AU2007202896A1 - Genes and proteins, and their uses - Google Patents
Genes and proteins, and their uses Download PDFInfo
- Publication number
- AU2007202896A1 AU2007202896A1 AU2007202896A AU2007202896A AU2007202896A1 AU 2007202896 A1 AU2007202896 A1 AU 2007202896A1 AU 2007202896 A AU2007202896 A AU 2007202896A AU 2007202896 A AU2007202896 A AU 2007202896A AU 2007202896 A1 AU2007202896 A1 AU 2007202896A1
- Authority
- AU
- Australia
- Prior art keywords
- leu
- ala
- val
- ser
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Landscapes
- Peptides Or Proteins (AREA)
Description
Regulation 3.2
AUSTRALIA
Patents Act 1990 COMPLETE SPECIFICATION DIVISIONAL
APPLICATION
APPLICANT:
Invention Title: Microscience Limited GENES AND PROTEINS, AND THEIR USES SGENES AND PROTEINS. AND THEIR USES Field of the Invention This invention relates to bacterial genes and proteins, and their uses. More Cparticularly, it relates to their use in therapy, for immunisation and in screening for drugs.
Background of the Invention Neisseria meningitidis is a Gram-negative bacterial pathogen that is implicated 00 in septic shock and bacterial meningitis. This bacterium is a leading cause of bacterial Smeningitis in developed countries, and causes large-scale epidemics in Africa and S 10 China. In the UK, Neisseria meningitidis is the leading cause of death in childhood C1 apart from road traffic accidents. The bacterium naturally inhabits the human nasopharynx and then gains access to the blood stream from where it causes severe septicaemia or meningitis. Although current anti-microbials are effective in eliminating the bacterium from the body, the mortalilty from menigococcal septicaemia remains substantial. It would be desirable to provide means for treating or preventing conditions caused by Neisseria meningitidis, e.g. by immunisation.
Summary of the Invention The present invention is based on the discovery of genes in Neisseria meningitidis, the products of which may be located on the outer surface of the organism, and therefore may be used as targets for immuno-therapy.
According to one aspect of the invention, a peptide is encoded by a gene having any of the nucleotide sequences identified in claim 1, or a homologue or a functional fragment thereof. Such a peptide is suitable for therapeutic or diagnostic use, e.g.
when isolated.
According to a second aspect of the invention, a polynucleotide encoding a peptide defined above, may also be useful in therapy or diagnosis.
According to a further aspect of the invention, the peptide or the polynucleotide may be used for screening potential antimicrobial drugs.
A further aspect of the invention is the use of any of the products identified herein, for the treatment or prevention of a condition associated with infection by Neisseria or Gram-negative bacteria.
Description of the Invention The present invention is based on the discovery of genes encoding peptides which are located on the cell surface of Neisseria, and which are therefore useful for the preparation of therapeutic agents to treat infection. It should be understood that references to therapy also include preventative treatments, e.g. vaccination.
SFurthermore, while the products of the invention are intended primarily for the treatment s of infections in human patients, veterinary applications are also considered to be within N the scope of the invention.
The present invention is described with reference to Neisseria meningitidis.
I However, all the Neisseria strains, and many other Gram-negative bacterial strains are 00 likely to include related peptides or proteins having amino acid sequence identity or O similarity to those identified herein. Organisms likely to contain the peptides include, but are not limited to the genera Salmonella, Enterobacter, Klebsiella, Shigella and Yersinia.
Preferably, the peptides that may be useful in the various aspects of the invention have greater than a 40% similarity with the peptides identified herein. More preferably, the peptides have greater than 60% sequence similarity. Most preferably, the peptides have greater than 80% sequence similarity, e.g. 95% similarity. With regard to the polynucleotide sequences identified herein, related polynucleotides that may be useful in the various aspects of the invention may have greater than identity with the sequences identified herein. More preferably, the polynucleotide sequences have greater than 60% sequence identity. Most preferably, the polynucleotide sequences have greater than 80% sequence identity, e.g. 95% identity.
The terms "similarity" and "identity" are known in the art. The use of the term "identity" refers to a sequence comparison based on identical matches between correspondingly identical positions in the sequences being compared. The term "similarity" refers to a comparison between amino acid sequences, and takes into account not only identical amino acids in corresponding positions, but also functionally similar amino acids in corresponding positions. Thus similarity between polypeptide sequences indicates functional similarity, in addition to sequence similarity.
Levels of identity between gene sequences and levels of identity or similarity between amino acid sequences can be calculated using known methods. In relation to the present invention, publicly available computer based methods for determining identity and similarity include the BLASTP, BLASTN and FASTA (Atschul et al,, J.
Molec. Biol., 1990; 215:403-410), the BLASTX program available from NCBI, and the Gap program from Genetics Computer Group, Madison WI. The levels of similarity and identity provided herein, were obtained using the Gap program, with a Gap penalty of 12 and a Gap length penalty of 4 for determining the amino acid sequence comparisons, and a Gap penalty of 50 and a Gap length penalty of 3 for the Spolynucleotide sequence comparisons.
;ZHaving characterised a gene according to the invention, it is possible to use the N gene sequence to search for related genes or peptides in other microorganisms. This may be carried out by searching in existing databases, e.g. EMBL or GenBank.
IDThe techniques mentioned herein are well known in the art. However, reference o\is made in particular to Sambrook et al, Molecular Cloning, A Laboratory Manual (1989) 00 and Ausubel et al, current Protocols in Molecular Biology (1995), John Wiley Sons, Inc.
1 0 Peptides or proteins according to the invention may be purified and isolated by Smethods known in the art. In particular, having identified the gene sequence, it will be possible to use recombinant techniques to express the genes in a suitable host. Active fragments and related molecules can be identified and may be useful in therapy. For example, the peptides or their active fragments may be used as antigenic determinants in a vaccine, to elicit an immune response. They may also be used in the preparation of antibodies, for passive immunisation, or diagnostic applications. Suitable antibodies include monoclonal antibodies, or fragments thereof, including single chain Fv fragments. Humanised antibodies are also within the scope of the invention. Methods for the preparation of antibodies will be apparent to those skilled in the art.
Active fragments of the peptides are those that retain the biological function of the peptide. For example, when used to elicit an immune response, the fragment will be of sufficient size, such that antibodies generated from the fragment will discriminate between that peptide and other peptides on the bacterial microorganism. Typically, the fragment will be at least 30 nucleotides (10 amino acids) in size, preferably nucleotides (20 amino acids) and most preferably greater than 90 nucleotides amino acids) in size.
It should also be understood, that in addition to related molecules from other microorganisms, the invention encompasses modifications made to the peptides and polynucleotides identified herein which do not significantly alter the biological function.
It will be apparent to the skilled person that the degeneracy of the genetic code can result in polynucleotides with minor base changes from those specified herein, but which nevertheless encode the same peptides. Complementary polynucleotides are also within the invention. Conservative replacements at the amino acid level are also envisaged, i.e. different acidic or basic amino acids may be substituted without substantial loss of function.
Q)The preparation of vaccines based on the identified peptides will be known to Sthose skilled in the art. Vaccine compositions can be formulated with suitable carriers Sor adjuvants, e.g. alum, as necessary or desired, to provide effective immunisation against infection. The preparation of vaccine formulations will be apparent to the skilled person.
O More generally, and as is well known to those skilled in the art, a suitable oO amount of an active component of the invention can be selected, for therapeutic use, as can suitable carriers or excipients, and routes of administration. These factors would be chosen or determined according to known criteria such as the nature/severity of the condition to be treated, the type and/or health of the subject etc.
In a separate embodiment, the products of the invention may be used in screening assays for the identification of potential antimicrobial drugs or for the detection for virulence. Routine screening assays are known to those skilled in the art, and can be adapted using the products of the invention in the appropriate way. For example, the products of the invention may be used as the target for a potential drug, with the ability of the drug to inactivate or bind to the target indicating its potential antimicrobial activity.
The genes of the invention may also be implicated in the virulence of the microorganism, and therefore deleting or inactivating the gene may be sufficient to produce an attenuated (avirulent) microorganism.
The attenuated microorganisms may be prepared with a mutation that disrupts the expression of any of the genes identified herein. The skilled person will be aware of methods for disrupting expression of particular genes. Techniques that may be used include insertional inactivation or gene deletion techniques. Attenuated microorganisms according to the invention may also comprise additional mutations in other genes, for example in a second gene identified herein or in a separate gene required for growth of the microorganism, e.g. an amro mutation or, with regard to Salmonella, in a gene located in the SPI2 region identified in WO-A-96/17951.
Attenuated microorganisms may also be used as carrier systems for the delivery of heterologous antigens, therapeutic proteins or nucleic acids (DNA or RNA). In this embodiment, the attenuated microorganisms are used to deliver a heterologous antigen, protein or nucleic acid to a particular site in vivo. Introduction of a heterologous antigen, peptide or nucleic acid into an attenuated microorganism can be carried out by conventional techniques, including the use of recombinant constructs, e.g. vectors, which comprise polynucleotides that express the heterologous antigen or O therapeutic protein, and also include suitable promoter sequences. Alternatively, the Sgene that encodes the heterologous antigen or protein may be incorporated into the genome of the organism and the endogenous promoters used to control expression.
The various products of the invention may also be used in veterinary applications.
O The peptides of the present invention were identified as follows: oO Identification of Peptides A partial gene library of Neisseria meningitidis (strain C311 chromosomal DNA was prepared using the plasmid vectors pFW-phoA1, pFW-phoA2 and pFW-phoA3 (Podbielski, A. etal, Gene 1996; 177:137-147). These plasmids possess a constitutive spectinomycin adenyltransferase antibiotic resistance marker, which confers a high level of spectinomycin resistance and is therefore easily selected. Furthermore, these vectors contain a truncated (leaderless) Escherichia coil phoA gene for alkaline phosphatase. The three vectors differ only with respect to the reading frame in which the leaderless phoA gene exists, as compared to an upstream in-frame BamHI restriction enzyme site. Because this truncated E. coliphoA gene lacks the appropriate leader sequence for export of this enzyme across the bacterial membrane, extracellular alkaline phosphatase activity is absent when these plasmids are propagated in an E. coil phoA mutant strain DH5a). The chromogenic alkaline phosphatase substrate, XP (5-Bromo-4-chloro-3-indolyl-phosphate), does not enter intact bacterial cells and therefore only exported or surface-associated alkaline phosphatase activity can be detected. When exported or surface-associated alkaline phosphatase activity is present, the chromogenic XP substrate is cleaved to yield a blue pigment and the corresponding bacterial colonies can be identified by their blue colour.
Plasmid DNA was digested to completion with BamHI and dephosphorylated using shrimp alkaline phosphatase. Neisseria genomic DNA was partially digested with Sau3Al, such that a majority of fragments appeared to be 0.5 1.0 kb in size when observed as bands on a 1% agarose gel stained with ethidium bromide. These Sau3AI fragments were ligated into the prepared pFW-phoA vectors. E. coil strain DH5a was chosen as the cloning host since it lacks a functional phoA gene. Recombinant plasmids were selected on Luria agar containing 100 pg/ml of spectinomycin and pg/ml of the chromogenic XP substrate. E. coil transformants harbouring plasmids containing Neisseria meningitidis insert DNA that complements the export signal
IND
C 00
N
o sequence of the leaderless phoA gene were identified by the blue colour of the colonies.
Neisseria meningitidis insert DNA that complemented the export signal sequence of the leaderless phoA gene was sequenced and the resulting sequence was searched for known proteins in the GenBank database. The results are shown in Table Table 1 SEQ ID NO. Ref. Putative Protein Accession Gene Protein Name No.
0 1 2 phol-94 L-lactate permease NMB0543 3 4 phol-61 Membrane fusion protein NMB1716 6 phol-96 Protein-export membrane protein SECF NMB0608 7 8 pho2-7 Organic solvent tolerance protein NMB0280 9 10 pho2-10 Penicillfin-bin ding protein 4 NMB0749 11 12 pho2-6 Thiol:disulphide interchange protein NMB1519 13 14 pho2-35 Protein-export membrane protein SEOD NMB0607 16 pho2-66 Spermidine/Putre sci ne-bi nding protein NMB0623 17 18 pho2-76 Hypothetical 17.6 kD protein NMB0350 19 20 pho2-80 Hypothetical 11.9 kD protein NMB0844 21 22 pho2-81 -NMB0159 23 24 pho2-86 NMB1 277 26 pho2-90 Sulphate ABC transporter NMB0880 27 28 pho2-91 NMB0580 29 30 pho2-5 FRPC operon protein NMB1412 NMB0584 NMB0364 NMB1414 31 32 pho2-25 Hypothetical 10.2 kD protein NMB1546 NMB1631 33 34 pho2-41 NMB1 830 0 Protective properties of candidate protein vaccines SGenes identified in the screen were assessed as potential protein vaccine candidates based on the ability of the cloned, expressed, proteins to raise an immune C response in rabbits, with the resulting antibodies having the ability to stimulate complement-mediated bacteriolysis of Neisseria meningitidis. Protective responses O were determined by live bacterial challenge of mice immunised with recombinant Q proteins.
00 SIn summary, the candidate genes were PCR amplified, cloned and the encoded protein expressed and purified. The purified protein was used to generate antibodies for use in Enzyme Linked Immuno-Sorbent Assays (ELISA). The PorA
C
gene was also PCR amplified, cloned, expressed and purified. Monoclonal antibodies against PorA have been shown to passively protect animals in an infant rat model of infection (Saukkonen et al, Microb. Pathog., 1987; 261-267). Therefore, this protein was used as a positive control in some experiments. PorA has been shown to be unable to protect an animal against challenge from different strains of N.
meningitidis (Poolman, Infect. Dis., 1995; 4: 13), therefore any candidate that is able to generate a protective immune response against a diverse range of N. meningitidis strains, offers advantages over PorA.
PCR amplification of DNA.
Candidate genes were amplified by PCR using genomic DNA from strain MC58 as the DNA template (McGuinness et al, Lancet, 1991; 337:514). The primers are listed in Table 2. F denotes the forward primer and R the reverse primer. The primer pair PRAF and PRAR was used to amplify the PorA gene DNA.
Table 2 Candidate Primer Sequence SEQ ID NO.
PRAF 5'ATGCGAAAAAAACTTACCGCCCTC PRAR 5'GAATTTGTGGCGCAAACC 36 phoA 1-94R 5'GAGGAAGAAAATCATTGCCGCGAC 37 phoA 1-94F 5'ATGGTGTCCGTATTCGCCGC 38 phoA 1-61F 5'ATGGCTTrTTATGCTTTTAAGGCG 39 phoA 1-61 R 5'TTTCGCTTCAGAAGCAGGTTTGGC phoA 2-66R 5'TTTGCCCGCTTTGAGCCCTTG 41 phoA 2-66F 5'ATGCTCAACATCTACAACTGGTCG 42 phoA 2-10R 5'GGAGTCGGCAAAAAGGTGGGC 43 phoA 2-10F 5'ATGCTCTCCTCACAGTCTGCCC 44 phoA 1-97F 5'ATGGAACTCTTTAAAATCAAACGCG phoA 1-97R 5'AACCACGATTTCTTCTTTCTTCTTC 46 phoA 2-5F 5'ATGAGACCATATGCTACTAC 47 phoA 2-5R 5'1 I I I I ACTTGGATTGTTTAC 48 Cloning of vaccine candidates.
PCR amplified DNA from candidates was cloned directly into the InVitrogen pCRT7/CT-TOPO vector. This vector provides a T7 promoter, ribosome binding site and C-terminal 6xHis tag fusion to facilitate expression and purification of recombinant proteins using metal affinity chromatography.
For cloning, the ligation reaction was transformed in TOP1 OF' cells (Invitrogen).
DNA preparations from transformant DNA clones were screened to check the orientation of the insert DNA. Clones from candidates that appeared to have the insert DNA in the correct orientation were sequenced to confirm the integrity of the region of the construct.
Expression and purification.
Cloned candidates were tested for expression of the candidate genes following transformation into HMS174(DE3)pLysS competent cells (Invitrogen). Expression of candidate clones was induced with IPTG and expression analysed by SDS PAGE and western blotting using anti-His antibody after four hours induction. Candidate protein was purified via Talon resin (metal affinity column utilising the 6xHis-tag cloned at the
O
O carboxy terminus of the protein (Clontech)) utilizing an imidozole buffer gradient for Selution of protein from the resin (10-100mM).
Antibody production.
Prior to antibody production, animal serum was pre-screened for low reactogenicity to whole cell Neisseria meningitidis in ELISA assays. Antibodies were raised against each of the cloned and purified candidates in rabbits using 100pg of oO proteins for initial vaccination with Freund's adjuvant and three subsequent boosts at S28-day intervals with Freund's incomplete adjuvant. Serum was collected after each boost to generate sera samples.
ELISA against whole heat killed N. meningitidis ELISA assays against heat killed N. meningitidis were carried out to confirm that antibodies raised to purified proteins recognise N. meningitidis cells. These assays were carried out on strain MC58 as well as: Neisseria meningitidis Type 1000 Neisseria meningitidis Type SW2 107 Neisseria meningitidis Type NGH38 Neisseria meningitidis Type NGE28 Neisseria meningitidis Type 2996 These are all prevalent disease-causing strains and span the genetic diversity of this species based on dendrograms generated by MLST (multi-locus sequence typing).
Preparation of heat killed N. meningitidis N. meningitidis was grown on Columbia agar with chocolated horse blood (Oxoid) for 14 hours at 37 0 C in 5% CO 2 The cells were scraped from agar plate and resuspended the cells in 20ml PBS in a 50ml tube. The cell suspension was heated for 30 minutes at 56°C to kill the bacteria.
A 50 pl sample of the heat killed N. meningitidis was spread to Columbia agar with chocolated horse blood (Oxoid) and incubated for 18 hours at 37 0 C, 5% CO This allows confirmation that all N. meningitidis cells have been killed. The heat-killed cells were then washed in PBS. The OD 620 of the suspension was adjusted to 0.1 OD units versus PBS.
ELISA with heat killed N. meningitidis ELISA assays were carried out using the heat killed whole cell N. meningitidis.
ELISA plates were coated overnight with heat-killed cells (50pl of killed bacteria in PBS to each well of 96 well plate and incubated Standard ELISA protocols 0 were followed, with all incubations at 37 C for 1 hour. PBS/3% BSA blocking solution, PBS/Tween 0.1% wash solution, anti-rabbit AP conjugate secondary antibody (Sigma) Sand Sigma Fast P Nitrophenyl phosphate detection reagent (Sigma) were utilised.
C
The data was read at 405nm using an appropriate micro-titre plate reader. The data was generated using sera available seven days after the first boostervaccination (day IND 35 after first vaccination).
0O ELISA data.
0 The results showed that the anti-sera raised against each candidate protein elicited a strong response against the different strains of N. meningitidis.
In vivo screening.
To evaluate the protective efficacy of vaccine candidates, adult mice were immunised with recombinant proteins and the protective response determined by live bacterial challenge.
For each vaccine candidate, 15 six week old balb/C mice were vaccinated (subcutaneously) with 25pg of antigen on two separate occasions at three week intervals. One week after the end of the immunisation schedule, the group was challenged with the homologous bacterial strain MC58. The bacteria were inoculated intraperitoneally in a volume of 500pl in Brain Heart Infusion/ 0.5% iron dextran media at a dose of lxl0 6 cfu. Previous results have shown that iron is required for initiation of bacteraemic disease in these animals. This model has previously been used to demonstrate the protective efficacy of vaccination (Lissolo etal, Infect. Immun., 1995; 63: 884-890).
Control groups included animals vaccinated with adjuvant alone (negative control), with adjuvant combined with purified PorA (positive control) or an attenuated homologous strain. Survival was monitored following challenge.
