1 NM_005018 programmed cell death 1 precursor PDCD11 NM_014976 programmed cell death 11 PDCD4 NM014456 programmed cell death 4 isoform 1 PDCD6IP NM_013374 programmed cell death 6 interacting protein PDCD7 NM005707 programmed cell death 7 PDCL NM_005388 phosducin-like PDDCI NM_182612 hypothetical protein LOC347862 PDE3B NM_000922 phosphodiesterase 3B, cGMP-inhibited PDE4D NM_006203 cAMP-specific phosphodiesterase 4D
PDE7B NM_018945 phosphodiesterase 7B
PDGFRA NM_006206 platelet-derived growth factor receptor alpha PDGFRB NM002609 platelet-derived growth factor receptor beta PDIA6 NM 005742 protein disulfide isomerase-associated 6 PDIKIL NM152835 PDLIMI interacting kinase 1 like PDK2 NM002611 pyruvate dehydrogenase kinase, isoenzyme 2 PDK4 NM_002612 pyruvate dehydrogenase kinase 4 PDLIM2 NM176871 PDZ and LIM domain 2 isoform I
PDLIM5 NM001011513 PDZ and LIM domain 5 isoform b PDPKI NM_002613 3-phosphoinositide dependent protein kinase-I
PDPN NM_001006624 lung type-I cell membrane-associated PDPR NM_017990 pyruvate dehydrogenase phosphatase regulatory PDRG1 NM030815 p53 and DNA damage-regulated protein PDXK NM_003681 pyridoxal kinase PDYN NM024411 beta-neoendorphin-dynorphin preproprotein PDZD2 NM_178140 PDZ domain containing 2 PELI2 NM021255 pellino 2 PELI3 NM_145065 pellino 3 alpha PEMT NM 007169 phosphatidylethanolamine N-methyltransferase PER3 NM 016831 period 3 PERLDI NM_033419 CAB2 protein PERP NM_022121 PERP, TP53 apoptosis effector PEX10 NM 002617 peroxisome biogenesis factor 10 isoform 2 WO 2008/073923 PCT/iJS2007/087038 PEX12 1NM_000286 peroxisomal biogenesis factor 12 PEX13 NM_002618 peroxisome biogenesis factor 13 PEX16 NM_057174 peroxisomal biogenesis factor 16 isoform 2 PEX19 NM002857 peroxisomal biogenesis factor 19 PEX5 NM000319 peroxisomal biogenesis factor 5 PFKFB2 NM006212 6-phosphofructo-2-kinase/fructose-2, PFKFB4 NM 004567 6-phosphofructo-2-kinase/fructose-2, PFKL NM_001002021 liver phosphofructokinase isoform a PGAM5 NM138575 Bcl-XL-binding protein v68 PGD NM_002631 phosphogluconate dehydrogenase PGEA1 NM001002880 PKD2 interactor, golgi and endoplasmic reticulum PGLS NM_012088 6-phosphogluconolactonase PGM1 NM_002633 phosphoglucomutase I
PGM2L1 NM_173582 phosphoglucomutase 2-like 1 PHACTRI NM_030948 phosphatase and actin regulator I
PHACTR2 NM_014721 phosphatase and actin regulator 2 PHACTR4 NM_023923 phosphatase and actin regulator 4 PHB NM_002634 prohibitin PHF13 NM_153812 PHD finger protein 13 PHF15 NM_015288 PHD finger protein 15 PHF17 NM_024900 Jadel protein short isoform PHF19 NM_015651 PHD finger protein 19 isoform a PHF20 NM_016436 PHD finger protein 20 PHF20L1 NM_016018 PHD finger protein 20-like I isoform 1 PHIP NM_017934 pleckstrin homology domain interacting protein PHLDA3 NM_012396 pleckstrin homology-like domain, family A, PHLDB3 NM_198850 pleckstrin homology-like domain, family B, PHLPPL NM015020 PH domain and leucine rich repeat protein PHOX2B NM 003924 paired-like homeobox 2b PHYHIP NM014759 phytanoyl-CoA hydroxylase interacting protein PI4K2B NM_018323 phosphatidylinositol 4-kinase type-II beta PI4KII NM_018425 phosphatidylinositol 4-kinase type II
PIASI NM_016166 protein inhibitor of activated STAT, 1 PIB5PA NM 001002837 phosphatidylinositol (4,5) bisphosphate PIGA NM_002641 phosphatidylinositol PiGB NM_004855 phosphatidylinositol glycan, class B
PIGQ NM_004204 phosphatidylinositol glycan, class Q isoform 2 PIGR NM_002644 polymeric immunoglobulin receptor PIGT NM015937 phosphatidylinositol glycan, class T precursor PIK3C2B NM_002646 phosphoinositide-3-kinase, class 2, beta PIK3Rl NM_181504 phosphoinositide-3-kinase, regulatory subunit, PIK3R2 NM_005027 phosphoinositide-3-kinase, regulatory subunit 2 PIK3R3 NM_003629 phosphoinositide-3-kinase, regulatory subunit 3 PIK4CB NM_002651 phosphatidylinositol 4-kinase, catalytic, beta PILRB NM013440 paired immunoglobulin-like type 2 receptor beta PIMI NM 002648 pim-1 oncogene PIM3 NM~001001852 pim-3 oncogene PIP3-E NM015553 phosphoinositide-binding protein PIP3-E
PIP5KIB NM001031687 phosphatidylinositol-4-phosphate 5-kinase, type PIP5KIC NM012398 phosphatidylinositol-4-phosphate 5-kinase, type PIP5K2C NM024779 phosphatidylinositol-4-phosphate 5-kinase, type PIP5K3 NM 001002881 phosphatidylinositol-3-PISD NM 014338 phosphatidylserine decarboxylase PITPNA NM_006224 phosphatidylinositol transfer protein, alpha PKDI NM 000296 polycystin I isoform 2 precursor PKDIL2 NM182740 polycystin 1-like 2 isoform b PKHDI NM_138694 polyductin isoform 1 PKLR NM_000298 pyruvate kinase, liver and RBC isoform I
PKNOXI NM004571 PBX/knotted 1 homeobox 1 isoform I
PKP1 NM_000299 plakophilin 1 isoform lb PLA2G2F NM022819 phospholipase A2, group IIF
PLA2G4D NM_178034 phospholipase A2, group IVD
PLAC2 NM_153375 placenta-specific 2 PLAGI NM 002655 pleiomorphic adenoma gene 1 PLAGLI NM_002656 pleiomorphic adenoma gene-like 1 isoform 1 PLCD1 NM_006225 phospholipase C, delta 1 PLCXDI NM018390 phosphatidylinositol-specific phospholipase C, X
PLCXD3 NM001005473 phosphatidylinositol-specific phospholipase C, X
PLDI NM002662 phospholipase Dl, phophatidylcholine-specific PLD2 NM002663 phospholipase D2 PLDN NM_012388 pallidin PLEKHAI NM_001001974 pleckstrin homology domain containing, family A
PLEKHA5 NM019012 pleckstrin homology domain containing, family A
PLEKHA6 NM_014935 phosphoinositol 3-phosphate-binding protein-3 PLEKHA7 NM_175058 pleckstrin homology domain containing, family A
PLEKHB2 NM_017958 pleckstrin homology domain containing, family B
PLEKHCI NM_006832 pleckstrin homology domain containing, family C
PLEKHGI NM001029884 pleckstrin homology domain containing, family G
PLEKHG3 NM015549 pleckstrin homology domain containing, family G, PLEKHGS NM198681 putative NFkB activating protein isoform b PLEKHHI NM020715 pleckstrin homology domain containing, family H
PLEKHH2 NM_172069 pleckstrin homology domain containing, family H
PLEKHJI NM018049 pleckstrin homology domain containing, family J
PLEKHKI NM 145307 pleckstrin homology domain containing, family K
PLEKHMI NM_014798 pleckstrin homology domain containing, family M
PLEK.HQI NM_025201 PH domain-containing protein PLRG1 NM_002669 pleiotropic regulator 1(P1ZL1 homolog, PLSI NM_002670 plastin I
PLSCR4 NM_020353 phospholipid scramblase 4 PLUNC NM_130852 palate, lung and nasal epithelium carcinoma PLXDCI NM_020405 plexin domain containing I precursor PLXNAI NM_032242 plexin A1 PLXNA2 NM_025179 plexin A2 PLXNBI NM_002673 plexin B1 PLXNDI NM_015103 plexin D1 PML NM_033239 promyelocytic leukemia protein isoform 9 PMM1 NM_002676 phosphomannomutase I
PMM2 NM_000303 phosphomannomutase 2 PMP2 NM_002677 peripheral myelin protein 2 PMP22 NM_000304 peripheral myelin protein 22 PNKD NM_015488 myofibrillogenesis regulator 1 isoform 1 PNLIPRPI NM006229 pancreatic lipase-related protein 1 PNMA3 NM013364 paraneoplastic cancer-testis-brain antigen PNMA5 NM_052926 hypothetical protein LOC114824 PNMA6A NM_032882 hypothetical protein LOC84968 PNPO NM 018129 pyridoxine 5'-phosphate oxidase PNRC2 NM017761 proline-rich nuclear receptor coactivator 2 PODN NM153703 podocan PODXL NM_001018111 podocalyxin-like precursor isoform I
POFIB NM_024921 premature ovarian failure, 1B
POFUTI NM_015352 protein 0-fucosyltransferase 1 isoform I
POFUT2 NM_015227 protein 0-fucosyltransferase 2 isoform A
POLD3 NM_006591 polymerase (DNA directed), delta 3 POLDIP3 NM_032311 DNA polymerase delta interacting protein 3 POLE NM_006231 DNA polymerase epsilon catalytic subunit POLE4 NM 019896 DNA polymerase epsilon subunit 4 POLL NM_013274 polymerase (DNA directed), lambda POLR2D NM004805 DNA directed RNA polymerase II polypeptide D
POLR2E NM_002695 DNA directed RNA polymerase II polypeptide E
POLR2G NM002696 DNA directed RNA polymerase II polypeptide G
POLR2J NM_006234 DNA directed RNA polymerase II polypeptide J
POLR3B NM_018082 polymerase (RNA) III (DNA directed) polypeptide POLR3D NM 001722 RNA polymerase 11153 kDa subunit RPC4 POLR3F NM_006466 DNA-directed RNA polymerase 11139 kDa POM121 NM 172020 nuclear pore membrane protein 121 POMT2 NM 013382 putative protein 0-mannosyltransferase POMZP3 NM_012230 POMZP3 fusion protein isoform 1 POU2AFI NM006235 POU domain, class 2, associating factor I
POU3F2 NM005604 POU domain, class 3, transcription factor 2 POU4F1 NM 006237 POU domain, class 4, transcription factor 1 POU4F2 NM004575 POU domain, class 4, transcription factor 2 POU6F1 NM002702 POU domain, class 6, transcription factor 1 PPAP2A NM003711 phosphatidic acid phosphatase type 2A isoform I
PPAP2B NM003713 phosphatidic acid phosphatase type 2B
PPAP2C NM003712 phosphatidic acid phosphatase type 2C isoform 1 PPAPDC2 NM203453 phosphatidic acid phosphatase type 2 domain PPAPDC3 NM_032728 phosphatidic acid phosphatase type 2 domain PPARA NM001001928 peroxisome proliferative activated receptor, PPARD NM_006238 peroxisome proliferative activated receptor, PPARGCIA NM013261 peroxisome proliferative activated receptor PPFIA3 NM003660 PTPRF interacting protein alpha 3 PPFIA4 NM015053 protein tyrosine phosphatase, receptor type, f PPIE NM_006112 peptidylprolyl isomerase E isoform I
PPIF NM005729 peptidylprolyl isomerase F precursor PPIH NM_006347 peptidylprolyl isomerase H
PPILI NM_016059 peptidylprolyl isomerase-like 1 PPIL2 NM014337 peptidylprolyl isomerase-like 2 isoform a PPIL4 NM_139126 peptidylprolyl isomerase-like 4 PPL NM_002705 periplakin PPMIA NM021003 protein phosphatase 1A isoform I
PPMID NM_003620 protein phosphatase 1D
PPM 1 E NM014906 protein phosphatase 1 E
PPM1F NM_014634 protein phosphatase 1F
PPM1L NM_139245 protein phosphatase 1 (formerly 2C)-like PPM1M NM144641 protein phosphatase IM (PP2C domain containing) PPM2C NM_018444 pyruvate dehydrogenase phosphatase precursor PPMEl NM_016147 protein phosphatase methylesterase-1 PPPI CA NM_001008709 protein phosphatase 1, catalytic subunit, alpha PPPIRII NM 021959 protein phosphatase 1, regulatory (inhibitor) PPP1R12A NM 002480 protein phosphatase 1, regulatory (inhibitor) PPP1R12B NM002481 protein phosphatase 1, regulatory (inhibitor) PPP1R12C NM_017607 protein phosphatase 1, regulatory subunit 12C
PPP1R13B NM015316 protein phosphatase 1, regulatory (inhibitor) PPP1R14C NM030949 protein phosphatase 1, regulatory (inhibitor) PPP1R16B NM_015568 protein phosphatase 1 regulatory inhibitor PPPIRIA NM_006741 protein phosphatase 1, regulatory (inhibitor) PPPIR2 NM006241 protein phosphatase 1, regulatory (inhibitor) PPPIR3B NM024607 protein phosphatase 1, regulatory (inhibitor) PPP2CA NM_002715 protein phosphatase 2, catalytic subunit, alpha PPP2RIA NM014225 alpha isoform of regulatory subunit A, protein PPP2RIB NM_002716 beta isoform of regulatory subunit A, protein PPP2R2C NM_020416 gamma isoform of regulatory subunit B55, protein PPP2R2D NM_001003656 protein phosphatase 2, regulatory subunit B, PPP2R4 NM_021131 protein phosphatase 2A, regulatory subunit B' PPP2R5C NM_002719 gamma isoform of regulatory subunit B56, protein PPP3CB NM_021132 protein phosphatase 3 (formerly 2B), catalytic PPP4RIL NM018498 hypothetical protein LOC55370 PPP6C NM_002721 protein phosphatase 6, catalytic subunit PPRCI NM_015062 PGC-1 related co-activator PPT1 NM_000310 palmitoyl-protein thioesterase 1 PPT2 NM_005155 palmitoyl-protein thioesterase 2 isoform a PPTC7 NM139283 T-cell activation protein phosphatase 2C
PQLC1 NM_025078 PQ loop repeat containing 1 PRDM12 NM021619 PR domain containing 12 PRDM16 NM_022114 PR domain containing 16 isoform I
PRDM2 NM001007257 retinoblastoma protein-binding zinc finger PRDM4 NM_012406 PR domain containing 4 PREI3 NM 015387 preimplantation protein 3 isoform 1 PRELP NM002725 proline arginine-rich end leucine-rich repeat PRFI NM_005041 perforin I precursor PRH2 NM_005042 proline-rich protein HaeIII subfamily 2 PRIC285 NM033405 PPAR-alpha interacting complex protein 285 PRICKLE2 NM_198859 prickle-like 2 PRKAAI NM_006251 protein kinase, AMP-activated, alpha 1 catalytic PRKAB2 NM005399 AMP-activated protein kinase beta 2 PRKACA NM002730 cAMP-dependent protein kinase catalytic subunit PRKARIA NM002734 cAMP-dependent protein kinase, regulatory PRKAR2A NM_004157 cAMP-dependent protein kinase, regulatory PRKCA NM 002737 protein kinase C, alpha PRKCBPI NM_012408 protein kinase C binding protein 1 isoform b PRKCD NM_006254 protein kinase C, delta PRKCG NM 002739 protein kinase C, gamma PRKCI NM_002740 protein kinase C, iota PRKCZ NM001033581 protein kinase C, zeta isoform 2 PRKD2 NM_016457 protein kinase D2 PRKD3 NM_005813 protein kinase D3 PRKG1 NM006258 protein kinase, cGMP-dependent, type I
PRNT NM_177549 prion protein (testis specific) PR00149 NM_014117 hypothetical protein LOC29035 PROK2 NM_021935 prokineticin 2 ProSAPiP1 NM_014731 ProSAPiPI protein PROSC NM 007198 proline synthetase co-transcribed homolog PRPF38A NM_032864 PRP38 pre-mRNA processing factor 38 (yeast) PRPS2 NM002765 phosphoribosyl pyrophosphate synthetase 2 PRR13 NM001005354 hypothetical protein LOC54458 isoform 2 PRR3 NM_025263 proline-rich protein 3 PRRGI NM_000950 proline rich Gla (G-carboxyglutamic acid) 1 PRRX1 NM_006902 paired mesoderm homeobox I isoform pmx-la PRSS12 NM_003619 neurotrypsin precursor PRSS22 NM_022119 protease, serine, 22 PRSS23 NM_007173 protease, serine, 23 precursor PRSS27 NM_031948 marapsin PRSS33 NM_152891 protease, serine, 33 PRSS7 NM 002772 enterokinase precursor PRX NM_020956 periaxin isoform I
PSAP NM 002778 prosaposin PSAT1 NM021154 phosphoserine aminotransferase isoform 2 PSCA NM_005672 prostate stem cell antigen preproprotein PSCD3 NM004227 pleckstrin homology, Sec7 and coiled/coil PSD3 NM015310 ADP-ribosylation factor guanine nucleotide PSD4 NM_012455 pleckstrin and Sec7 domain containing 4 PSKHI NM_006742 protein serine kinase HI
PSMB5 NM_002797 proteasome beta 5 subunit PSMD13 NM_002817 proteasome 26S non-ATPase subunit 13 isoform I
PSMD7 NM_002811 proteasome 26S non-ATPase subunit 7 PSMD9 NM_002813 proteasome 26S non-ATPase subunit 9 PSME3 NM_005789 proteasome activator subunit 3 isoform I
PSME4 NM_014614 proteasome (prosome, macropain) activator PSORSIC2 NM_014069 SPR1 protein PSRC2 NM 144982 hypothetical protein LOC196441 PTBPI NM002819 polypyrimidine tract-binding protein 1 isoform PTCH NM 000264 patched PTD008 NMu_016145 hypothetical protein LOC51398 PTDSSI NM_014754 phosphatidylserine synthase 1 PTER NM_001001484 phosphotriesterase related PTGER3 NM_198718 prostaglandin E receptor 3, subtype EP3 isoform PTGES2 NM198939 prostaglandin E synthase 2 isoform 3 PTGFRN NM020440 prostaglandin F2 receptor negative regulator PTGIR NM_000960 prostaglandin 12 (prostacyclin) receptor (IP) PTGS1 NM000962 prostaglandin-endoperoxide synthase I isoform 1 PTH NM_000315 parathyroid hormone preproprotein PTHLH NM_198965 parathyroid hormone-like hormone isoform I
PTK2B NM004103 PTK2B protein tyrosine kinase 2 beta isoform a PTK6 NM_005975 PTK6 protein tyrosine kinase 6 PTK7 NM_152883 PTK7 protein tyrosine kinase 7 isoform e PTPDCI NM_152422 protein tyrosine phosphatase domain containing 1 PTPLAD2 NM_001010915 hypothetical protein LOC401494 PTPN18 NM014369 protein tyrosine phosphatase, non-receptor type PTPN20B NM_015605 protein tyrosine phosphatase, non-receptor type PTPN3 NM_002829 protein tyrosine phosphatase, non-receptor type PTPN4 NM_002830 protein tyrosine phosphatase, non-receptor type PTPN7 NM_002832 protein tyrosine phosphatase, non-receptor type PTPRF NM_002840 protein tyrosine phosphatase, receptor type, F
PTPRM NM_002845 protein tyrosine phosphatase, receptor type, M
PTPRR NM 002849 protein tyrosine phosphatase, receptor type, R

