AU2005291039A1 - T-cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents - Google Patents

Description

WO 2006/037960 PCT/GB2005/003752 T cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents The present invention relates to T cell receptors (TCRs) containing a non-native 5 disulphide interchain bond associated with therapeutic agents. Background to the Invention The novel TCR therapeutic combinations disclosed herein will be of use in the treatment of autoimmune disease, organ rejection, Graft Versus Host Disease 10 (GVHD) and cancer. The TCR portion of the TCR therapeutic agent combinations disclosed herein are targeting moieties. Brief Description of the Invention This invention makes available for the first time a dimeric TCR (dTCR) or single 15 chain TCR (scTCR) associated with a therapeutic agent, wherein said agent is selected from IL-1, IL-la, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-11, IL-12, IL-13, IL-15, IL-21, IL-23, TGF-3, IFN-y, Lymphotoxin, TNFa, Anti-CD2 antibody, Anti CD3 antibody, Anti-CD4 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti CD45RA antibody, Anti-CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 20 antibody, Antilymphocyte globulin, Anti-apTCR antibody, Anti-ySTCR antibody, Anti-CD49a antibody, Anti-CD49b antibody, Anti-CD49c antibody, Anti-CD49d antibody, Anti-CD49e antibody, Anti-CD49f antibody, Anti-TCR V38 antibody, Anti-CD16 antibody, Anti-CD28 antibody, CTLA-4-Ig, Anti-B7.2 antibody, Anti CD40L antibody, Anti-ICAM-1 antibody, ICAM-1, Anti-Mac antibody, Anti-LFA-1 25 antibody, Anti-IFN-y antibody IFN-y, IFN-yR/IgG1 fusions, Anti-IL-2R antibodies, IL-2R antibody, IL-2 Diptheria-toxin protein, Anti-IL-12 antibody, IL-12 Antagonist (p40), Anti-IL-1 antibody, IL-1 Antagonist, Glutamic acid decarboxylase (GAD), Anti-GAD antibody, Viral proteins and peptides, Bacterial proteins or peptides, A Galactosyl-ceramide, Calcitonin, Nicotinamide, Anti-oxidants (Vitamin E, Probucol 30 analog, Probucol + deflazacoert or Aminoguanidine), Anti-Inflammatory agents (Pentoxifylline or Rolipram), Immunomodulators (Linomide, Ling-zhi-8, D-Glucan, Multi-functional protein 14, Ciamexon, Cholera toxin B, Vanadate or Vitamin D3 analogue, small molecule CD80 inhibitors, Androgens, IGF-1, Immunomanipulation WO 2006/037960 PCT/GB2005/003752 -2 (Natural antibodies), Lupus idiotype, Lipopolysaccaride), Sulfatide, Bee venom, Kampo formulation, Silica, Ganglioside, Antiasialo GM-1 antibody, Hyaluronidase., Concanavalin A, Anti-Class I MHC antibody, or Anti-Class II MHC antibody, Cyclosporin, FK-506, Azathioprine, Rapamycin or Deoxyspergualin, PE38 5 Pseudomonas exotoxin or a functional variant or fragment of any of the foregoing, and wherein said TCR comprises a first segment constituted by an amino acid sequence corresponding to a TCR a chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR cc chain constant domain extracellular sequence, a second segment constituted by an amino acid sequence 10 corresponding to a TCR [ chain variable domain fused to the N terminus of an amino acid sequence corresponding to TCR P chain constant domain extracellular sequence, a disulfide bond between the first and second chains, said disulfide bond being one which has no equivalent in native ajpT cell receptors, and in the case of said scTCRts further comprising a linker sequence linking the C terminus of the first segment to the 15 N terminus of the second segment, or vice versa, the length of the linker sequence and the position of the disulfide bond being such that the variable domain sequences of the first and second segments are mutually orientated substantially as in native cp T cell receptors. 20 Detailed Description of the Invention The present invention provides a dimeric TCR (dTCR) or single-chain TCR (scTCR) associated with a therapeutic agent, wherein said agent selected from one of IL-1, IL la, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-11, IL-12, IL-13, IL-15, IL-21, IL-23, TGF p, IFN-y, Lymphotoxin, TNFa, Anti-CD2 antibody, Anti-CD3 antibody, Anti-CD4 25 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti-CD45RA antibody, Anti CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 antibody, Antilymphoc yte globulin, Anti-aPTCR antibody, Anti-ySTCR antibody, Anti-CD49a antibody, Anti CD49b antibody, Anti-CD49c antibody, Anti-CD49d antibody, Anti-CD49e antibody, Anti-CD49f antibody, Anti-TCR Vp8 antibody, Anti-CD16 antibody, Anti-CD28 30 antibody, CTLA-4-Ig, Anti-B7.2 antibody, Anti-CD40L antibody, Anti-ICAM-1 antibody, ICAM-1, Anti-Mac antibody, Anti-LFA-1 antibody, Anti-IFN-y antibody IFN-y, IFN-yR/IgGl fusions, Anti-IL-2R antibodies, IL-2R antibody, IL-2 Diptheria- WO 2006/037960 PCT/GB2005/003752 -3 toxin protein, Anti-IL-12 antibody, IL-12 Antagonist (p40), Anti-IL-I antibody, IL-1 Antagonist, Glutamic acid decarboxylase (GAD), Anti-GAD antibody, Viral proteins and peptides, Bacterial proteins or peptides, A-Galactosyl-ceramide, Calcitonin, Nicotinamide, Anti-oxidants (Vitamin E, Probucol analog, Probucol + deflazacoert or 5 Aminoguanidine), Anti-Inflammatory agents (Pentoxifylline or Rolipram), Immunomodulators (Linomide, Ling-zhi-8, D-Glucan, Multi-functional protein 14, Ciamexon, Cholera toxin B, Vanadate or Vitamin D3 analogue, small molecule CD80 inhibitors, Androgens, IGF-1, Immunomanipulation (Natural antibodies), Lupus idiotype, Lipopolysaccaride), Sulfatide, Bee venom, Kampo formulation, Silica, 10 Ganglioside, Antiasialo GM-I antibody, Hyaluronidase, Concanavalin A, Anti-Class I MHC antibody, or Anti-Class II MHC antibody, Cyclosporin, FK-506, Azathioprine, Rapamycin or Deoxyspergualin, PE38 Pseudomonas exotoxin, or a functional variant or fragment of any of the foregoing, and wherein said TCR comprises a first segment constituted by an amino acid sequence corresponding to a 15 TCR ca chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR c chain constant domain extracellular sequence, a second segment constituted by an amino acid sequence corresponding to a TCR chain variable domain fused to the N terminus of an amino acid sequence corresponding to TCR P chain constant domain extracellular sequence, a disulfide 20 bond between the first and second chains, said disulfide bond being one which has no equivalent in native up T cell receptors, and in the case of said scTCRs further comprising a linker sequence linking the C terminus of the first segment to the N terminus of the second segment, or vice versa, the length of the linker sequence and the position of the disulfide bond being such that the variable domain sequences of the 25 first and second segments are mutually orientated substantially as in native cP T cell receptors. As used herein the term "a dimeric TCR (dTCR) or single-chain TCR (scTCR) associated with an therapeutic agent" is understood to refer to a TCR covalently or 30 otherwise linked to an therapeutic agent. The therapeutic agent may either be directly linked to the TCR, or indirectly via a linker moiety.