Animals vaccinated with the candidate pho2-5 showed 80% (12/15) survival compared to non-vaccinated controls where 13% (2/15) survived. The candidate showed levels of protection equivalent to porA protein (13/15).
Animals vaccinated with candidates pho2-10, phol-94 or pho2-66 had 47% (7/15) or 27% (4/15) survival respectively, compared to the nonvaccinated controls, where 13% (2/15) survived.
Claims (14)
1. A peptide encoded by a gene including any of the nucleotide sequences S identified herein as SEQ ID NOS. 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, c 31 and 33, of N. meningitidis. or a homologue thereof in a Gram-negative bacterium, or a functional fragment thereof, for therapeutic or diagnostic use.
2. A peptide according to claim 1, wherein the homologue has at least 00 sequence similarity or identity at the peptide or nucleotide level.
3. A peptide according to claim 1 or claim 2, wherein the homologue has at least sequence similarity or identity at the peptide or nucleotide level.
4. A peptide according to any preceding claim, wherein the homologue has at least 90% sequence similarity or identity at the peptide or nucleotide level. A peptide according to claim 1, comprising any of the amino acid sequences defined herein as SEQ ID NOS. 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 32 and 34.
6. A polynucleotide encoding a peptide according to any preceding claim, for therapeutic or diagnostic use.
7. A host transformed to express a peptide according to any of claims 1 to
8. A microorganism comprising a mutation that disrupts the expression of any of the nucleotide sequences defined in claim 1.
9. A microorganism according to claim 8, wherein the mutation is insertional inactivation or a gene deletion. A microorganism according to claim 8 or claim 9, wherein the microorganism is Neisseria meningitidis.
11. A microorganism according to any of claims 8 to 10, comprising a mutation in a second nucleotide sequence.
12. A microorganism according to any of claims 8 to 11, for therapeutic or diagnostic use.
13. A vaccine comprising a peptide according to any of claims 1 to 5, or the means for its expression.
14. An antibody raised against a peptide according to any of claims 1 to Use of a product according to any of claims 1 to 7, in a screening assay.
16. Use of a product according to any of claims 1 to 12, for the manufacture of a medicament for use in the treatment or prevention of a condition associated with infection by Neisseria or Gram-negative bacteria. 1 1 1 11 SEQUENCE LISTING <110> Mioroscience Limited <120> GENES AND PROTEINS, AND THEIR USES <130> REP06516WO <140> (not yet known) <141> 2001-08-21 <150> 0020952.8 <151> 2000-08-24 <160> 48 <170> Patentln Ver. 2.1 <210> <211> <212> <213> 939 DNA Neisseri. meningitidis <220> <221> CDS <222> (939) <400> 1 atg too Met Ser 1 ato cat act Ile His Thr 5 otg aaa. cgc ctg Leu Lys Arg Leu tca tog otg otg Ser Ser Leu Leu ctc ggt Leu Gly gao att Asp Ile ctc tgc ott Leu Cys Leu tcc Ser ctg ocg toa gcc Leu Pro Ser Ala ctt ttt gcc gao Leu Phe Ala Asp tta ggg Leu Gly gaa ata Gu Ilie ttt tta gaa cag Phe Leu Giu Gin aac As n atg ott aco too too gat oog ata Met Leu Thr Ser Ser Asp Pro Ile tto goo gaa agc Phe Ala Glu Ser acg Thr ata oao 000 aco Ile His Pro Thr aco caa gcc att Thr Gin Al1a Ile aca Thr ggc ggt otg att Gly Gly Leu Ile too toa oag Ser Ser Gin tot goo Ser Ala 75 ctg gtc gto aao Leu Vai Val Asn aac As n aaa acc gga cag Lys Thr Gly Gin ata Ile ctg tat cag aaa Leu Tyr Gin Lys gcc gac agg att Ala Asp Arg Ile atg ccc Met Pro 288 atc gcc tcc Ile Ala Ser att Ile 100 tcc aaa ctg atg Ser Lys Leu Met gcg atg gtc gtt Ala Met Val Val ttg gat gca Leu Asp Ala 110 gaa atc gac Giu Ile Asp aac ttg gac atg aac gaa acc Asn Leu Asp Met Asn Giu Thr 115 gtt Val 120 acc att acg ccc Thr Ile Thr Pro gac Asp 125 cgc atc Arg Ile 130 aaa ggg acc ggc Lys Gly Thr Gly a gc Ser 135 cgt ctt gcc ata Arg Leu Ala Ile acg gca ctt aca Thr Ala Leu Th~r cgc Arg 145 aaa aaa ctg ctg Lys Lys Leu Leu cac His 150 ctg agc ctg atg Leu Ser Leu Met agc Ser 155 agc gaa aac cgc Ser Giu Asn Arg gcc Ala 1.60 acc cat gca ttg Thr His Ala Leu ggc Gi y 165 aga acc tac ccc Arg Thr Tyr Pro ggc atg ggc gca Gly Met Gly Ala ttt gtc Phe Val 175 gcc gcc atg Ala Ala Met cgc aaa gcc caa Axg Lys Al1a Gin a gc Ser 185 ctc ggt atg tac Leu Gly Met Tyr ggc agc cgc Gly Set Arg 190 ttt tac Phe Tyr gac ctg Asp Leu 210 ccg acc gga ctc Pro Thr Gly Leu aac Asn 200 ttc caa aac gtt Phe Gin Asn Val tct acc gcc aaa Set Thr Ala Lys 205 ccg caa atc cgc Pro Gin Ile Arg agc ctt atg gtc Ser Leu met Val gcc gcc gcc caa Ala Ala Al a Gin acc Thr 225 aac tcg act tcc Asn Ser Thr Ser aac As n 230 tac gcc tcg gta Tyr Ala Set Val ca g Gin 235 acc aaa aac ggg Thr Lys Asn Gly cag Gin 240 cag aac tac aaa Gin Asn Tyr Lys aac As n 245 tcc aat gcc ctg Ser Asn Ala Leu gtc Val 250 aga gaa ggc atg Arg Giu Gly Met tgg aac Trp Asn 255 atc gaa ttg Ile Giu Leu ca g Gin 260 aaa acc ggc tac Lys Thr Giy Tyr ata cgc gaa gca ggc Ile Arg Giu Ala Gly agg tct atg Arg Set Met 270 816 gtt gtc aaa Val Val Lys 275 aac tcg ccc Asn Ser Pro 290 gcc aac att caa Al1a Asn Ile Gin a ac As n 280 caa ccc gtt acc Gin Pro Val Thr atc gta ttg ctg 864 Ile Vai Leu Leu 285 cgc aaa atc gaa 912 Arg Lys Ile Giu aca tcc gcc Thr Ser Ala cgc gtc aac gac Arg Val Asn Asp 00 tcg Ser 305 tgg atg ctg cag Trp Met Leu Gin cgc tcc tga Arg Ser <210> 2 <211> 312 <212> PRT <213> Neisseria xneningitidis <400> 2 Met Ser 1 Ile His Thr 5 Leu Lys Arg Leu Ser Ser Leu Leu Leu Giy Leu Cys LeU Leu Giy Gin Ser Leu Pro Ser Ala His Leu Phe Aia Asp 25 Asn Asp Ile Asp Pro Ile Phe Leu Glu Gin As n Met Leu Thr Ser Giu Ile Phe Ala Giu Ser Thr 55 Ile His Pro Thr As n Thr Gin Ala Ile Thr Gly Gly Leu Ile Leu 70 Ser Ser Gin Ser Al a Leu Val Val Asn Lys Thr Giy Gin Ile Leu Tyr Gin Lys Ala Asp Arg Ile Met Pro Ile Ala Ser Asn Leu Asp 115 Ile 100 Ser Lys Leu Met Ser Ala Met Vai Vai 105 Leu Asp Ala 110 Giu Ile Asp Met Asn Giu Thr Val1 120 Thr Ile Thr Pro Asp 125 Arg Ile 130 Lys Gly Thr Gly Ser 135 Arg Leu Ala Ile Gi y 140 Thr Ala Leu Thr Arg 145 Lys Lys Leu Leu His Leu 150 Ser Leu Met Ser 155 Ser Giu Asn Axg Thr His Ala Ala Ala Met Leu Gly Arg Thr Tyr 165 Asn Arg Lys Ala Gin 180 Pro Gly Gly Met Gly Ala Phe Val 170 175 Ser Leu Gly Met Tyr Gly Ser Arg 185 190 Phe Tyr Giu 195 Pro Thr Gly Leu Asn Phe Gin Asn Val 200 Thr Ala Lys Asp Leu 210 Ser Leu Met Val Ala Ala Ala Gin Pro Gin Ile Arg Thr 225 Asn Ser Thr Ser Tyr Ala Ser Val Gin 235 Thr Lys Asn Gly Gin Asn Tyr Lys Asn 245 Ser Asn Ala Leu Arg Giu Giy Met Trp Asn 255 Ile Giu Leu Val Val Lys 275 Gin 260 Lys Thr Gly Tyr Ile 265 Arg Giu Ala Giy Axg Ser Met 270 Val Leu Leu Ala Asn Ile Gin Gin Pro Vai Thr Ile 285 Asn Ser 290 Pro Thr Ser Ala Arg Val Asn Asp Al a 300 Axg Lys Ile Giu Ser 305 Trp Met Leu Gin Gin Arg Ser 310 <210> 3 <211> 1239 <212> DNA <213> Neisseria meningitidis <220> <221> CDS <222> (1)..(1239) <400> 3 atg gct ttt tat gct ttt aag gcg Met Ala Phe Tyr Ala Phe Lys Ala atg cgt Met Arg gcg gcc gcg ttg Ala Ala Ala Leu gct gcc Ala Ala gcc gtt gca ttg gta ctg tcg tct tgc ggt aaa ggc gga gac gcg gcg Ala Val. Ala Leu Val Leu cag cct gct Gin Pro Ala Ser Ser Cys Gly Lys Gly 25 gaa gcc cct gcg Giu Ala Pro Ala Gi y Asp Ala Ala gtc gtc ggt Val Val Gly cag ggc ggg Gin Gly Gly ggt cgg Gly Arg 40 ccc Pro gtc gta Val Val acc gtc cat ccg Thr Val His Pro acc gtc gca ttg Thr Val Ala Leu gtc gag ttg ccg Val Giu Leu Pro ggg Gi y cgt ttg gaa tcg Arg Leu Glu Ser cgt acc gcc gat Arg Thr Ala Asp gtc Val 75 cgc gcc caa gtc Arg Al a Gin Val gqc Gi y 192 240 288 ggc atc atc caa Gly Ile Ile Gin aaa Lys cgc ctg ttc caa Arg Leu Phe Gin gaa Glu 90 ggc agt tat gtc Gly Ser Tyr Vai cgt gcc Arg Ala gga cag ccg Gly Gin Pro gaa agc gcg Glu Ser Ala 115 ctg Leu 100 tat cag atc gac Tyr Gin Ile Asp agt Ser 105 tcc act tat gaa Ser Thr Tyr Giu gca ggt ctg Ala Gly Leu 110 ctt gcc aaa Leu Ala Lys 336 384 cgc gcg caa ctg Arg Ala Gin Leu acg gct cag gca Thr Ala Gin Ala acg Th r 125 gcg gat Ala Asp 130 gcg gat ttg gcg Ala Asp Leu Ala cga Arg 135 tac aag cct ttg Tyr Lys Pro Leu gcc gcc gaa gcc Ala Ala Giu Ala gtc Val 145 agc cgg cag gaa Ser Arg Gin Giu tac Tyr 150 gat gct gcg gta Asp Ala Ala Val acg Thr 155 gcg aaa cgt tct Ala Lys Arg Ser 432 480 528 576 gag gca ggc gtt Giu Ala Gly Val aaa Lys 165 gcg gcg cag gcg Ala Ala Gin Ala gca Al a 170 atc aaa tcc gcc Ile Lys Ser Ala ggc atc Gly Ile 175 atc ggt Ile Giy agc ctg aac Ser Leu Asn cag tcc aaa Gin Ser Lys 195 cgt Arg 180 tcg cgc att acc Ser Arg Ile Thr gcg Al a 185 ccg att tcc ggc Pro Ile Ser Gly t tt Phe 190 gtt tcc gaa ggt Val Ser Glu Gly ttg ctg aac gct Leu Leu Asn Ala ggc gat gcg acc Gly Asp Ala Thr 205 624 gta ctg gcg acc atc cgc caa acc aat ccg atg tat gtg aac gtt acc Val Leu 210 A-la Thr Ile Arg Gin Thr Asn Pro Met 215 Tyr 220 Vai Asn Val Thr cag Gin 225 tct gca tcc gaa Ser Ala Ser Giu gtg Val 230 atg aaa ttg cgc Met Lys Leu Arg cag ata gcc gaa Gin Ile Ala Glu ggc Gly 240 aaa ctg ctg gcg Lys Leu Leu Ala 00 gat ggt gtg att gcg Asp Giy Val Ile Ala 250 gtc ggc atc aaa Val Gly Ile Lys ttt gac Phe Asp 255 720 768 816 864 gac ggc aca Asp Gly Thr gcc gtc aac Ala Val Asn 275 tac cct gaa aaa Tyr Pro Giu Lys ggc Gi y 265 cgc ctg ctg ttt Axg Leu Leu Phe gcc gat ccg Ala Asp Pro 270 gcc gta ccg Ala Val Pro gaa tcg acc ggt Giu Ser Thr Gly att acc ctg cgc Ile Thr Leu Arg gcc Al a 285 aac gat Asn Asp 290 cag aat atc ttg Gin Asn Ile Leu ccc ggt ctg tat Pro Gly Leu Tyr cgc gtg ctg atg Arg Vai Leu Met gac Asp 305 caa gtg gcg gtg Gin Vai Al1a Vai gat Asp 310 aac gca ttt gtt Asn Ala Phe Val gtg Val 315 ccg cag cag gcg Pro Gin Gin Ala gta Val 320 912 960 1008 acg cgc ggt gcg Thr Arg Giy Ala aaa Lys 325 gat acc gtg atg Asp Thr Val Met att Ile 330 gtg aat gcc caa Val Asn Ala Gin ggc ggt Giy Gly 335 atg gaa ccc Met Giu Pro att gtt acg Ile Val Thr 355 gag gta. acg gtt Giu Val Thr Val caa cag cag ggt Gin Gin Gin Gly acg aat tgg Thr Asn Trp 350 gtg gaa ggc Val Giu Gly 1056 1104 tcg ggt ctg aag Ser Gly Leu Lys gac Asp 360 ggg gac aag gtg Gly Asp Lys Vai gtt Vai 365 atc agt Ile Ser 370 atc gcc ggt ata Ile Ala Gly Ile acg Thr 375 ggt gcg aaa aag Gly Ala Lys Lys acg ccc aaa gaa Thr Pro Lys Giu 1152 1200 tgg Trp, 385 gcg tcg tct gaa Ala Ser Ser Glu aac Asn 390 caa gcc gcc gcg Gin Ala A-la Ala cc t Pro 395 caa tcc ggc gtt Gin Ser Gly Vai cag Gin 400 acg gca tct gaa gcc aaa cct gct tct gaa gcg aaa taa 13 1239 Thr Ala Ser Glu Ala Lys Pro Ala Ser Glu Ala Lys 405 410 <210> 4 <211> 412 <212> PRT <213> Neisseria ineningitidis <400> 4 Met Ala Phe Tyr Ala 1 5 Phe Lys Ala Met Ala Ala Ala Leu Ala Ala Ala Val Ala Gin Gly Gly Val Leu Ser Ser Cys Gly Lys Gly Gly Asp Ala Ala Val Val Gly Gin Pro Ala Gly Giu Ala Pro Ala Val Val Thr Val His Pro Gin 55 Thr Val Al a Leu Thr Val Giu Leu Pro Gl y Arg Leu Giu Ser Leu Arg Thr Ala Asp Arg Ala Gin Val Gly Ile Ile Gin Lys Arg Leu Phe Gin Giu 90 Gly Ser Tyr Val Arg Ala Gly Gin Pro Giu Ser Ala 115 Tyr Gin Ile Asp Ser Thr Tyr Giu Ala Gly Leu 110 Leu Ala Lys Arg Ala Gin Leu Thr Ala Gin Ala Thr 125 Ala Asp 130 Ala Asp Leu Ala Arg 135 Tyr Lys Pro Leu Ala Ala Giu Ala Val 145 Ser Arg Gin Giu Tyr 150 Asp Al1a Ala Val Thr 155 Al a Lys Arg Ser Glu Ala Gly Val Lys 165 Ala Ala Gin Ala Al a 170 Ile Lys Ser Ala Gly Ile 175 Ser Leu Asn Gin Ser Lys 195 Arg 180 Ser Axg Ile Thr Al a 185 Pro Ile Ser Giy Phe Ile Giy 190 Asp Ala Thr Val Ser Giu Giy Thr 200 Leu Leu Asn Ala Gi y 205 Val Leu Ala Thr Ile Arg 210 Gin Thr Asn Pro Met Tyr 215 220 Val Asn Val Thr Gin Ser Ala 225 Ser Giu Val 230 Met Lys Leu Arg Arg Gin 235 Ile Ala Giu Lys Leu Leu Ala Asp Gly Val Ile Al a 250 Val Giy Ile Lys Phe Asp 255 INO C 00 0Asp Giy Thr Ala Vai Asn 275 Val 260 Tyr Pro Glu Lys Arg Leu Leu Phe Ala Asp Pro 270 Ala Val Pro Giu Ser Thr Gly Gin 280 Ile Thr Leu Arg Asn Asp 290 Gin Asn Ile Leu Met 295 Pro Gly Leu Tyr Val 300 Arg Vai Leu Met Asp 305 Gin Val Ala Val Asp 310 Asn Ala Phe Val Val 315 Pro Gin Gin Ala Val 320 Thr A-rg Gly Ala Asp Thr Val Met Val Asn Ala Gin Gly Giy 335 Met Glu Pro Arg Glu Val Thr Val 340 Al a 345 Gin Gin Gin Gly Thr Asn Trp 350 Val Giu Giy Ile Vai Thr 355 Ser Gly Leu Lys Asp 360 Gly Asp Lys Val Ile Ser 370 Ile Ala Gly Ile Gly Ala Lys Lys Vai 380 Thr Pro Lys Giu Trp 385 Ala Ser Ser Glu Asn 390 Gin Ala Ala Ala