PTPRT NM_007050 protein tyrosine phosphatase, receptor type, T
PURA NM_005859 purine-rich element binding protein A
PURB NM033224 purine-rich element binding protein B
PURG NM013357 purine-rich element binding protein G isoform A
PUSLI NM_153339 pseudouridylate synthase-like I
PWWP2 NM_138499 PWWP domain containing 2 PXMP4 NM007238 peroxisomal membrane protein 4 isoform a PXN NM 002859 paxillin PYCRI NM006907 pyrroline-5-carboxylate reductase I isoform I
PYCR2 NM013328 pyrroline-5-carboxylate reductase family, member PYCRL NM_023078 pyrroline-5-carboxylate reductase-like PYY2 NM_021093 peptide YY, 2(seminalplasmin) QKI NM_206853 quaking homolog, KH domain RNA binding isoform QPRT NM_014298 quinolinate phosphoribosyltransferase QSCN6LI NM 181701 quiescin Q6-like 1 QTRTDI NM024638 queuine tRNA-ribosyltransferase domain RAB10 NM016131 ras-related GTP-binding protein RAB10 RABIIFIPI NM 001002814 Rab coupling protein isoform 3 RABIIFIP2 NM 014904 RABI I family interacting protein 2 (class I) RABIIFIP3 NM 014700 rabl1-family interacting protein 3 RABI IFIP4 NM+_032932 RAB11 family interacting protein 4 (class II) RABIIFIP5 NM_015470 RAB 11 family interacting protein 5 (class 1) RAB15 NM_198686 Ras-related protein Rab-15 RAB IA NM 004161 RABIA, member RAS oncogene family RAB22A NM~020673 RAS-related protein RAB-22A
RAB23 NM 016277 Ras-related protein Rab-23 RAB2B NM_032846 RAB2B protein RAB39B NM_171998 RAB39B, member RAS oncogene family RAB3B NM 002867 RAB3B, member RAS oncogene family RAB3D NM004283 RAB3D, member RAS oncogene family RAB40A NM080879 RAB40A, member RAS oncogene family RAB40B NM_006822 RAB40B, member RAS oncogene family RAB43 NM_198490 RAB43 protein RAB4B NM_016154 ras-related GTP-binding protein 4b RAB6B NM_016577 RAB6B, member RAS oncogene family RAB6IP2 NM_015064 RAB6-interacting protein 2 isoform alpha RABBB NM_016530 RAB8B, member RAS oncogene family RAB9A NM_004251 RAB9A, member RAS oncogene family RABACI NM_006423 Rab acceptor I
RABEP2 NM024816 rabaptin, RAB GTPase binding effector protein 2 RABL3 NM173825 RAB, member of RAS oncogene family-like 3 RACGAPI NM_013277 Rac GTPase activating protein I
RAD23A NM_005053 UV excision repair protein RAD23 homolog A
RAD23B NM002874 UV excision repair protein RAD23 homolog B
RAD50 NM_005732 RAD50 homolog isoform I
RAD51L1 NM_133509 RAD51-like I isoform 3 RAD5II,3 NM_002878 RAD51-like 3 isoform 1 RAD9A NM_004584 RAD9 homolog RAET] G NM_001001788 retinoic acid early transcript 1 G
RAF 1 NM002880 v-raf-1 murine leukemia viral oncogene homolog RAGE NM014226 MAPK/MAKlMRK overlapping kinase RAI14 NM015577 retinoic acid induced 14 RAI17 NM 020338 retinoic acid induced 17 RALB NM002881 v-ral simian leukemia viral oncogene homolog B
RALBPI NM_006788 ralA binding protein 1 RALGPSI NM014636 Ral GEF with PH domain and SH3 binding motif I
RANBPIO NM020850 RAN binding protein 10 RANBP3 NM_003624 RAN binding protein 3 isoform RANBP3-a RANGAPI NM_002883 Ran GTPase activating protein I
RAPIGAP NM_002885 RAP1, GTPase activating protein I
RAPIGDSI NM021159 RAP 1, GTP-GDP dissociation stimulator 1 RAP2C NM 021183 RAP2C, member of RAS oncogene family RAPGEFI NM_005312 guanine nucleotide-releasing factor 2 isoform a RAPGEFLI NM_016339 Rap guanine nucleotide exchange factor RAPHI NM_213589 Ras association and pleckstrin homology domains RARB NM000965 retinoic acid receptor, beta isoform 1 RARG NM_000966 retinoic acid receptor, gamma RARRES2 NM_002889 retinoic acid receptor responder (tazarotene RASA3 NM_007368 RAS p21 protein activator 3 RASA4 NM_006989 RAS p21 protein activator 4 RASALI NM_004658 RAS protein activator like 1 RASGEFIB NM152545 RasGEF domain family, member 1B
RASGEFIC NM_001031799 RasGEF domain family, member IC isoform 2 RASL12 NM_016563 RAS-like, family 12 protein RASSFI NM007182 Ras association domain family I isoform A
RASSF2 NM_014737 Ras association domain family 2 RASSF3 NM_178169 Ras association (Ra1GDS/AF-6) domain family 3 RASSF4 NM_032023 Ras association domain family 4 isoform a RASSF5 NM_031437 Ras association (RaIGDS/AF-6) domain family 5 RBBP6 NM_006910 retinoblastoma-binding protein 6 isoform 1 RBED 1 NM_032213 RNA binding motif and ELMO domain I
RBJ NM 016544 Ras-associated protein Rapl RBL2 NM005611 retinoblastoma-like 2 (p130) RBM12 NM_006047 RNA binding motif protein 12 RBM12B NM_203390 hypothetical protein LOC389677 RBM16 NM_014892 RNA-binding motif protein 16 RBM19 NM_016196 RNA binding motif protein 19 RBM21 NM_022830 RNA binding motif protein 21 RBM23 NM_018107 hypothetical protein LOC55147 RBM24 NM_153020 hypothetical protein LOC221662 RBM33 NM_001008408 hypothetical protein LOC155435 RBM35B NM_024939 hypothetical protein LOC80004 RBM6 NM_005777 RNA binding motif protein 6 RBM7 NM_016090 RNA binding motif protein 7 RBPMS2 NM_194272 RNA binding protein with multiple splicing 2 RCE1 NM_001032279 prenyl protein peptidase RCE1 isoform 2 RCLI NM005772 RNA cyclase homolog RCOR3 NM_018254 REST corepressor 3 RDH13 NM_138412 retinol dehydrogenase 13 (all-trans and 9-cis) RDMI NM 145654 RAD52 motif 1 isoform 1 RDS NM000322 retinal degeneration slow protein RECK NM 021111 RECK protein precursor RECQL5 NM004259 RecQ protein-like 5 isoform 1 REEPI NM 022912 receptor expression enhancing protein 1 REEP3 NM001001330 receptor expression enhancing protein 3 RELN NM 005045 reelin isoform a WO 2008/073923 PCTiUS2007/087038 RET NM 020975 ret proto-oncogene isoform a REXO1 NM020695 transcription elongation factor B polypeptide 3 REXO4 NM020385 XPMC2 prevents mitotic catastrophe 2 homolog RFFL NM 001017368 rififylin RFK NM018339 riboflavin kinase RFTI NM_052859 hypothetical protein LOC91869 RFWD2 NM001001740 ring finger and WD repeat domain 2 isoform d24 RFWD3 N1V1_018124 ring finger and WD repeat domain 3 RFX4 NM_002920 regulatory factor X4 isoform b RGAG4 NM001024455 retrotransposon gag domain containing 4 RGLl NM_015149 ral guanine nucleotide dissociation RGMA NM020211 RGM domain family, member A
RGMB NM001012761 RGM domain family, member B isoform I precursor RGPD5 NM005054 RANBP2-like and GRIP domain containing 5 isoform RGS 11 NM_003834 regulator of G-protein signalling 1 I isoform 2 RGS 12 NM002926 regulator of G-protein signalling 12 isoform 2 RGS22 NM_015668 regulator of G-protein signalling 22 RGS3 NM017790 regulator of G-protein signalling 3 isoform 3 RGSS NM003617 regulator of G-protein signalling 5 RGS9BP NM_207391 RGS9 anchor protein RHBDL3 NM138328 rhomboid, veinlet-like 3 RHBG NM_020407 Rhesus blood group, B glycoprotein RHOB NM004040 ras homolog gene family, member B
RHOBTB2 NM015178 Rho-related BTB domain containing 2 RHOD NM014578 ras homolog D
RHOJ NM020663 TC10-like Rho GTPase RHOU NM021205 ras homolog gene family, member U
RHPN2 NM_033103 rhophilin-like protein RICBA NM021932 resistance to inhibitors of cholinesterase 8 RICTOR NM_152756 rapamycin-insensitive companion of mTOR
R1F1 NM_018151 RAP1 interacting factor I
RIMBP2 NM_015347 RIM-binding protein 2 RIMS3 NM014747 regulating synaptic membrane exocytosis 3 RIPK4 NM020639 ankyrin repeat domain 3 RIPK5 NM_015375 receptor interacting protein kinase 5 isoform 1 RKHD2 NM 016626 ring finger and KH domain containing 2 RKHD3 NM032246 ring finger and KH domain containing 3 RNASEHI NM_002936 ribonuclease H1 RNFIO NM014868 ring finger protein 10 RNF 111 NM_017610 ring finger protein 111 RNF 125 NM017831 ring finger protein 125 RNF138 NM016271 ring finger protein 138 isoform 1 RNF I44 NM014746 ring finger protein 144 RNF149 NM_173647 ring finger protein 149 RNF165 NM_152470 ring finger protein 165 RNF166 NM_178841 ring finger protein 166 RNF183 NM145051 ring finger protein 183 RNF190 NM_152598 hypothetical protein LOC162333 RNF24 NM007219 ring finger protein 24 RNF31 NM_017999 ring finger protein 31 RNF38 NM022781 ring finger protein 38 isoform 1 RNF39 NM_025236 HZFwI protein isoform I
RNF41 NM_005785 ring finger protein 41 isoform 1 RNF43 NM_017763 ring finger protein 43 RNF44 NM_014901 ring finger protein 44 RNF8 NM_003958 ring finger protein 8 isoform 1 RNGTT NM003800 RNA guanylyltransferase and 5'-phosphatase RNHI NM_002939 ribonuclease/angiogenin inhibitor RNMT NM 003799 RNA (guanine-7-) methyltransferase RNPC1 NMu_017495 RNA-binding region containing protein 1 isoform RNPS1 NM 006711 RNA-binding protein S1, serine-rich domain ROB04 NM019055 roundabout homolog 4, magic roundabout ROGDI NM_024589 leucine zipper domain protein RP13-15M17.2 NM_001010866 hypothetical protein LOC199953 RPI-32F7.2 NM_173698 hypothetical protein LOC286499 RP3-473B4.1 NM_138819 hypothetical protein LOC159091 RPH3AL NM 006987 rabphilin 3A-like (without C2 domains) RPLIO NM006013 ribosomal protein L10 RPL28 NM_000991 ribosomal protein L28 RPL32 NM_000994 ribosomal protein L32 RPP14 NM007042 ribonuclease P l4kDa subunit RPP25 NM017793 ribonuclease P 25kDa subunit RPRM NM_019845 reprimo, TP53 dependant G2 arrest mediator RPRML NM_203400 reprimo-like RPS23 NM_001025 ribosomal protein S23 RPS6KA3 NM004586 ribosomal protein S6 kinase, 90kDa, polypeptide RPS6KA5 NM_004755 ribosomal protein S6 kinase, 90kDa, polypeptide RPS6KB1 NM_003161 ribosomal protein S6 kinase, 70kDa, polypeptide RPS6KB2 NM001007071 ribosomal protein S6 kinase, 70kDa, polypeptide RPUSD1 NM_058]92 RNA pseudouridylate synthase domain containing RPUSD4 NM032795 RNA pseudouridylate synthase domain containing RRAGA NM_006570 Ras-related GTP binding A
RRAGC NM_022157 Ras-related GTP binding C
RREBI NM001003698 ras responsive element binding protein 1 isoform RRH NM_006583 peropsin RRP22 NM001007279 RAS-related on chromosome 22 isoform b RSl NM000330 X-linked juvenile retinoschisis protein RSBNI NM_018364 round spermatid basic protein 1 RSNL2 NM024692 restin-like 2 RSP02 NM178565 R-spondin family, member 2 RSP03 NM 032784 thrombospondin, type I, domain containing 2 RSUI NM_012425 ras suppressor protein 1 isoform 1 RTELI NM_032957 regulator of telomere elongation helicase 1 RTFI NM_015138 Pafl /RNA polymerase II complex component RTN2 NM206902 reticulon 2 isoform D
RTN3 NM 006054 reticulon 3 isoform a RTN4 NM007008 reticulon 4 isoform C
RTN4RLI NM_178568 reticulon 4 receptor-like 1 RUNX1 NM001001890 runt-related transcription factor 1 isoform b RUNXITI NM_004349 acute myelogenous leukemia 1 translocation I
RUTBCI NM_014853 RUN and TBCI domain containing 1 RXRA NM_002957 retinoid X receptor, alpha RYBP NM_012234 RING1 and YY1 binding protein S100A5 NM_002962 S100 calcium binding protein A5 S100A7L1 NM176823 S100 calcium binding protein A7-like 1 SACMIL NM 014016 suppressor of actin 1 SAEI NM 005500 SUMO-1 activating enzyme subunit 1 SALL2 NM005407 sal-like 2 SALL3 NM_171999 sal-like 3 SALL4 NM 020436 sal-like 4 SAMDIO NM 080621 sterile alpha motif domain containing 10 SAPS2 NM~014678 hypothetical protein LOC970I
SAPS3 NM018312 SAPS domain family, member 3 SARMI NM015077 sterile alpha and TIR motif containing I
SAT NM 002970 spermidine/spermine Nl-acetyltransferase SATB2 NM015265 SATB family member 2 SAVI NM 021818 WW45 protein SBFI NM002972 SET binding factor I isoform a SCAMPI NM_004866 secretory carrier membrane protein I isoform 1 SCAMP4 NM 079834 secretory carrier membrane protein 4 SCAMP5 NM138967 secretory carrier membrane protein 5 SCAND2 NM 022050 SCAN domain-containing protein 2 isoform 1 SCARB I NM005505 scavenger receptor class B, member I
SCARFI NM 145349 scavenger receptor class F, member I isoform 2 SCCPDH NM 016002 saccharopine dehydrogenase (putative) SCG3 NM 013243 secretogranin III
SCMHI NM001031694 sex comb on midleg homolog 1 isoform I
SCML4 NM 198081 sex comb on midleg-like 4 SCN2B NM 004588 sodium channel, voltage-gated, type II, beta SCN3A NM 006922 sodium channel, voltage-gated, type lIl, alpha SCN4A NM 000334 voltage-gated sodium channel type 4 alpha SCN4B NM 174934 sodium channel, voltage-gated, type IV, beta SCN5A NM 000335 voltage-gated sodium channel type V alpha SCOC NM_032547 short coiled-coil protein SCOTIN NM 016479 scotin SCRNI NM 014766 secernin I
SDCI NM 001006946 syndecan I precursor SDCBP2 NM~015685 syndecan binding protein 2 isoform b SDHC NM_003001 succinate dehydrogenase complex, subunit C
SEC14L1 NM_003003 SEC14 (S. cerevisiae)-like I isoform a SEC14L4 NM 174977 SEC14p-like protein TAP3 SEC22C NM004206 SEC22 vesicle trafficking protein homolog C
SEC61A1 NM 013336 Sec61 alpha 1 subunit SECISBP2 NM 024077 SECIS binding protein 2 SEHIL NM_001013437 secl3-like protein isoform I
SELIL NM 005065 sel-1 suppressor of lin-12-like SELE NM000450 selectin E precursor SELENBPI NM003944 selenium binding protein I
SELI NM_033505 selenoprotein I
SELO NM_031454 selenoprotein 0 SELPLG NM 003006 selectin P ligand SELS NM018445 selenoprotein S
SEMA3B NM001005914 semaphorin 3B isoform 2 precursor SEMA3D NM_152754 semaphorin 3D
SEMA3E NM_012431 semaphorin 3E
SEMA3G NM020163 semaphorin sem2 SEMA4B NM_020210 semaphorin 4B precursor SEMA4F NM_004263 semaphorin W
SEMA5A NM 003966 semaphorin 5A