WO 2006/037960 PCT/GB2005/003752 -4- As used herein the term "functional variant" is understood to refer to analogues of the disclosed therapeutic agents which have the same therapeutic effect. For example, as is known to those skilled in the art, it may be possible to produce therapeutics that incorporate minor changes in the chemical structure or amino acid sequence thereof 5 compared to those disclosed without altering the therapeutic effect of the agents. Such trivial variants are included in the scope of this invention. Functional antibody fragments and variants 10 Antibody fragments and variants/analogues which are suitable for use in the compositions and methods described herein include, but are not limited to, the following. Antibody Fragments 15 As is known to those skilled in the art, it is possible to produce fragments of a given antibody which retain substantially the same binding characteristics as those of the parent antibody. The following provides details of such fragments: 20 Minibodies - These constructs consist of antibodies with a truncated Fc portion. As such they retain the complete binding domains of the antibody from which are derived. Fab fragments - These comprise a single immunoglobulin light chain covalently 25 linked to part of an immunoglobulin heavy chain. As such, Fab fragments comprise a single antigen combining site. Fab fragments are defined by the portion of an IgG that can be liberated by treatment with papain. Such fragments are commonly produced via recombinant DNA techniques. (Reeves et al., (2000) Lecture Notes on Immunology (4th Edition) Published by Blackwell Science) 30 F(ab') 2 fragments - These comprise both antigen combining sites and the hinge region from a single antibody. F(ab') 2 fragments are defined by the portion of an IgG that can be liberated by treatment with pepsin. Such fragments are commonly WO 2006/037960 PCT/GB2005/003752 -5 produced via recombinant DNA techniques. (Reeves et al., (2000) Lecture Notes on Immunology (4tth Edition) Published by Blackwell Science) Fv fragments - These comprise an immunoglobulin variable heavy domain linked to 5 an immunoglobulin variable light domain. A number of Fv designs have been produced. These include dsFvs, in which the association between the two domains is enhanced by an introduced disulfide bond. Alternatively, scFVs can be formed using a peptide linker to bind the two domains together as a single polypeptide. Fvs constructs containing a variable domain of a heavy or light immunoglobulin chain associated to 10 the variable and constant domain of the corresponding immunoglobulin heavy or light chain have also been produced. FV have also been multimerised to form diabodies and triabodies (Maynard et al., (2000) Annu Rev Biomed Eng 2 339-376) NanobodiesTM - These constructs, marketed by Ablynx (Belgium), comprise synthetic 15 single immunoglobulin variable heavy domain derived from a camelid (e.g. camel or llama) antibody. Domain Antibodies - These constructs, marketed by Domantis (Belgium), comprise an affinity matured single immunoglobulin variable heavy domain or 20 immunoglobulin variable light domain. Antibody variants and analogues The defining functional characteristic of antibodies in the context of the present 25 invention is their ability to bind specifically to a target ligand. As is known to those skilled in the art it is possible to engineer such binding characteristics into a range of other proteins. Examples of antibody variants and analogues suitable for use in the compositions and methods of the present invention include, but are not limited to, the following. 30 Protein scaffold-based binding polypeptides - This family of binding constructs comprise mutated analogues of proteins which contain native binding loops. Examples include Affibodies, marketed by Affibody (Sweden), which are based on a WO 2006/037960 PCT/GB2005/003752 -6 three-helix motif derived from one of the IgG binding domains of Staphylococcus aureus Protein A. Another example is provided by Evibodies, marketed by EvoGenix (Australia) which are based on the extracellular domains of CTLA-4into which domains similar to antibody binding loops are grafted. A final example, Cytokine 5 Traps marketed by Regeneron Pharmaceuticals (US), graft cytokine receptor domains into antibody scaffolds. (Nygren et al., (2000) Current Opinion in Structural biology 7 463-469) provides a review of the uses of scaffolds for engineering novel binding sites in proteins. This review mentions the following proteins as sources of scaffolds: CP1 zinc finger, Tendamistat, Z domain (a protein A analogue), PST1, Coiled coils, 10 LACI-D1 and cytochrome b 562 . Other protein scaffold studies have reported the use of Fibronectin, Green fluorescent protein (GFP) and ankyrin repeats. As is known to those skilled in the art antibodies or fragments, variants or analogues thereof can be produced which bind to various parts of a given protein ligand. For 15 example, anti-CD3 antibodies can be raised to any of the polypeptide chains from which this complex is formed (i.e.y, 6, s, C, and 11 CD3 chains) Antibodies which bind to the s CD3 chain are the preferred anti-CD3 antibodies for use in the compositions and methods of the present invention. 20 Another aspect of the invention provides a dTCR or scTCR associated with a therapeutic agent, wherein the therapeutic agent is selected from IL-1, IL-l a, IL-3, IL-5, IL-6, IL-7, IL-11, IL-12, TGF-, Lymphotoxin, TNFa, Anti-CD2 antibody, Anti-CD4 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti-CD45RA antibody, Anti-CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 antibody, 25 Antilymphocyte globulin, Anti-apTCR antibody, Anti-y6TCR antibody, Anti-CD49a antibody, Anti-CD49b antibody, Anti-CD49c antibody, Anti-CD49d antibody, Anti CD49e antibody,Anti-CD49f antibody, Anti-TCR Vp8 antibody, Anti-CD 16 antibody, Anti-CD28 antibody, CTLA-4-Ig, Anti-B7.2 antibody, Anti-CD40L antibody, Anti-ICAM-1 antibody, ICAM-1, Anti-Mac antibody, Anti-LFA-1 30 antibody, Anti-IFN-y antibody IFN-y, IFN-yR/IgGl fusions, Anti-IL-2R antibodies, IL-2R antibody, IL-2 Diptheria-toxin protein, Anti-IL-12 antibody, IL-12 Antagonist (p40), Anti-IL-1 antibody, IL-1 Antagonist, Glutamic acid decarboxylase (GAD), WO 2006/037960 PCT/GB2005/003752 -7 Anti-GAD antibody, Viral proteins and peptides, Bacterial proteins or peptides, A Galactosyl-ceramide, Calcitonin, Nicotinamide, Anti-oxidants (Vitamin E, Probucol analog, Probucol + deflazacoert or Aminoguanidine), Anti-Inflammatory agents (Pentoxifylline or Rolipram), Immunomodulators (Linomide, Ling-zhi-8, D-Glucan, 5 Multi-functional protein 14, Ciamexon, Cholera toxin B, Vanadate or Vitamin D3 analogue, small molecule CD80 inhibitors, Androgens, IGF-1, Immunomanipulation (Natural antibodies), Lupus idiotype, Lipopolysaccaride), Sulfatide, Bee venom, Kampo formulation, Silica, Ganglioside, Antiasialo GM-1 antibody, Hyaluronidase, Concanavalin A, Anti-Class I MHC antibody, or Anti-Class II MHC antibody, 10 Cyclosporin, FK-506, Azathioprine, Rapamycin or Deoxyspergualin, or a functional variant or fragment of any of the foregoing. "Anti-T cell" antibodies 15 One preferred group of the immunomodulatory agents of the invention are antibodies or functional fragments or variants/analogues thereof which bind epitopes presented only by T cells or Natural Killer (NK) cells. The following are the antibodies which will specifically target these cells: 20 Anti-CD3 antibody, Anti-CD4 antibody, Anti-CD8 antibody, Anti-apTCR antibody, Anti-CD49a antibody, Anti-CD49b antibody, Anti-CD49c antibody, Anti-CD49d antibody, Anti-CD49e antibody, Anti-CD49f antibody, Anti-y6TCR antibody, Anti TCR Vp8 antibody and Anti-CD28 antibody. 25 As will be known to those skilled in the art particular subsets of T cells and/or NK cells are targeted by the majority of the above antibodies. Only anti-CD3 antibodies will target all NK cells and T cells. Such antibodies, linked to a soluble TCR to form a bifunctional composition of the 30 invention, will cause T cells and/or NK cells to be localised to the cells expressing the cognate peptide-MHC ligand for the soluble TCR. Without wishing to be limited by theory, the binding of these antibodies to the T cells or NK cells may cause these cells to be activated.