Pro 395 Gin Ser Gly Val Gln 400 Thr Ala Ser Glu Al a 405 Lys Pro Ala Ser Giu Ala Lys 410 <210> <211> 936 <212> DNA <213> Neisseria meningitidis <220> <221> CDS <222> <400> atg gaa Met Glu ctc ttt Leu Phe aaa Lys atc aaa cgc gat Ile Lys Arg Asp att Ile 10 cog ttt atg agc Pro Phe Met Ser tac ggc Tyr Giy aaa ctg acg Lys Leu Thr ttt ttg gtt Phe Leu Val aco Thr ttc att. tcg ttg Phe Ile Ser Leu acg ttt atc gct Thr The Ile Ala gcc gtg ttc Ala Val Phe acc ggc ggt Thr Gly Gly aco aga ggt ctg Thr Arg Gly Leu aa t As n 40 ttc tot gtc gaa Phe Ser Val G2lu ttt Phe acg gta Thr Val atg gaa gtc caa Met Glu Val Gin tat Tyr 55 cag cag ggt gcg Gin Gin Giy Ala gat Asp gtc aat aag atg Vai Asn Lys Met ogc Arg gaa cgc otc gat Giu Arg Leu Asp acg Thr 70 ctg aaa ata ggt Leu Lys Ile Gly gta cag gtt cag Val Gin Val Gin gca Al a 192 240 288 ttg ggt acg aac Leu Gly Thr Asn aaa Lys cac atc atg atc His Ile Met Ile ogo Arg 90 ctg cog aac aaa Leu Pro Asn Lys gaa ggt Giu Giy gtt act tcc Val Thr Ser gc a Al a 100 cag ttg tcc aat Gin Leu Ser Asn cag Gin 105 gtt atg gat ttg Val Met Asp Leu otg aaa aaa Leu Lys Lys 110 ggc ccg caa Gly Pro Gin gac agt Asp Ser gtc ggt Val Giy 130 gac gtt aco ttg Asp Vai Thr Leu caa gtc gaa ttt Gin Vai Glu Phe atc Ile 125 gag gaa ttg gta Giu Giu Leu Val agt Ser 135 aat gga ttg atg Asn Giy Leu Met got Al1 a 140 tta ggt ttt gto Leu Gly Phe Vai gtt Vai 145 ato ggo ato att. Ile Giy Ile Ile att Ile 150 tao otg tog atg ogt ttt gaa tgg ogt Tyr Leu Ser Met Arg Phe Giu Trp Arg 155 480 goc gta tot gcc Ala Val Ser Ala att. ato Ile Ile 165 goc aat atg Ala Asn Met cac His 170 gao ato gtg att. Asp Ile Vai Ile att otc Ile Leu 175 ggc tge ttt Gly Cys Phe ggt atc ctt Giy Ile Leu 195 gc Al a 180 ttc ttc caa tgg gaa Phe Phe Gin Trp Glu 185 ttt tcg ctg acc Phe Ser Leu Thr gtc ttg gcg Val Leu Ala 190 gte gtC gtc Val Val Val gcc gta ttg ggc Ala Val Leu Giy tat Tyr 200 tct gtg aac gaa Ser Val Asn Glu tc c Ser 205 ttc gac Phe Asp 210 cgt aic cgt gaa Arg Ile A-rg Glu aac Asn 215 ttc cgc aag ccg Phe Arg Lys Pro gcg atg cgc gga Ala Met Arg Gly 220 gca acg atg agc Ala Thr Met Ser cat His gcc Al a 225 gtg ccg gaa gtc Val Pro Giu Val gac aac gcg att Asp Asn Ala Ile cgc Arg 240 672 720 768 ace atc att acc Thr Ile Ile Thr cac His 245 ggt tcg ace gag Gly Ser Thr Glu atg gtc gta tcc Met Val Val Ser atg ctg Met Leu 255 gtg ttc ggc Val Phe Gly ggc atc gtg Gly Ile Val 275 ggt Gi y 260 geg gce ttg eac Ala Ala Leu His gge Gly 265 ttt tct atg geg Phe Ser Met Ala ttg ace att Leu Thr Ile 270 age ceg ctt Ser Pro Leu 816 864 ttc ggc att tat Phe Gly Ile Tyr tce gta ttg gtt Ser Vai Leu Val gc Al a 285 etg eta Leu Leu 290 atg tte ggt ttg Met Phe Gly Leu age Ser 295 ege gac aat ate Arg Asp Asn Ile ggt Gi y 300 aaa gaa ceg aag Lys Glu Pro Lys aag aaa gaa gaa Lys Lys G1u Giu 305 <210> 6 <211> 311 <212> PRT <213> Neisseria <400> 6 Met Glu Leu Phe 1 ate gtg gtt tga Ile Val Val 310 ineningi tidi s Lys Ile Lys Arg Asp 5 Ile Pro Phe Met Ser Tyr Gly 10 Lys Leu Thr Thr Phe Ile Ser Leu Val Thr Phe Ile Ala Ala Val Phe Phe Leu Val Thr Arg Gly Leu Asn Phe Ser Val Giu Phe Thr Gly Gly Thr Val Met Giu Val Gin Gin Gin Gly Ala Asp Val Asn Lys Met Glu Arg Leu Asp Thr Leu Lys Ile Gly Asp Val Gin Val Gin 00 00 Leu Gly Thr Asn His Ile Met Ile Leu Pro Asn Lys Glu Gly Val Thr Ser Asp Ser Pro 115 Ala 100 Gin Leu Ser Asn Gin 105 Val Met Asp Leu Leu Lys Lys 110 Gly Pro Gin Asp Vai Thr Leu Gin Val Glu Phe Ile 125 Vai Gly 130 Glu Glu Leu Val Ser 135 Asn Gly Leu Met Leu Gly Phe Val Ile Gly Ile Ile Tyr Leu Ser Met Arg 155 Phe Giu Trp Arg Ala Val Ser Ala Ile 165 Ile Ala Asn Met His 170 Asp Ile Val Ile Ile Leu 175 Gly Cys Phe Gly Ile Leu 195 Ala 180 Phe Phe Gin Trp Phe Ser Leu Thr Val Leu Ala 190 Val Val Val Ala Vai Leu Gly Tyr 200 Ser Val Asn Glu Ser 205 Phe Asp 210 Arg Ile Arg Glu Phe Arg Lys Pro Met Arg Gly His Ala 225 Val Pro Giu Val Ile 230 Asp Asn Ala Ile Thr 235 Ala Thr Met Ser Arg 240 Thr Ile Ile Thr His 245 Gly Ser Thr Glu Ala 250 Met Vai Val Ser Met Leu 255 Val Phe Gly Gly Ile Val 275 Gly Ala 260 Ala Leu His Giy 265 Phe Ser Met Ala Leu Thr Ile 270 Ser Pro Leu Phe Gly Ile Tyr Ser 280 Ser Vai Leu Val Ala 285 Leu Leu Met Phe Gly Leu Ser Arg Asp Asl Ile Giy Lys Giu Pro Lys 290 295 300 Lys Lys Giu Giu Ile Val Val 305 310 <210> 7 <211> 2277 <212> DNA <213> Neisseria reningitidis <220> <221> CDS <222> (1)..(2277) <400> 7 gtg tcc gaa ccc Val Ser Giu Pro 1 ata Ile 5 cag cct acc agc Gin Pro Thr ser agc ctc ggt tog Ser Leu Giy Ser acc tgc Thr Cys ctg ttt tgc Leu Phe Cys gtc caa ggc Val Gin Gly agt Ser aac gaa agc ggc Asn Giu Ser Giy agc Ser 25 ccc gag aga acc Pro Giu Arg Thr gaa gcc gc Giu Ala Ala acg cgc att Thr Arg Ile agc ggc gaa gca Ser Giy Giu Ala tec Ser atc ccc gaa gac Ile Pro Giu Asp gtt gc Val Ala gao agg atg gaa Asp Axg Met Giu cag tcg cag gtg Gin Ser Gin Val gtg cgt gcc gaa Val Arg Ala Giu ggc Gi Y aac gtc gte gtc Asn Val Val Val gaa Gi u 70 cgc aac cgg acg Arg Asn Arg Thr acc Thr 75 etc aat acc gat Leu Asn Thr Asp tgg Trp gcg gat tao gac Ala Asp Tyr Asp tcg ggc gac ac Ser Gly Asp Thr gtt Val ace gca ggc gac Thr Ala Gly Asp cgg ttc Arg Phe gOC etc caa Ala Leu Gin cag Gin 100 gac ggt aeg ctg Asp Giy Thr Leu egg ggc gaa acc Arg Gly Giu Thr ctg ace tac Leu Thr Tyr 110 aat etc gag cag cag aec ggg gaa gcg eac aac gtc cgc atg gaa atc Asn Leu Giu Gin Gin Thr Gly Giu Ala His Asn Val Arg Met Glu Ile gaa caa Glu Gin 130 ggc gga cgg cgg ctg caa agc gtc agc Gly Giy Arg Arg Leu Gin Ser Vai Ser 135 cgc acc: Arg Thr 140 gcc gaa atg Ala Giu Met tg Leu 145 ggc gaa ggg cat Gly Giu Giy His tac Tyr 150 aaa ctg acg gaa Lys Leu Thr Giu acc Thr 155 caa ttc aac acc Gin Phe Asn Thr tgt Cys 160 icc: gcc ggc gat S er Ala Gly Asp ggc tgg tat gtc Gly Trp, Tyr Vai aag Lys 170 gca gcc tci gtc Ala Ala Ser Val gaa gcc Giu Ala 175 480 528 576 624 gat cgg gaa Asp Arg Giu ggc ggc gtt Gly Giy Val 195 ggc ata ggc gt Gly Ile Gly Val gcc Al1 a 185 aaa cac gec gcc Lys His Ala Ala tic gtg ttc Phe Val Phe 190 ccg ctt gac Pro Leu Asp ccc att ttc tac Pro Ile Phe Tyr acc Thr 200 cct tgg gcg gac Pro Trp Ala Asp ttc Phe 205 ggc aac Gly Asn 210 cgc aaa agc ggc Arg Lys Ser Gly ctg Leu 215 cti git ccc ica Leu Val Pro Ser cig Leu 220 tcc gcc ggi icg Ser Ala Gly Ser gac Asp 225 ggc: git icc ct Giy Val Ser Leu icc Ser 230 git ccc tat tat Vai Pro Tyr Tyr tc Phe 235 aac cii gcc ccc Asn Leu Ala Pro 672 720 768 ctc gat gcc acg Leu Asp Ala Thr gcg ccc agc gig Ala Pro Ser Val aic Ile 250 ggc gaa cgc ggc Giy Giu Arg Gly gcg qtc Ala Val 255 itt gac: ggg Phe Asp Gly gta cgc tac cig Val Arg Tyr Leu cgg Arg 265 ccg gat tat gcc Pro Asp Tyr Ala ggc cag icc Gly Gin Ser 270 aai aac cgc Asn Asn Arg 816 gac ctg Asp Leu acc Thr 275 igg ctg ccg cac Trp Leu Pro His aag aaa agc ggc Lys Lys Ser Gly agg Arg 285 tat cag gcg Tyr Gin Ala 290 aaa igg cag Lys Trp Gin cat cgg His Arg 295 cac: gac ati His Asp Ile tcc Ser 300 gac acg cit cag Asp Thr Leu Gin 912 gcg ggt gtc gat tic aac caa gic icc gac agc ggc tac tac cgc gac Al a 305 Giy Val Asp Phe Asn 310 Gin Val Ser Asp Ser 315 aac gtc Asn Vai 330 Gly Tyr Tyr Arg aac ctc aac cgc Asn Leu Asn Arg 335 Asp 320 cgt Arg ttt tac ggc aac Phe Tyr Gly Asn aaa Lys 325 gaa ate gcc ggc Giu Ile Ala Gly 1008 gta tgg ctg Val Trp, Leu ga t Asp 340 tat ggc ggc agg Tyr Gly Gly Arg gcg ggc ggc agc Ala Giy Giy Ser aat gcc Asn Ala ggc ctt Gly Leu aaa gac Lys Asp 370 tcg Ser 355 gtt ctg aaa tac Val Leu Lys Tyr acg ctg gca aac Thr Leu Ala Asn caa Gin 365 age ggc tac Ser Gly Tyr 1056 1104 1152 aaa ccg tat gcc Lys Pro Tyr Ala ctc Leu 375 atg ccg cgc ctt Met Pro Arg Leu tcg Ser 380 gte gag tgg cgt Val. Glu Trp Arg aaa Lys 385 aac aec ggc agg Asn Thr Gly Arg geg Al a 390 caa ate ggc gtg Gin Ile Gly Val tcc Ser 395 gca caa ttt ace Ala Gin Phe Thr ega Arg 400 1200 1248 ttc agc cac gac Phe Ser His Asp agc Ser 405 cgc caa gac ggc Axg Gin Asp Gly cgc ctg gtc gtc Arg Leu Val Val tat ccc Tyr Pro 415 gac atc Asp Ile etc gga Leu Gly gaa gcc Giu Ala 450 aaa Lys gat ttc age aac Asp Phe Ser Asn age Ser 425 tgg ggc tat gte Trp Gly Tyr Val cgt ccc aaa Arg Pro Lys 430 gge age caa Gly Ser Gin ctg cae gee ace tat Leu His Ala Thr Tyr 435 ega ege gte age ege Arg Arg Val Ser Arg 455 tac Tyr 440 age etc aae ege Ser Leu Asn Arg 1296 1344 1392 act ctg ccc att Thr Leu Pro Ile aac ate gac agc Asn Ile Asp Ser gge gca act ttt gag Gly Ala Thr Phe Glu 465 egg Arg 470 aat aeg egg atg Asn Thr Arg met ttc Ph e 475 gge gga gaa gte Gly Gay Glu Val etg Leu 480 1440 1488 caa ace etc gag Gin Thr Leu Glu cg Pro 485 ege ctg ttc tac Arg Leu Phe Tyr aae Asn 490 tat att cet gee Tyr Ile Pro Ala aaa. tcc Lys Ser 495 caa aac gac etg eec aat ttc gat teg teg gaa age age ttc ggc tac 13 1536 Gin Asn Asp ggg cag ctc Gly Gin Leu 515 Leu 500 Pro Asn Phe Asp SeGiSeSe Set Glu Set Set Phe Gly Tyr 510 agg att aac Arg Ile Asn ttt cgc gaa aac Phe Arg Giu Asn ctc Leu 520 tat tac ggc aac gac Tyr Tyr Gly Asn Asp 525 1584 acc gca Thr Ala 530 aac agc ctt tcc gcc gcc gtg caa agc cgt att ttg gac ggc Asn Ser Leu Ser Ala Ala Val Gin Ser Arg Ile Leu Asp Gly 1632 gcg acg ggg gaa gag Ala Thr Giy Giu Giu 545 ttc aag gat gat gcg Phe Lys Asp Asp Ala 565 cgt Arg 550 ttc cgc gcc ggc Phe Axg Ala Gly ggt cag aaa ttc Gly Gin Lys Phe tat Tyr 560 1680 1728 gtg atg ctt gac Val Met Leu Asp agc gtc ggc aaa Ser Val Giy Lys aaa ccg Lys Pro 575 cgc aac cgt Arg Asn Arg cgc ttc atc Arg Phe Ile 595 tcc Set 580 gac tgg gtg gca Asp Trp Val Ala ttt Phe 585 gcc tcc ggc agc Ala Set Gly Ser atc ggc agc Ile Giy Set 590 gac aaa cgc Asp Lys Arg 1776 1824 ctc gac agc agc Leu Asp Ser Set cac tac aac caa His Tyr Asn Gin aac As n 605 gcc gag Ala Giu 610 aac tac gcc gtc Asn Tyr Ala Vai ggt Gi y 615 gca agc tac cgt Ala Set Tyr Arg ccc gca cag ggc Pro Ala Gin Gly 620 gaa aaa atc tac Glu Lys Ile Tyr aaa Lys ctg Leu 640 gtg Val1 625 ctg aac gcc cgc Leu Asn Ala Arg ta c Tyr 630 aaa tac ggg cgc Lys Tyr Gly Arg aac Asn 635 1872 1920 1968 aag tcc gac ggt Lys Set Asp Gly tcc gca caa tgg Ser Ala Gin Trp 660 tcc Set 645 tat ttt tac gac Tyr Phe Tyr Asp aaa Lys 650 ctc agc cag ctc Leu Ser Gin Leu gac ctg Asp Leu 655 ccg ctg acg cgc Pro Leu Thr Arg aac Asn 665 ctg tcg gcc gtc Leu Ser Ala Val gtc cgt tac Val Arg Tyr 670 gcg ggt gcg Ala Gly Al1a 2016 aac tac Asn Tyr ggt Gi y 675 ttt gaa gcc aaa Phe Giu Ala Lys aaa Lys 680 ccg ata gag gtg Pro Ile Giu Val ctg Leu 685 2064 gaa tac aaa agc agt tgc ggc tgc tgg ggc gcg ggc gtg tac gcc caa 21 2112 Giu Tyr 690 Lys Ser Ser Cys Gly 695 Cys Trp Gly Ala Val Tyr Ala Gin tac gtt acc ggc Tyr Val Thr Gly gaa Gi u 710 aac acc tac aaa Asn Thr Tyr Lys aac Asn 715 gct gtc ttt ttc Ala Val Phe Phe tca Ser 720 ctt cag ttg aaa Leu Gin Leu Lys ctc agc agt gtc Leu Ser Ser Val aga aac ccc gca Arg Asn Pro Ala gac agg Asp Arg 735 2160 2208 2256 2277 atg gat gtc Met Asp Val gga cgc aac Gly Arg Asn 755 gcc Al a 740 gtt ccc ggc tat Val Pro Gly Tyr atc Ile 745 acc gcc cac tct Thr Ala His Ser ctt tcc gcc Leu Ser Ala 750 aaa cga ccc tga Lys Arg Pro <210> 8 <211> 758 <212> PRT <213> Neisseria meningitidis <400> 8 Val Ser I Glu Pro Ile 5 Gin Pro Thr Ser Leu 10 Ser Leu Gly Ser Thr Cys Leu Phe Cys Ser Val Gin Giy Ser Asn Giu Ser Giy Pro Giu Arg Thr Giu Ala Ala Thr Arg Ile Gly Giu Ala Ile Pro Giu Asp Tyr Val Al1a Asp Arg Met Giu Giy 55 Gin Ser Gin Val Gin Val Axg Ala Giu Gi y Asn Vai Val Val Giu 70 Arg Asn Arg Thr Thr Leu Asn Thr Asp Ala Asp Tyr Asp Gin Ser Giy Asp Giy Thr Leu Thr Vai 90 Ile Arg 105 Thr Ala Giy Giy Giu Thr Asp Arg Phe Leu Thr Tyr 110 Ala Leu Gin Gin Asp 100 Asn Leu Glu Gin Gin Thr Giy Giu Ala His Asn Val Arg Met Giu Ile 125 Thr Glu Gin 130 Leu Gly Gly Arg Arg Leu 135 Lys Ser Val Ser Ala Glu Met Glu Gly His 145 Ser Tyr 150 Giy Leu Thr Glu Thr 155 Ala Phe Asn Thr Ala Gly Asp Ala 165 Giy Trp Tyr Val Ala Ser Val Glu Ala 175 Asp Arg Glu Gly Gly Val 195 Gly Asn Arg Lys 180 Pro Ile Gly Val Ala 185 Pro His Ala Ala Ile Phe Tyr Trp Ala Asp Phe 205 Ser Phe Val Phe 190 Pro Leu Asp Ala Gly Ser Lys Ser Gly Val Pro Ser 210 Asp Gly Val Ser Leu 225 Leu Ser 230 Ala Pro Tyr Tyr Phe 235 Gly Leu Ala Pro Asn 240 Asp Ala Thr Phe 245 Val Pro Ser Val Glu Arg Gly Ala Vai 255 Phe Asp Gly Asp Leu Thr 275 Tvr Gin Ala Gin 260 Trp Arg Tyr Leu Arg 265 Lys Asp Tyr Ala Leu Pro His Lys Ser Gly Arg 285 Asp Gly Gin Ser 270 Asn Asn Arg Thr Leu Gin Lys Trp Gin 290 Ala Gly His 295 Gin His Asp