SEMA5B NM001031702 semaphorin 5B isoform I
SEMA6A NM020796 sema domain, transmembrane domain (TM), and SEMA6B NM_032108 semaphorin 6B isoform 3 precursor SEMA6D NM_020858 semaphorin 6D isoform I precursor SEMA7A NM 003612 semaphorin 7A
SENPI NM014554 sentrin/SUMO-specific protease 1 SENP2 NM_021627 SUMO1/sentrin/SMT3 specific protease 2 SEPN1 NM_020451 selenoproteinN, I isoform 1 precursor SEPT11 NM_018243 septin 11 SEPT2 NM_001008491 septin 2 SEPT3 NM_019106 septin 3 isoform B
SEPT9 NM006640 septin 9 SEPWI NM_003009 selenoprotein W, I
SERACI NM_032861 serine active site containing 1 SERBPI NM_001018067 SERPINEI mRNA binding protein I isoform I
SERHL NM_170694 serine hydrolase-like SERINC2 NM_178865 tumor differentially expressed 2-like SERPINAIO NM_016186 serine (or cysteine) proteinase inhibitor, clade SERPINB13 NM_012397 serine (or cysteine) proteinase inhibitor, clade SERPINB2 NM002575 serine (or cysteine) proteinase inhibitor, clade SERPINB7 NM 003784 serine (or cysteine) proteinase inhibitor, clade SERPTNB9 NM004155 serine (or cysteine) proteinase inhibitor, clade SERPINEI NM_000602 plasminogen activator inhibitor-1 SERPiNF2 NM_000934 alpha-2-plasmin inhibitor SERPiNGI NM000062 complement component 1 inhibitor precursor SESN1 NM014454 sestrin 1 SESN2 NM031459 sestrin 2 SETD3 NM032233 hypothetical protein LOC84193 isoform a SETD4 NM001007258 hypothetical protein LOC54093 isoform b SF1 NM 201997 splicing factor 1 isoform 4 SF3A1 NM_001005409 splicing factor 3a, subunit 1, 120kDa isoform 2 SF3A3 NM_006802 splicing factor 3a, subunit 3 SF4 NM_021164 splicing factor 4 isoform b SFRSI I NM_004768 splicing factor p54 SFRS12 NM139168 splicing factor, arginine/serine-rich 12 SFRS16 NM 007056 splicing factor, arginine/serine-rich 16 SFRS2 NM 003016 splicing factor, arginine/serine-rich 2 SFRS2IP NM 004719 splicing factor, arginine/serine-rich 2, SFRS5 NMy_006925 splicing factor, arginine/serine-rich 5 SFRS8 NM_152235 splicing factor, arginine/serine-rich 8 isoform SFT2D3 NM 032740 SFT2 domain containing 3 SFTPB NM000542 surfactant, pulmonary-associated protein B
SFXNI NM_022754 sideroflexin 1 SFXN2 NM_178858 sideroflexin 2 SFXN3 NM030971 sideroflexin 3 SFXN5 NM_144579 sideroflexin 5 SGCA NM 000023 sarcoglycan, alpha (5OkDa dystrophin-associated SGCD NM`000337 delta-sarcoglycan isoform I
SGK NM005627 serum/glucocorticoid regulated kinase SGK2 NM 016276 serum/glucocorticoid regulated kinase 2 isoform SGK3 NMV001033578 serum/glucocorticoid regulated kinase 3 isoform SH2D2A NM 003975 SH2 domain protein 2A
SH2D3C NMy170600 SH2 domain containing 3C isoform 2 SH3BGRL2 NM 031469 SH3 domain binding glutamic acid-rich protein SH3BP2 NM003023 SH3-domain binding protein 2 SH3BP4 NM_014521 SH3-domain binding protein 4 SI-I3BP5L NM030645 SH3-binding domain protein 5-like SH3GL2 NM 003026 SH3-domain GRB2-like 2 SH3PX3 NM_153271 SH3 and PX domain containing 3 SH3PXD2B NM_001017995 SH3 and PX domains 2B
SHANK2 NM012309 SH3 and multiple ankyrin repeat domains 2 SHC3 NM016848 src homology 2 domain containing transforming SHF NM_138356 hypothetical protein LOC90525 SHOC2 NM_007373 soc-2 suppressor of clear homolog SHOX NM_006883 short stature homeobox isoform b SHOX2 NM003030 short stature homeobox 2 isoform b SHRM NM_020859 shroom SIAHl NM 001006610 seven in absentia homolog 1 isoform b SIAHBPI NM_014281 fuse-binding protein-interacting repressor SIDTI NM_017699 SIDI transmembrane family, member 1 SIM2 NM 005069 single-minded homolog 2 long isoform SIPAIL2 NM020808 signal-induced proliferation-associated 1 like SIRPA NM 080792 signal-regulatory protein alpha precursor SIRPB I NM006065 signal-regulatory protein beta I precursor SIRT4 NM 012240 sirtuin 4 SIRT5 NM~031244 sirtuin 5 isoform 2 SIX4 NM 017420 sine oculis homeobox homolog 4 SKI NM_003036 v-ski sarcoma viral oncogene homolog SKIP NM_030623 sphingosine kinase type -interacting protein SLCI lA2 NM 000617 solute carrier family I 1(proton-coupled SLCI2A2 NM 001046 solute carrier family 12 SLC12A5 NM 020708 solute carrier family 12 member 5 SLC12A7 NM 006598 solute carrier family 12 (potassium/chloride SLC12A8 NM 024628 solute carrier family 12, member 8 SLC13A1 NM_022444 solute carrier family 13 (sodium/sulfate SLC13A3 NM 001011554 solute carrier family 13 member 3 isoform b SLC13A5 NM 177550 solute carrier family 13 (sodium-dependent SLC15A4 NM 145648 solute carrier family 15, member 4 SLC16A14 NM 152527 solute carrier family 16 (monocarboxylic acid SLC16A3 NM 004207 solute carrier family 16, member 3 SLC16A8 NM013356 solute carrier family 16, member 8 SLC18AI NM_003053 solute carrier family 18 (vesicular monoamine), SLC18A3 NM 003055 solute carrier family 18 (vesicular SLC19A2 NM006996 solute carrier family 19, member 2 SLC1A2 NM_004171 solute carrier family 1, member 2 SLC2OA2 NM 006749 solute carrier family 20, member 2 SLC22A13 NM004256 organic cation transporter like 3 SLC22A15 NM 018420 solute carrier family 22 (organic cation SLC22A17 NM_016609 solute carrier family 22 (organic cation SLC22A2 NM_003058 solute carrier family 22 member 2 isoform a SLC22A7 NM_153320 solute carrier family 22 member 7 isoform b SLC24A1 NM_004727 solute carrier family 24 SLC24A3 NM 020689 solute carrier family 24 SLC24A4 NM 153646 solute carrier family 24 member 4 isoform I
SLC24A6 NM 024959 solute carrier family 24 member 6 SLC25A12 NM 003705 solute carrier family 25 (mitochondrial carrier, SLC25A15 NM014252 solute carrier family 25 (mitochondrial carrier;
SLC25A19 NM_021734 solute carrier family 25 (mitochondrial SLC25A2 NM031947 solute carrier family 25 member 2 SLC25A22 NM_024698 mitochondrial glutamate carrier 1 SLC25A29 NM_152333 solute carrier family 25, member 29 isoform a SLC25A3 NM_213612 solute carrier family 25 member 3 isoform c SLC25A34 NM_207348 solute carrier family 25, member 34 SLC25A35 NM201520 solute carrier family 25, member 35 SLC26A1 NM022042 solute carrier family 26, member 1 isoform a SLC26A10 NM001018084 solute carrier family 26, member 10 isoform I
SLC26A2 NM_000112 solute carrier family 26 member 2 SLC26A4 NM_000441 pendrin SLC28A1 NM_201651 solute carrier family 28 (sodium-coupled SLC29A2 NM_001532 solute carrier family 29 (nucleoside SLC2AI4 NM_153449 glucose transporter 14 SLC2A3 NM_006931 solute carrier family 2 (facilitated glucose SLC2A4 NM_001042 glucose transporter 4 SLC2A8 NM_014580 solute carrier family 2, (facilitated glucose SLC30A10 NM_001004433 solute carrier family 30 (zinc transporter), SLC30A4 NM013309 solute carrier family 30 (zinc transporter), SLC30A8 NM_173851 solute carrier family 30 member 8 SLC31A1 NM_001859 solute carrier family 31 (copper transporters), SLC35A4 NM_080670 solute carrier family 35, member A4 SLC35B2 NM_178148 solute carrier family 35, member B2 SLC35C] NM_018389 solute carrier family 35, member Cl SLC35E1 NM024881 solute carrier family 35, member EI
SLC36A1 NM_078483 solute carrier family 36 member 1 SLC36A2 NM181776 solute carrier family 36 (proton/amino acid SLC37A2 NM198277 solute carrier family 37 (glycerol-3-phosphate SLC38A3 NM006841 solute carrier family 38, member 3 SLC38A4 NM018018 solute carrier family 38, member 4 SLC39AI NM_014437 solute carrier family 39 (zinc transporter), SLC39AI0 NM020342 solute carrier family 39 (zinc transporter), SLC39A7 NM 006979 solute carrier family 39 (zinc transporter), SLC39A9 NM018375 solute carrier family 39 (zinc transporter), SLC3A1 NM000341 solute carrier family 3, member 1 SLC41A2 NM_032148 solute carrier family 41, member 2 SLC41A3 NM_001008487 solute carrier family 41, member 3 isoform 4 SLC43A1 NM 003627 solute carrier family 43, member I
SLC44A1 NM~080546 CDW92 antigen isoform 2 SLC44A2 NM_020428 CTL2 protein SLC45A2 NM001012509 membrane-associated transporter protein isoform SLC45A3 NM_033102 prostein SLC4A4 NM 003759 solute carrier family 4, sodium bicarbonate SLC4A7 NM003615 solute carrier family 4, sodium bicarbonate SLC6A1 NM_003042 solute carrier family 6 (neurotransmitter SLC6AI4 NM_007231 solute carrier family 6 (amino acid SLC6A17 NM001010898 solute carrier family 6, member 17 SLC6A2 NM_001043 solute carrier family 6 member 2 SLC6A4 NM_001045 solute carrier family 6 member 4 SLC6A6 NM_003043 solute carrier family 6 (neurotransmitter SLC6A8 NM_005629 solute carrier family 6 (neurotransmitter SLC6A9 NM 001024845 solute carrier family 6 member 9 isoform 3 SLC7A1 NM003045 soiute carrier family 7(cationic amino acid SLC7A2 NM_001008539 solute carrier family 7, member 2 isoform I
SLC7A5 NM 003486 solute carrier family 7 (cationic amino acid SLC7A6 NM_003983 solute carrier family 7 (cationic amino acid SLC8A3 NM182933 solute carrier family 8 member 3 isoform E
SLC9AI NM003047 solute carrier family 9, isoform A1 SLC9A3R2 NM004785 solute carrier family 9 isoform 3 regulator 2 SLC9A5 NM 004594 solute carrier family 9(sodium/hydrogen SLC9A6 NM_006359 solute carrier family 9(sodium/hydrogen SLC9A8 NM_015266 Na+/H+ exchanger isoform 8 SLCO2A1 NM005630 solute carrier organic anion transporter family, SLCO4C1 NM180991 solute carrier organic anion transporter family, SLFN11 NM152270 schlafen family member 1 I
SLFN13 NM144682 schlafen family member 13 SLFNLI NM144990 hypothetical protein LOC200172 SLITRKI NM 052910 slit and trk like 1 protein SLITRK2 NM032539 SLIT and NTRK-like family, member 2 SLITRK6 NM 032229 slit and trk like 6 SLN NM 003063 sarcolipin SLURPI NM_020427 ARS component B precursor SMAD2 NM 001003652 Sma- and Mad-related protein 2 SMAD3 NM005902 MAD, mothers against decapentaplegic homolog 3 SMAD5 NM001001419 SMAD, mothers against DPP homolog 5 SMAD7 NM 005904 MAD, mothers against decapentaplegic homolog 7 SMAF1 NM001018082 small adipocyte factor I
SMAP1 NM021940 stromal membrane-associated protein SMAPIL NM022733 stromal membrane-associated protein 1-like SMARCAI NM003069 SWI/SNF-related matrix-associated SMARCD2 NM003077 SWI/SNF-related matrix-associated SMC1L1 NM 006306 SMCI structural maintenance of chromosomes SMC6LI NM024624 SMC6 protein SMCR8 NM144775 Smith-Magenis syndrome chromosome region, SMG5 NM 015327 Estlp-like protein B
SMG6 NM017575 Smg-6 homolog, nonsense mediated mRNA decay SMPD1 NM 000543 sphingomyelin phosphodiesterase 1, acid SMPD3 NM018667 sphingomyelin phosphodiesterase 3, neutral SMURFI NM 020429 Smad ubiquitination regulatory factor I isoform SMURF2 NM022739 SMAD specific E3 ubiquitin protein ligase 2 SMYDI NM 198274 SET and MYND domain containing I
SMYD4 NM052928 SET and MYND domain containing 4 SMYD5 NM 006062 SMYD family member 5 SNAP23 NM003825 synaptosomal-associated protein 23 isoform SNAP25 NM003081 synaptosomal-associated protein 25 isoform SNCG NM_003087 synuclein, gamma (breast cancer-specific protein SNFILK NM 173354 SNF1-like kinase SNFILK2 NM_015191 SNF1-like kinase 2 SNIP1 NM_024700 Smad nuclear interacting protein SNN NM003498 Stannin SNPH NM_014723 syntaphilin SNRK NM017719 SNF related kinase SNRPAI NM 003090 small nuclear ribonucleoprotein polypeptide A' SNRPC NM003093 small nuclear ribonucleoprotein potypeptide C
SNRPDI NM 006938 small nuclear ribonucleoprotein D1 polypeptide SNTB2 NM130845 basic beta 2 syntrophin isoform b SNURF NM_005678 SNRPN upstream reading frame protein SNXI NM_003099 sorting nexin 1 isoform a SNX1 I NM_013323 sorting nexin 11 SNX16 NM022133 sorting nexin 16 isoform a SNX19 NM_014758 sorting nexin 19 SNX6 NM_021249 sorting nexin 6 isoform a SNX9 NM 016224 sorting nexin 9 SOCS5 NM014011 suppressor of cytokine signaling 5 SOCS6 NM004232 suppressor of cytokine signaling 6 SOD3 NM_003102 superoxide dismutase 3, extracellular SON NM032195 SON DNA-binding protein isoform B
SORBSI NM_015385 sorbin and SH3 domain containing 1 isoform 2 SORBS2 NM_003603 sorbin and SH3 domain containing 2 isoform 1 SORCSI NM_001013031 SORCS receptor I isoform b SORCS2 NM020777 VPS10 domain receptor protein SORCS 2 SORT1 NM_002959 sortilin I preproprotein SOST NM 025237 scierostin precursor SOX1 NM_005986 SRY (sex determining region Y)-box I
SOXI1 NM_003108 SRY-box 11 SOX13 NM005686 SRY-box 13 SOX3 NM 005634 SRY (sex determining region Y)-box 3 SOX4 NM003107 SRY (sex determining region Y)-box 4 SOX5 NM006940 SRY (sex determining region Y)-box 5 isoform a SOX9 NM_000346 transcription factor SOX9 SP5 NM 001003845 Sp5 transcription factor SP8 NM182700 Sp8 transcription factor isoform 1 SPATA18 NM_145263 spermatogenesis associated 18 homolog SPATA21 NM_198546 spermatogenesis associated 21 SPATA3 NM_139073 testis and spermatogenesis cell apoptosis SPDEF NM012391 SAM pointed domain containing ets transcription SPEN NMOI5001 spen homolog, transcriptional regulator SPFH2 NM007175 SPFH domain family, member 2 isoform 1 SPG20 NM 015087 spartin SPG7 NM_199367 paraplegin isoform 2 SPHK2 NM_020126 sphingosine kinase type 2 isoform SPINT2 NM_021102 serine protease inhibitor, Kunitz type, 2 SPIRE2 NM_032451 spire homolog 2 SPN NM_001030288 sialophorin SPOCK2 NM014767 sparc/osteonectin, cwcv and kazal-like domains SPON2 NM012445 spondin 2, extracellular matrix protein SPP2 NM_006944 secreted phosphoprotein 2, 24kDa SPPL2B NM_152988 signal peptide peptidase-like 2B isoform 2 SPPL3 NM_139015 SPPL3 protein SPREDI NM_152594 sprouty-related protein I with EVH-1 domain SPRN NM_001012508 shadow of prion protein SPRRIB NM003125 small proline-rich protein 1B
SPRY3 NM 005840 sprouty homolog 3 SPRY4 NM_030964 sprouty homolog 4 SPRYD3 NM_032840 hypothetical protein LOC84926 SPSB2 NM_032641 SPRY domain-containing SOCS box protein SSB-2 SPSB3 NM_080861 SPRY domain-containing SOCS box protein SSB-3 SPSB4 NM 080862 SPRY domain-containing SOCS box protein SSB-4 SPTANI NM 003127 spectrin, alpha, non-erythrocytic 1 SPTB NM001024858 spectrin beta isoform a SPTBN2 NM006946 spectrin, beta, non-erythrocytic 2 SPTLCI NM 006415 serine palmitoyltransferase subunit I isoform a SPTY2D1 NM194285 hypothetical protein LOC144108 SRC NM 005417 proto-oncogene tyrosine-protein kinase SRC
SRD5A2 NM000348 3-oxo-5 alpha-steroid 4-dehydrogenase 2 SREBFI NM_001005291 sterol regulatory element binding transcription SRP72 NM_006947 signal recognition particle 72kDa SRPKI NM_003137 SFRS protein kinase 1 SRPR NM_003139 signal recognition particle receptor (docking SRPRB NM021203 signal recognition particle receptor, beta SRPX NM_006307 sushi-repeat-containing protein, X-linked SRXNI NM080725 sulfiredoxin I homolog SSH3 NM017857 slingshot homolog 3 isoform I
SSRI NM_003144 signal sequence receptor, alpha SSRPl NM_003146 structure specific recognition protein I
SSU72 NM_014188 Ssu72 RNA polymerase II CTD phosphatase homolog ST3GAL4 NM006278 ST3 beta-galactoside alpha-2,3-sialyltransferase ST3GAL5 NM_003896 sialyltransferase 9 ST5 NM005418 suppression of tumorigenicity 5 isoform 1 ST6GALI NM003032 sialyltransferase 1 isoform a ST7L NM_017744 suppression of tumorigenicity 7-like isoform I
ST8SIA3 NM015879 ST8 alpha-N-acetyl-neuraminide ST8SIA5 NM_013305 ST8 alpha-N-acetyl-neuraminide STAC2 NM_198993 SH3 and cysteine rich domain 2 STARD 13 NM052851 START domain containing 13 isoform gamma STARD3 NM_006804 steroidogenic acute regulatory protein related STAT3 NM_003150 signal transducer and activator of transcription STAT5B NM012448 signal transducer and activator of transcription STCI NM 003155 stanniocalcin I precursor STEAP2 NM~152999 six transmembrane epithelial antigen of the STEAP3 NM~001008410 dudulin 2 isoform b STIM1 NM 003156 stromal interaction molecule 1 precursor STIM2 NMy_020860 stromal interaction molecule 2 STIP1 NM_006819 stress-induced-phosphoprotein 1 STKIO NM005990 serine/threonine kinase 10 STKI 1 N1vI_000455 serine/threonine protein kinase 11 STK17A NM_004760 serine/threonine kinase 17a STK19 NM004197 serine/threonine kinase 19 isoform 1 STK32B NM 018401 serine/threonine kinase 32B
STK32C NM_173575 serine/threonine kinase 32C
STK33 NM_030906 serine/threonine kinase 33 STK35 NM_080836 serine/threonine kinase 35 STK38 NM_007271 serine/threonine kinase 38 STK38L NM015000 serine/threonine kinase 38 like STOMLI NM_004809 stomatin (EPB72)-like I
STON1 NM006873 stonin I
STOX2 NM_020225 storkhead box 2 STX16 NM001001433 syntaxin 16 isoform a STX17 NM017919 syntaxin 17 STX1A NM_004603 syntaxin 1A (brain) STX3 NM 004177 syntaxin 3A