WO 2006/037960 PCT/GB2005/003752 -8 Another aspect of the invention provides a dTCR or scTCR associated with a therapeutic agent selected from IL-10, IL-4 or IL-13 or a functional variant or fragment of any of the foregoing. 5 One aspect of the invention is provided wherein the dTCR or scTCR is tissue-specific. In a one embodiment of the present aspect the dTCR or scTCR is specific for a tissue which is a target for auto-reactive T cells in autoimmune disease, organ rejection or Graft Versus Host Disease (GVHD). In a specific embodiment of the present aspect 10 the dTCR or scTCR is islet cell-specific. The T cell clones NY8.3 (Santamaria et al., J. hnmnunology (1995) 154 2494-2503) and (Nagata et al., (1995) Jmmunology 152 2042-2050) and G9C8 (Wong et al., JExp Med 1996) 183 67-76) are examples of murine T cell clones that are islet cell-specific. The NY8.3 T cell clone is specific for a glucose-6-phosphatase catalytic subunit-related protein (IGRP)-derived peptide 15 presented by the murine H2-Kd MHC and the G9C8 T cell clone is specific for an insulin-derived peptide presented by the murine H2-Kd MHC. A further aspect of the invention provides a dTCR or scTCR associated with a therapeutic agent, wherein the therapeutic agent is selected from IL-15, IL-21, IL-23, 20 PE3 8 Pseudomonas exotoxin, IFN-y or Anti-CD3 antibody or a functional variant or fragrnent of any of the foregoing. In one aspect of the invention the TCR associated with a therapeutic agent is a dTCR. In an alternative aspect of the invention the TCR associated with a therapeutic agent is 25 a scTCR. There are two classes of linker that are preferred for the association of TCRs and therapeutic agents of the present invention. A TCR of the invention in which the TCR is linked by a polyalkylene glycol chain to the therapeutic agent provides one 30 embodiment of the present aspect. Peptidic linkers are the other class of TCR linkers. These two classes of linker are discussed in detail below in relation to their use in the formation of TCR multimers. Example 6 herein provides two examples of peptidic liners which may be used to form the association between the TCR and therapeutic WO 2006/037960 PCT/GB2005/003752 -9 agent. As is known to those skilled in the art a variety of peptide linkers may be suitable to link the TCR P chains to the required therapeutic agents. The following are additional examples linker sequences which may be used for this purpose 5 ggcggtccg - which encodes a Gly-Gly-Pro linker. cccggg - which encodes a Pro-Gly linker including a Xmal restriction enzyme site As mentioned above, the TCR portions of the TCR therapeutic agent combinations disclosed herein are targeting moieties. The TCRs of the invention target TCR ligands 10 such as peptide-MHC or CD 1 -antigen complexes. As such, it would be desirable if these TCR had a higher affinity and/or a slower off-rate for the TCR ligands than native TCRs specific for that ligand. The inventors co-ending application WO 2004/044004 details methods of producing TCR having a higher affinity and/or a slower off-rate for the TCR ligand than native TCRs specific for that ligand. 15 Preferably, the affinity (KD) of the TCR for the TCR ligand is higher than 1 tM, and/or the off-rate (kOFF) is slower than 1 x 10- S-1. More preferably, the affinity (KD) of the TCR for the TCR ligand is higher than 1 OnM, and/or the off-rate (koff) is slower than 1 x 1 0 4 S1. Most preferably, the affinity (KD) of the TCR for the TCR ligand is higher than 1nM, and/or the off-rate (koff) is slower than 1 x 10- S 1 . 20 The affinity (KD) and/or off-rate (koff) measurement can be made by any of the known methods. A preferred method is the Surface Plasmon Resonance (Biacore) method of Example 3. 25 In one broad aspect, the TCRs of the invention are in the form of either single chain TCRs (scTCRs) or dimeric TCRs (dTCRs) as described in WO 04/033685 and WO 03/020763. A suitable scTCR form comprises a first segment constituted by an amino acid 30 sequence corresponding to a TCR a chain variable domain, a second segment constituted by an amino acid sequence corresponding to a TCR P chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to WO 2006/037960 PCT/GB2005/003752 - 10 a TCR P chain constant domain extracellular sequence, and a linker sequence linking the C terminus of the first segment to the N terminus of the second segment. Alternatively the first segment may be constituted by an amino acid sequence 5 corresponding to a TCR P chain variable domain, the second segment may be constituted by an amino acid sequence corresponding to a TCR a chain variable domain sequence fused to the N ternainus of an amino acid sequence corresponding to a TCR cc chain constant domain extracellular sequence 10 More specifically the first segment may be constituted by an amino acid sequence corresponding to a TCR cx chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR a chain constant domain extracellular sequence, the second segment may be constituted by an amino acid sequence corresponding to a TCR P chain variable domain fused to the N terminus of 15 an amino acid sequence corresponding to TCR P chain constant domain extracellular sequence, and a disulfide bond may be provided between the first and second chains, said disulfide bond being one which has no equivalent in native up T cell receptors. In the above scTCR forms, the linker sequence may link the C terminus of the first 20 segment to the N terminus of the second segment, and may have the formula -PGGG

(SGGGG)

5 -P- (SEQ ID NO: 1) or -PGGG-(SGGGG) 6 -P- (SEQ ID NO: 2) wherein P is proline, G is glycine and S is seine. A suitable dTCR form of the TCRs of the present invention comprises a first 25 polypeptide wherein a sequence corresponding to a TCR Ua chain variable domain sequence is fused to the N terminus of a sequence corresponding to a TCR a chain constant domain extracellular sequence, and a second polypeptide wherein a sequence corresponding to a TCR P chain variable domain sequence fused to the N terminus a sequence corresponding to a TCR P chain constant domain extracellular sequence, the 30 first and second polypeptides being linked by a disulfide bond which has no equivalent in native up T cell receptors.