Ile Val Asp Phe 305 Phe Asn 310 Glu Val Ser Asp Ser 315 Val Tyr Tyr Arg Asp 320 Tyr Gly Asn Ile Ala Gly Asn 330 Ala Asn Leu Asn Arg Arg 335 Val Trp Leu Gly Leu Ser 355 Lys Asp Lys Asp 340 Val Gly Gly Arg Ala 345 Thr Gly Gly Ser Leu Asn Ala 350 Ser Giy Tyr Leu Lys Tyr Leu Ala Asn Pro Tyr Ala Leu Pro Arg Leu Ser Val Giu Trp Arg 370 Lys Asn Thr Gly Arg Ala 385 390 380 Ala Ile Gly Val Ser 395 Arg Gin Phe Thr Arg 400 Ser His Asp Ser 405 Asp Arg Gin Asp Gly Ser 410 Trp Leu Val Val Tyr Pro 415 Asp Ile Lys Leu Gly Leu 435 Glu Ala Arg Trp 420 His Phe Ser Asn Ser 425 Ser Gly Tyr Val Ala Thr Tyr Tyr 440 Thr Leu Asn Arg Arg Pro Lys 430 Gly Ser Gin Ile Asp Ser Arg Val Ser Leu Pro Ile 450 Glv Ala Val 460 Gly Thr Phe Glu 465 Gin Arg 470 Arg Thr Arg Met Gly Giu Vai Leu 480 Thr Leu Glu Leu Phe Tyr Asn 490 Ser Ile Pro Ala Lys Ser 495 Gin Asn Asp Gly Gin Leu 515 Thr Ala Asn Leu 500 Phe Asn Phe Asp Glu Ser Ser Arg Giu Asn Leu 520 Ala Tyr Gly Asn Asp 525 Ile Phe Giy Tyr 510 Arg Ile Asn Leu Asp Gly Ser Leu Ser 530 Ala Thr Ala 535 Phe Val Gin Ser Arg 540 Giy Gly Giu Glu Arg 550 Val Arg Ala Gly Ile 555 Ser Gin Lys Phe Lys Asp Asp Met Leu Asp Giy 570 Ala Vai Gly Lys Lys Pro 575 Arg Asn Arg Arg Phe Ile 595 Ala Glu Asn 610 Ser 580 Leu Trp Val Ala Phe 585 His Ser Gly Ser Asp Ser Ser Ile 600 Ala Tyr Asn Gin Ile Gly Ser 590 Asp Lys Arg Gin Gly Lys Tyr Ala Val Gly 615 Ser Tyr Arg Pro 620 Giu Val Leu Asn Ala Arg Tyr Lys Tyr Giy Arg Asn Lys Ile Tyr Leu 625 65 630 63564 640 Lys Ser Asp Gly S er 645 Tyr Phe Tyr Asp Leu Ser Gin Leu Asp Leu 655 Ser Ala Gin Asn Tyr Gly 675 Pro Leu Thr Arg Asn 665 Leu Ser Ala Val Val Mxg Tyr 670 Ala Gly Ala Phe Giu Ala Lys Pro Ile Glu Val Leu 685 Glu Tyr 690 Lys Ser Ser Cys Gly 695 Cys Trp Gly Ala Val Tyr Ala Gin Axg 705 Tyr Val Thr Gly Gi u 710 Asn Thr Tyr Lys Asn Ala Val Phe Phe 715 Leu Gin Leu Lys Asp 725 Leu Ser Ser Val Axg Asn Pro Ala Asp Arg 735 Met Asp Val Gly Arg Asn 755 Val Pro Gly Tyr Ile 745 Thr Ala His Ser Leu Ser Ala 750 Lys Arg Pro <210> 9 <211> 939 <212> DNA <213> Neisseria meningitidis <220> <221> CDS <222> <400> 9 atg tcc atc cat act Met Ser Ile His Thr 1 5 ctc tgc ctt tcc ctg Leu Cys Leu Ser Leu tta ggg caa ttt tta Leu Gly Gin Phe Leu ctg aaa cgc ctg Leu Lys Arg Leu tca tcg ctg ctg Ser Ser Leu Leu ctc ggt 48 Leu Gly ccg tca gcc cac ctt ttt gcc gac Pro Ser Ala His Leu Phe Ala Asp 25 aac gac att 96 Asn Asp Ile gaa cag aac atg ctt acc tcc tcc gat ccg ata Glu Gin Asn Met Leu Thr Ser Ser Asp Pro Ile gaa ata Glu Ile ttc gcc gaa agc Phe Ala Giu Ser ata cac ccc acc Ile His Pro Thr acc caa gcc att Thr Gin Ala Ile aca Thr ggc ggt ctg att Gly Gly Leu Ile Ctc Leu tcc tca cag tot Ser Set Gin Set ctg gtc gtc aac Leu Val Vai Asn aaa aco gga cag Lys Thr Gly Gin ctg tat cag aaa Leu Tyr Gin Lys aac As n goc gac agg att Ala Asp Arg Ile atg coo Met Pro 192 240 288 336 384 ato gcc tcc Ilie Ala Ser aac ttg gac Asn Leu Asp 115 att Ile 100 toc aaa ctg atg Ser Lys Leu Met gog atg gto gtt Ala Met Val Val ttg gat gca Leu Asp Ala 110 gaa atc gao Giu Ile Asp atg aao gaa acc Met Asn Giu Thr gt Val 120 acc att acg ccc Thr Ile Thr Pro gac Asp 125 ogo ato Arg Ile 130 aaa ggg acc 99c Lys Gly Thr Gly agc Ser 135 cgt ctt gcc ata Arg Leu Ala Ile acg gca ott aca Thr Ala Leu Thr ogo Arg 145 aaa. aaa otg otg Lys Lys Leu Leu otg ago otg atg Leu Ser Leu Met ago Ser 155 ago qaa aac ogo Ser Glu Asn Arg go o Al a 160 aoO oat goa ttg Thr His Ala Leu ggc Gi y 165 aga aoc tao ccc Arg Thr Tyr Pro ggo Gi y 170 ggo atg ggo gca Gly Met Giy Ala ttt gto Phe Vai 175 goc goo atg Ala Ala Met ttt tac gaa Phe Tyr GlU 195 aao As n 180 ogc aaa goo caa Arg Lys Ala Gin ctc ggt atg tao Leu Gly Met Tyr ggo ago ogo Gly Ser Arg 190 aco goo aaa Thr Ala Lys oog aoo gga oto Pro Thr Gly Leu aac Asn 200 tto caa aao gtt Phe Gin Asn Val tct Ser 205 gao otg Asp Leu 210 ago ctt atg gtc Ser Leu Met Val aac Asn 215 gco goo goo oaa Ala Ala Ala Gin tat Tyr 220 cog oaa ato ogo Pro Gin Ile Arg aoc aac tog act too aac tao gcc tog gta oag aoc aaa aac ggg oag Thr Asn Ser Thr Ser Asfl Tyr Ala Ser Vai Gin Thr Lys Asn Gly Gin 230 23524 240 cag aac tac aaa. Gin Asn Tyr Lys aac Asn 245 tcc aat gcc ctg Ser Asn Ala Leu aga gaa ggc atg Arg Giu Gly Met tgg aac Trp Asn 255 atc gaa ttg Ile Giu Leu gtt gtc aaa Vai Val Lys 275 cag Gin 260 aaa acc ggc tac Lys Thr Gly Tyr cgc gaa gca ggc Arg GlU Ala Gly agg tct atg Arg Ser Met 270 gta ttg ctg Val Leu Leu gcc aac att caa Ala Asn Ile Gin aac Asn 280 caa ccc gtt acc Gin Pro Val Thr atc Ile 285 816 864 912 aac tog Asn Ser 290 cco aca toc gcc Pro Thr Ser Ala aca Thr 295 cgc gtc aac gac Arg Val Asn Asp gcc Al a 300 cgo aaa atc gaa Arg Lys Ile Glu tcg Ser 305 tgg atg ctg cag Trp Met Leu Gin caa. cgc tcc tga Gin Arg Ser 310 <210> <211> 312 <212> PRT <213> Neisseria.men ingi tidi s <400> Met Se~r Ile His Thr 1 5 Leu Lys Arg Leu Pro Ser Ser Leu Leu 10 Leu Gly Leu Cys Leu Leu Gly Gin Ser Leu Pro Ser Ala Leu Phe A-la Asp Asn Asp Ile Asp Pro Ile Phe Leu Giu Gin Asn 40 Met Leu Thr Ser Ser Giu Ilie Phe Ala Giu Ser Ile His Pro Thr Asn Thr Gin Ala Leu Val Val Asn Ile As n Thr Gly Giy Leu Ile Leu 70 Ser Ser Gin Ser Al a 75 Met Pro Lys Thr Giy Gin Leu Tyr Gin Lys Asn Ala Asp Axg Ile Ile Ala Ser Ile Ser Lys Leu Met Ser Ala Met Vai Vai Leu Asp Ala 100 105 Asn Leu Asp 115 Met Asn Giu Thr Val 120 Thr Ile Thr Pro Asp 125 Giu Ile Asp Arg Ile 130 Lys Gly Thr Gly Arg Leu Ala Ile Gi y 140 Thr Ala Leu Thr Arg 145 Lys Lys Leu Leu His 150 Leu Ser Leu Met Ser Glu Asn Arg Al a 160 Thr His Ala Leu Gi y 165 Arg Thr Tyr Pro Gly 170 Gly Met Gly Ala Phe Val 175 A-1a Al a Met Phe Tyr Glu 195 Asn 180 Arg Lys Ala Gin Leu Gly Met Tyr Gly Ser Arg 190 Thr Ala Lys Pro Thr Gly Leu As n 200 Phe Gin Asn Val Ser 205 Asp Leu 210 Ser Leu Met Val Ala Ala Ala Gin Tyr 220 Pro Gin Ile Axrg Thr 225 Asn Ser Thr Ser Asn 230 Tyr Ala Ser Vai Gin 235 Thr Lys Asn Giy Gin Asn Tyr Lys Asn 245 Ser Asn Ala Leu Val 250 Arg Giu Gly Met Trp, Asn 255 Ile Giu Leu Vai Val Lys 275 Gin 260 Lys Thr Giy Tyr Ile 265 Arg Giu Ala Gly Arg Ser Met 270 Val Leu Leu Ala Asn Ile Gin Asn 280 Gin Pro Vai Thr Ile 285 Asn Ser 290 Pro Thr Ser Ala Thr 295 Arg Vai Asn Asp Al a 300 Arg Lys Ile Giu Trp Met Leu Gin Gin Arg Ser 310 <210> 1i <211> 1806 <212> DN'A <213> Neisseria meningitidis <220> <221> CDS <222> (1)..(1806) <400> 11 atg aaa aaa. ctg a Met Lys Lys Leu I tgc ctg ttc gcc Cys Leu Phe Ala gta ttt Val Phe ttg atg ttg Leu Met Leu tgc gga Cys Gly cga gct ttc A.rg Ala Phe ttc gtg ccg Phe Val Pro gcg Al a ctg gat gcg aac Leu Asp Ala Asn ctg ctg ccg ccg Leu Leu Pro Pro gaa aag gca Giu Lys Ala gtc cgt ttc Val Arg Phe gag ctt gcc gtt Glu Leu Ala Val gac gac ggt gtg Asp Asp Gly Val agg att Arg Ile gcc gac gga tac A-la Asp Gly Tyr tat Tyr atg tat cag gcg Met Tyr Gin Ala aic gtc ggc aag Ile Val Gly Lys acc Th r gat ccg gcg gat Asp Pro Ala Asp tt g Leu 70 ttg gga cag cct Leu Gly Gin Pro tct Ser 75 ttc agc aag ggc Phe Ser Lys Gly ga a Gi u 192 240 288 336 gag aag gaa gac Giu Lys Giu Asp gag G1 u ttt ttc ggc agg Phe Phe Giy Arg cag Gin 90 acg gtt tac cat Thr Val Tyr His cac gag His Giu tat aaa Tyr Lys gcg cag gtt Ala Gin Val ttg gtt ttg Leu Val Leu 115 gc C Al a 100 ttt cct tat gca Phe Pro Tyr Ala aag Lys 105 gct gtc ggc gaa Ala Val Gly Giu acc tat cag ggc Thr Tyr Gin Gly gcc gaa gcc ggc Ala Glu Ala Gly gtg Val 125 tgc tat ccg Cys Tyr Pro ccc gtg Pro Val 130 gat acc gag ttt Asp Thr Glu Phe att ttc ggc aac Ile Phe Giy Asn ggc Gi y 140 act tac cat ccg Thr Tyr His Pro caa Gin 145 acc gac gaa Thr Asp Giu ccg gca Pro Ala 150 tcc gcc aaa gac Ser Ala Lys Asp cgc Arg 155 ttt ttg cag cct Phe Leu Gin Pro tcc Ser 160 tct caa aac ggc agc ggg gcg ctg ccg ser Gin Asn Gly Ser Gly Ala Leu Pro 165 ccc pro 170 ccg aag ggg gat Pro Lys Gly Asp gag ggc Glu Gly 175 ggc gac agc cgt Gly Asp Ser Arg 180 ttg gcg ttt ttt Leu Ala Phe Phe 195 ttc aag ctg tot Phe Lys Leu Ser tgg Trp 185 gat acg ctc aac Asp Thr Leu Asn gcc aat ott Ala Asn Leu 190 gcc tgt atg Ala Cys Met ctc gct ggt Leu Ala Gly ggc otg agt ttt Gly Leu Ser Phe tat ccc Tyr Pro 210 ctg ttg cog att Leu Leu Pro Ile tcc agt att gtg Ser Ser Ile Val ggc gac aaa aag Giy Asp Lys Lys gcg Al a 225 ggc aag gcg cgg Gly Lys Ala Axg ttt gtg ctg too Phe Val Leu Ser gto Val 235 gtt tat gtt oag Val Tyr Val Gin ttg got otg act Leu Ala Leu Thr tat Tyr 245 acg ctg gto ggo Thr Leu Val Giy gtt goc gga otg Val Ala Gly Leu acg ggc Thr Giy 255 gca ctg ctg Ala Leu Leu tog got tta Ser Ala Leu 275 acc Thr 260 gta tgg ttg cag Vai Trp Leu Gin cag Gin 265 got tgg gtg gta Ala Trp Val Val ttg gog gca Leu Ala Ala 270 otg tto aao Leu Phe Asn atg gto gto ttg Met Val Val Leu otg tot atg tto Leu Ser Met Phe atO cag Ile Gin 290 ott ccc aao gc Leu Pro Asn Ala gtg Vai 295 oag tog tat ttt Gin Ser Tyr Phe cag Gin 300 aat caa ago ago Asn Gin Ser Ser agg Ar g 305 too Ser ott toa ggo ggt Leu Ser Giy Gly gcg otg att gtc Ala Leu Ile Vai 325 ato gtt too gto Ilie Vai Ser Vai att atg ggc ata Ile Met Giy Ile 912 960 1008 ggg cog tgo gtc Gly Pro Cys Val gc Al a 330 cog cog ctg goa Pro Pro Leu Ala ttt got Phe Ala 335 ttg ggo tao Leu Giy Tyr ott tao act Leu Tyr Thr 355 ggt cag acg ggc Giy Gin Thr Gly gog gtt tta ggo Ala Vai Leu Giy ggt ttg gca Giy Leu Ala 350 goc ato ggo Ala Ile Gly 1056 1104 ttg gog ttg ggc Leu Ala Leu Gly ggo gtt cog otg Giy Vai Pro Leu acg ttc Thr Phe 370 ggc ggg cat atc Gly Gly His Ile ctg Leu 375 cct aag gca ggc Pro Lys Ala Gly tgg atg aat gcc Trp, Met Asn Ala 1152 gtc aaa tac Val Lys Tyr 385 gca ttc ggc Ala Phe Gly 390 ttc atc ctg cta Phe Ile Leu Leu gcc Al a 395 gtc gcc gtt tac Val Ala Val Tyr ctc Leu 400 1200 gcc acg ccg cac Ala Thr Pro His ttg Leu 405 ccc tat tat ctc Pro Tyr Tyr Leu gtc gcg ctg tac Val Ala Leu Tyr acg ctg Thr Leu 415 ctg atg ctg Leu Met Leu aaa cqc cgt Lys Axg Arg 435 cct gcc ttt atg Pro Ala Phe Met ctg Leu 425 ctg gtc aac gga Leu Val Asn Gly cgc agg cag Arg Arg Gin 430 ata ttg ctg Ile Leu Leu 1248 1296 1344 ccg aaa gct gtg Pro L~ys Al1a Val gca Al a 440 ttc gca ttg ggc Phe Ala Leu Gly ata ggc Ile Gly 450 ggc gcg tgg ttc Gly Ala Trp Phe tgg cag ggc gca Trp Gin Gly Ala aac Asn 460 ggc aaa acg ac Gly Lys Thr Thr gcg Al a 465 ctg cac cat ttc Leu His His Phe acc ctc aat cca Thr Leu Asn Pro cca Pro 475 gcc gaa gca ggc Ala Giu Ala Gly 1392 1440 1488 tct tcg gaa cac Ser Ser Giu His ggc Gly 485 aaa atg ttt gcc Lys Met Phe Ala act gcc gcg ctg Thr Al a Ala Leu a ag Lys 495 gcg atg gat Ala Met Asp gat ttt tat Asp Phe Tyr 515 gcg ttg aaa gaa Ala Leu Lys Glu cat His 505 ccc gac aaa ccc Pro Asp Lys Pro gtc gtt ttg Val Vai Leu 510 gcg gct tac Ala Ala Tyr 1536 1584 gcc gac tgg tgc Ala Asp Trp Cys att Ile 520 tcc tgc aaa gaa Ser Cys Lys Giu acg ctc Thr Leu 530 aat cag ccg Asn Gin Pro gaa gtg Giu Vai 535 cat cag gca gtc His Gin Ala Val ga t Asp 540 atg gaa cgc ttt Met Glu Arg Phe 1632 ttc Phe 545 caa atc gac gta Gin Ile Asp Val acc Thr 550 gcc aac acg ccc gaa cat cag gcg ttg Ala Asn Thr Pro Giu His Gin Ala Leu 555 ttg Leu 560 1680 aaa gaa tac ggt Lys Giu Tyr Gly ttc ggg ccg ccg Phe Gly Pro Pro gtg ttt gtc gtc Val Phe Val Val cgc Arg 57 tcc 1728 S er gac ggc agc Asp Gly Ser cgc Arg 580 agc gag ccg ctg Ser Glu Pro Leu ggt ttt gtc aaa Gly Phe Val Lys gac aag 1776 Asp Lys ttt atc gag tgg Phe Ile Giu Trp 595 <210> 12 <211> 601 <212> PRT <213> Neisseria tat gaa caa Tyr Giu Gin aac cgc tga Asn Arg 600 1806 meningitidis <400> 12 Met Lys Lys Leu Ile 1 5 Cys Leu Phe Ala Val 10 Phe Leu Met Leu Cys Gly Arg Ala Phe Phe Vai Pro Al a Leu Asp Ala Asn Leu Leu Pro Pro Giu Lys Ala Val Arg Phe Giu Leu Ala Val Al a 40 Asp Asp Gly Vai As n Arg Ile Ala Asp Gly Tyr Tyr Met Tyr Gin Ala Ile Val Gly Lys Thr Asp Pro Ala Asp Leu Gly Gin Pro Se r 75 Phe Ser Lys Giy Giu Giu Lys Giu Asp Gi u Phe Phe Gly Arg Thr Val Tyr His His Giu Ala Gin Val Leu Val Leu 115 Al a 100 Phe Pro Tyr Ala Lys 105 Ala Vai Gly Giu Pro Tyr Lys 110 Cys Tyr Pro Thr Tyr Gin Gly Cys 120 Ala Giu Ala Gly Val 125 Pro Vai 130 Asp Thr Giu Phe Ile Phe Giy Asn Gi y 140 Thr Tyr His Pro Gin Thr Asp Glu Pro Ala Ser Ala Lys Asp Arg Phe Leu Gin Pro Ser 145 S er 150 Gi y 155 Pro Gin Asn Gly Ala Leu Pro Lys Gly Asp 160 Glu Gly Gly Asp Ser Leu Ala Phe 195 Tyr Pro Leu Lys Leu Ser Trp 185 G].y Thr Leu Asn Leu Ala Giy Leu Ser Phe Ala Asn Leu 190 Ala Cys Met Asp Lys Lys Leu Pro Ile 210 Ala Gly Val 215 Phe Ser Ile Val Val 220 Val Lys Ala Arg 225 Leu Al a 230 Thr Val Leu Ser Tyr Val Gin Gly 240 Ala Leu Thr Tyr 245 Val Leu Val Gly Ile 250 Al a Ala Gly Leu Thr Gly 255 Ala Leu Leu Ser Ala Leu 275 Ile Gin Leu Thr 260 Met Trp Leu Gin Trp Val Val Val Val Leu Al a 280 Gin Ser Met Phe Giy 285 Asn Leu Ala Ala 270 Leu Phe Asn Gin Ser Ser Pro Asn Ala 290 Arq Leu Val 295 Ile Ser Tyr Phe Ser Giy Gly Lys 310 Gi y Val Ser Val Phe 315 Pro Met Giy Ile Ala Leu Ile Pro Cys Val Al a 330 Al a Pro Leu Ala Phe Ala 335 Leu Giy Tyr Leu Tyr Thr 355 Thr Phe Gly Ile 340 Leu Gin Thr Gly Val Leu Gly Ala 1.eu Gly Giy His Ile 370 Val Lys Leu 375 Phe Thr Gly Vai 360 Pro Lys Ala Ile Leu Leu Pro Leu Gi y Al a Asp 380 Val Gly Leu Ala 350 Ala Ile Gly Met Asn Ala Tyr Al a Phe 385 Al a Gly 390 Pro 395 Leu Val Val Al a Val Tyr Thr Pro His Leu Tyr Tyr 27 Ala Leu Tyr Thr 405 410 Leu Met Leu Lys Arg Arg 435 Val1 420 Pro Ala Phe Met Leu Val Asn Gly Arg Arg Gin 430 Pro Lys Ala Val Ala Phe Ala Leu Gly 440 Ile Leu Leu Ile Gly 450 Gly Ala Trp Phe Trp Gin Gly Ala Asn 460 Gly Lys Thr Thr Leu His His Phe Leu 470 Thr Leu Asn Pro Pro 475 Ala Giu Ala Gly Ser Ser Glu His Gi y 485 Lys Met Phe Ala Thr Ala Ala Leu Lys Ala 495 Ala Met Asp Asp Phe Tyr 515 Thr 500 Ala Leu Lys Glu His 505 Pro Asp Lys Pro Val Val Leu 510 Ala A-la Tyr Ala Asp Trp Cys Ser Cys Lys Glu Thr Leu 530 Asn Gin Pro Giu His Gin Ala Val Asp 540 Met Giu Arg Phe Gin Ile Asp Val. Ala Asn Thr Pro Gi u 555 His Gin Ala Leu Lys Glu Tyr Giy Leu 565 Phe Gly Pro Pro Gly 570 Val Phe Val Val Arg Ser 575 Asp Gly Ser Phe Ile Giu 595 Ser Glu Pro Leu Leu 585 Gly Phe Val Lys Ala Asp Lys 590 Trp Tyr Glu Gin Asn Arg 600 <210> <211> <212> <213> <220> <22 1> <222> 13 1857 DNA Neisseria meringitidis CDS (1)..