STX5 NM_003164 syntaxin 5 STX6 NM_005819 syntaxin 6 STXBPI NM_001032221 syntaxin binding protein i isoform b STXBP3 NM007269 syntaxin binding protein 3 STXBP4 NM178509 syntaxin binding protein 4 STXBP5 NM_139244 tomosyn SUFU NM_016169 suppressor of fused SUHW3 NM_017666 suppressor of hairy wing homolog 3 SUHW4 NM 001002843 suppressor of hairy wing homolog 4 isoform 2 SULT4AI NMy_014351 sulfotransferase family 4A, member 1 SUMO3 NM_006936 small ubiquitin-like modifier protein 3 SUPT16H NM_007192 chromatin-specific transcription elongation SUPT6H NM003170 suppressor of Ty 6 homolog SUPT7L NM_014860 SPTF-associated factor 65 gamma SURF4 NM033161 surfeit 4 SURF5 NM_133640 surfeit 5 isoform b SUSDI NM_022486 sushi domain containing I
SUV420H1 NM_016028 suppressor of variegation 4-20 homolog 1 isoform SUV420H2 NM_032701 suppressor of variegation 4-20 homolog 2 SUZ12 NM_015355 joined to JAZFI
SVH NM_031905 SVH protein SVIL NM_003174 supervillin isoform I
SWAP70 NM_015055 SWAP-70 protein SYBL1 NM_005638 synaptobrevin-like 1 SYDEI NM_033025 synapse defective 1, Rho GTPase, homolog 1 SYN2 NM 003178 synapsin II isoform IIb SYNEI NM_015293 nesprin I isoform beta SYNGRI NM_004711 synaptogyrin 1 isoform la SYNGR3 NM_004209 synaptogyrin 3 SYNJI NM003895 synaptojanin 1 isoform a SYPLI NM_006754 synaptophysin-like I isoform a SYT10 NM_198992 synaptotagmin 10 SYT12 NM_177963 synaptotagmin XII
SYT15 NM_031912 synaptotagmin XV isoform a SYT3 NM_032298 synaptotagmin 3 SYT4 NM_020783 synaptotagmin IV
SYT6 NM_205848 synaptotagmin VI
SYT8 NM_138567 synaptotagmin VIII
SYTL2 NM 032379 synaptotagmin-like 2 isoform b SYTL4 NM080737 synaptotagmin-like 4 (granuphilin-a) TAB3 NM_152787 TAK1-binding protein 3 isoform 1 TACCI NM006283 transforming, acidic coiled-coil containing TAF15 NM003487 TBP-associated factor 15 isoform 2 TAFI C NM005679 TBP-associated factor 1 C isoform 1 TAF5 NM006951 TBP-associated factor 5 TAF7 NM005642 TATA box-binding protein-associated factor 2F
TAF7L NM024885 TATA box binding protein-associated factor, RNA
TAF9B NM_015975 transcription associated factor 9B
TAGLN2 NM_003564 transgelin 2 TALI NM_003189 T-cell acute lymphocytic leukemia 1 TAOKl NM020791 TAO kinase I
TAP2 NM000544 transporter 2, ATP-binding cassette, sub-family TAPBP NM 003190 tapasin isoform I precursor TARBPI NM_005646 TAR RNA binding protein 1 TARBP2 NM004178 TAR RNA binding protein 2 isoform b TASPI NM_017714 taspase 1 TAT NM_000353 tyrosine aminotransferase TAXIBP3 NM014604 Taxl (human T-cell leukemia virus type I) TAZ NM_000116 tafazzin isoform 1 TBC1D1 NM 015173 TBCI (tre-2/USP6, BUB2, cdc16) domain family, TBC1D10B NM_015527 TBC1 domain family, member lOB
TBCID13 NM_018201 TBCI domain family, member 13 TBC1D14 NM020773 TBC1 domain family, member 14 TBCIDI9 NM_018317 TBC1 domain family, member 19 TBC1D22A NM 014346 TBCI domain family, member 22A
TBC1D22B NM017772 TBCI domain family, member 22B
TBCID2B NM_015079 TBCI domain family, member 2B
TBCID3C NM_001001418 TBC1 domain family member 3C
TBC1D8 NM007063 TBCI domain family, member 8 TBCID9 NM_O15130 hypothetical protein LOC23158 TBCC NM003192 beta-tubulin cofactor C
TBCCDI NM_018138 TBCC domain containing 1 TBKl NM_013254 TANK-binding kinase I
TBLIX NM 005647 transducin beta-like I X
TBLIXRI NM024665 nuclear receptor co-repressor/HDAC3 complex TBL2 NM012453 transducin (beta)-like 2 TBP NM_003194 TATA box binding protein TBPLI NM 004865 TBP-like I
TBRGI NM032811 transforming growth factor beta regulator 1 TBX1 NM_005992 T-box 1 isoform B
TBX2 NM005994 T-box 2 TBX6 NM004608 T-box 6 isoform I
TCAP NM_003673 telethonin TCEB2 NM_007108 elongin B isoform a TCFI NM000545 transcription factor 1, hepatic TCF21 NM_198392 transcription factor 21 TCF3 NM_003200 transcription factor 3 TCF7 NM003202 transcription factor 7(T-cell specific, TCFL5 NM 006602 transcription factor-like 5 protein TCHP NM_032300 trichoplein TCL6 NM_014418 T-cell leukemia/lymphoma 6 isoform TCL6a2 TDGF1 NM003212 teratocarcinoma-derived growth factor 1 TEAD1 NM 021961 TEA domain family member I
TEDDMI NM_172000 putative membrane protein HE9 TES NM015641 testin isoform 1 TEX261 NM_144582 testis expressed sequence 261 TFAP2A NM 001032280 transcription factor AP-2 alpha isoform b TFAP2C NM003222 transcription factor AP-2 gamma TFAP2D NM_172238 transcription factor AP-2 beta-like 1 TFAP2E NM178548 transcription factor AP-2 epsilon (activating TFAP4 NM_003223 transcription factor AP-4 (activating enhancer TFCP2L1 NM_014553 LBP-9 TFEC NM_001018058 transcription factor EC isoform b TFG NM_001007565 TRK-fused gene TFPI2 NM_006528 tissue factor pathway inhibitor 2 TGFBRI NM 004612 transforming growth factor, beta receptor I