WO 2006/037960 PCT/GB2005/003752 - 11 The first polypeptide may comprise a TCR a chain variable domain sequence is fused to the N terminus of a sequence corresponding to a TCR a chain constant domain extracellular sequence, and a second polypeptide wherein a sequence corresponding to a TCR P chain variable domain sequence is fused to the N terminus a sequence 5 corresponding to a TCR P chain constant domain extracellular sequence, the first and second polypeptides being linked by a disulfide bond between cysteine residues substituted for Thr 48 of exon 1 of TRAC*01 and Ser 57 of exon 1 of TRBC1*01 or TRBC2*01 or the non-human equivalent thereof. ("TRAC" etc. nomenclature herein as per T cell receptor Factsbook, (2001) LeFranc and LeFranc, Academic Press, ISBN 10 0-12-441352-8) The dTCR or scTCR form of the TCRs of the invention may have amino acid sequences corresponding to human cp TCR extracellular constant and variable domain sequences, and a disulfide bond may link amino acid residues of the said 15 constant domain sequences, which disulfide bond has no equivalent in native TCRs. The disulfide bond is between cysteine residues corresponding to amino acid residues whose P carbon atoms are less than 0.6 nm apart in native TCRs, for example between cysteine residues substituted for Thr 48 of exon 1 of TIRAC*01 and Ser 57 of exon 1 of TRBC1*01 or TRBC2*01 or the non-human equivalent thereof. Other sites where 20 cysteines can be introduced to form the disulfide bond are the following residues in exon 1 of TRAC*01 for the TCR a chain and TRBC1*01 or TRBC2*01 for the TCR p chain: TCR a chain TCR chain Native p carbon separation (nm) Thr 45 Ser 77 0.533 Tyr 10 Ser 17 0.359 Thr 45 Asp 59 0.560 Ser 15 Glu 15 0.59 25 WO 2006/037960 PCT/GB2005/003752 - 12 In addition to the non-native disulfide bond referred to above, the dTCRl or scTCR form of the TCRs of the invention may include a disulfide bond between residues corresponding to those linked by a disulfide bond in native TCRs. 5 The dTCR or scTCR form of the TCRs of the invention preferably does not contain a sequence corresponding to transmembrane or cytoplasmic sequences of native TCRs. One embodiment of the invention provides a TCR associated with a therapeutic agent, wherein said therapeutic agent is a PE38 exotoxin. 10 PE38 exotoxin is a truncated form of a Pseudomonas exotoxin. The native polypeptide is a 66kDa protein consisting of domains IA, II, IB and III. The PE38 derivative consists of domain II, amino acids 380-399 of domain IB and domain III. As will be obvious to those skilled in the art other truncated forms of Pseudomonas 15 exotoxin may be of use in the present invention. (For example PE40).The preferred variant of PE38 for use in the present invention contains mutations in the domain III thereof such that the C-terminus amino acids are KDEL. These C-terminal mutations have previously been shown to increase the toxicity of the Pseudomona.s exotoxin. (Kreitman et al (1995) JBiochem 307 29-37) 20 In a preferred embodiment said TCR associated with a PE38 exotoxin comprises the amino acid sequences of (SEQ ID NO: 73) and (SEQ ID NO: 71). (Figures 29b and 28b respectively). 25 PEGylated TCR Monomers In one particular embodiment a TCR associated with a therapeutic agent of the invention is associated with at least one polyalkylene glycol chain(s). This association may be cause in a number of ways known to those skilled in the art. In a preferred embodiment the polyalkylene chain(s) is/are covalently linked to the TCR. In a 30 further embodiment the polyethylene glycol chains of the present aspect of the invention comprise at least two polyethylene repeating units.

WO 2006/037960 PCT/GB2005/003752 - 13 Multivalent TCR Complexes One aspect of the invention provides a multivalent TCR complex comprising at least two TCRs associated with a therapeutic agent. In one embodiment of this aspect, at 5 least two TCR molecules are linked via linker moieties to form multivalent complexes. Such multivalent TCR complexes may be linked by either a non-peptidic polymer chain or a peptidic linker sequence. Preferably the complexes are water soluble, so the linker moiety should be selected accordingly. Furthermore, it is preferable that the linker moiety should be capable of attachment to defined positions 10 on the TCR molecules, so that the structural diversity of the complexes formed is minimised. One embodiment of the present aspect is provided by a TCR complex of the invention wherein the polymer chain or peptidic linker sequence extends between amino acid residues of each TCR which are not located in a variable region sequence of the TCR. 15 Since the complexes of the invention may be for use in medicine, the linker moieties should be chosen with due regard to their pharmaceutical suitability, for example their immunogenicity. 20 Examples of linker moieties which fulfil the above desirable criteria are known in the art, for example the art of linking antibody fragments. There are two classes of linker that are preferred for use in the production of multivalent TCR molecules of the present invention. A TCR complex of the invention 25 in which the TCRs are linked by a polyalkylene glycol chain provides one embodiment of the present aspect. The first are hydrophilic polymers such as polyalkylene glycols. The most commonly used of this class are based on polyethylene glycol or PEG, the structure of which is 30 shown below.

HOCH

2

CH

2 0 (CH 2

CH

2 O)n-CH 2

CH

2

OH

WO 2006/037960 PCT/GB2005/003752 - 14 Wherein n is greater than two. However, others are based on other suitable, optionally substituted, polyalkylene glycols include polypropylene glycol, and copolymers of ethylene glycol and propylene glycol. 5 Such polymers may be used to treat or conjugate therapeutic agents, particularly polypeptide or protein therapeutics, to achieve beneficial changes to the PK profile of the therapeutic.. Such improvements in the PK profile of the PEG-therapeutic conjugate are believe to result from the PEG molecule or molecules forming a 'shell' around the therapeutic which sterically hinders the reaction with the immune system 10 and reduces proteolytic degradation. (Casey et al, (2000) Tumor Targetting 4 235 244) The size of the hydrophilic polymer used my in particular be selected on the basis of the intended therapeutic use of the TCR complex. Thus for example, where the product is intended to leave the circulation and penetrate tissue, for example for use in the treatment of a tumour, it may be advantageous to use low molecular weight 15 polymers in the order of 5 KDa. There are numerous review papers and books that detail the use of PEG and similar molecules in pharmaceutical formulations. For example, see Harris & Zalipsky (1997) Chemistry and Biological Applications of Polyethylene Glycol ACS Books, Washington, D.C. 20 The polymer used can have a linear or branched conformation. Branched PEG molecules, or derivatives thereof, can be induced by the addition of branching moieties including glycerol and glycerol oligomers, pentaerythritol, sorbitol and lysine. 25 Usually, the polymer will have a chemically reactive group or groups in its structure, for example at one or both termini, and/or on branches from the backbone, to enable the polymer to link to target sites in the TCR. This chemically reactive group or groups may be attached directly to the hydrophilic polymer, or there may be a spacer group/moiety between the hydrophilic polymer and the reactive chemistry as shown 30 below: Reactive chemistry-Hydrophilic polymer-Reactive chemistry WO 2006/037960 PCT/GB2005/003752 - 15 Reactive chemistry-Spacer-Hydrophilic polymer-Spacer-Reactive chemistry The spacer used in the formation of constructs of the type outlined above may be any organic moiety that is a non-reactive, chemically stable, chain, Such spacers include, 5 by are not limited to the following:

-(CH

2 )n- wherein n = 2 to 5

-(CH

2

)

3

NHCO(CH

2

)

2 10 A multivalent TCR complex of the invention in which a divalent alkylene spacer radical is located between the polyalkylene glycol chain and its point of attachment to a TCR associated with a therapeutic agent provides a further embodiment of the present aspect. 15 A multivalent TCR complex of the invention in which the polyalkylene glycol chain comprises at least two polyethylene glycol repeating units provides a further embodiment of the present aspect. A wide variety of coupling chemistries can be used to couple polymer molecules to 20 protein and peptide therapeutics. The choice of the most appropriate coupling chemistry is largely dependant on the desired coupling site. For example N maleimide, Vinyl sulfone, Benzotriazole carbonate, Succinimidyl proprionate, Succinimidyl butanoate, Thio-ester, Acetaldehyde, Acrylate, Biotin and Primary amine coupling chemistries have been used attached to one or more of the termini of 25 PEG molecules (Source: Nektar Molecular Engineering Catalogue 2003): As stated above non-PEG based polymers also provide suitable linkers for multimerising the TCRs of the present invention. For example, moieties containing maleimide termini linked by aliphatic chains such as BMH and BMOE (Pierce, 30 products Nos. 22330 and 22323) can be used. Peptidic linkers are the other class of TCR linkers. These linkers are comprised of chains of amino acids, and function to produce simple linkers or multimerisation WO 2006/037960 PCT/GB2005/003752 - 16 domains onto which TCR molecules can be attached. The biotin / streptavidin system has previously been used to produce TCR tetramers (see WO/99/60119) for in-vitro binding studies. However, strepavidin is a microbially-derived polypeptide and as such not ideally suited to use in a therapeutic. 5 A TCR complex of the invention in which the TCRs are linked by a peptidic linker derived from a human multimerisation domain provides a further embodiment of the present aspect. There are a number of human proteins that contain a multimerisation domain that could be used in the production of multivalent TCR complexes. For 10 example the tetramerisation domain of p53 which has been utilised to produce tetramers of scFv antibody fragments which exhibited increased serum persistence and significantly reduced off-rate compared to the monomeric scFV fragment. (Willuda et al. (2001) J. Biol. Chem. 276 (17) 14385-14392) Haemoglobin also has a tetramerisation domain that could potentially be used for this kind of application. 15 Soluble TCRs or multivalent TCR complexes of the invention may be linked to an enzyme capable of converting a prodrug to a drug. This allows the prodrug to be converted to the drug only at the site where it is required (i.e. targeted by the sTCR). 20 Therapeutic Use The invention also provides a method for delivering a therapeutic agent to a target cell, which method comprises contacting potential target cells with a TCR or multivalent TCR complex in accordance with the invention under conditions to allow 25 attachment of the TCR or multivalent TCR complex to the target cell, said TCR or multivalent TCR complex being specific for a given peptide-MHC complex. In particular, the soluble TCR or multivalent TCR complex of the present invention can be used to deliver therapeutic agents to the location of cells presenting a particular 30 antigen. This would be useful in many situations, for example, against tumours or sites of autoimmune disease. A therapeutic agent could be delivered such that it would exercise its effect locally but not only on the cell to which it binds.

WO 2006/037960 PCT/GB2005/003752 - 17 Thus, one particular strategy envisages immunostimulatory molecules linked to TCRs or multivalent TCR complexes according to the invention specific for tumour antigens. For cancer treatment, the localisation in the vicinity of tumours or metastasis would enhance the effect of toxins or immunostimulants. Alternatively, the soluble 5 TCR or multivalent TCR complex of the present invention can be used to deliver immunoinhibitory agents to the location of cells presenting a particular antigen related to an autoimmune disease. For example, an Islet cell-specific TCR could be used to deliver an immunoinhibitory agent, such as IL- 10, IL-4 or IL- 13 or a functional variant or fragment of any of the foregoing to the Islet cells of a patient suffering from 10 diabetes. For vaccine delivery, the vaccine antigen could be localised in the vicinity of antigen presenting cells, thus enhancing the efficacy of the antigen. 15 It is envisaged that the administration of an interferon (IFN), such as IFN-y, to a patient prior to, and/or simultaneously with, the administration of the TCR associated with a therapeutic agent may increase levels of peptide-MHC expression on the target cells. This may be of particular benefit in the treatment of cancer. 20 Further embodiments of the invention are provided by a pharmaceutical composition comprising a TCR associated with a therapeutic agent or a multivalent TCR complex thereof together with a pharmaceutically acceptable carrier. The invention also provides a method of treatment of cancer comprising administering 25 to a subject suffering such cancer disease an effective amount of a TCR associated with a therapeutic agent or a multivalent TCR complex thereof. In a related embodiment the invention provides for the use of a TCR associated with a therapeutic agent or a multivalent TCR complex thereof, in the preparation of a composition for the treatment of cancer. IL-15, IL-21 or Anti-CD3 antibody or a functional variant or 30 fragment of the foregoing, are particularly preferred therapeutic agents for use in the treatment of cancer.