(1857) <400> 13 atg Met 1 atg aac cgt tat cct tta tgg aaa Met Asn Arg Tyr Pro Leu Trp Lys 5 tat Tyr 10 ctg ctg Leu Leu att gtg ttc acg Ile Val Phe Thr att gcg gtt gcc gca gtg tat tcg Ile Ala Val Ala Ala Val Tyr Ser ccc aac cta ttc Pro Asn Leu Phe ggc gaa aca Gly Giu Thr ccc gcc gtg Pro Ala Vai cag gta tcg acc Gin Val Ser Thr aac As n 40 cga caa gcc atc atc atc aac gaa Arg Gin Ala Ile Ile Ile Asn Giu cag act Gin Thr caa ttc aaa gtg Gin Phe Lys Val gcc gcg ctg aaa Ala Ala Leu Lys gca ggt att cag Ala Giy Ile Gin acc Thr gac Asp gac ggg atg ttt Asp Giy Met Phe aca gaa acg cag Thr Giu Thr Gin gtg gac aat tca Vai Asp Asn Ser ctg Leu aaa gtg cgt ttc Lys Val Arg Phe ctt aaa gcg cgc Leu Lys Ala Arg gac Asp 90 gtc atc gaa aac Val Ile Giu Asn act ttg Thr Leu ggc gaa ggg Gly Giu Gly tgg atg gcg Trp Met Ala 115 tat Tyr 100 att acc gcg ctc Ile Thr Ala Leu aac As n 105 ctg ttg gcg gac Leu Leu Ala Asp agc ccc gaa Ser Pro Giu 110 ttg gac ctg Leu Asp Leu 336 384 aaa atc aaa gcc Lys Ile Lys Ala ccg atg ttt ttg Pro Met Phe Leu ggt Giy 125 cgc ggc Arg Gly 130 ggc gtg cat ttc Gly Val His Phe acc Thr 135 atg cag gtc gat Met Gin Val Asp atg Met 140 aaa gcg gcg atg Lys Ala Ala Met aaa acg ttt gaa Lys Thr Phe Giu cgt Arg 150 tat tcg ggc gac Tyr Ser Giy Asp a tc Ile 155 cgc cgc gaa ctg Arg Arg Giu Leu cgc Arg 160 432 480 528 cgc gaa aaa atc Arg Giu Lys Ile agc ggc acg gtg Ser Gly Thr Val cgt Arg 170 cag gct gga aac Gin Ala Gly Asn agc ctg Ser Leu 175 acc gtc oct ttg cag gat gca ggt gat gtg caa aag gct ctg ccg cag Thr Vai Pro Leu Gin Asp Ala Gly Asp Vai Gin Lys Ala Leu Pro Gin 180 ttg cgc Leu Arg atc gtc Ile Val 210 aag Lys 195 ctg ttt cct gaa Leu Phe Pro Giu acg ctg aat tca Thr Leu Asn Ser gac ggc agc aat Asp Gly Ser Asn 205 gtg tgt tcc gat Val Cys Ser Asp ttg acg ctt tcg Leu Thr Leu Ser gag gcg gtc aat Giu Ala Val Asn 624 672 720 768 gcg Al a 225 gtc aaa cag aac Val Lys Gin Asn a tc Ile 230 act acc ctg cac Thr Thr Leu His aac Asn 235 cgt gtg aac gag Arg Val Asn Glu ttg Leu 240 ggc gtg gcc gag Gly Val Ala Glu ccc Pro 245 gtc atc cag cag Val Ile Gin Gin ggt gca gac cgt Gly Ala Asp Arg atc gtc Ile Val 255 gtg cag ctt Vai Gin Leu ggc cgt acc Gly Arg Thr 275 ccg Pro 260 ggc gtt cag gat Giy Val Gin Asp act Thr 265 gcc aag gca aaa Ala Lys Ala Lys gac atc atc Asp Ile Ile 270 gat cct gcc Asp Pro Ala 816 864 gcg act ttg gaa Ala Thr Leu Glu cgt atg gtg gag Arg Met Val Giu aag ttg Lys Leu 290 cgc gag gca ttg Axg Giu Ala Leu gaa. Giu 295 ggc aac gtg ccg Gly Asn Val Pro agc Ser 300 ggt tat gag ctg Gly Tyr Giu Leu ctt Leu 305 tca. agc ggc gga Ser Ser Gly Gly cgt ccc gaa att Arg Pro Giu Ile ctg Leu 315 ctg atc agc aaa Leu Ile Ser Lys cag Gin 320 912 960 1008 gtc gag ctg acg Val Giu Leu Thr ggc Gi y 325 gac aac atc aac Asp Asn Ile Asn gcg caa ccg agt Ala Gin Pro Ser ttc gac Phe Asp 335 caa. atg ggc Gin met Gly gca Al a 340 cct goc gtc agt Pro Ala Val Ser agc ttg gac agc Ser Leu Asp Ser gcg ggc ggc Ala Giy Gly 350 cgc atg gcg Arg Met Ala 1056 agc att Ser Ile ggc gaa ctg act Gly Giu Leu Thr gcc Al a 360 gca aat gtc ggc Ala Asn Vai Gly 1104 atg gtt ttg atc gac caa gga Met Val Leu Ile Asp Gin Gly aaa tcc gag gtt gta acc gcg ccg gtt Lys Ser Giu Val Val Thr Ala Pro Val 1152 370 cgt Arg 375 380 act gcc att Thr Ala Ile ggc gga cgc gtg Gly Gly Arg Val att tcc gga agc Ile Ser Gly Ser atg Met 400 acg aca gcc gaa Thr Thr Ala Glu aat gat acg tct Asn Asp Thr Ser ctg ttg cgt gcc Leu Leu Arg Ala ggt tct Gly Ser 415 1200 1248 1296 1344 ctt. gcc gca Leu Ala Ala ttg ggt aag Leu Gly Lys 435 ccg Pro 420 atg cag att. gtc Met Gin Ile Val gaa Gi u 425 gaa cgt acc atc Giu Arg Thr Ile ggt ccg tct Gly Pro Ser 430 tta tgg ggt Leu Trp, Gly gag aac atc gaa Giu Asn Ile Giu aaa Lys 440 ggc ttc cat tcg Giy Phe His Ser act Thr 445 ttt gcc Phe Ala 450 atc gtt gct gca Ile Val Ala Ala ttc Phe 455 atg gtg gtt tac Met Val Val Tyr tat Tyr 460 cgt ctg atg gqt Arg Leu Met Gly ttc Phe 465 ttt tct acc att Phe Ser Thr Ile ttg agt gcc aac Leu Ser Ala Asn ctg ttc cta atc Leu Phe Leu Ile ggt Gi y 480 1392 1440 1488 att ttg tct gcc Ile Leu Ser Ala cag gca acg ttg Gin Ala Thr Leu acg Thr 490 tta ccg ggt atg Leu Pro Gly Met gcc gcg Al a Al a 495 ctg gcg ttg Leu Ala Leu ttg ggt atg gca Leu Gly Met Ala atc Ile 505 gac tcc aac gtc Asp Ser Asn Val ttg att aac Leu Ile Asn 510 cag cag gca Gin Gin Ala 1536 gaa cgt Giu Arg atc aat Ile Asn 530 cgc gaa gaa ttg Arg Giu Giu Leu c gt Arg 520 gcc ggc gtg ccg Ala Gly Val Pro ctc ggt ttc caa Leu Gly Phe Gin cac His 535 gca tgg gcg acc Ala Trp, Ala Thr gtc gat tcg aac Val Asp Ser Asn 1584 1632 1680 ctg Leu 545 act tcg ctg att Thr Ser Leu Ile gcc Al a 550 ggt atc gcg ctt Gly Ile Ala Leu gta ttc ggt tcc Vai Phe Giy Ser ggc Gi y 560 ccg gta cgc Pro Vai Arg ggt ttt gcg gtc gta cac tgt ttg ggt att ctg act tcg Giy Phe Ala Vai Val His Cys Leu Gly Ile Leu Thr Ser 1728 565 570 atg tat tca Met Tyr Ser gga cgc aga Gly Arg Arg 595 tcc Ser 580 gtc gtc gta ttc Val Val Val Phe gcg ttg gtc aat Ala Leu Val Asn ctg tgg tac 1776 Leu Trp Tyr 590 gtg tgg aag 1824 Val Trp Lys cgc aaa ttg cag Arg Lys Leu Gin aat As n 600 att tcc att. ggt Ile Ser Ile Gly tcg Ser 605 ccg aaa Pro Lys 610 gcc gaa atg gca Ala Giu Met Ala ggc aag gag taa Gly Lys Giu 1857 <210> 14 <211> 618 <212> PRT <213> Neisseria meningitidis <400> 14 Met Met Asn Arg Tyr Pro 1 5 Leu Trp Lys Tyr 10 Leu Leu Ile Val Phe Thr Ile Ala Val Pro Ala Val. Al a Ala Val Tyr Ser Pro Asn Leu Phe Giy Giu Thr Ile Asn Giu Gin Val Ser Thr Asn Arg Gin Ala Ile Gin Thr Gin Phe Lys Val Asp 55 Ala Ala Leu Lys As n Ala Gly Ile Gin Thr Asp Gly Met Phe Vai 70 Val Asp Asn Ser Lys Val Arg Phe Lys Asp Thr Giu Thr Leu Lys Ala Arg Asp Val Ile Giu Asn Thr Leu Gly Giu Gly Trp Met Ala 115 Tyr 100 Ile Thr Ala Leu Asn 105 Leu Leu Ala Asp Ser Pro Giu 110 Leu Asp Leu Lys Ile Lys Ala As n 120 Pro Met Phe Leu Gly 125 Arg Gly 130 Gly Val His Phe Thr 135 Met Gin Vai Asp Met 140 Lys Ala Ala Met Gin 145 Lys Thr Phe Giu Tyr Ser Gly Asp Arg Arg Giu Leu Arg 160 Arg Glu Lys Ile Ser Gly Thr Val Gin Ala Gly Asn Ser Leu 175 Thr Val Pro Leu Gin Asp Ala Gly 180 Leu Phe Pro Giu Ala Asp 185 Val Gin Lys Ala Leu Pro Gin 190 Giy Ser Asn 00 Leu Azg Lys 195 Thr Leu Asn Ser Asp 205 Ile Vai 210 Leu Thr Leu Ser Giu Ala Val Asn Val Cys Ser Asp Al a 225 Vai Lys Gin Asn Ile 230 Thr Thr Leu His Arg Val Asn Giu Leu 240 Gly Vai Ala Glu Val Ile Gin Gin Ser 250 Gly Ala Asp Arg Ile Val 255 Vai Gin Leu Giy Arg Thr 275 Pro 260 Giy Vai Gin Asp Ala Lys Ala Lys Asp Ile Ile 270 As p Pro Al1a Ala Thr Leu Giu Leu 280 Arg Met Val Giu Asp 285 Lys Leu 290 Arg Giu Ala Leu Giu 295 Giy Asn Val Pro Ser 300 Gly Tyr Giu Leu Ser Ser Giy Giy Arg Pro Giu Ile Leu Ile Ser Lys Gin 320 Val Giu Leu Thr Gi y 325 Asp Asn Ile Asn Ala Gin Pro Ser Phe Asp 335 Gin Met Gly Ser Ile Phe 355 Pro Ala Val Ser Leu 345 Ser Leu Asp Ser Al a Giy Giy 350 Arg Met Ala Gly Giu Leu Thr Al a 360 Ala Asn Val Giy Lys 365 Met Val 370 Leu Ile Asp Gin Gi y 375 Lys Ser Giu Vai Vai 380 Thr Ala Pro Val Ile 385 Arg Thr Ala Ile Thr 390 Giy Giy Arg Val Giu 395 Ile Ser Gly Ser Thr Thr Ala Glu Ala Asn Asp Thr Ser Leu Leu Leu Arg Ala Gly Ser 405 410 415 Leu Ala Ala Leu Gly Lys 435 Pro 420 Met Gin Ile Val Gi u 425 Giu Arg Thr Ile Gly Pro Ser 430 Leu Trp Gly Giu Asn Ile Giu Gly Phe His Ser Thr 445 Phe Ala 450 Ile Val Ala Ala Phe Met Val Val Tyr 455 Tyr 460 Arg Leu Met Gly Phe Ser Thr Ile Al1 a 470 Leu Ser Ala Asn Ile 475 Leu Phe Leu Ile Gi y 480 Ile Leu Ser Ala Gin Ala Thr Leu Leu Pro Giy Met Ala Ala 495 Leu Ala Leu Giu Arg Ile 515 Thr 500 Leu Gly Met Ala Asp Ser Asn Vai Leu Ile Asn 510 Gin Gin Ala Arg Giu Giu Leu Ala Gly Vai Pro Pro 525 Ile Asn 530 Leu Gly Phe Gin His 535 Ala Trp Ala Thr Ile 540 Val Asp Ser A.Sn Thr Ser Leu Ile Al a 550 Gly Ile Ala Leu Leu 555 Vai Phe Gly Ser Pro Val Arg Gly Phe 565 Ala Val Val His Cys 570 Leu Gly Ile Leu Thr Ser 575 Met Tyr Ser Gly Arg Arg 595 Val Val Vai Phe Arg 585 Ala Leu Val Asn Leu Trp Tyr 590 Vai Trp Lys Arg Lys Leu Gin Asn 600 Ile Ser Ile Giy Ser 605 Pro Lys 610 Ala Giu Met Ala Gi y 615 Giy Lys Giu <210> <211> 1140 <212> DNA <213> Neisseria meningitidis <220> <221> CDS <222> (1140) <400> atg aaa aaa Met Lys Lys 1 gcg tgc ggc Ala Cys Gly ccc gaa gcc Pro Giu Ala aca ctg Thr Leu 5 gtg gcg gcg gca Val Ala Ala Ala ctg agc Ctc gc Leu Ser Leu Ala ttg act Leu Thr gcc aag Ala Lys ggc Gly gga agc gat acc Gly Ser Asp Thr gce caa acc ccc Ala Gin Thr Pro gaa caa tcg ggc Glu Gin Ser Gly etc aac ate tac Leu Asn Ile Tyr aac Asn tgg tcg gat Trp, Ser Asp tat gtc Tyr Val gat ccc gaa acc gtt gcc gcc ttt gaa Asp Pro Glu Thr Val Ala Ala Phe Glu 55 aaa Lys gaa ace ggc ate Giu Thr Gly Ile aag Lys aeg cgt tee gat Thr Arg Ser Asp tat Tyr tac gac agc aac Tyr Asp Ser Asn aca Ctg gag gca Thr Leu Giu Ala 240 288 gtc ctg ace ggc Val Leu Thr Giy aaa Lys tcc ggc tac gac Ser Gly Tyr Asp acc gcg ccg tcc Thr Ala Pro Ser atc gcc Ile Ala aac gtc ggc Asn Val Gly gcg caa atc Ala Gin Ile 115 egg Arg 100 caa ate aaa gag Gin Ile Lys Ala ggC Gi y 105 gcg tat eag aaa Ala Tyr Gin Lys atc gac aag Ile Asp Lys 110 etg aaa atg Leu Lys Met 336 384 ccc eat tae ggc Pro His Tyr Gly aae Asn 120 ate gat aaa gat Ile Asp Lys Asp ttg Leu 125 atg gaa Met GJlu 130 gee gte gat ccg Ala Val Asp Pro ggc Gl y 135 aac gaa tac gee Asn Glu Tyr Ala gtC Val 140 ccc tat ttc tgg Pro Tyr Phe Trp 432 480 ggC Gly 145 ate aat ace ttg Ile Asn Thr Leu gca Al a 150 ate aat ace Ile Asn Thr eag cag Gin Gin 155 gtg aaa aaa gca Val Lys Lys Ala ttg Leu 160 ggt aeg gac aag etg ccc gaa aac gaa tgg gat ttg gtg tte aaa ccc Gly Thr Asp Lys Leu Pro Giu Asn Giu Trp ASP Leu Vai Phe Lys Pro 165 170 gaa tac acc Giu Tyr Thr gca atc gaa Ala Ile Giu 195 gcc Al a 180 aaa ctc aaa tcc Lys Leu Lys Ser tgc Cys 185 ggc atc agc Gly Ile Ser cag att ccc ttg Gin Ile Pro Leu ttg cac tat ttg Leu His Tyr Leu tat ttc gac agc Tyr Phe Asp Ser 190 ggc aaa gac ccc Gly Lys Asp Pro 205 gat atg atg aaa Asp Met Met Lys aac agt Asn Ser 210 gag aat ccc gaa Giu Asn Pro Giu gac Asp 215 atc aaa gcc gcc Ile Lys Ala Aia gt c Vai 220 576 624 672 720 768 gcc Al a 225 gtc cgg ggc gac Val Arg Giy Asp aaa cgc ttc agc Lys Arg Phe Ser tct Ser 235 tcc ggc tat atc Ser Gly Tyr Ile gac Asp 240 gat atg gcg gcg Asp Met Ala Ala ggc Giy 245 aac ctg tgt gcc Asri Leu Cys Ala gc Al a 250 atc ggt tac ggc Ile Gly Tyr Gly ggc gat Gay Asp 255 ttg aac att Leu Asn Ile atc aaa gta Ile Lys Val 275 gcc Al a 260 aaa acc cgt gcc Lys Thr Arg Ala gaa gcc gca aac Giu Ala Ala Asn ggc gtg gaa Gly Vai Giu 270 gtg gat tcc Vai Asp Ser ttg acc ccg aaa Leu Thr Pro Lys ggc gtg ggc gtg Giy Val Giy Vai ttt atg Phe Met 290 att ccg cgc gac Ile Pro Arg