TGFBR3 NM_003243 transforming growth factor, beta receptor III
TGIF2 NM021809 TGFB-induced factor 2 TGIF2LY NM139214 TGFB-induced factor 2-like, Y-linked TGOLN2 NM_006464 trans-golgi network protein 2 THAP2 NM031435 THAP domain containing, apoptosis associated THAP6 NM_144721 THAP domain containing 6 THBS2 NM003247 thrombospondin 2 precursor THEM4 NM_053055 thioesterase superfamily member 4 isoform a THSD3 NM_182509 thrombospondin, type I domain containing 3 THSD4 NM024817 hypothetical protein LOC79875 THUMPDI NM_017736 THUMP domain containing I
THYNI NM_014174 thymocyte nuclear protein 1 isoform I
TIAFI NM_004740 TGFB1-induced anti-apoptotic factor I
TIGAI NM_053000 hypothetical protein LOC114915 TIGD6 NM_030953 hypothetical protein LOC81789 TIMM13 NM012458 translocase of inner mitochondrial membrane 13 TIMM22 NM013337 translocase of inner mitochondrial membrane 22 TIMM50 NM001001563 translocase of inner mitochondrial membrane 50 TIMP2 NM_003255 tissue inhibitor of metalloproteinase 2 TK2 NM_004614 thymidine kinase 2, mitochondrial TKTLI NM012253 transketolase-like I
TLE4 NM_007005 transducin-like enhancer protein 4 TLKI NM012290 tousled-like kinase 1 TLK2 NM_006852 tousled-like kinase 2 TLLI NM012464 tolloid-like 1 TLL2 NM_012465 tolloid-like 2 TLN1 NM_006289 talin 1 TLOC1 NM 003262 translocation protein 1 TLRI NM003263 toll-like receptor 1 TLR4 NM_138554 toll-like receptor 4 precursor TLR7 NM_016562 toll-like receptor 7 TLX2 NM_016170 T-cell leukemia, homeobox 2 TM2D2 NM_001024380 TM2 domain containing 2 isoform b TM4SFI NM014220 transmembrane 4 superfamily member 1 TM9SF4 NM014742 transmembrane 9 superfamily protein member 4 TMCCI NM001017395 transmembrane and coiled-coil domains 1 isoform TMCC3 NM 020698 transmembrane and coiled-coil domains 3 TMED3 NM_007364 transmembrane emp24 domain containing 3 TMED9 NM017510 transmembrane emp24 protein transport domain TMEM10 NM_033207 transmembrane protein 10 isoform a TMEM100 NM_018286 hypothetical protein LOC55273 TMEM101 NM_032376 hypothetical protein LOC84336 TMEM104 NM_017728 hypothetical protein LOC54868 TMEM105 NM_178520 hypothetical protein LOC284186 TMEM106A NM145041 hypothetical protein LOC113277 TMEM 109 NM_024092 transmembrane protein 109 TMEM113 NM_025222 hypothetical protein PR02730 TMEM119 NM_181724 hypothetical protein LOC338773 TMEM123 NM_052932 pro-oncosis receptor inducing membrane injury TMEM127 NM_017849 hypothetical protein LOC55654 TMEM134 NM_025124 hypothetical protein LOC80194 TMEM135 NM_022918 hypothetical protein LOC65084 TMEM138 NM 0 16464 hypothetical protein LOC51524 WO 2008/073923 PCT/iJS2007/087038 TMEM139 NM_153345 hypothetical protein LOC135932 TMEM143 NM_018273 hypothetical protein LOC55260 TMEM16C NM_031418 transmembrane protein 16C
TMEMI6F NM_001025356 transmembrane protein 16F
TMEM16G NM_001001891 transmembrane protein 16G isoform NGEP long TMEMI6K NM_018075 hypothetical protein LOC55129 TMEM18 NM_152834 transmembrane protein 18 TMEM20 NM_153226 transmembrane protein 20 TMEM26 NM_178505 transmembrane protein 26 TMEM30B NM001017970 transmembrane protein 30B
TMEM33 NM_018126 transmembrane protein 33 TMEM35 NM_021637 transmembrane protein 35 TMEM43 NM_024334 transmembrane protein 43 TMEM45B NM_138788 transmembrane protein 45B
TMEM47 NM_031442 transmembrane 4 superfamily member 10 TMEM49 NM_030938 transmembrane protein 49 TMEM50B NM_006134 transmembrane protein 50B
TMEM52 NM_178545 transmembrane protein 52 TMEM55A NM_018710 transmembrane protein 55A
TMEM55B NM_144568 transmembrane protein 55B
TMEM63C NM_020431 transmembrane protein 63C
TMEM79 NM_032323 hypothetical protein LOC84283 TMEMB NM021259 transmembrane protein 8 (five membrane-spanning TMEM85 NM_016454 hypothetical protein LOC51234 TMEM86A NM_153347 hypothetical protein LOC144110 TMEM86B NM_173$04 hypothetical protein LOC255043 TMEM87A NM_015497 hypothetical protein LOC25963 TMEM87B NM_032824 hypothetical protein LOC84910 TMEPAI NM_020182 transmembrane prostate androgen-induced protein TMIE NM147196 transmembrane inner ear protein TMODI NM_003275 tropomodulin I
TMPRSS13 NM032046 transmembrane protease, serine 13 TMPRSS3 NM_024022 transmembrane protease, serine 3 isoform I
TMPRSS4 NM_019894 transmembrane protease, serine 4 isoform 1 TMTC2 NM_152588 hypothetical protein LOC160335 TNFAIPI NM021137 tumor necrosis factor, alpha-induced protein 1 TNFAIP8L1 NM 152362 tumor necrosis factor, alpha-induced protein TNFAIP8L3 NM 207381 tumor necrosis factor, alpha-induced protein TNFRSFIOB NM 003842 tumor necrosis factor receptor superfamily, TNFRSFIOD NM_003840 tumor necrosis factor receptor superfamily, TNFRSF13B NM_012452 tumor necrosis factor receptor 13B
TNFRSFI4 NM_003820 tumor necrosis factor receptor superfamily, TNFRSF19 NM_148957 tumor necrosis factor receptor superfamily, TNFRSFI9L NM_032871 tumor necrosis factor receptor superfamily, TNFSF7 NM_001252 tumor necrosis factor ligand superfamily, member TNFSF9 NM_003811 tumor necrosis factor (ligand) superfamily, TNIP1 NM_006058 Nef-associated factor I
TNIP2 NM_024309 A20-binding inhibitor of NF-kappaB activation 2 TNK2 NM_001010938 tyrosine kinase, non-receptor, 2 isoform 2 TNNI1 NM_003281 troponin 1, skeletal, slow TNRC6B NM001024843 trinucleotide repeat containing 6B isoform 2 TNSI NM 022648 tensin TNS3 NM 022748 tensin-like SH2 domain containing 1 TNT NM 182831 hypothetical protein LOC162083 TOB2 NM016272 transducer of ERBB2, 2 TOLLIP NM 019009 toll interacting protein TOMI NM_005488 target of mybl TOM1L2 NM_001033551 target of mybl-like 2 isoform I
TOMM20 NM014765 translocase of outer mitochondrial membrane 20 TOMM34 NM006809 translocase of outer mitochondrial membrane 34 TOR1B NM014506 torsin family 1, member B (torsin B) TOR3A NM_022371 torsin family 3, member A
TP53111 NM_006034 p53-induced protein TP531NP2 NM021202 tumor protein p53 inducible nuclear protein 2 TP53TG3 NM016212 hypothetical protein LOC24150 TP73L NM003722 tumor protein p73-like TPCN2 NM139075 two pore segment channel 2 TPD52L3 NM 033516 protein kinase NYD-SP25 isoform I
TpM1 NM_001018004 tropomyosin 1 alpha chain isoform 3 TPM2 NM 003289 tropomyosin 2 (beta) isoform 1 TPM3 NM_153649 tropomyosin 3 isoform 2 TPPP NNI_007030 brain-specific protein p25 alpha TPRXI NM_198479 tetra-peptide repeat homeobox TRAF] NM_005658 TNF receptor-associated factor 1 TRAF4 NM004295 TNF receptor-associated factor 4 isoform 1 TRAF5 NM_001033910 TNF receptor-associated factor 5 TRAF7 NM_032271 ring finger and WD repeat domain I isoform 1 TRAFDI NM_006700 FLN29 gene product TRAK1 NM_014965 OGT(O-Glc-NAc transferase)-interacting protein TRAM1 NM_014294 translocating chain-associating membrane TRAM2 NM_012288 translocation-associated membrane protein 2 TREML2 NM_024807 triggering receptor expressed on myeloid TRIAD3 NM_207111 TRIAD3 protein isoform a TRIMIO NM_006778 tripartite motif-containing 10 isoform 1 TRIMl ] NM_145214 tripartite motif-containing 11 TRIM14 NM_014788 tripartite motif protein TRIM14 isoform alpha TRIM2 NM_015271 tripartite motif-containing 2 TRIM29 NM_012101 tripartite motif protein TRIM29 isoform alpha TRIM35 NM_015066 tripartite motif-containing 35 isoform I
TRIM36 NM_018700 tripartite motif-containing 36 isoform 1 TRIM37 NM_015294 tripartite motif-containing 37 protein TRIM56 NM_030961 tripartite motif-containing 56 TRIM6 NM_001003818 tripartite motif-containing 6 isoform 1 TRIM62 NM_018207 tripartite motif-containing 62 TRIM68 NM_018073 ring finger protein 137 TRIM7 NM203293 tripartite motif-containing 7 isoform 1 TRIM9 N]VI_015163 tripartite motif protein 9 isoform I
TRIP10 NM 004240 thyroid hormone receptor interactor 10 TRIT1 NM017646 tRNA isopentenyltransferase 1 TRMT5 NM_020810 tRNA-(N I G37) methyltransferase TRMU NM_001008568 tRNA 5-methylaminomethyl-2-thiouridylate TRPCI NM 003304 transient rece tor potential cation channel, TRPC4AP NM_015638 TRPC4-associated protein isoform a TRPM2 NM001001188 transient receptor potential cation channel, TRPV1 NM018727 transient receptor potential cation channel, TSCI NM 000368 tuberous sclerosis 1 protein isoform 1 TSC22D1 NM006022 TSC22 domain family I isoform 2 TSC22D2 NM_014779 TSC22 domain family 2 TSC22D3 NM001015881 TSC22 domain family, member 3 isoform 3 TSGAI3 NM_052933 testis specific, 13 TSHR NM001018036 thyroid stimulating hormone receptor isoform 2 TSN NM 004622 translin TSPAN14 NM030927 tetraspanin 14 TSPAN15 NM_012339 transmembrane 4 superfamily member 15 TSPAN17 NM001006616 transmembrane 4 superfamily member 17 isoform c TSPAN18 NM_130783 tetraspanin 18 isoform 2 TSPAN3 NM005724 transmembrane 4 superfamily member 8 isoform 1 TSPAN33 NM_178562 penumbra TSPAN5 NM_005723 transmembrane 4 superfamily member 9 TSPAN9 NM_006675 tetraspanin 9 TSPYL2 NM022117 TSPY-like 2 TSPYL4 NM_021648 TSPY-like 4 TSPYL5 NM_033512 TSPY-like 5 TSPYL6 NM_001003937 TSPY-like 6 TSSK6 NM 032037 serine/threonine protein kinase SSTK
TTBKI NM032538 tau tubulin kinase 1 TTC1 NM_003314 tetratricopeptide repeat domain 1 TTC13 NM_024525 tetratricopeptide repeat domain 13 TTC21B NM_024753 tetratricopeptide repeat domain 21B
TTC23 NM_001018029 tetratricopeptide repeat domain 23 isoform 1 TTC25 NM_031421 hypothetical protein LOC83538 TTLL12 NM_015140 hypothetical protein LOC23170 TTLL5 NM_015072 tubulin tyrosine ligase-like family, member 5 TTLL9 NM_001008409 tubulin tyrosine ligase-like family, member 9 TTYH3 NM_025250 tweety 3 TUB NM_003320 tubby isoform a TUBA2 NM_006001 tubulin, alpha 2 isoform 1 TUBA3 NM006009 tubulin, alpha 3 TUBB NM_178014 tubulin, beta polypeptide TUBB3 NM006086 tubulin, beta, 4 TUFTI NM020127 tuftelin I
TULP3 NM_003324 tubby like protein 3 TUSC5 NM_172367 LOST1 TXLNA NM_175852 taxilin TXN2 NM_012473 thioredoxin 2 precursor TXNDC5 NM_022085 thioredoxin domain containing 5 isoform 2 TXNIP NM_006472 thioredoxin interacting protein TXNL4A NM006701 thioredoxin-like 4A
TYRO3 NM_006293 TYRO3 protein tyrosine kinase TYSNDI NM_173555 trypsin domain containing I isoform a UAP1L1 NM_207309 UDP-N-acteylglucosamine pyrophosphorylase I-like UBADCI NM_016172 ubiquitin associated domain containing 1 UBAP1 NM_016525 ubiquitin associated protein 1 UBASH3A NM001001895 ubiquitin associated and SH3 domain containing, UBE2A NM_003336 ubiquitin-conjugating enzyme E2A isoform I
UBE2B NM_003337 ubiquitin-conjugating enzyme E2B
UBE2H NM003344 ubiquitin-conjugating enzyme E2H isoform 1 UBE2I NM_003345 ubiquitin-conjugating enzyme E21 UBE2J1 NM 016021 ubiquitin-conjugating enzyme E2, J1 UBE2J2 NM058167 ubiquitin conjugating enzyme E2, J2 isoform 2 UBE2O NM022066 ubiquitin-conjugating enzyme E20 UBE2Ql NM017582 ubiquitin-conjugating enzyme E2Q
UBE2Q2 NM_173469 ubiquitin-conjugating enzyme E2Q (putative) 2 UBE2R2 NM_017811 ubiquitin-conjugating enzyme UBC3B
UBE2V1 NM_001032288 ubiquitin-conjugating enzyme E2 variant I
UBE2Z NM_023079 ubiquitin-conjugating enzyme E2Z (putative) UBE3C NM_014671 ubiquitin protein ligase E3C
UBE4A NM_004788 ubiquitination factor E4A
UBE4B NM_006048 ubiquitination factor E4B
UBL3 NM_007106 ubiquitin-like 3 UBL4A NM_014235 ubiquitin-like 4 UBL4B NM_203412 hypothetical protein LOC164153 UBNI NM016936 ubinuclein 1 UBOX5 NM_014948 U-box domain containing 5 isoform a UBP1 NM_014517 upstream binding protein 1(LBP-1a) UBTD1 NM 024954 ubiquitin domain containing 1 UBXD2 NM_014607 UBX domain containing 2 UBXD3 NM_152376 UBX domain containing 3 UBXD8 NM_014613 UBX domain containing 8 UCP2 NM_003355 uncoupling protein 2 UHMKI NM_175866 kinase interacting stathmin ULKI NM003565 unc-5l-like kinase I
UMOD NM_001008389 uromodulin precursor UNC13D NM_199242 unc-13 homolog D
UNC5D NM_080872 netrin receptor Unc5h4 UNC84A NM_025154 unc-84 homolog A
UNC84B NM_015374 unc-84 homolog B
UNG NM_003362 uracil-DNA glycosylase isoform UNGI precursor UNG2 NM_001024592 uracil-DNA glycosylase 2 isoform b UNQ9370 NM_207447 hypothetical protein LOC400454 UPF1 NM002911 regulator of nonsense transcripts 1 UQCR NM006830 ubiquinol-cytochrome c reductase, 6.4kDa URG4 NM_017920 hypothetical protein LOC55665 UROS NM_000375 uroporphyrinogen III synthase USH2A NM206933 usherin isoform B
USP14 NM_005151 ubiquitin specific protease 14 isoform a USP15 NM_006313 ubiquitin specific protease 15 USP18 NM_017414 ubiquitin specific protease 18 USP19 NM_006677 ubiquitin specific protease 19 USP2 NM_004205 ubiquitin specific protease 2 isoform a USP20 NM_001008563 ubiquitin specific protease 20 USP25 NM_013396 ubiquitin specific protease 25 USP3 NM 006537 ubiquitin specific protease 3 USP32 NM_032582 ubiquitin specific protease 32 USP36 NM_025090 ubiquitin specific protease 36 UTX NM021140 ubiquitously transcribed tetratricopeptide VAC14 NM_018052 Vac14 homolog VAMP1 NM_014231 vesicle-associated membrane protein I isoform 1 VAMP2 NM014232 vesicle-associated membrane protein 2 VAMP8 NM003761 vesicle-associated membrane protein 8 VAPB NM004738 VAMP-associated protein B/C
VASHI NM 014909 vasohibin 1 VAT1 NM_006373 vesicle amine transport protein 1 VAV2 NM_003371 vav 2 oncogene VAXI NM199131 ventral anterior homeobox 1 VCL NM003373 vinculin isoform VCL
VDR NM000376 vitamin D (1,25-dihydroxyvitamin D3) receptor VEGF NM_001025366 vascular endothelial growth factor isoform a VEZT NM_017599 transmembrane protein vezatin VGLL2 NM_153453 vestigial-like 2 isoform 2 VGLL3 NM_016206 colon carcinoma related protein VIL2 NM_003379 villin 2 VIPR2 NM_003382 vasoactive intestinal peptide receptor 2 VISA NM_020746 virus-induced signaling adapter VIT NM_053276 vitrin VMD2L2 NM_153274 vitelliform macular dystrophy 2-like 2 VMD2L3 NM152439 vitelliform macular dystrophy 2-like 3 VPS13B NM_017890 vacuolar protein sorting 13B isoform 5 VPS13D NM_015378 vacuolar protein sorting 13D isoform 1 VPS24 NM001005753 vacuolar protein sorting 24 isoform 2 VPS33B NM_018668 vacuolar protein sorting 33B (yeast homolog)) VPS36 NM_016075 vacuolar protein sorting 36 VPS37B NM_024667 vacuolar protein sorting 37B
VPS37C NM_017966 vacuolar protein sorting 37C
VPS41 NM014396 vacuolar protein sorting 41 (yeast homolog) VPS4A NM_013245 vacuolar protein sorting factor 4A
VSIG4 NM007268 V-set and immunoglobulin domain containing 4 VTI1B NM_006370 vesicle transport through interaction with VWF NM_000552 von Willebrand factor preproprotein WAPAL NM_015045 wings apart-like homolog WARS2 NM_015836 mitochondrial tryptophanyl tRNA synthetase 2 WASF2 NM006990 WAS protein family, member 2 WASL NM003941 Wiskott-Aldrich syndrome gene-like protein WASPIP NM_003387 WASP-interacting protein WBP11 NM_016312 WW domain binding protein I I
WBP2 NM_012478 WW domain binding protein 2 WBSCR17 NM_022479 UDP-GaINAc:polypeptide WBSCR18 NM_032317 Williams Beuren syndrome chromosome region 18 WBSCR19 NM_175064 Williams Beuren syndrome chromosome region 19 WDFY3 NM178583 WD repeat and FYVE domain containing 3 isoform WDHD1 NM_001008396 WD repeat and HMG-box DNA binding protein 1 WDR13 NM_017883 WD repeat domain 13 protein WDR20 NM_181291 WD repeat domain 20 isoform 1 WDR21A NM_015604 WD repeat domain 21A isoform 1 WDR21C NM_152418 hypothetical protein LOC138009 WDR22 NM_003861 Breakpoint cluster region protein, uterine WDR31 NM_001006615 WD repeat domain 31 isoform 2 WDR33 NM_001006623 WD repeat domain 33 isoform 3 WDR37 NM_014023 WD repeat domain 37 WDR4 NM_018669 WD repeat domain 4 protein WDR41 NM_018268 WD repeat domain 41 WDR42A NM_015726 H326 WDR47 NM 014969 WD repeat domain 47 WDR59 NM~_030581 WD repeat domain 59 WDR62 NM 173636 WD repeat domain 62 WDR68 NM_005828 WD-repeat rotein WDR7 NM015285 rabconnectin-3 beta isoform I
WDR73 NM_032856 WD repeat domain 73 WDTC1 NM015023 WD and tetratricopeptide repeats I
WEE1 NM_003390 weel tyrosine kinase WFDC5 NM_145652 WAP four-disulfide core domain 5 precursor WFIKKN2 NM_175575 WFIKKN2 protein WHSC1 NM_007331 Wolf-Hirschhorn syndrome candidate 1 protein WHSC2 NM005663 Wolf-Hirschhorn syndrome candidate 2 protein WIBG NM_032345 within bgcn homolog WIFI NM_007191 Wnt inhibitory factor-I precursor WIPI2 NM001033518 hypothetical protein LOC26100 isoform c WIRE NM_133264 WIRE protein WISP1 NM_003882 WNT] inducible signaling pathway protein I
WNK3 NM_001002838 WNK lysine deficient protein kinase 3 isoform 2 WNT2B NM004185 wingless-type MMTV integration site family, WNT3A NM_033131 wingless-type MMTV integration site family, WNT5A NM003392 wingless-type MMTV integration site family, WNT5B NM_030775 wingless-type MMTV integration site family, WNT7A NM_004625 wingless-type MMTV integration site family, WNTSA NM_058244 wingless-type MMTV integration site family, WNT9A NM_003395 wingless-type MMTV integration site family, WSB1 NM015626 WD repeat and SOCS box-containing I isoform I
WTI NM_000378 Wilms tumor 1 isoform A
W WC 1 NM_015238 KIBRA protein W WP1 NM_007013 WW domain containing E3 ubiquitin protein ligase WWP2 NM007014 WW domain containing E3 ubiquitin protein ligase XAB 1 NM007266 XPA binding protein 1 XKR5 NM_207411 XK-related protein 5a XKR8 NM018053 X Kell blood group precursor-related family, XPC NM_004628 xeroderma pigmentosum, complementation group C
XPO4 NM_022459 exportin 4 XPO5 NM_020750 exportin 5 XPO6 NM_015171 exportin 6 XPR1 NM_004736 xenotropic and polytropic retrovirus receptor XRN 1 NM019001 5'-3' exoribonuclease 1 XTP7 NM 138568 protein 7 transactivated by hepatitis B virus X
YAF2 NM_001012424 YYI associated factor 2 isoform b YAP] NM 006106 Yes-associated protein 1, 65 kD
YARS2 NM_015936 tyrosyl-tRNA synthetase 2 (mitochondrial) YEATS2 NM018023 YEATS domain containing 2 YIFIB NM033557 Yip1 interacting factor homolog B isoform 2 YIPF7 NM182592 Yi ] domain family, member 7 YKT6 NM_006555 YKT6 v-SNARE protein YOD1 NM 018566 hypothetical protein LOC55432 YPELI NMy013313 yippee-like I
YPEL4 NM_145008 yippee-like 4 YRDC NM 024640 ischemia/reperfusion inducible protein YTHDC] NM 001031732 splicing factor YT521-B isoform I
YTHDFI NM_017798 YTH domain family, member 1 YWHAG NM 012479 tyrosine 3-monooxygenase/tryptophan YWHAH NM~003405 tyrosine 3/tryptophan 5 -monooxygenase YWHAQ NM 006826 tyrosine 3/tryptophan 5 -monooxygenase ZA2OD2 NM_006007 zinc finger protein 216 ZA20D3 NM_019006 zinc finger, A20 domain containing 3 ZADH2 NM 175907 zinc binding alcohol dehydrogenase, domain ZAK NM133646 MLK-related kinase isoform 2 ZBED1 NM_004729 Ac-like transposable element ZBP 1 NM_030776 tumor stroma and activated macrophage protein ZBTBIO NM023929 zinc finger and BTB domain containing 10 ZBTB 11 NM_014415 zinc finger protein ZNF-U69274 ZBTB2 NM020861 zinc finger and BTB domain containing 2 ZBTB24 NM_014797 zinc finger and BTB domain containing 24 ZBTB3 NM_024784 zinc finger and BTB domain containing 3 ZBTB32 NM 014383 testis zinc finger protein ZBTB33 NM_006777 kaiso ZBTB39 NM_014830 zinc finger and BTB domain containing 39 ZBTB40 NM014870 zinc finger and BTB domain containing 40 ZBTB41 NM 194314 zinc finger and BTB domain containing 41 ZBTB43 NM014007 zinc finger protein 297B
ZBTB5 NM014872 zinc finger and BTB domain containing 5 ZBTB8 NM_144621 zinc finger and BTB domain containing 8 ZBTB9 NM_152735 zinc finger and BTB domain containing 9 ZC3H11A NM_014827 hypothetical protein LOC9877 ZC3H12B NM001010888 hypothetical protein LOC340554 ZC3H6 NM198581 zinc finger CCCH-type domain containing 6 ZCCHC2 NM_017742 zinc finger, CCHC domain containing 2 ZCCHC3 NM033089 zinc finger, CCHC domain containing 3 ZCCHC5 NM_152694 zinc finger, CCHC domain containing 5 ZCSL3 NM_181706 zinc finger, CSL domain containing 3 ZDHHCI I NM024786 zinc finger, DHHC domain containing 11 ZDHHC12 NM_032799 zinc finger, DHHC domain containing 12 ZDHHCI4 NM_024630 NEWI domain containing protein isoform 1 ZDHHCI5 NM_144969 zinc finger, DHHC domain containing 15 ZDHHCI6 NM_032327 AbI-philin 2 isoform I
ZDHHCI7 NM_015336 huntingtin interacting protein 14 ZDHHCI8 NM 032283 zinc finger, DHHC domain containing 18 ZDHHC22 NM_174976 zinc finger, DHHC domain containing 22 ZDHHC23 NM_173570 zinc finger, DHHC domain containing 23 ZDHHC9 NM_001008222 zinc finger, DHHC domain containing 9 ZFAND3 NM021943 testis expressed sequence 27 ZFP106 NM022473 zinc finger protein 106 homolog ZFP28 NM_020828 zinc finger protein 28 ZFP41 NM_173832 zinc finger protein 41 homolog ZFP95 NM_014569 zinc finger protein 95 homolog ZFYVEI NM 021260 zinc finger, FYVE domain containing 1 isoform 1 ZFYVE20 NM_022340 FYVE-finger-containing Rab5 effector protein ZFYVE28 NM_020972 zinc finger, FYVE domain containing 28 ZHX1 NM 001017926 zinc fingers and homeoboxes I
ZHX3 NM_015035 zinc fingers and homeoboxes 3 ZICI NM_003412 zinc finger protein of the cerebellum I
ZKSCANI NM_003439 zinc finger protein 36 ZMYM6 NM 007167 zinc finger protein 258 ZMYNDIO NM 015896 zinc finger, MYND domain-containing 10 ZNF10 NM~_015394 zinc finger protein 10 ZNF134 NM 003435 zinc finger protein 134 WO 2008/073923 PCT/i1S2007/087038 Z1=IF135 NM_003436 zinc finger protein 135 (clone pHZ-17) ZNF187 NM 001023560 zincfingerprotein187 ZNF192 NM006298 zinc finger protein 192 ZNF193 NM_006299 zinc finger protein 193 ZNF 198 NM_003453 zincfingerprotein 198 ZNF212 NM 012256 zinc finger protein 212 ZNF213 NM_004220 zinc finger protein 213 ZNF215 NM013250 zinc finger protein 215 ZNF236 NM 007345 zinc fmger protein 236 ZNF259 NM_003904 zinc finger protein 259 ZNF264 NM_003417 zinc finger protein 264 ZNF267 NM 003414 zinc finger protein 267 ZNF282 NM_003575 zinc finger protein 282 ZNF285 NM_152354 zinc finger protein 285 ZNF289 NM_032389 zinc finger protein 289, ID1 regulated ZNF295 NM_020727 zinc finger protein 295 ZNF304 NM 020657 zinc finger protein 304 ZNF306 NM024493 zinc finger protein 306 ZNF307 NM_019110 zinc finger protein 307 ZNF313 NM_018683 zinc finger protein 313 ZNF317 NM_020933 zinc finger protein 317 ZNF319 NM_020807 zinc finger protein 319 ZNF323 NM_030899 zinc finger protein 323 isoform I
ZNF326 NM_181781 zinc fin er protein 326 isoform 2 ZNF329 NM 024620 zinc finger protein 329 ZNF343 NMJ_024325 zinc finger protein 343 ZNF346 NM_012279 zinc finger protein 346 ZNF365 NM 014951 zinc finger protein 365 isoform A
ZNF367 NM153695 zinc finger protein 367 ZNF395 NM_018660 zinc finger protein 395 ZNF406 NM 001029939 zinc finger protein 406 isoform TR-ZFAT
ZNF417 NM152475 zinc finger protein 417 ZNF423 NM 015069 zinc finger protein 423 ZNF436 NM 030634 zinc finger protein 436 ZNF445 NM~181489 zinc finger protein 445 ZNF449 NM~_152695 zinc finger protein 449 ZNF454 NM 182594 zinc finger protein 454 ZNF488 NM_153034 zinc finger protein 488 ZNF497 NM 198458 zinc finger protein 497 ZNF498 NM 145115 zinc finger protein 498 ZNF500 NM_021646 zinc finger protein 500 ZNF501 NM_145044 zinc finger protein 501 ZNF503 NM_032772 zinc finger protein 503 ZNF512 NM 032434 zinc finger protein 512 ZNF532 NM018181 zinc finger protein 532 ZNF536 NM_014717 zinc finger protein 536 ZNF548 NM_152909 zinc finger protein 548 ZNF569 NM_152484 zinc finger protein 569 ZNF572 NM_152412 zinc finger protein 572 ZNF592 NM_014630 zinc finger protein 592 ZNF600 NM_198457 zinc finger protein 600 ZNF609 NM_015042 zinc finger protein 609 ZNF621 NM 198484 zinc finger protein 621 ZNF622 NM_033414 zinc finger protein 622 ZNF623 NM_014789 zinc finger protein 623 ZNF626 NM 145297 zinc finger protein 626 ZNF627 NM145295 zinc fmger protein 627 ZNF650 NM_172070 zinc finger protein 650 ZNF651 NM_145166 zinc finger protein 651 ZNF660 NM_173658 zinc finger protein 660 ZNF691 NM_015911 zinc finger protein 691 ZNF694 NM_001012981 zinc finger protein 694 ZNF695 NM 020394 zinc finger protein SBZF3 ZNF696 NM_030895 zinc finger protein 696 ZNF701 NM_018260 zinc finger protein 701 ZNF704 NM_001033723 zinc finger protein 704 ZNF705A NM_001004328 hypothetical protein LOC440077 ZNF71 NM_021216 zinc finger protein 71 ZNF74 NM_003426 zinc finger protein 74 (Cos52) ZNF747 NM_023931 hypothetical protein LOC65988 ZNF76 NM_003427 zinc finger protein 76 (expressed in testis) ZNF81 NM_007137 zinc finger protein 81 (HFZ20) ZNFNIAI NM_006060 zinc finger protein, subfamily 1A, 1(Ikaros) ZNFNIA4 NM_022465 zinc finger protein, subfamily 1A, 4 ZNHIT3 NM_004773 thyroid hormone receptor interactor 3 isoform 2 ZNRFI NM_032268 zinc and ring finger protein I
ZNRF2 NM_147128 zinc finger/RING finger 2 ZPLD1 NM_175056 hypothetical protein LOC131368 ZSWIM3 NM080752 zinc finger, SWIM domain containing 3 ZSWIM4 NM_023072 zinc finger, SWIM domain containing 4 ZWlO NM_004724 centromere/kinetochore protein zwlO
ZYG11A NM_001004339 hypothetical protein LOC440590 ZYGIIBL NM_006336 zyg-11 homolog B (C. elegans)-Iike ZYX NM_001010972 zyxin ZZEFI NM_015113 zinc finger, ZZ type with EF hand domain 1 ZZZ3 NM 015534 zinc finger, ZZ domain containing 3 [002511 The predicted gene targets that exhibited altered mRNA expression levels in human cancer cells, following transfection with pre-miR hsa-miR-16, are shown in Table 4 below.