WO 2006/037960 PCT/GB2005/003752 - 18 The invention also provides a method of treatment of autoimmune disease, organ rejection or GVHD comprising administering to a subject suffering such an autoimmune disease, organ rejection or GVHD an effective amount of a TCR associated with a therapeutic agent or a multivalent TCR complex thereof. In a related 5 embodiment the invention provides for the use of a TCR associated with a therapeutic agent or a multivalent TCR complex thereof, in the preparation of a composition for the treatment of autoimmune disease, organ rejection or GVHD. Preferred therapeutic agents for use in the treatment of autoinmnune disease, organ rejection or GVHD are IL- 10, IL-4 and IL- 13 or a functional variant or fragment of any of the foregoing. In 10 another related embodiment the dTCR or scTCR of the invention is tissue-specific. In further related embodiment the dTCR or scTCR is specific for a tissue which is a target for auto-reactive T cells in autoimmune disease, organ rejection or Graft Versus Host Disease (GVHD). In a specific embodiment the invention provides a method of treating diabetes, wherein the 15 dTCR or scTCR is islet cell-specific. Cancers which may benefit the methods of the present invention include: leukaemia, head, neck, lung, breast, colon, cervical, liver, pancreatic, ovarian and testicular) 20 Auto-immune diseases which may benefit the methods of the following invention include: Acute disseminated encephalomyelitis Adrenal insufficiency Allergic angiitis and granulomatosis 25 Amylodosis Ankylosing spondylitis Asthma Autoimmune Addison's disease Autoimmune alopecia 30 Autoimmune chronic active hepatitis Autoimmune haemolytic anaemia Autoinimune Neutrogena Autoimmune thrombocytopenic purpura WO 2006/037960 PCT/GB2005/003752 - 19 Behget's disease Cerebellar degeneration Chronic active hepatitis Chronic inflammatory demyelinating polyradiculoneuropathy 5 Chronic neuropathy with monoclonal gammopathy Classic polyarteritis nodosa Congenital adrenal hyperplasia Cryopathies Dermatitis herpetiformis 10 Diabetes Eaton-Lambert myasthenic syndrome Encephalomyelitis Epidern-olysis bullosa acquisita Erytherna nodosa 15 Gluten-sensitive enteropathy Goodpasture's syndrome Guillain-Barre syndrome Hashinioto's thyroiditis Hyperthyroidism 20 Idiopathic hemachromatosis Idiopathic membranous glomerulonephritis Isolated vasculitis of the central nervous system Kawasaki's disease Minimal change renal disease 25 Miscellaneous vasculitides Mixed connective tissue disease Multifocal motor neuropathy with conduction block Multiple sclerosis Myasthenia gravis 30 Opsoclonus-myoclonus syndrome Pemphigoid Pemphigus permicious anaemia WO 2006/037960 PCT/GB2005/003752 - 20 Polymyositis/dennatomyositis Post-infective arthritides Primary biliary sclerosis Psoriasis 5 Reactive arthritides Reiter's disease Retinopathy Rheumatoid arthritis Sclerosing cholangitis 10 Sjigren's syndrome Stiff-man syndrome Subacute thyroiditis Systemic lupus erythenatosis Systemic necrotizing vasculitides 15 Systemic sclerosis (scleroderma) Takayasu's arteritis Temporal arteritis Thromboangiitis obliterans Type I and type II autoimmune polyglandular syndrome 20 Ulcerative colitis Uveitis Wegener's granulomatosis Therapeutic compositions in accordance with the invention will usually be supplied as 25 part of a sterile, pharmaceutical composition which will normally include a pharmaceutically acceptable carrier. This pharmaceutical composition may be in any suitable form, (depending upon the desired method of administering it to a patient). It may be provided in unit dosage form, will generally be provided in a sealed container and may be provided as part of a kit. Such a kit would normally (although not 30 necessarily) include instructions for use. It may include a plurality of said unit dosage forms.

WO 2006/037960 PCT/GB2005/003752 -21 The pharmaceutical composition may be adapted for administration by any appropriate route, for example parenteral, transdermal or via inhalation, preferably a parenteral (including subcutaneous, intramuscular, or, most preferably intravenous) route. Such compositions may be prepared by any method known in the art of pharmacy, for 5 example by mixing the active ingredient with the carrier(s) or excipient(s) under sterile conditions. Dosages of the substances of the present invention can vary between wide limits, depending upon the disease or disorder to be treated, the age and condition of the 10 individual to be treated, etc. and a physician will ultimately determine appropriate dosages to be used. Additional Aspects A scTCR or dTCR associated with a therapeutic agent (which TCR preferably is 15 constituted by constant and variable sequences corresponding to human sequences) may be provided in substantially pure form, or as a purified or isolated preparation. For example, it may be provided in a form which is substantially free of other proteins. Preferred features of each aspect of the invention are as for each of the other aspects 20 mutatis mutandis. The prior art documents mentioned herein are incorporated to the fullest extent permitted by law. Examples The invention is further described in the following examples, which do not limit the 25 scope of the invention in any way. Reference is made in the following to the accompanying drawings in which: Figures 1 a and lb show respectively the nucleic acid sequences of the a and P chains 30 of a soluble A6 TCR, mutated so as to introduce a cysteine codon. The shading indicates the introduced cysteine codon; WO 2006/037960 PCT/GB2005/003752 - 22 Figure 2a shows the A6 TCR a chain extra-cellular amino acid sequence, including the T 48 -> C mutation (underlined) used to produce the novel disulphide inter-chain bond, and Figure 2b shows the A6 TCR P chain extracellular amino acid sequence, including the S 57 -> C mutation (underlined) used to produce the novel disulphide 5 inter-chain bond; Figure 3a shows the A6 TCR a chain sequence including novel cysteine residue mutated to incorporate a BamH1 restriction site. Shading indicates the mutations introduced to form the BamH1 restriction site. 10 Figures 3b and 3c show the DNA sequence of a and P chain of the JM22 TCR mutated to include additional cysteine residues to form a non-native disulphide bond; Figures 4a and 4b show respectively the Jld22 TCR a and P chain extracellular amino 15 acid sequences produced from the DNA sequences of Figures 3b and 3c; Figures 5a and 5b show respectively the DNA sequences of the a and P chains of a soluble AH-1.23 TCR, mutated so as to introduce a novel cysteine codon (indicated 20 by shading). Figures 6a and 6b show respectively the AH-1.23 TCR a and P chain extracellular amino acid sequences produced from the DNA sequences of Figures 5a and 5b; 25 Figure 7a - DNA sequence of mature human IL-10. Figure 7b - Amino acid sequence of mature human IL-10. Figure 8a - DNA sequence of AH1.23 TCR 3 chain containing a non-native cysteine 30 involved in the formation of a novel interchain bond linked to mature human IL-10 via a Pro-Gly linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Pro-Gly linker is underlined.

WO 2006/037960 PCT/GB2005/003752 - 23 Figure 8b - Amino acid sequence of AH1.23 TCR P chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-10 via a Pro-Gly linker. The introduced cysteine is indicated by shading. 5 The Pro-Gly linker is underlined. Figure 9a - DNA sequence of AH1.23 TCR P chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL- 10 via a Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. 10 The DNA sequence encoding the Gly-Ser-Gly-Gly-Pro linker is underlined. Figure 9b - Amino acid sequence of AH1.23 TCR P chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-10 via a Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated 15 by shading. The Gly-Ser-Gly-Gly-Pro linker is underlined. Figure 1 0a - DNA sequence of AH 1.23 TCR P chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL- 10 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker. 20 The introduced cysteine is indicated by shading. The DNA sequence encoding the Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined. Figure 1Ob - Amino acid sequence of AH 1.23 TCR P chain containing a non-native 25 cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-10 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly Pro linker. The introduced cysteine is indicated by shading. The Gly-Ser-Gly-Gly Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is -nderlined. 30 Figure 11 a - DNA sequence of mature human IL-4. Figure 1 lb - Amino acid sequence of mature human IL-4.

WO 2006/037960 PCT/GB2005/003752 - 24 Figure 12a - DNA sequence of AH1.23 TCR P chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-4 via a Pro-Gly linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Pro-Gly linker is underlined. 5 Figure 12b - Amino acid sequence of AH1.23 TCR P chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-4 via a Pro-Gly linker. The introduced cysteine is indicated by shading. The Pro-Gly linker is underlined. 10 Figure 13 a - DNA sequence of AH 1.23 TCR P chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-4 via a Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Gly-Ser-Gly-Gly-Pro linker is underlined. 15 Figure 13b - Amino acid sequence of AHI.23 TCR P chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-4 via a Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The Gly-Ser-Gly-Gly-Pro linker is underlined. 20 Figure 14a - DNA sequence of AH1.23 TCR 3 chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-4 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker. 'The introduced cysteine is indicated by shading. The DNA sequence encoding the Gly 25 Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined. Figure 14b - Amino acid sequence of AH1.23 TCR P chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature 30 human IL-4 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly Pro linker. The introduced cysteine is indicated by shading. The Gly-Ser-Gly-Gly Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined.