Asp caa aac gtt gcc Gin Asn Val Ala aat gcc cac cgc Asn Ala His Arg .300 aaa aac ggc agc Lys Asn Gly Ser tat Tyr ttc Phe 320 gac tac acg ctc Asp Tyr Thr Leu cgg Arg 310 ccc gag gtg gcg Pro Glu Val Ala gcg Al a 315 912 960 1008 gtt acc tac gcg Val Thr Tyr Ala ccc Pro 325 gcc agc cgt ccc Ala Ser Arg Pro gc g Al a 330 cgc gag ctg atg Axg Giu Leu Met gat gaa Asp Giu 335 aaa tac acc Lys Tyr Thr tcc Ser 340 gac gca tcg att Asp Ala Ser Ile ttc Phe 345 ccg aac aaa gaa Pro Asn Lys Glu ctg atg gaa Leu Met Giu 350 1056 aaa agt ttc atc gta tcg ccc aaa Lys Ser Phe Ile Val Ser Pro Lys tcc gca gaa tcc gtc aaa ctg ggc ser Ala Giu Ser Val Lys Leu Gly 1104 355 355 365 gtg aag ctg tgg caa ggg ctc aaa gcg ggc aaa taa Val Lys Leu Trp Gin Gly Leu Lys Ala Gly Lys 370 375 380 1140 <210> 16 <211> 379 <212> PRT <213> Neisseria meningi tidi s <400> 16 Met Lys Lys Thr Leu Val Ala Ala Ala 1 5 Ile 10 Leu Ser Leu Ala Leu Thr Ala Cys Giy Pro Glu Ala Gi y Gly Ser Asp Thr Al a 25 Ala Gln Thr Pro Ser Ala Lys Trp Ser Asp GJlu Gin Ser GJly Lys 40 Leu Asn Ile Tyr Asn Tyr Val Asp Pro Giu Thr Ala Al1a Phe Giu Lys Glu Thr Gly Ile Lys Thr Arg Ser Asp Tyr Tyr Asp Ser Asn Thr Leu Giu Ala Val Leu Thr Gly Lys Ser Giy Tyr Asp Leu 90 Thr Ala Pro Ser Ile Ala Asn Val Gly Al a Gin Ile 115 Arg 100 Gin Ile Lys Ala Gi y 105 Ala Tyr Gin Lys Ile Asp Lys 110 Leu Lys Met Pro His Tyr Gly Ile Asp Lys Asp Leu 125 Met Giu 130 Ala Vai Asp Pro Giy 135 Asn Giu Tyr Ala Pro Tyr Phe Trp Giy 145 Ile Asn Thr Leu Ala Ile 150 Asn Thr Gin Gin 155 Val Lys Lys Ala Leu 160 Gly Thr Asp Lys Giu Tyr Thr Ala 180 Leu 165 Pro Giu Asn Giu Trp Asp 170 Leu Vai Phe Lys Pro 175 Lys Leu Lys Ser Cys Gly Ile Ser Tyr Phe Asp Ser 185 190 Ala Ile Giu 195 Gin Ile Pro Leu Al a 200 Leu His Tyr Leu Gi y 205 Lys Asp Pro Asn Ser 210 Giu Asn Pro Glu Ile Lys Ala Ala Val 220 Asp Met Met Lys Al a 225 Val Arg Gly Asp Lys Arg Phe Ser Ser 235 Ser Gly Tyr Ile Asp 240 Asp Met Ala Ala Gi y 245 Asn Leu Cys Ala Ile Gly Tyr Gly Giy Asp 255 Leu Asn Ile Al a 260 Lys Thr Arg Ala Gi u 265 Giu Ala Ala Asn Gly Val Giu 270 Val Asp Ser Ile Lys Val 275 Leu Thr Pro Lys Thr 280 Giy Val Gly Vai Trp 285 Phe Met 290 Ile Pro Arg Asp Al a 295 Gin Asn Val Ala Ala His Arg Tyr Ile 305 Asp Tyr Thr Leu Arg 310 Pro Giu Val Ala Al a 315 Lys Asn Gly Ser Phe 320 Val Thr Tyr Ala Ala Ser Arg Pro Arg Giu Leu Met Asp Giu 335 Lys Tyr Thr Lys Ser Phe 355 Asp Ala Ser Ile Phe 345 Pro Asn Lys Giu Leu Met Giu 350 Lys Leu Gly Ile Val Ser Pro Lys 360 Ser Ala Giu Ser Val 365 Val Ly 37) <2 10> <211> <212> <213> <220> <221> <222> s 0 Leu Trp Gin Gly Leu 375 Lys Ala Gly Lys 17 453 DNA Neisseria rneningiticdis CDS (453) <400> 17 atg gca aaa gca Met Ala Lys Ala 1 a tc Ile 5 gaa atc att tca Glu Ile Ile Ser aat gaa att tat Asn Glu Ile Tyr tca gat Ser Asp aaa atg Lys Met ctg att ttt Leu Ile Phe att aac cta Ile Asn Leu aag Lys gat ccg gta cct Asp Pro Val Pro ccc Pro cat act att gaa His Thr Ile Glu gaa ttg aaa gcc Glu Leu Lys Ala atc Ile 40 aat ctt tac gat Asn Leu Tyr Asp tgt Cys gcc ttt gaa Ala Phe Giu gat ttc Asp Phe gtt ccc gaa atc Val Pro Glu Ile gac aat ttt tgt Asp Asn Phe Cys gtg Val gga att gat tta Gly Ile Asp Leu ata gga act gat Ilie Gly Thr Asp agt gat get gca Ser Asp Ala Ala ata ttt tct gtt Ile Phe Ser Val cgc Arg ata tgc tct cct Ile Cys Ser Pro aaa Lys tgg att ttg cat Trp Ile Leu His aat As n 90 tgt ttc caa aat Cys Phe Gin Asn caa agg Gin Arg gtt aaa tgg Val Lys Trp gtt att aaa Val Ile Lys 115 ggg Gly 100 gcg ggt atg atg Ala Gly Met Met att Ile 105 atg aat gaa ttt Met Asn Giu Phe aat cat tct Asn His Ser 110 tea aaa gaa Ser Lys Giu tcg gaa att gag Ser Giu Ile Glu att ctt aaa gaa Ile Leu Lys Glu tgt Cys 125 act tgg Thr Trp 130 gaa aag tca ttg Giu Lys Ser Leu act Thr 135 tat tta ctt cgt ttt ttt tcg tgg gaa Tyr Leu Leu Arg Phe Phe Ser Trp Giu 140 ttt Phe 145 gaa gat tat cag Glu Asp Tyr Gin tgc taa Cys 150 <210> 18 <211> 150 <212> PRT <213> Neisseria reningitidis <400> 18 Met 1 Ala Lys Ala Ile Glu Ile Ile Ser 5 Asn Giu Ile Tyr Se~r Asp Leu Ile Phe Ile Asn Leu Lys Asp Pro Val Pro His Thr Ile Glu Tyr Lys Met Ala Phe Giu Giu Leu Lys Ala Ile 40 Asn Leu Tyr Asp Cys; Asp Phe Val Pro Giu Ile Lys Asp Asn Phe Cys Gly Ile Asp Leu Asp Ile Ile Gly Thr Asp Cys Ser Pro Lys Asp Ser Asp Ala Ala Ile Phe Ser Val Trp Ile Leu His As n 90 Cys Phe Gin Asn Gin Arg Val Lys Trp, Vai Ile Lys 115 Gi y 100 Ala Gly Met Met Met Asn Giu Phe Asn His Ser 110 Ser Lys Glu Ser Giu Ile Giu Ile Leu Lys Giu Thr Trp 130 Giu Lys Ser Leu Thr 135 Tyr Leu Leu Arg Phe 140 Phe Ser Trp Giu Phe G. 145 <210> <211> <212> <213> <220> <221> <222> lu Asp Tyr Gin Cys 150 19 324 DNA Neisseria ieningitidis CDS (324) <400> 19 atg aaa aaa tgt att ttg ggc att Met Lys Lys Cys Ile Leu Gly Ile ttg acc Leu Thr gcg tgt gcc gcc Ala Cys Ala Ala atg cct Met Pro gca ttt gcc gac aga atc ggc Ala Phe Ala Asp Arg Ile Gly gat ttg gaa gca cgt ctg gcg cag ttg Asp Leu Glu Ala Arg Leu Ala Gin Leu gaa cac cgt gtc gcc gta Giu His Arg Vai Ala Val ttg gaa Leu Giu agc ggc ggc aat Ser Giy Gly Asfl gtc aaa atc Vai Lys Ile gac ctt Asp Leu ttc ggt tca aat Phe Gly Ser Asn acc atg tat gta Thr Met Tyr Val t gc cys agc gtt acg cct Ser Val Thr Pro 144 192 240 288 ttt Ph e cag aag acg ttt Gin Lys Thr Phe gca agc gat cgg Ala Ser Asp Arg aat Asn 75 gaa ggc gtg gcg Giu Gly Val Ala Cgg Mrg cag aaa gtg cgt Gin Lys Val Arg cag Gin gcg tgc aac cgc Ala Cys Asn Arg ga a Gi u 90 act tcg gca atg Thr Ser Ala Met ttt tgc Phe Cys gaa gat gag Giu Asp Giu gca Ala 100 atc cga tgc aga. Ile Arg Cys Arg ttc gat tga Phe Asp <210> <211> 107 <212> PRT <213> Neisseria meningi tidis <400> Met Lys Lys 1 Ala Phe Ala Giu His Arg Cys Ile Leu Giy Ile Leu 5 Ala Cys Ala Ala Met Pro Asp Arg Ile Giy Asp Leu 25 Giu Ala Axrg Leu Ala Gin Leu Val Lys Ile Vai Ala Val Leu Ser Gly Giy Asn Thr Asp Leu Phe Gly Ser Asn Thr Met Tyr Vai Ser Val Thr Pro Phe Gin Lys Thr Phe Gin Lys Val A-rg Gin Gi u 70 Ala Ser Asp Arg Asn 75 Giu Giy Val A-la Arg Ala Cys Asn Arg Giu 90 Thr Ser Ala Met Phe Cys Giu Asp Giu Ala Ile Arg Cys AMg Lys Phe Asp 100 <210> <211> <212> <213> <220> <221> <222> <400> atg gc Met Al 1 21 519 DNA Neisseria meningitidis CDS 23 aaa cat Lys His gaa Gi u 5 att gaa gaa cgc Ile Glu Giu Arg ggt Gi y gac ggt ctg att gaa aag Asp Gly Leu Ile Giu Lys atg gtc gct, Met Vai Ala atg gct ttc Met Ala Phe aat cgc gta act aaa gta gtt aaa ggt Asn Arg Val Thr Lys Val Val Lys Gly ggc cgt atc Gly Arg Ile tca gca ctg act gtt gtt ggt gat ggt gat ggt cgc att Ser Ala Leu Thr Val Val Gly Asp Gly Asp Gly Arg Ile ggt atg Gly Met ggc aaa ggt aaa Gly Lys Giy Lys aaa gaa gta cca Lys Glu Val Pro gct. gtt caa aaa Ala Val Gin Lys atg gat caa gct Met Asp Gin Ala cga Axg cgc tct atg att Arg Ser Met Ile aa a Lys 75 gta cct. ttg aaa Val Pro Leu Lys aac Asn 192 240 288 336 ggt act att cat Gly Thr Ile His cat His gag gtt att ggc Giu Val Ile Gly cgt Arg 90 cat ggt gct. act His Giy Ala Thr aaa gta Lys Val gga cct. Gly Pro ttt atg cag Phe Met Gin cct Pro 100 gct. aaa gag ggt Ala Lys Giu Gly ggc gta aaa gcc Gly Val Lys Ala atg cgt ttg gtt ttt gat gct Met Arg Leu Val Phe Asp Ala 115 ggc att. cat aat Gly Ile His Asn atc Ile 125 tcc gcc aaa Ser Ala Lys 384 gtg cac gga tct act aac cca tat aat Val His Giy Ser Thr Asn Pro Tyr Asn atc gta cgt gca aca tta gat Ile Val Arg Ala Thr Leu Asp ggt ttg tct aag Gly Leu Ser Lys 145 ttg cat act cct Leu His Thr Pro 150 gac att ttg gga ASP Ile Leu Gly 165 gct gat atc Ala Asp Ile 155 gca gcc aaa cgt ggc 480 Ala Ala Lys Arg Gly 160 ttg aca gtg gaa Leu Thr Val Glu <210> 22 <211> 172 <212> PRT <213> Neisseria. <400> 22 Met Ala Lys His 1 gtt aac Val Asn 170 cat ggc tga His Gly meningitidis Glu Ile Glu Glu Arg Gly Asp Gly Leu Ile Glu Lys Met Val Ala Met Ala Phe Val Asn Arg Val. Thr Val Val Lys Gly Giy Arg Ile Gly Arg Ile Ser Ala Leu Thr Val. Val Gly Asp Gly 40 Asp Gly Met Gly Lys Gly Lys Ser Lys Giu Val Pro 55 Val Ala Val Gin Lys Al a Gly Met Asp Gin Ala Thr Ile His His A-rg '70 Axg Ser Met Ile Lys Val Pro Leu Lys Glu Val Ile Giy Arg 90 His Gly Ala Thr Lys Val. Phe Met Gin Met Arg Leli 115 Pro 100 Ala Lys Giu Gly Ser 105 Gly Vai Lys Ala Giy Giy Pro 110 Ser Ala Lys Val Phe Asp Ala Met 120 Gly Ile His Asn Ile 125 Val His 130 Gly Ser Thr Asn Pro Tyr Asn Ile Val 135 Thr Pro Ala Asp Ile 155 Arg 140 Ala Thr Leu Asp Gly Leu Ser 145 Lys Leu His 150 Ala Ala Lys Arg Gi y 160 Leu Thr Val Giu Asp Ile Leu Gly Val Asn His Gly 165 170 <210> <211> <212> <213> <220> <221> <222> 23 2028 DNA Neisseria meningitidis CDS (2028) <400> 23 ttg tcc ctg tct gaa Leu Ser Leu Ser Giu 1 5 ttt ata gaa cgc Phe Ile Glu Arg acg tca ttt aat Thr Ser Phe Asn ccg atg Pro Met gtt att ttg Val Ilie Leu tta acc gtg Leu Thr Vai acg Thr act ttg ttt ttt Thr Leu Phe Phe tgt gtt ttg gtg Cys Val Leu Val gta ttg gtt Val Leu Vai gca aaa gaa Ala Lys Giu ccg gat cag gtg Pro Asp Gin Vai cag Gin 40 atg tgg ctc gat Met Trp, Leu Asp cgg Ar g gtc att Vai Ilie ttt acc gag ttc Phe Thr Giu Phe tgg ttt tat gtt Trp Phe Tyr Val acg ttt tcc att Thr Phe Ser Ile ttt Phe ctg ggt ttc ctg Leu Gly Phe Leu ctg Leu 70 ata ctc tcg gtc Ile Leu Ser Val agc Ser agt ttg gga aac Ser Leu Gly Asn 192 240 288 agg ctc gga cgg gat Arg Leu Gly Arg Asp gaa gat gtg ccg Giu Asp Vai Pro ttc ggC ttc ctg Phe Gly Phe Leu tcg tgg Ser Trp, ctg gcg atg Leu Ala Met ctg Leu 100 ttt gcg gcc ggg Phe Ala Ala Giy a tg Met 105 ggc gtg ggt ctg Gly Val Gly Leu atg ttt ttc Met Phe Phe 110 acg gcc ggc Thr Ala Giy 336 ggC gtg Giy Vai gca Al a 115 gag ccg ttg atg Glu Pro Leu Met cat His 120 tat ttt tcg gac Tyr Phe Ser Asp att Ile 125 acg OCg gaa cac agg cag cag cag gca ttg ctg cac acg gtg ttc cat Thr Pro Giu His Arg Gin Gin Gin Ala Leu Leu His Thr Val Phe His 130 30135 140 tgg T rp 145 ggc gtt cac gct Gly Val. His Ala tgg Trp 150 tcg gtg tac ggt Ser Val Tyr Gly att gca ttg gct Ile Ala Leu Ala tg Leu 160 gct tat ttc ggt Ala Tyr Phe Gly cgc tac aag ctg Arg Tyr Lys Leu cit gcc ctg cgt Leu Ala Leu Arg ici tgi Ser Cys 175 480 528 576 624 tti tac ccc Phe Tyr Pro ati gat att Ile Asp Ile 195 ctg Leu 180 ttg aaa gaa aaa Leu Lys Giu Lys att Ile 185 tcc gga agg ttc Set Gly Arg Phe ggc gat gcc Gly Asp Ala 190 atc acc aca Ile Thr Thr aig gcg ttg ctt Met Ala Leu Leu gct A-la 200 act ttt tic ggc Thr Phe Phe Gly atc Ile 205 tig ggg Leu Gly 210 tic ggg gct tcg Phe Gly Ala Ser ctg ggc gcc gga Leu Gly Ala Giy tg Leu 220 cag gaa atg ggc Gin Giu Met Gly tgg T rp 225 att gcc gaa aac Ile Ala Giu Asn agc Ser 230 ttc agc gig cag Phe Ser Val Gin gt Val 235 ttg ait aic gcc Leu Ile Ile Ala gcc Al a 240 672 720 768 gic atg icc cic Val Met Ser Leu gc Al a 245 gtc gtt tog gca Vai Val Ser Ala tcc ggc gig ggg Ser Gly Val Gly aag ggc Lys Gly 255 gtg aag gig Val Lays Val iii itt gt Phe Phe Vai 275 agc gag tig aac Ser Giu Leu Asn cig Leu 265 ggc cii gcg ttt Gly Leu Ala Phe tig cig ctg Leu Leu Leu 270 tcg gca tic Ser Ala Phe 816 864 ttg gcg gcg gga Leu Ala Ala Gly act git tac ctg Thr Val Tyr Leu ggc gac Gly Asp 290 aac ata ggg aac Asn Ile Giy Asn tac Tyr 295 ctc gga aat cig Leu Giy Asn Leu gtg Val 300 cgc ctc agi iii Arg Leu Ser Phe aaa Lays 305 act tai gcg tac Thr Tyr Ala Tyr ga Gi u 310 cgg gaa cac aag Arg Giu His Lays ccg Pro 315 igg itt gaa ict Trp Phe Giu Ser tgg Trp 320 acg gig cii tat igg gcg tgg Thr Vai Leu Tyr Trp Ala Trp igg Trp igi ict igg gcg cog itt gig ggi Cys Ser Trp Ala Pro Phe Val Gly 1008 325 33035 335 ttg ttt ate Leu Phe Ile geg Al a 340 egc att tea aag Arg Ile Ser Lys cgc acc ate cgc Arg Thr Ile Arg gag ttt gte Giu Phe Val 350 1056 00 ttc ggg Phe Gly gtc ttc Val Phe 37 0 gtt Val 355 ttg ctc atc ccc Leu Leu Ile Pro ggc Gi y 360 etg ttc ggc gtt Leu Phe Gly Val ttg tgg ttt ace Leu Trp, Phe Thr 365 gtt gcg ggg gga. Val Ala Gly Gly ggc aat acg geg Gly Asn Thr Ala att Ile 375 tgg ctg aat gac Trp Leu Asn Asp 1104 1152 1200 1248 atg Met 385 ctc gaa aag atg Leu Giu Lys Met acc Thr 390 tcc tct ccg gaa Ser Ser Pro Glu acg Thr 395 ctg ctt ttt aaa Leu Leu Phe Lys ttt aat tac ctc Phe Asn Tyr Leu ccc Pro 405 ctg ccc gaa ttg Leu Pro Giu Leu agc ate gtc agc Ser Ile Val Ser ctg ctg Leu Leu 415 gtc att tct Val Ile Ser ctg aac aat Leu Asn Asri 435 ctg Leu 420 ttt ttt gta act Phe Phe Val Thr tct Ser 425 gcc gat tee ggg Ala Asp Ser Gly att tat gtc Ile Tyr Val 430 cca cgg tgg Pro Arg Trp 1296 1344 att acc tet cgg Ile Thr Ser Arg gac Asp 440 aaa ggc ttg agc Lys Gly Leu