Table 4. Predicted hsa-miR-16 targets that exhibited altered mRNA expression levels in human cancer cells after transfection with pre-miR hsa-miR- 16.
Gene Ref'Seq Transcript Description Symbol ID
ACTR2 NM_001005386 actin-related protein 2 isoform a ADARBI NM 001033049 RNA-specific adenosine deaminase B1 isoform 4 ADRB2 NM000024 adrenergic, beta-2-, receptor, surface ANKRD 12 NM 015208 ankyrin repeat domain 12 ARHGDIA NM_004309 Rho GDP dissociation inhibitor (GDI) al ha ARL2 NM 001667 ADP-ribosylation factor-like 2 CA12 NM_001218 carbonic anhydrase XII isoform 1 precursor CCND1 NM 053056 cyclin Dl CDC37L1 NM_017913 cell division cycle 37 homolog (S.
CDHI NM 004360 cadherin 1, type I preproprotein CDS2 NM_003818 hos hatidate cytidylyltransferase 2 CHUK NM_001278 conserved helix-loop-helix ubi uitous kinase CYP4F3 NM 000896 cytochrome P450, family 4, subfamily F, DI02 NM 000793 deiodinase, iodothyronine, type II isoform a FGF2 NM_002006 fibroblast growth factor 2 FGFR4 NM 002011 fibroblast growth factor receptor 4 isoform 1 GALNT7 NM 017423 polypeptide N-acetylgalactosaminyltransferase 7 HAS2 NM_005328 hyaluronan synthase 2 KCNJ2 NM000891 potassium inwardly-rectifying channel J2 LCN2 NM 005564 lipocalin 2 (oncogene 24p3) LRP12 NM_013437 suppression of tumorigenicity MAP7 NM003980 microtubule-associated protein 7 PHACTR2 NM_014721 phosphatase and actin regulator 2 PLSCR4 NM 020353 phospholipid scramblase 4 PODXL NM001018111 podocalyxin-like precursor isoform 1 PPAP2C NM 003712 phosphatidic acid phosphatase type 2C isoform 1 quaking homolog, KH domain RNA binding QKI NM_206853 isoform RPS6KA3 NM004586 ribosomal protein S6 kinase, 90kDa, polypeptide RPS6KA5 NM_004755 ribosomal protein S6 kinase, 90kDa, ol e tide SLC11A2 NM 000617 solute carrier family 11 (proton-coupled SLC4A7 NM 003615 solute carrier family 4, sodium bicarbonate STC1 NM003155 stanniocalcin 1 precursor SYNE1 NM 015293 nesprin 1 isoform beta TACC1 NM 006283 transforming, acidic coiled-coil containing TFG NM_001007565 TRK-fused gene THUMPDI NM 017736 THUMP domain containing 1 TNFSF9 NM003811 tumor necrosis factor (ligand) superfamily, TPMl NM_001018004 tro om osin 1 alpha chain isoform 3 UBE21 NM_003345 ubiquitin-conjugating enzyme E21 VIL2 NM 003379 villin 2 [00252] The predicted gene targets of hsa-miR-16 whose mRNA expression levels are affected by hsa-miR-16 represent particularly useful candidate targets for cancer therapy and therapy of other diseases through manipulation of their expression levels.