WO 2006/037960 PCT/GB2005/003752 - 25 Figure 15a - DNA sequence of mature human IL-13. Figure 15b - Amino acid sequence of mature human IL-13. 5 Figure 16a - DNA sequence of AH1.23 TCR P chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL- 13 via a Pro-Gly linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Pro-Gly linker is underlined. 10 Figure 16b - Amino acid sequence of AHI.23 TCR P chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-13 via a Pro-Gly linker. The introduced cysteine is indicated by shading. The Pro-Gly linker is underlined. 15 Figure 17a - DNA sequence of AH1.23 TCR p chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-13 via a Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Gly-Ser-Gly-Gly-Pro linker is underlined. 20 Figure 17b - Amino acid sequence of AH1.23 TCR P chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-13 via a Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The Gly-Ser-Gly-Gly-Pro linker is underlined. 25 Figure 18a - DNA sequence of AH1.23 TCR P chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-13 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is 30 underlined. Figure 18b - Amino acid sequence of AH1.23 TCR P chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature WO 2006/037960 PCT/GB2005/003752 - 26 human IL-13 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly Pro linker. The introduced cysteine is indicated by shading. The Gly-Ser-Gly-Gly Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined. 5 Figure 19 details the DNA sequence of the pEX821 plasmid. Figure 20 provides a plasmid map of the pEX821 vector, the DNA sequence of which is provided by Figure 19. 10 Figure 21 details the DNA sequence of the pEX954 plasmid. Figure 22 provides a plasmid map of the pEX954 plasmid, the DNA sequence of which is provided by Figure 21. 15 Figure 23a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain and Figure 23b details the AA sequence encoded by the DNA sequence of Figure 23a. Figure 24a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR 20 beta chain linked at the C-terminus thereof via a peptide linker to IL-18. Figure 24b details the AA sequence of this fusion protein, the peptide linker is underlined. Figure 25 a details the DNA sequence encoding IL-18 pro-protein linked at the C terminus thereof via a peptide linker to the high affinity c61 NY-ESO MTCR beta 25 chain. The pro-IL- 18 DNA has been altered to encode a Factor X cleavage site. Figure 25b details the AA sequence of this fusion protein, the peptide linker is underlined. Figure 26a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR 30 beta chain linked at the C-terminus thereof via a peptide linker to IL-10. Figure 26b details the AA sequence of this fusion protein, the peptide linker is underlined.

WO 2006/037960 PCT/GB2005/003752 - 27 Figure 27a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-13. Figure 27b details the AA sequence of this fusion protein, the peptide linker is underlined. 5 Figure 28a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to the "KDEL" variant of the PE38 exotoxin. Figure 28b details the AA sequence of this fusion protein, the peptide linker is underlined. 10 Figure 29a details the DNA sequence encoding the high affinity c58 NY-ESO MTCR alpha chain and Figure 29b details the AA sequence encoded by the DNA sequence of Figure 29a. Example 1 - Design ofprimers and mutagenesis ofA6 Tax TCR a and , chains 15 For mutating A6 Tax threonine 48 of exon 1 in TRAC*01to cysteine, the following primers were designed (mutation shown in lower case): 5'-C ACA GAC AAA tgT GTG CTA GAC AT (SEQ ID NO: 3) 20 5'-AT GTC TAG CAC Aca TTT GTC TGT G (SEQ ID NO: 4) For mutating A6 Tax seine 57 of exon 1 in both TRBC1*01 and TRBC2*01 to cysteine, the following primers were designed (mutation shown in lower case): 25 5'-C AGT GGG GTC tGC ACA GAC CC (SEQ ID NO: 5) 5'-GG GTC TGT GCa GAC CCC ACT G (SEQ ID NO: 6) PCR mutagenesis: Expression plasmids containing the genes for the A6 Tax TCR a or P chain were 30 mutated using the a-chain primers or the p-chain primers respectively, as follows. 100 ng of plasmid was mixed with 5 d 10 mM dNTP, 25 pl 10xPfu-buffer (Stratagene), 10 units Pfu polymerase (Stratagene) and the final volume was adjusted WO 2006/037960 PCT/GB2005/003752 -28 to 240 [l with H 2 0. 48 pl of this mix was supplemented with primers diluted to give a final concentration of 0.2 [M in 50 pl final reaction volume. After an initial denaturation step of 30 seconds at 95'C, the reaction mixture was subjected to 15 rounds of denaturation (95'C, 30 sec.), annealing (55'C, 60 sec.), and elongation 5 (73'C, 8 min.) in a Hybaid PCR express PCR machine. The product was then digested for 5 hours at 37'C with 10 units of DpnI restriction enzyme (New England Biolabs). 10 pl of the digested reaction was transformed into competent XL1-Blue bacteria and grown for 18 hours at 37'C. A single colony was picked and grown over night in 5 ml TYP + ampicillin (16 g/l Bacto-Tryptone, 16 g/l Yeast Extract, 5 g/l 10 NaCl, 2.5 g/l K 2

HPO

4 , 100 mg/l Ampicillin). Plasmid DNA was purified on a Qiagen mini-prep column according to the manufacturer's instructions and the sequence was verified by automated sequencing. The respective mutated nucleic acid and amino acid sequences are shown in Figures la and 2a for the cc chain and Figures lb and 2b for the P chain. 15 Example 2 - Expression, refolding and purification of soluble TCR The expression plasmids containing the mutated a-chain and p-chain respectively were transformed separately into E.coli strain BL21pLysS, and single ampicillin 20 resistant colonies were grown at 37 0 C in TYP (ampicillin 100tg/ml) medium to