Ser gcg Al a 445 eag gcg Gin Ala 450 gtt atg tgg ggc Val Met Trp, Gly gtg Vai 455 ctg atg tct gcc Leu Met Ser Ala gtt gcc gtt ttg Val Ala Vai Leu 460 atg acc ctg att Met Thr Leu Ile ctg Leu gtt Val1 480 atg Met 465 cge tcg ggc gga Arg Ser Gly Gly ctc Leu 470 ggc aac ctg cag Gly Asn Leu Gin 1392 1440 1488 tee etg ccg ttt Ser Leu Pro Phe gcc Ala 485 ctg ctg atg etg Leu Leu Met Leu ata Ile 490 atg tgt ttc age Met Cys Phe Ser ctg tgg Leu Trp 495 aaa ggc ttg Lys Gly Leu agt geg gat aag aaa tat Ser Ala Asp Lys Lys Tyr 500 505 ttt gag ace egg Phe Glu Thr Arg gtt aae cet Val Asn Pro 510 1536 ace agt gta ttt tgg aeg gge gge aag tgg aaa gaa egg etg gtg cag Thr Ser Val Phe Trp Thr Gly Giy Lys Trp Lys Glu Arg Leu Val Gin 1584 525 ata atq Ile Met 530 agc cag acg cag Ser Gin Thr Gin gag Giu 535 cag gat att tta Gin Asp Ile Leu ttc cic aaa cag Phe Leu Lys Gin 1632 act Thr 545 gca tcg ccc gct Ala Ser Pro Ala atg Met cac gag ttg caa cgg gag ctt tcg gaa His Giu Leu Gin Arg Glu Leu Ser Giu 555 gaa Giu 560 cgg gtc gat aaa Arg Val Asp Lys tac ggc ttg agc Tyr Gly Leu Ser gtc Vali 565 ttt cat cgg gac Phe His Axrg Asp gag ccc Giu Pro 575 1680 1728 1776 gca atc gag Ala Ile GiU ttc Phe 580 gtc att. cgg aaa Val Ile Arg Lys gag Gi u 585 acg atg cgc gat Thr Met Arg Asp ttt atg tac Phe Met Tyr 590 att aac gac Ile Asn Asp ggg att Giy Ile ggc aag Giy Lys 610 tct gtc ggg cag Ser Vai Giy Gin gta tcc gac cag Vai Ser Asp Gin ctg ccg cat atc Leu Pro His Ile cgg Arg 615 cat cag aca act His Gin Thr Thr tac Tyr 620 tat Tyr 625 ttt ttc gac ggg Phe Phe Asp Giy cgC Arg 630 gtc ggg tac gat Vai Giy Tyr Asp gtg cag Val Gin 635 tac gaa Tyr Giu aaa ccc tac gct Lys Pro Tyr Ala tat atg aac aag Tyr Met Asn Lys 640 cgt tat ttg atg Arg Tyr Leu Met 655 1824 1872 i1920 1968 2016 gac gag ctg att Asp Giu Leu Ile gcc Al.a 645 gac att, ttg aaa Asp Ile Leu Lys ttg ttg gat Leu Leu Asp gtc ggt cag gaa ctg Vai Gly Gin Giu Leu atg gcg cac gag cag gtg gaa Met Ala His Giu Gin Vai Giu 670 ttg gca gag taa 2028 Leu Ala Giu 675 <210> 24 <211> 675 <212> PRT <213> Neisseria meningitidis <400> 24 Leu Ser Leu Ser Glu Phe Ile Giu Arg Arg Thr Ser Phe Asn Pro Met Val Ile Leu Thr Thr Leu Phe Phe Cys Val Leu Val Val Leu Val Ala Lys Giu Leu Thr Val Pro Asp Gin Val.Gin 40 Met Trp, Leu Asp Arg Val Ile Phe Leu Phe Thr Giu Phe Gly Phe Leu Leu 70 Trp Phe Tyr Val Thr Phe Ser Ile Ile Leu Ser Val Ser Ser Leu Gly Asn Arg Leu Gly Arg Asp Giu Asp Vai Pro Giu 90 Phe Gly Phe Leu Ser Trp Leu Ala Met Giy Val Ala 115 Leu 100 Phe Ala Ala Gly Gly Val Gly Leu Met Phe Phe 110 Thr Ala Gly Giu Pro Leu Met Tyr Phe Ser Asp Ile 125 Thr Pro 130 Glu His Arq Gin Gin Ala Leu Leu Thr Val Phe His Trp 145 Giy Val His Al1a Trp 150 Ser Val Tyr Gly Thr 155 Ile Ala Leu Ala Ala Tyr Phe Gly Phe 165 Arg Tyr Lys Leu Pro 170 Leu Ala Leu Arg Ser Cys 175 Phe Tyr Pro Ile Asp Ile 195 Leu 180 Leu Lys Giu Lys Ser Gly Arg Phe Gly Asp Ala 190 Ile Thr Thr Met Ala Leu Leu Thr Phe Phe Giy Leu Gly 210 Phe Gly Ala Ser Ala Giu Asn Ser 230 Gin 215 Leu Gly Ala Gly Leu 220 Gin Glu Met Gly Trp 225 Ile Phe Ser Val Gin Val 235 Leu Ile Ile Ala Val Met Ser Leu Ala Val Val Ser Ala 245 Ile 250 Ser Gly Val Gly Lys Giy 255 Val Lys Val Phe Phe Val 275 Glv Asp Asn Leu 260 Leu Ser Giu Leu Asn Leu Gly Leu Ala Phe Leu Leu Leu 265 270 Ala Ala Gly Thr Val Tyr Gly Asn Leu Leu Leu 285 Val Arg Ser Ala Phe Leu Ser Phe Ile Gly Asn 00 00 290 Lvs Thr Tyr 295 Arg Tyr Ala Tyr 305 Thr Glu 310 Ala Glu His Lys Pro 315 Trp Phe Glu Ser Val Leu Tyr Trp Trp Cys Ala Pro Phe Val Gly 335 Leu Phe Ile Phe Giy Val 355 Val Phe Gly Ala 340 Leu Ile Ser Lys Gly 345 Leu Thr Ile Arg Leu Ile Pro Phe Gly Val Glu Phe Val 350 Trp Phe Thr Ala Gly Gly Asn Thr Ala Leu Asn Asp 370 Met Leu Giy 380 Leu Glu Lys Met 385 Phe Thr 390 Leu Ser Pro Glu Thr 395 Ser Leu Phe Lys Asn Tyr Leu Pro Glu Leu Ile Val Ser Leu Leu 415 Val Ile Ser Leu Asn Asn 435 Gin Ala Val Leu 420 Ile Phe Val Thr Ser 425 Lys Asp Ser Gly Thr Ser Arg Asp 440 Leu Gly Leu Ser Ala 445 Ala Ile Tyr Val 430 Pro Arg Trp Val Leu Leu Met Trp Gly Met Ser Ala 450 Met Arg Ser Gly Gly 465 Ser Leu 470 Leu Asn Leu Gin Ser 475 Met Thr Leu Ile Val 480 Trp Leu Pro Phe Ala 485 Leu Met Leu Ile 490 Cys Phe Ser Leu 495 Lys Gly Leu Ser Ala 500 Asp Lys Lys Tyr 505 Phe Giu Thr Arg Val Asn Pro 510 Thr Ser Val 515 Phe Trp Thr Gly Lys Trp Lys Giu Axg 525 Leu Val Gin Ile Met 530 Ser Gin Thr Gin Gin Asp Ile Leu Phe Leu Lys Gin Th r 545 Ala Ser Pro Ala His Giu Leu Gin Arg Giu Leu Ser Giu 555 Giu 560 Tyr Gly Leu Ser Arg Val Asp Lys Phe His Arg Asp Giu Pro 575 Ala Ile Giu Gly Ile Lys 595 Phe 580 Val Ile Arg Lys Giu 585 Thr Met Axrg Asp Phe Met Tyr 590 Ile Asn Asp Ser Val. Gly Gin Val Ser Asp Gin Gly Lys 610 Leu Pro His Ile His Gin Thr Thr Lys Pro Tyr Ala Tyr 625 Phe Phe Asp Gly Arg 630 Vai Gly Tyr Asp Gin Tyr Met Asn Asp Glu Leu Ile Asp Ile Leu Lys Asn 650 Tyr Glu Axg Tyr Leu Met 655 Leu Leu Asp Leu Ala Giu 675 Asp 660 Val Gly Gin Glu Leu 665 Met Ala His Giu Gin Val Giu 670 <210> <211> <212> <213> <220> <221> <222> 861 DNA Neisseria meningitidis CDS (861) <400> atg aaa ccc tat tcc gcc aat ccc aac ctg acc gaa ccg cgc cgg ctg 48 met Lys Pro Tyr Ser Ala Asn Pro Asn Leu Thr Glu Pro Arg Arg Leu cgc gtg ttg Arg Val Leu gtc gtg ccg Val Val. Pro ctg Leu att gcc gcc gcg Ile Ala Ala Ala ctg Leu 25 ggc ttt ctg ctg Gly Phe Leu Leu ctg atg ctg Leu Met Leu ggc ggt tgg Gly Gly Trp, ctc gtc gcc gtg Leu Val. Ala Val tao gaa gcc tta Tyr Giu Ala Leu gat ttg Asp Leu tac ctg aaa tcc Tyr Leu Lys Ser tta Leu aac gat ccc gaa Asn Asp Pro Giu tgg tct gcc atc Trp Ser Al1a Ile 96 144 192 240 288 aaa Lys ttg acg ctg att Leu Thr Leu Ile gcg ctg att gtc Ala Leu Ile Val ccc gtc aat gcc Pro Val Asn Ala ttg ggt gtg gcg Leu Gly Val Ala atg Met gcg tgg ctg ctg Ala Trp Leu Leu acc cgt Thr Arg 90 ttt gat ttt Phe Asp Phe cgc ggc Arg Gly aag cag ttg Lys Gin Leu gtg gtg gcc Val Val Ala 115 acc ace ctg ctc Thr Thr Leu Leu gat Asp 105 ttg cog ttt too Leu Pro Phe Ser gta tcg ccc Val. Ser Pro 110 cat acg gca His Thr Ala 336 384 ggt ttg atg ttc Gly Leu Met Phe tta ttg ttc ggc Leu Leu Phe Gly grog Al a 125 ttg ggt Leu Gly 130 ggc tgg ctc gaa Gly Trp Leu Glu gcg Al a 135 caa ggc ata cag Gin Gly Ile Gin att Ile 140 ato ttc gcc atc Ile Phe Ala Ile coo Pro 145 ggt att gtt ttg Gly Ile Val Leu acg ctg ttc gtt Thr Leu Phe Val. ttc ccc ttt gtc Phe Pro Phe Val. gc a Al a 160 cgc gaa atc atc Arg G.u Ile Ile Ccg Pro 165 ctg atg cag gca Leu Met Gin Ala cag Gin 170 ggo gao ago gaa Gly Asp Ser Giu gaa cag Giu Gin 175 cgc gtt Arg Val. gog gca ttg Ala Ala Leu ata Ile oto ggc gca agc Leu Gly Ala Ser 9gc Gly 185 tgg cag atg ttt Trp Gin Met Phe tgg Trp 190 aco otg ccc aao ato Thr Leu Pro Asn Ile aaa tgg gcg tta oto tao ggc ato atc ctc aco Lys Trp Ala Leu Leu Tyr Gy Ile Ile Leu Thr aac gc Asn Ala 210 cgc gcg atg ggc Arg Ala Met Giy gag Gi u 215 ttc ggc gcg gte Phe Gly Ala Val gtg gta teg gga Val Val Ser Gly cac His 225 ata cgc ggc gaa Ile Arg Gly Giu ace Thr 230 aac acc gtc ceg Asn Thr Val Pro ctt Leu 235 ttg gtc gaa atc Leu Val Glu Ile 672 720 768 816 tac aac gaa tac Tyr Asn Giu Tyr aac Asn 245 ttc ace ggc gca Phe Thr Gly Ala gcc etc tcc ggc Ala Leu Ser Gly gta ttg Val Leu 255 gca ctt ttg Ala Leu Leu tta. caa gac Leu Gin Asp 275 gca Al a 260 aaa Lys etg geg aeg ctg Leu Ala Thr Leu aaa etc gee gee Lys Leu Ala Ala 280 geg Al a 265 gtg eag aac ate Val. Gln Asn Ile att. ace aaa Ile Thr Lys 27 0 gee gaa agg aat Ala Giu Arg Asn gea ata. tga Ala Ile 285 <210> 26 <211> 286 <212> PRT <213> Neisseria meningitidis <400> 26 Met Lys Pro 1 Arg Val Leu Val Val Pro Tyr Ser Ala 5 Asn Pro Asn Leu 10 Thr Giu Pro Axg Arg Leu Ile Ala Ala Ala Gly Phe Leu Leu Leu Met Leu Gly Gay Trp Leu Val Ala Val Phe Tyr Giu Ala Leu Asp Leu Tyr Leu Lys Ser Leu 55 Asn Asp Pro Giu Ala Trp Ser Ala Ile Leu Thr Leu Ile Ala Leu Ile Val Pro Vai Asn A-la Leu Giy Val Ala Met Ala Trp Leu Leu Arg Phe Asp Phe Arg Gly Lys Gin Leu Leu Thr Thr Leu Leu Asp Leu Pro Phe Ser Val Ser Pro 105 Val Val Ala Gly Leu Met Phe Val Leu Leu Phe Gly Ala His Thr Ala Leu Gly 130 Gly Trp Leu Giu Al a 135 Gin Gly Ile Gin Ile 140 Ile Phe Ala Ile Gly Ile Val Leu Thr Leu Phe Val Phe Pro Phe Val Al a 160 A-rg Giu Ile Ile Leu Met Gin Ala Gly Asp Ser Glu Giu Gin 175 Ala Ala Leu Thr Leu Pro 195 Leu Gly Ala Ser Gi y 185 Leu Trp Gin Met Phe Leu Tyr Giy Ile 205 Trp Arg Val 190 Ile Leu Thr Asn Ile Lys Trp Al a 200 Asn Ala 210 Arg Ala Met Gly Phe Gly Ala Vai Val Vai Ser Giy His 225 Ile Arg Giy Giu Thr 230 Asn Thr Val Pro Leu 235 Leu Vai Giu Ile Phe 240 Tyr Asn Glu Tyr Asn 245 Phe Thr Gly Ala Ala Leu Ser Giy Val Leu 255 Ala Leu Leu Leu Gin Asp 275 Al a 260 Leu Ala Thr Leu Al a 265 Val Gin Asn Ile Ile Thr Lys 270 Lys Lys Leu Al1a Ala 280 Ala Glu Arg Asn Ala Ile 285 <210> 27 <211> 495 <212> DMA <213> Neisseria meningitidis <220> <221> CDS <222> <400> 27 atg aaa aaa acc ctg ttg gca att. gtt gcc gtt tcc gcc tta agt gcc 48 Met Lys Lys Thr Leu Leu Ala Ile Val Ala Val Ser Ala Leu Ser Ala tgc cgg cag Cys Arg Gin gcg Al a gaa gag gga ccg Glu Glu Gly Pro cct tta ccc cgg Pro Leu Pro Arg cag att. agc Gin Ile Ser gaa cac aac Glu His Asn gac cgt tcg gtc gga cac tat Asp Arg Ser Val Gly His Tyr tgc cys agt. atg aac ctg Ser Met Asn Leu ggc ccc Gly Pro aaa gcc cag att Lys Ala Gin Ile ttg aac ggc aaa Leu Asn Gly Lys gat cag ccc gtt Asp Gin Pro Val ttc tcc acc atc Phe Ser Thr Ile aag Lys cag atg ttc ggc Gin Met Phe Gly tat Tyr acc aag ctg ccc Thr Lys Leu Pro gag cct aaa ggc Giu Pro Lys Gly atc Ile cgc gtg att tac Arg Val Ile Tyr gtt Val 90 acc gat atg ggc Thr Asp Met Gly aat gtt Asn Val gcg aaa Al a Lys 288 336 acc gat tgg Thr Asp Trp aaa gcc ttt Lys Ala Phe 115 acg Thr 100 aat ccc aat gcc Asn Pro Asn Ala acg gag tgg atg Thr Giu Trp, Met ga t Asp 110 tac gtc atc gac Tyr Val Ile Asp agc Ser 120 ggc ttt atc ggc Gly Phe Ile Gly atg ggt gcg Met Gly Ala gaa gac Giu Asp 130 gcg ctg ccg ttc Ala Leu Pro Phe aac aaa gag cag Asfl Lys Glu Gin gct Ala 140 gag aaa ttt gca Giu Lys Phe Ala aag gat aaa ggc ggt aag Lys Asp Lys Gly Gly Lys 145 150 gtt gtc ggt ttc Val Val Gly Phe gac Asp 155 gat atg cct gat Asp Met Pro Asp acc Thr 160 tat att ttc aaa taa Tyr Ile Phe Lys 165 <210> 28 <211> 164 <212> PRT <213> Neisseria meningitidis <400> 28 Met 1 Lys Lys Thr Leu Lieu Ala Ile Val Ala Val Ser Ala Lieu S et Ala Cys Arg Gin Asp Arg Set Al a Glu Glu Gly Pro Pro Leu Pro Axg Gin Ile Ser Glu His Asn 00 Val Gly His Tyr Ser Met Asn Leu Gly Pro Lys Ala Gin Ile Phe 55 Leu Asn Gly Lys Pro Asp Gin Pro Val Phe Set Thr Ile Lys Gin Met Phe Gly Thr Lys Leu Pro Glu Pro Lys Giy Ile Arg Val Ile Tyr Val 90 Thr Asp Met Gly Asn Val. Thr Asp Trp Lys Ala Phe 115 Thr 100 Asn Pro Asn Ala Thr Glu Trp Met A-sp Ala Lys 110 Met Gly Ala Tyr Vai Ile Asp Gly Phe Ile Gly Gi y 125 Glu ASP 130 Ala Lieu Pro Phe Gi y 135 Asn Lys GiU Gin Al a 140 Glu Lys Phe Ala Lys 145 Asp Lys Gly Gly Lys 150 Val Val Gly Phe Asp Met Pro Asp Thr 160 Tyr Ile Phe Lys <210> 29 <211> 810 <212> DNA <213> Neisseria ineningitidis <220> <221> CDS <222> <400> 29 atg aga cca tat gct act act Met Arg Pro Tyr Ala Thr Thr att tat caa ctt ttt att ttg ttt att 48 Ile Tyr Gin Leu Phe Ile Leu Phe Ile ggg agt gtt Gly Ser Val gat caa, aaa Asp Gin Lys act atg acc tca Thr Met Thr Ser gaa cct gtg aat Glu Pro Val Asn gaa aag aca Glu Lys Thr acc agt ttc Thr Ser Phe gca gta agt gcg Ala Val Ser Ala caa Gin cag gct aaa gaa Gin Ala Lys Giu aac aat Asn Asn ccc gag cca atg Pro Giu Pro Met gga ttt gaa cat Gly Phe Giu His acg Thr gtt aca ttt gat Val Thr Phe Asp 96 144 192 240 28B ttt Phe cag ggc acc aaa Gin Gly Thr Lys atg Met gtt atc ccc tat Val Ile Pro Tyr tat ctt gca cgg Tyr Leu Ala Arg acg caa gac aat Thr Gin Asp Asn aca aaa tgg ctt Thr Lys Trp Leu tcc Ser gac acg cca ggg Asp Thr Pro Gly cag gat Gin Asp gct tac tcc Ala Tyr Ser gac caa, ggc Asp Gin Gly 115 aat ttg ata gag Asn Leu Ile Glu att Ile 105 agc gtc tat tac Ser Val Tyr Tyr aaa aaa acc Lys Lys Thr 110 aaa gcg cac Lys Ala His 336 384 tgg gtg ctc gaa Trp Val Leu Giu cca Pro 120 tac aac cag caa Tyr Asn Gin Gin aa c Asn 125 ttt atc Phe Ile 130 caa ttt cta cgc Gin Phe Leu Arg ggt ttg gat agc Gly Leu Asp Ser gtg Vai 140 gac gat att gtt Asp Asp Ile Val cga aaa gat gcg Arg Lys Asp Ala tgt Cys 150 agt tta agc acg Ser Leu Ser Thr atg gga. gaa aga Met Gly Giu Arg ttg Leu 160 432 480 528 ctt act tac ggg Leu Thr Tyr Gly