EXAMPLE 4:

[00253] Cell proliferation and survival pathways are commonly altered in tumors (Hanahan and Weinberg, 2000). The inventors have shown that hsa-miR-16 directly or indirectly regulates the transcripts of proteins that are critical in the regulation of these pathways. Many of these targets have inherent oncogenic or tumor suppressor activity. Hsa-miR- 16 targets that are associated with various cancer types are shown in Table 5.

[00254] Among these targets are regulators of the cell cycle, including cyclin D1, cyclin G2 and the transforming acidic coiled coil 1 protein (TACC1). While cyclin Dl forms a functional complex with the cyclin-dependent kinases 4 and 6 (CDK4/6) and is necessary to promote cells from the G1 phase into S phase, cyclin G2 - unlike conventional cyclins -negatively regulates the cell cycle (Donnellan and Chetty, 1998; Home el al., 1997). The growth-promoting activity of cyclin Dl correlates with the observation that a broad roster of cancers show elevated levels of cyclin D1 (Donnellan and Chetty, 1998). In contrast, cyclin G2 is down-regulated in multiple cancers, such as oral cancer and papillary carcinomas (Alevizos et al., 2001; Ito et al., 2003). Since hsa-miR-16 over-expression leads to suppression of the cyclin D1 transcript and up regulation of cyclin G2, hsa-miR-16 may function as a tumor suppressor. This view is supported by the fact that hsa-miR-16 negatively regulates the TACCI message which encodes a putative oncogene located within a breast cancer amplicon on chromosome 8p11 (Cully et al., 2005). Over-expression of TACC1 induces oncogenic transformation of fibroblasts in culture and cooperates with Ras to form tumors in mice with a PTEN+/- background (Cully et al., 2005).

[00255] Other hsa-miR-16 targets include the fibroblast growth factor 2 (FGF-2), fibroblast growth factor receptor 4 (FGF-R4) and IkappaB kinase alpha (IKKalpha, CHUK), all of which are components of the intracellular signaling network. FGF-2 is a secretory protein with potent mitogenic and angiogenic activity that transmits the signal into cells via transmembrane receptors (FGFRs) composed of 2-3 extracellular immunoglobulin-like domains and an intracellular tyrosine kinase domain (Chandler et al., 1999).
While FGF-2 mRNAs levels are increased in renal, oral, and non-small lung cancer cells, FGFR-4 is up-regulated in numerous types of cancer (Chandler et al., 1999). Similarly, IKKalpha is a positive regulator of the intracellular signaling cascade and functions to activate the transcription factor nuclear factor kappa B (NFkappaB) (Karin et al. 2002).
NFkappaB is constitutively activated in several cancer types and promotes anti-apoptotic and survival pathways. Based on our data, hsa-miR-l6 negatively regulates these proteins and therefore is likely to function as a tumor-suppressor. In contrast, hsa-miR- 16 may also have oncogenic activity. This view is supported by the observation that hsa-miR-16 negatively regulates the tumor-suppressor RBL-1 (p107) and induces an up-regulation of the oncogenic E3 ubiquitin ligase Skp2 (Gstaiger et al., 2001; Huang et al., 2005; Jiang et al., 2005).
In addition, hsa-miR-16 regulates genes that may have either oncogenic or growth-inhibitory activity, depending on the cellular context: among these are connective tissue growth factor (CTGF) and neutrophil gelatinase-associated lipocalin (NGAL), also known as lipocalin-2 (LCN2) (Croci et al., 2004; Hishikawa et al., 1999; Lin et al., 2005; Yang et al., 2005; Fernandez et al., 2005; Lee et al., 2006).

[00256] In summary, hsa-miR-16 governs the activity of proteins that are critical regulators of cell proliferation and survival. These targets are frequently deregulated in human cancer. Based on this review of the genes and related pathways that are regulated by miR-16, introduction of hsa-miR-16 or an anti-hsa-miR-16 into a variety of cancer cell types would likely result in a therapeutic response.

Table 5. Tumor associated mRNAs altered by hsa-miR-16 having prognostic or therapeutic value for the treatment of various malignancies.
Gene Gene Title Cellular Process Cancer Type Reference [PMIDI
S mbol CCND1 cyclin DI cell cycle MCL, BC, SCCHN, Donnellan and Chetty, 1998 OepC, HCC, CRC, B1dC, EC, OC, M, AC, GB, GC, PaC
CCNG2 cyclin G2 cell cycle TC, SCCHN Ito et al., 2003b; Alevizos et al., CDKN2C CDK cell cycle HB, MB, HCC, HL, MM lolascon et al., 1998; Kulkarni et inhibitor 2C al., 2002; Morishita et al., 2004;
Sanchez-Aguilera et al., 2004 CHUK IKK alpha signal LSCC, BC Cao et al., 2001; Nakayama et transduction al., 2001; Romieu-Mourez el al., CTGF CTGF/IGFB cell adhesion, BC, GB, OepC, RMS, Hishikawa et al., 1999; Shimo et P-8 migration CRC, PC al., 2001; Koliopanos et al., 2002; Pan et al., 2002; Croci et al., 2004; Lin et al., 2005; Yang et al., 2005 FGF2 FGF-2 signal BC, RCC, OC, M, Chandler et al., 1999 transduction NSCLC
FGFR4 FGF-R4 signal TC, BC, OC, PaC Jaakkola et al., 1993; Shah et al., transduction 2002; Ezzat et al., 2005 LCN2 lipocalin 2 cell adhesion PaC, CRC, HCC, BC, Bartsch and Tschesche, 1995;
NGAL OC Furutani et al., 1998; Fernandez et al., 2005; Lee et al., 2006 NF1 NF-1 signal G, AC, NF, PCC, ML Rubin and Gutmann, 2005 transduction RBLI p107 cell cycle BCL, PC, CRC, TC Takimoto et al., 1998; Claudio et al., 2002; Wu et al., 2002; Ito et al., 2003a; Rubin and Gutmann, SKP2 SKP-2 proteasomal PaC, OC, BC, MFS, GB, Kamata et al., 2005; Saigusa et degradation EC, NSCLC, PC al., 2005; Shibahara et al., 2005;
Takanami, 2005; Einama et al., 2006; Huang et al., 2006; Sui et al., 2006; Traub et al., 2006 TACCI cell cycle BC, OC Cully et al., 2005; Lauffart et al., WISP2 WISP-2 signal CRC, BC Pennica et al., 1998; Saxena et transduction al., 2001 Abbreviations: AC, astrocytoma; BC, breast carcinoma; BCL, B-cell lymphoma;
BIdC, bladder carcinoma;
CRC, colorectal carcinoma; EC, endometrial carcinoma; GB, glioblastoma; GC, gastric carcinoma; HB, hepatoblastoma; HCC, hepatocellular carcinoma; HL, Hodgkin lymphoma; LSCC, laryngeal squamous cell carcinoma; M, melanoma; MB, medulloblastoma; MCL, mantle cell lymphoma; MFS, myxofibrosarcoma; ML, myeloid leukemia; MM, multiple myeloma; NF, neurofibroma; NSCLC, non-small cell lung carcinoma; OC, ovarian carcinoma; OepC, oesophageal carcinoma; PaC, pancreatic carcinoma; PC, prostate carcinoma; PCC, pheochromocytoma; RCC, renal cell carcinoma; RMS, rhabdomyosarcoma; SCCHN, squamous cell carcinoma of the head and neck; TC, thyroid carcinoma.

REFERENCES
The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.

U.S. Patent 4,337,063 U.S. Patent 4,404,289 U.S. Patent 4,405,711 U.S. Patent 4,659,774 U.S. Patent 4,682,195 U.S. Patent 4,683,202 U.S. Patent 4,704,362 U.S. Patent 4,816,571 U.S. Patent 4,959,463 U.S. Patent 5,141,813 U.S. Patent 5,143,854 U.S. Patent 5,202,231 U.S. Patent 5,214,136 U.S. Patent 5,221,619 U.S. Patent 5,223,618 U.S. Patent 5,242,974 U.S. Patent 5,264,566 U.S. Patent 5,268,486 U.S. Patent 5,288,644 U.S. Patent 5,324,633 U.S. Patent 5,378,825 U.S. Patent 5,384,261 U.S. Patent 5,405,783 U.S. Patent 5,412,087 U.S. Patent 5,424,186 U.S. Patent 5,428,148 U.S. Patent 5,429,807 U.S. Patent 5,432,049 U.S. Patent 5,436,327 U.S. Patent 5,445,934 U.S. Patent 5,446,137 U.S. Patent 5,466,786 U.S. Patent 5,468,613 U.S. Patent 5,470,710 U.S. Patent 5,470,967 U.S. Patent 5,472,672 U.S. Patent 5,480,980 U.S. Patent 5,492,806 U.S. Patent 5,503,980 U.S. Patent 5,510,270 U.S. Patent 5,525,464 U.S. Patent 5,527,681 U.S. Patent 5,529,756 U.S. Patent 5,532,128 U.S. Patent 5,545,531 U.S. Patent 5,547,839 U.S. Patent 5,554,501 U.S. Patent 5,554,744 U.S. Patent 5,556,752 U.S. Patent 5,561,071 U.S. Patent 5,571,639 U.S. Patent 5,574,146 U.S. Patent 5,580,726 U.S. Patent 5,580,732 U.S. Patent 5,583,013 U.S. Patent 5,593,839 U.S. Patent 5,599,672 U.S. Patent 5,599,695 U.S. Patent 5,602,240 U.S. Patent 5,602,244 U.S. Patent 5,610,289 U.S. Patent 5,610;287 U.S. Patent 5,614,617 U.S. Patent 5,623,070 U.S. Patent 5,624,711 U.S. Patent 5,631,134 U.S. Patent 5,637,683 U.S. Patent 5,639,603 U.S. Patent 5,645,897 U.S. Patent 5,652,099 U.S. Patent 5,654,413 U.S. Patent 5,658,734 U.S. Patent 5,661,028 U.S. Patent 5,665,547 U.S. Patent 5,667,972 U.S. Patent 5,670,663 U.S. Patent 5,672,697 U.S. Patent 5,677,195 U.S. Patent 5,681,947 U.S. Patent 5,695,940 U.S. Patent 5,700,637 U.S. Patent 5,700,922 U.S. Patent 5,705,629 U.S. Patent 5,708,153 U.S. Patent 5,708,154 U.S. Patent 5,714,606 U.S. Patent 5,728,525 U.S. Patent 5,744,305 U.S. Patent 5,763,167 U.S. Patent 5,770,358 U.S. Patent 5,777,092 U.S. Patent 5,789,162 U.S. Patent 5,792,847 U.S. Patent 5,800,992 U.S. Patent 5,807,522 U.S. Patent 5,830,645 U.S. Patent 5,837,196 U.S. Patent 5,847,219 U.S. Patent 5,856,174 U.S. Patent 5,858,988 U.S. Patent 5,859,221 U.S. Patent 5,871,928 U.S. Patent 5,872,232 U.S. Patent 5,876,932 U.S. Patent 5,886,165 U.S. Patent 5,919,626 U.S. Patent 5,922,591 U.S. Patent 6,004,755 U.S. Patent 6,040,193 U.S. Patent 6,087,102 U.S. Patent 6,251,666 U.S. Patent 6,368,799 U.S. Patent 6,383,749 U.S. Patent 6,617,112 U.S. Patent 6,638,717 U.S. Patent 6,720,138 U.S. Patent 6,723,509 U.S. Patent Serial 09/545,207 U.S. Patent Serial 10/667,126 U.S. Patent Serial 11/141,707 U.S. Prov. Appln. 60/575,743 U.S. Prov. Appln. 60/649,584 U.S. Prov. Appln. Methods and Compositions Involving miRNA and miRNA Inhibitor Molecules, 2005 EP 266,032 PCT Appln. WO 0168255 PCT Appln. WO 03020898 PCT Appln. WO 03022421 PCT Appln. WO 03023058 PCT Appln. WO 03029485 PCT Appln. WO 03040410 PCT Appln. WO 03053586 PCT Appln. WO 03066906 PCT Appln. WO 03067217 PCT Appln. WO 03076928 PCT Appln. WO 03087297 PCT Appln. WO 03091426 PCT Appln. WO 03093810 PCT Appln. WO 03100448A1 PCT Appln. WO 04020085 PCT Appln. WO 04027093 PCT Appln. WO 09923256 PCT Appln. WO 09936760 PCT Appln. WO 93/17126 PCT Appln. WO 95/11995 PCT Appin. WO 95/21265 PCT Appln. WO 95/21944 PCT Appin. WO 95/35505 PCT Appln. WO 96/31622 PCT Appln. WO 97/10365 PCT Appln. WO 97/27317 PCT Appln. WO 9743450 PCT Appln. WO 99/35505 PCT Appln. WO0138580 PCT Appln. W003100012 UK Patent 1,529,202 UK Patent 8 803 000 Alevizos et al., Oncogene, 20(43):6196-6204, 2001.
Ambros, Cell, 107(7):823-826, 2001.
Bagga et al., Cell, 122(4):553-563, 2005.

Bartsch and Tschesche, FEBS Lett, 357(3):255-259, 1995.
Brennecke et al., Cell, 113(1):25-36, 2003.
Calin and Croce, Nat Rev Cancer, 6(11):857-866, 2006.
Calin et al., Proc. Natl. Acad. Sci. USA, 99(24):15524-15529, 2002.
Cao et al., Cell, 107(6):763-775, 2001.
Carrington and Ambros, Science, 301(5631):336-338, 2003.
Chandler et al., Int J Cancer, 81(3):451-458, 1999.
Claudio et al., Clin Cancer Res, 8(6):1808-1815, 2002.
Croci et al., Cancer Res, 64(5):1730-1736, 2004.
Cully et al., Cancer Res, 65(22):10363-10370, 2005.
Cummins et al., In: IRT: Nucleosides and nucleosides, La Jolla CA, 72, 1996.
Denli et al., Trends Biochem. Sci., 28:196, 2003.
Didenko, Biotechniques, 31(5):1106-1116, 1118, 1120-1121, 2001.
Dong et al., Crit Rev Oncol Hematol, 54(2):85-93, 2005.
Donnellanm and Chetty, Mol Pathol, 51(1):1-7, 1998.
Einama et al., Pancreas, 32(4):376-381, 2006.
Emptage et al., Neuron, 29(1):197-208, 2001.
Esquela-Kerscher and Slack, Nat Rev Cancer, 6(4):259-269, 2006.
Ezzat et al., Clin Cancer Res, 11(3):1336-1341, 2005.
Fernandez et al., Clin Cancer Res, I 1(15):5390-5395, 2005.
Fodor et al., Science, 251:767-777, 1991.
Froehler et al., Nucleic Acids Res., 14(13):5399-5407, 1986.
Furutani et al., Cancer Lett, 122(1-2):209-214, 1998.
Griffey et al., J. Mass Spectrom, 32(3):305-13, 1997.
Gstaiger et al., Proc Natl Acad Sci USA, 98(9):5043-5048, 2001.
Hanahan and Weinberg, Cell, 100(1):57-70, 2000.
He et al., Nature, 435(7043):828-833, 2005.
He et al., Proc. Natl. Acad. Sci. USA, 102(52):19075-19080, 2005.
Hishikawa et al., J Biol Chem, 274(52):37461-37466, 1999.
Home et al., JBiol Chem, 272(19):12650-12661, 1997.
Huang et al., Proc Natl Acad Sci USA, 102(5):1649-1654, 2005.
Huang et al., Clin Cancer Res, 12(2):487-498, 2006.
Iolascon et al., Hepatology, 27(4):989-995, 1998.
Itakura and Riggs, Science, 209:1401-1405, 1980.

Ito et al., Anticancer Res, 23(3B):2335-2338, 2003b.
Ito et al., Anticancer Res, 23(5A):3819-3824, 2003a.
Jaakkola et al., lnt JCancer, 54(3):378-382, 1993.
Jiang et al., Oncogene 24(21):3409-3418, 2005.
Kamata et al., JCancer Res Clin Oncol, 131(9):591-596, 2005.
Karin et al., Nat Rev Cancer, 2(4):301-310, 2002.
Klostenneier and Millar, Biopolymers, 61(3):159-79, 2001-2002.
Koliopanos et al., World JSurg, 26(4):420-427, 2002.
Komberg and Baker, In: DNA Replication, 2d Ed., Freeman, San Francisco, 1992.
Kulkami et al., Leukemia, 16(1):127-134, 2002.
Lagos-Quintana et al., Science, 294(5543):853-858, 2001.
Lau et al., Science, 294(5543):858-862, 2001.
Lauffart et al., BMC Womens Health, 5:8, 2005.
Lee and Ambros, Science, 294(5543):862-864, 2001.
Lee et al., IntJCancer, 118(10):2490-2497, 2006.
Lim et al., Nature, 433(7027):769-773, 2005.
Lin et al., Gastroenterology, 128(1):9-23, 2005.
Lu et al., Nature, 435(7043):834-838, 2005.
Morishita et al., Hepatology, 40(3):677-686, 2004.
Mrozek et al., Blood, 06-001149v1, 2006.
Nakayama et al., Cancer, 92(12):3037-3044, 2001.
Olsen et al., Dev. Biol., 216:671, 1999.
Pan et al., Neurol Res, 24(7):677-683, 2002.
Pennica et al., Proc Natl Acad Sci USA, 95(25):14717-14722, 1998.
Reinhart et al., Nature, 403(6772):901-906, 2000.
Romieu-Mourez et al., Cancer Res, 61(9):3810-3818, 2001.
Rubin and Gutmann, Nat Rev Cancer, 5(7):557-564, 2005.
Saigusa et al., Cancer Sci, 96(10):676-683, 2005.
Sambrook et al., In: DNA microaarays: a molecular cloning manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, 2001, 2003.
Sanchez-Aguilera et al., Blood, 103(6):2351-2357, 2004.
Saxena et al., Mol Cell Biochem, 228(1-2):99-104, 2001.
Scheit, In: Synthesis and Biological Function, Wiley-Interscience, New York, 171-172, 1980.
Seggerson et al., Dev. Biol., 243:215, 2002.

Shah et al., Oncogene, 21(54):8251-8261, 2002.
Shibahara et al., Anticancer Res, 25(3B):1881-1888, 2005.
Shimo et al., Cancer Lett, 174(1):57-64, 2001.
Sui et al., Oncol Rep, 15(4):765-771, 2006.
Takanami, Oncol Rep, 13(4):727-731, 2005.
Takimoto et al., Biochem Biophys Res Commun, 251(1):264-268, 1998.
Traub et al., Breast Cancer Res Treat, 99(2):185-191, 2006.
Wu et al., Eur JCancer, 38(14):1838-1848, 2002.
Xu et al., Curr. Biol., 13(9):790-795, 2003.
Yang et al., Cancer Res, 65(19):8887-8895, 2005.

Claims (55)

1. A method of modulating gene expression in a cell comprising administering to the cell an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence in an amount sufficient to modulate the expression of one or more gene identified in Table 1, 3, 4, or 5.

2. The method of claim 1, wherein the cell is in a subject having, suspected of having, or at risk of developing astrocytoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, laryngeal squamous cell carcinoma, melanoma, medulloblastoma, mantle cell lymphoma, myxofibrosarcoma, myeloid leukemia, multiple myeloma, neurofibroma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, pancreatic carcinoma, prostate carcinoma, pheochromocytoma, renal cell carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, or thyroid carcinoma, wherein the modulation of one or more gene is sufficient for a therapeutic response.

3. The method of claim 1, wherein the expression of a gene is down-regulated.

4. The method of claim 1, wherein the expression of a gene is up-regulated.

5. The method of claim 1, wherein the miR-16 nucleic acid is one or more of hsa-miR-16-1, hsa-miR-16-2, or a segment thereof.

6. The method of claim 1, wherein the miR-16 nucleic acid is an inhibitor of miR-16 function.

7. The method of claim 1, wherein the cell is a cancer cell.

8. The method of claim 7, wherein the cancer cell is a neuronal, glial, lung, liver, brain, breast, bladder, blood, leukemic, colon, endometrial, stomach, skin, ovarian, esophageal, pancreatic, prostate, kidney, or thyroid cell.

9. The method of claim 1, wherein the cell is in a subject having, suspected of having, or at risk of developing a metabolic, an immunologic, an infectious, a cardiovascular, a digestive, an endocrine, an ocular, a genitourinary, a blood, a musculoskeletal, a nervous system, a congenital, a respiratory, a skin, or a cancerous disease or condition.

10. The method of claim 9, wherein the infectious disease or condition is a parasitic, bacterial, viral, or fungal infection.

11. The method of claim 1, wherein the isolated miR-16 nucleic acid is a recombinant nucleic acid.

12. The method of claim 11, wherein the recombinant nucleic acid is an RNA.

13. The method of claim 11, wherein the recombinant nucleic acid is DNA.

14. The method of claim 13, wherein the recombinant nucleic acid comprises a miR-16 expression cassette.

15. The method of claim 14, wherein the expression cassette is comprised in a viral, or plasmid DNA vector.

16. The method of claim 1, wherein the miR-16 nucleic acid is a synthetic nucleic acid.

17. A method of modulating a cellular pathway comprising administering to a cell an amount of an isolated nucleic acid comprising a miR- 16 nucleic acid sequence in an amount sufficient to modulate the expression of a cellular pathway that includes one or more gene identified in Table 1, 3, 4, or 5.

18. The method of claim 17, wherein the expression of a gene is down-regulated.

19. The method of claim 17, wherein the miR-16 nucleic acid one or more of hsa-miR-16-1, hsa-miR-16-2, or a segment thereof.

20. The method of claim 17, wherein the cell is a cancer cell.

21. The method of claim 20, wherein the modulation of a cellular pathway results in reduced viability, reduced proliferation, reduced metastasis, or increased sensitivity to therapy.

22. The method of claim 20, wherein the cancer cell is a neuronal, glial, lung, liver, brain, breast, bladder, blood, leukemic, colon, endometrial, stomach, skin, ovarian, esophageal, pancreatic, prostate, kidney, or thyroid cell.

23. The method of claim 17, wherein the isolated miR-16 nucleic acid is a recombinant nucleic acid.

24. The method of claim 23, wherein the recombinant nucleic acid is DNA.

25. The method of claim 24, wherein the recombinant nucleic acid is a viral or a plasmid DNA vector.

26. The method of claim 17, wherein the miR- 16 nucleic acid is a synthetic nucleic acid.

27. A method of treating a patient with a pathological condition comprising the steps of:
(a) administering to the patient an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence in an amount sufficient to modulate the expression of a cellular pathway; and (b) administering a second therapy, wherein the modulation of the cellular pathway sensitizes the patient to the second therapy.

28. The method of claim 27, wherein the cellular pathway is one or more pathway including one or more gene identified in Table 1, 3, 4, or 5.

29. The method of claim 27, wherein the miR-16 nucleic acid comprises at least one of hsa-miR-16-1 or hsa-miR- 16-2, or a segment thereof.

30. A method of treating a subject with a pathological condition comprising:

(a) determining an expression profile of one or more genes selected from Table 1, 3, 4, or 5;

(b) assessing the sensitivity of the subject to therapy based on the expression profile;
(c) selecting a therapy based on the assessed sensitivity; and (d) treating the subject using selected therapy.

31. An expression profile indicative of miR-16 status in a cell or tissue comprising expression assessment of one or more gene from Table 1, 3, 4, or 5.

32. A method of modulating a cellular pathway or a physiologic pathway comprising administering to a cell an amount of an isolated nucleic acid comprising a miR-126 nucleic acid sequence in an amount sufficient to modulate the cellular pathway or physiologic pathway that includes one or more genes identified or gene products related to one or more genes identified in Table 1, 3, 4, or 5.

33. The method of claim 32, further comprising administering 2, 3, 4, 5, 6, or more miRNAs.

34. The method claim 33 wherein the miRNAs are comprised in a single composition.

35. The method of 33, wherein at least two cellular pathways or physiologic pathways are modulated.

36. The method of claim 33, wherein at least one gene is modulated by multiple miRNAs.

37. The method of claim 32, wherein the expression of a gene or a gene product is down-regulated.

38. The method of claim 32, wherein the expression of a gene or a gene product is up-regulated.

39. The method of claim 32, wherein the cell is a cancer cell.

40. The method of claim 39, wherein the cancer cell is a lung or a liver cancer cell.

41. The method of claim 39, wherein viability of the cell is reduced, proliferation of the cell is reduced, metastasis of the cell is reduced, or the cell's sensitivity to therapy is increased.

42. The method of claim 39, wherein the cancer cell is neuronal, glial, lung, liver, brain, breast, bladder, blood, leukemic, colon, endometrial, stomach, skin, ovarian, fat, bone, cervical, esophageal, pancreatic, prostate, kidney, uterine, testicular, epithelial, muscle, oropharyngeal, adrenal, gastrointestinal, mesothelial, or thyroid cell.

43. The method of claim 32, wherein the isolated miR-16 nucleic acid is a recombinant nucleic acid.

44. The method of claim 43, wherein the recombinant nucleic acid is DNA.

45. The method of claim 44, wherein the recombinant nucleic acid is a viral vector or a plasmid DNA.

46. The method of claim 32, wherein the nucleic acid is RNA.

47. The method of claim 43, wherein the recombinant nucleic acid is a synthetic nucleic acid.

48. A method of treating a patient diagnosed with or suspected of having or suspected of developing a pathological condition or disease related to a gene modulated by a miRNA
comprising the steps of:

(a) administering to the patient an amount of an isolated nucleic acid comprising a miR-16 nucleic acid sequence in an amount sufficient to modulate a cellular pathway or a physiologic pathway; and (b) administering a second therapy, wherein the modulation of the cellular pathway or physiologic pathway sensitizes the patient to the second therapy.

49. The method of claim 48, wherein one or more cellular pathway or physiologic pathway includes one or more genes identified in Table 1, 3, 4, and 5.

50. A method of selecting a miRNA to be administered to a subject with, suspected of having, or having a propensity for developing a pathological condition or disease comprising:
(a) determining an expression profile of one or more genes selected from Table 1, 3, 4, and 5;

(b) assessing the sensitivity of the subject to miRNA therapy based on the expression profile; and (c) selecting one or more miRNA based on the assessed sensitivity.

51. The method of claim 50 further comprising treating the subject with 1, 2, 4, 5, 6, 7, 8, 9, 10, or more miRNAs.

52. The method of claim 51, wherein each miRNA is administered individually or one or more combinations.

53. The method of claim 52, wherein the miRNAs are in a single composition.

54. A method of assessing a cell, tissue, or subject comprising assessing expression of miR-16 in combination with assessing expression of one or more gene from Table 1, 3, 4, or in at least one sample.

55. A method of assessing miR-16 status in a sample comprising the steps of:

(a) assessing expression of one or more genes from Table 1, 3, 4, or 5 in a sample;
and (b) determining miR- 16 status based on level of miR-16 expression in the sample.