gtt Val 165 aaa aaa atg cca Lys Lys Met Pro tct Ser 170 gcc tat cct gaa A-la Tyr Pro Glu tac gag Tyr Glu 1'75 gct tat gaa Ala Tyr Giu ga t Asp 180 aaa aga cat att Lys Arg His Ile cct Pro 185 gaa aat cca tat Giu Asn Pro Tyr ttt cat gaa Phe His Giu 190 576 ttt tac tat att aaa aaa gga gaa aat ccg gcg att att act cat cgg phe Tyr Tyr Ile Lys Lys Gly Giu A-sn Pro Al1a Ile Ile Thr His Arg aac tat Asn Tyr 210 cat agg tat gga His Arg Tyr Gly gag Giu 215 aac gat tac age Asn Asp Tyr Ser agc gta ggt tcc Ser Val Giy Ser tgt Cys 225 att aac ggt ttc Ile Asn Gly Phe acg Thr 230 gta egg tat tac Val Arg Tyr Tyr ecg Pro 235 ttt att egg gaa Phe Ile Arg Giu aag Lys 240 612 720 768 cag cag etc aca Gin Gin Leu Thr cag gag ttg gta Gin Giu Leu Val ggt tat Giy Tyr 250 cac caa eaa His Gin Gin gta gag Vai Giu 255 caa ttg gta Gin Leu Val eag Gin 260 agt ttt gta aae Ser Phe Val Asn aat Asn 265 eca agt aaa aaa taa Pro Ser Lys Lys 270 <210> <211> 269 <212> PRT <213> Neisseria nieningitidis <400> Met Arg Pro Tyr Ala Thr Thr Ile Tyr Gin Leu Phe Ile Leu Phe Ile 1 5 10 Giy Ser Vai Asp Gin Lys Thr Met Thr Ser Cys Glu Pro Val Asn Giu Lys Thr Thr Ser Phe Ala Val Ser Ala Gin Gin Ala Lys Giu Asn Asn Pro Giu Pro Met Giy Thr Lys Met 70 Gly Phe Giu His Thr Val Thr Phe Asp Phe Gin Val Ile Pro Tyr Gi y Tyr Leu Ala Arg Thr Gin Asp Asn Thr Lys Trp Leu Ser Asp Thr Pro Giy Gin Asp Ala Tyr Ser Asp Gin Giy 115 Ile 100 Asn Leu Ile Glu Ile 105 Ser Val Tyr Tyr Lys Lys Thr 110 Lys Ala His Trp Vai Leu Glu Pro 120 Tyr Asn Gin Gin Asn 125 Phe Ile 130 Gin Phe Leu Arg Asp 135 Gly Leu Asp Ser Gly Lu As Ser Asp Asp Ile Vai Arg Lys Asp Aia Ser Leu Ser Thr Thr 155 Ser Ala 170 Met Gly Giu Arg Leu Thr Tyr Gly Val1 165 Lys Lys Met Pro Tyr Pro Giu Tyr Giu 175 Ala Tyr Giu Phe Tyr Tyr 195 Lys Arg His Ile Pro 185 Glu Asn Pro Tyr Phe His Giu 190 Thr His Arg Ile Lys Lys Giy Gi u 200 Asn Pro Ala Ile Ile 205 Asn Tyr 210 His Arg Tyr Gly Asn Asp Tyr Ser Thr 220 Ser Val Gly Ser Cys 225 Ile Asn Gly Phe Thr 230 Vai Arg Tyr Tyr Phe Ile Arg Giu Lys 240 Gin Gin Leu Thr Gin 245 Gin Giu Leu Val Gly
250. Tyr His Gin Gin Val Giu 255 Gin Leu Val Gin 260 Ser Phe Val Asn Asn 265 Pro Ser Lys Lys <210> <211> <212> <213> <220> <221> <222> 31 285 DNA Neisseria meningitidis CDS (285) <400> 31 atg aag caa gtc aag aag tcg tct Met Lys Gin Val Lys Lys Ser Ser 1 5 aaa acg atg aac atc gtt aaa aaa Lys Thr Met Asn Ile Val Lys Lys tat ttt Tyr Phe 10 aaa tat caa Lys Tyr Gin aaa agg aaa 48 Lys Arg Lys gcc ttg gca 96 Ala Leu Ala tac Tyr 25 gct gta aaa gca Ala Vai Lys Ala gcc ggt atc ttc aca ccg gcc att gtt atg gca gat acc ttt gat cca Ala Gly Ile Phe Thr Pro Ala Ile Val Met Ala Asp Thr Phe Asp Pro tcc gcg Ser Ala att ggt acg caa gta gcg aat gta atc atg ggt ttc gtg tca Ile Gly Thr Gin Val Ala Asn Val Ile Met Gly Phe Val Ser 192 atg Met gtt tcc gcc gtg Val Ser Ala Val ggt Gi y 70 atg gcg gcc att Met Ala Ala Ile acc Th r 75 gtg att ctt gca Val Ile Leu Ala atc Ile 240 caa ggc ttc aaa Gin Gly Phe Lys atg Met gct tgg agc atg Al1a Trp Ser Met att Ile 90 aaa tct gtc aaa taa Lys Ser Val Lys 285 <210> 32 <211> 94 <212> PRT <213> Neisseria rueningitidis <400> 32 Met Lys I Gin Val Lys 5 Lys Ser Ser Tyr Lys Tyr Gin Lys Arg Lys Lys Thr Met Ala Giy Ile As n Ile Val Lys Lys Ala Vai Lys Ala Ala Leu Ala Phe Asp Pro Phe Thr Pro Ala Val Met Ala Asp Thr Ser Ala Ile Gly Thr Gin Val Ala Asn Val Ile Gly Phe Val Ser Met Val Ser Ala Vai Gi y 70 Met Ala Ala Ile Th r Val Ile Leu Ala Gin Gly Phe Lys Met Ala Trp Ser Met Lys Ser Vai Lys <210> 33 <211> 966 <212> DNA <213> Neisseria meningitidis <220> <221> CDS <222> (966) <400> 33 gtg aaa ccg cgt ttt tat tgg gca gcc tgc gcc gtc ctg ctg acc gcc Val Lys Pro Arg Phe Tyr Trp, Ala Ala Cys Ala Val Leu Leu Thr Ala tgt tcg ccc gaa Cys Ser Pro Glu tct gcc gcc acg Ser Ala Ala Thr cct gcc gcc gaa Pro Ala Ala Glu act gta tcc gcc Thr Val Ser Ala gca tcc gca Ala Ser Ala gcc gtt gtg Ala Val Val ctg acc gtg Leu Th~r Val acc gcg cgg ggc Thr Ala Arg Gly gat Asp ccg aag Pro Lys aat ccc gaa cgc Asn Pro Giu Arg qcc gtg tac gac Ala Vai Tyr Asp tgg T rp gcg gcg ttg gat Ala Ala Leu Asp acg Thr ctg acc gaa ttg Leu Thr Giu Leu ggc Gi y 70 gtg aat gtg ggc Val Asn Val Giy acc acc gcg ccg Thr Thr Ala Pro gtg Val cgc gtg gat tat Arg Val Asp Tyr ttg Leu cag cet gca ttt Gin Pro Ala Phe gac Asp 90 aag gcg gca acg Lys Ala Ala Thr gtg ggg Val Giy aeg ctg ttc Thr Leu Phe ctt gtc att Leu Val Ile 115 gag Glu 100 ccc gat tac gaa Pro Asp Tyr Giu gcC Al a 105 ctg cac cgc tac Leu His Arg Tyr aat cct cag Asn Pro Gin 110 cag tta gcg Gin Leu Ala 336 384 acc ggc ggg ccg Thr Gly Gly Pro gcg gaa gcg tat Ala Glu Ala Tyr gaa Gi u 125 aaa aaC Lys Asfl 130 gcg ace acc ata Ala Thr Thr Ile gat Asp 135 ctg acg gtg gac Leu Thr Vai Asp aac. Asn 140 ggc aat atc cgc Giy Asn Ile Arg acc age ggc gaa aag Thr Ser Gly Giu Lys 145 cag Gin 150 atg gag ace ttg Met Glu Thr Leu gcg Al a 155 cgg att ttc ggc Ar Ile Phe Gly aag Lys 160 gaa gcg cgc geg Giu Ala Arg Ala gcg Al a 165 gaa. ttg aag gcg Giu Leu Lys Ala cag Gin 170 att gac gcg ctg Ile Asp Ala Leu ttc gee Phe Ala 175 caa acg cgc Gin Thr Axg gtt acg ggc Val Thr Gly 195 gaa Gi u 180 gcc gcc aaa ggc Ala Ala Lys Gly aaa Lys 185 gga cgc ggg Gly Arg Gly aac aag gtg tcc Asn Lys Val Ser gcc Ala 200 ttc ggc acg cag Phe Giy Thr Gin ctg gtg ctg tcg Leu Val Leu Ser 190 tcg cgg ttg gca Ser Arg Leu Ala 205 gac gaa tct tta Asp Glu Ser Leu 576 624 agt tgg Ser Trp 210 ata cac ggc gac Ile His Gly Asp ggc cta ccg cct Gly Leu Pro Pro gta Val 220 cgc Arg 225 aac gag ggg cac Asn Glu Gly His cag cct gtt tcc Gin Pro Val Ser ttc Phe 235 gaa tac atc aaa Giu Tyr Ile Lys 672 720 768 816 aaa aac ccc gat Lys Asn Pro Asp att ttc atc atc Ile Phe Ile Ile cgt acc gcc gcc Arg Thr Ala Ala atc ggg Ile Gly 255 gta cgc Val Arg cag gaa ggg Gin Giu Giy ggc acg aac Gly Thr Asn 275 ccg Pro 260 gcg gct gtc gaa Ala Al1a Val Giu ttg gat aac gcg Leu Asp Asn Ala gct tgg aag cgc Ala Trp Lys Arg aag Lys 280 caa atc atc gtc Gin Ile Ile Val atg Met 285 cct gcc gcg Pro Ala Ala aac tac Asn Tyr 290 att gtc gcg ggc Ile Val Ala Gly aag gcg gcg ttt Lys Ala Ala Phe 310 gcg cgg cag ttg Ala Arg Gin Leu att Ile 300 cag gcg gcg gag Gin Ala Ala Giu cag Gin 305 ttg Leu aaa aag gca gaa Lys Lys Ala Glu ccc Pro 315 gtt gcg gcg ggg Vai Ala Ala Gly 912 960 966 aag tag Lys <210> 34 <211> 321 <212> PRT <213> Neisseria meningitidis <400> 34 Val LYS Pro Arg Phe Tyr Trp Al1a Ala Cys Ala Val Leu Leu Thr Ala 1 Cys Ser Pro Glu 5 Pro Ala Ala 10 Glu Lys Thr Val Ser Ala Thr Ala Ser Ala Ala Val Val Ala Leu Asp Ser Ala Ala Pro Lys Asn Thr Leu Thr Leu Thr Val Pro Ala Ala Arg Gly Pro Glu Arg Glu Leu Gly 70 Tyr Leu Gin Val Tyr Asp Trp Thr Asn Val Gly Arg Ala 75 Lys Thr Ala Pro Val Val Asp Pro Ala Phe Ala Ala Thr Val Gly Thr Leu Phe Leu Val Ile 115 Lvs Asn Ala Glu 100 Thr Asp Tyr Glu Ala 105 Ala His Arg Tyr Gly Gly Pro Gly 120 Leu Glu Ala Tyr Asn Pro Gin 110 Gin Leu Ala Asn Ile Arg Thr Thr Ile 130 Thr Ser Asp 135 Met Thr Val Asp Asn 140 Arg Gly Glu Lys 145 Glu Gin 150 Glu Glu Thr Leu Ala 155 lie Ile Phe Gly Lys 160 Ala Arg Ala Ala 165 Ala Leu Lys Ala Asp Ala Leu Phe Ala 175 Gin Thr Arg Val Thr Gly 195 Ser Trp Ile Glu 180 Asn Ala Lys Gly Lys 185 Phe Arg Gly Leu Lys Val Ser Ala 200 Gly Gly Thr Gin Ser 205 Asp Val Leu Ser 190 Arg Leu Ala Glu Ser Leu His Gly Asp 210 Arg Asn Glu Gly His 225 Lys Gly 230 Ile Ile 215 Gin Phe Pro Val Ser Phe 235 Ile Ile Asp Arg 250 Tyr Ile Lys Glu 240 Gly Leu Pro Pro Asn Pro Asp Trp 245 Thr Ala Ala Ile 255 Gin Glu Gly Pro Ala Ala Val Glu Val Leu Asp Asn Ala Leu Val Arg 62 ;Z CA 260 26527 270 Gly Thr Asn 275 Ala Trp Lys Arg Lys 280 Gin Ie Ile Val Met 285 Pro Ala Ala Asn Tyr 290 Ile Val Ala Giy Gi y 295 Aia A-rg Gin Leu Ile 300 Gin Ala Ala Glu Gin 305 Lys Leu Lys Ala Ala Phe 310 Lys Lys Ala Giu Vai Ala Ala Gly <210> <211> 24 <212> DNA <2i3> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> atgcgaaaaa aacttaccgc cctc <210> 36 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 36 gaatttgtgg cgcaaacc <210> 37 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Oligonucleotide CK1 <400> 37 gaggaagaaa atcattgccg cgac 24 CK1 <210> 38 <211> S <212> DNA <213> Artificial Sequence 00 S <220> S <223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 38 atggtgtccg tattcgccgc <210> 39 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 39 atggcttttt atgcttttaa ggcg 24 <210> <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> tttcgcttca gaagcaggtt tggc 24 <210> 41 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Oligonucleotide C <400> 41 tttgcccgct ttgagccctt g 21 O 00 <210> 42 S <211> 24 C1 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 42 atgctcaaca tctacaactg gtcg 24 <210> 43 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 43 ggagtcggca aaaaggtggg c 21 <210> 44 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 44 atgctctcct cacagtctgc cc 22 <210> <211> <212> DNA ;Z <213> Artificial sequence <220> <223> Description of Artificial Sequence: Synthetic Oligonucleotide 00 <400> atggaactct ttaaaatcaa acgcg <210> 46 (i <211> <212> DRA <213> Artificial sequence <220> <223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 46 aaccacgatt tcttctttct tcttc <210> 47 <211> <212> DMA <213> Artificial Sequence <220> <223> Description of Artificial sequence: Synthetic Oligonucleotide <400> 47 atgagaccat atgctactac <210> 48 <211> 21 <212> DMA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Oligonucleotide <c400> 48 00
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2007202896A AU2007202896A1 (en) | 2000-08-24 | 2007-06-22 | Genes and proteins, and their uses |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB0020952.8 | 2000-08-24 | ||
AU2007202896A AU2007202896A1 (en) | 2000-08-24 | 2007-06-22 | Genes and proteins, and their uses |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2001282299A Division AU2001282299B2 (en) | 2000-08-24 | 2001-08-21 | Genes and proteins, and their uses |
Publications (1)
Publication Number | Publication Date |
---|---|
AU2007202896A1 true AU2007202896A1 (en) | 2007-07-12 |
Family
ID=38265085
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2007202896A Abandoned AU2007202896A1 (en) | 2000-08-24 | 2007-06-22 | Genes and proteins, and their uses |
Country Status (1)
Country | Link |
---|---|
AU (1) | AU2007202896A1 (en) |
-
2007
- 2007-06-22 AU AU2007202896A patent/AU2007202896A1/en not_active Abandoned
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Medaglini et al. | Mucosal and systemic immune responses to a recombinant protein expressed on the surface of the oral commensal bacterium Streptococcus gordonii after oral colonization. | |
Charles et al. | Molecular cloning and characterization of protective outer membrane protein P. 69 from Bordetella pertussis. | |
WO2003054007A2 (en) | Streptococcus antigens | |
EA006232B1 (en) | Streptococcus antigens | |
US20080241151A1 (en) | Virulence genes, proteins, and their use | |
AU723116B2 (en) | Mutants of streptococcal toxin A and methods of use | |
PT1141308E (en) | Group b streptococcus proteins, and their use | |
JP2002525083A (en) | STAPHYLOCOCCUSAUREUS gene and polypeptide | |
EP1240332B1 (en) | Streptococcus pyogenes virulence genes and proteins and their use | |
AU2001282299B2 (en) | Genes and proteins, and their uses | |
AU2001282299A1 (en) | Genes and proteins, and their uses | |
US20040219585A1 (en) | Nontypeable haemophilus influenzae virulence factors | |
CN100484956C (en) | Compound from catarrh mollase bacterial | |
AU2007202896A1 (en) | Genes and proteins, and their uses | |
CA2399276A1 (en) | Novel therapeutic compositions for treating infection by lawsonia spp | |
US20040005328A1 (en) | Moraxella catarrhalis proteins | |
AU662783B2 (en) | Whooping cough vaccine | |
AU780980B2 (en) | Novel therapeutic compositions for treating infection by lawsonia SPP | |
CA2455254A1 (en) | Moraxella (branhamella) catarrhalis antigens | |
NZ543923A (en) | Pho3-18 for a theraputic use, particulary in bacterial infection. | |
AU2004203417A1 (en) | Virulence genes, proteins, and their use | |
WO2002077020A2 (en) | Virulence genes in h. influenzae |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MK4 | Application lapsed section 142(2)(d) - no continuation fee paid for the application |