OD

600 of 0.4 before inducing protein expression with 0.5mM IPTG. Cells were harvested three hours post-induction by centrifugation for 30 minutes at 4000rpm in a Beckman J-6B. Cell pellets were re-suspended in a buffer containing 50mM Tris HCI, 25% (w/v) sucrose, 1mM NaEDTA, 0.1% (w/v) NaAzide, 10mM DTT, pH 8.0. 25 After an overnight freeze-thaw step, re-suspended cells were sonicated in 1 minute bursts for a total of around 10 minutes in a Milsonix XL2020 sonicator using a standard 12mm diameter probe. Inclusion body pellets were recovered by centrifugation for 30 minutes at 13000rpm in a Beckman J2-21 centrifuge. Three detergent washes were then carried out to remove cell debris and membrane 30 components. Each time the inclusion body pellet was homogenised in a Triton buffer (50mM Tris-HCI, 0.5% Triton-X100, 200mM NaCI, 10mM NaEDTA, 0.1% (w/v) NaAzide, 2mM DTT, pH 8.0) before being pelleted by centrifugation for 15 minutes WO 2006/037960 PCT/GB2005/003752 - 29 at 13000rpm in a Beckman J2-21. Detergent and salt was then removed by a similar wash in the following buffer: 50mM Tris-HC1, 1mM NaEDTA, 0.1% (w/v) NaAzide, 2mM DTT, pH 8.0. Finally, the inclusion bodies were divided into 30 mg aliquots and frozen at -70'C. Inclusion body protein yield was quantitated by solubilising with 5 6M guanidine-HCl and measurement with a Bradford dye-binding assay (PerBio). Denaturation of soluble TCRs; 30mg of the solubilised TCR -chain inclusion body and 60mg of the solubilised TCR a-chain inclusion body was thawed from frozen stocks. The inclusion bodies were diluted to a final concentration of 5mg/ml in 6M 10 guanidine solution, and DTT (2M stock) was added to a final concentration of 10mM. The mixture was incubated at 37'C for 30 min. Refolding of soluble TCRs: 1 L refolding buffer was stirred vigorously at 5'C 3 3C. The redox couple (2-mercaptoethylamine and cystamine (to final concentrations of 6.6mM and 3.7mM, respectively) were added approximately 5 minutes before 15 addition of the denatured TCR chains. The protein was then allowed to refold for approximately 5 hours ± 15 minutes with stirring at 5 0 C 3 3C. Dialysis of refolded soluble TCRs: The refolded TCR was dialysed in Spectrapor 1 membrane (Spectrum; Product No. 132670) against 10 L 10 mM Tris pH 8.1 at 5'C 3C for 18-20 hours. After this time, the dialysis buffer was changed to fresh 10 mM 20 Tris pH 8.1 (10 L) and dialysis was continued at 5'C ± 3C for another 20-22 hours. Example 3 - BIAcore surface plasmon resonance characterisation of sTCR binding to specific pMHC 25 A surface plasmon resonance biosensor (BIAcore 3000TM ) was used to analyse the binding of a sTCR to its peptide-MHC ligand. This was facilitated by producing single pMHC complexes (described below) which were immobilised to a streptavidin coated binding surface in a semi-oriented fashion, allowing efficient testing of the binding of a soluble T-cell receptor to up to four different pMHC (immobilised on 30 separate flow cells) simultaneously. Manual injection of HLA complex allows the precise level of immobilised class I molecules to be manipulated easily.

WO 2006/037960 PCT/GB2005/003752 -30 Such immobilised complexes are capable of binding both T-cell receptors and the coreceptor CD8axax, both of which may be injected in the soluble phase. Specific binding of TCR is obtained even at low concentrations (at least 40jig/ml), implying the TCR is relatively stable. The pMHC binding properties of sTCR are observed to 5 be qualitatively and quantitatively similar if sTCR is used either in the soluble or immobilised phase. This is an important control for partial activity of soluble species and also suggests that biotinylated pMHC complexes are biologically as active as non-biotinylated complexes. 10 Biotinylated class I HLA-A2 - peptide complexes were refolded in vitro from bacterially-expressed inclusion bodies containing the constituent subunit proteins and synthetic peptide, followed by purification and in vitro enzymatic biotinylation (O'Callaghan et al. (1999) Anal. Biochem. 266: 9-15). HLA-heavy chain was expressed with a C-terminal biotinylation tag which replaces the transmembrane and 15 cytoplasmic domains of the protein in an appropriate construct. Inclusion body expression levels of ~75 mg/litre bacterial culture were obtained. The HLA light chain or P2-microglobulin was also expressed as inclusion bodies in E.coli from an appropriate construct, at a level of -500 mg/litre bacterial culture. 20 E. coli cells were lysed and inclusion bodies are purified to approximately 80% purity. Protein from inclusion bodies was denatured in 6 M guanidine-HCl, 50 mM Tris pH 8.1, 100 rnaM NaCl, 10 mM DTT, 10 mM EDTA, and was refolded at a concentration of 30 mg/litre heavy chain, 30 mg/litre p2m into 0.4 M L-Arginine-HC1, 100 mM Tris pH 8.1, 3.7 mM cystamine, mM cysteamine, 4 mg/ml peptide (e.g. tax 11-19), by 25 addition of a single pulse of denatured protein into refold buffer at < 5"C. Refolding was allowed to reach completion at 4'C for at least 1 hour. Buffer was exchanged by dialysis in 10 volumes of 10 mM Tris pH 8.1. Two changes of buffer were necessary to reduce the ionic strength of the solution sufficiently. The 30 protein solution was then filtered through a 1.5tm cellulose acetate filter and loaded onto a POROS 50HQ anion exchange column (8 ml bed volume). Protein was eluted with a linear 0-500 mM NaCl gradient. HLA-A2-peptide complex eluted at WO 2006/037960 PCT/GB2005/003752 -31 approximately 250 mM\4 NaCl, and peak fractions were collected, a cocktail of protease inhibitors (Calbiochem) was added and the fractions were chilled on ice. Biotinylation tagged HLA complexes were buffer exchanged into 10 mM Tris pH 8.1, 5 5 nMl\4 NaCl using a Pharmacia fast desalting column equilibrated in the same buffer. Immediately upon elution, the protein-containing fractions were chilled on ice and protease inhibitor cocktail (Calbiochem) was added. Biotinylation reagents were then added: 1 mM biotin, 5 mM ATP (buffered to pH 8), 7.5 mM MgCl2, and 5 pig/ml BirA enzyme (purified according to O'Callaghan et al. (1999) Anal. Biochem. 266: 9 10 15). The mixture was then allowed to incubate at room temperature overnight. Biotinylated HLA complexes were purified using gel filtration chromatography. A Pharmacia Superdex 75 HR 10/30 column was pre-equilibrated with filtered PBS and 1 ml of the biotinylation reaction mixture was loaded and the column was developed 15 with PBS at 0.5 ml/min. Biotinylated HLA complexes eluted as a single peak at approximately 15 ml. Fractions containing protein were pooled, chilled on ice, and protease inhibitor cocktail was added. Protein concentration was determined using a Coomassie-binding assay (PerBio) and aliquots of biotinylated HLA complexes were stored frozen at -20*C. Streptavidin was immobilised by standard amine coupling 20 methods. The interactions between A6 Tax sTCR containing a novel inter-chain bond and its ligand/ MHC complex or an irrelevant HLA-peptide combination, the production of which is described above, were analysed on a BlAcore 3000TM surface plasmon 25 resonance (SPR) biosensor. SPR measures changes in refractive index expressed in response units (RU) near a sensor surface within a small flow cell, a principle that can be used to detect receptor ligand interactions and to analyse their affinity and kinetic parameters. The probe flow cells were prepared by immobilising the individual HLA peptide complexes in separate flow cells via binding between the biotin cross linked 30 onto P2m and streptavidin which have been chemically cross linked to the activated surface of the flow cells. The assay was then performed by passing sTCR over the surfaces of the different flow cells at a constant flow rate, measuring the SPR response in doing so. Initially, the specificity of the interaction was verified by WO 2006/037960 PCT/GB2005/003752 - 32 passing sTCR at a constant flow rate of 5 pl min-1 over two different surfaces; one coated with -5000 RU of specific peptide-HLA complex, the second coated with -5000 RU of non-specific peptide-HLA complex. Injections of soluble sTCR at constant flow rate and different concentrations over the peptide-HLA complex were 5 used to define the background resonance. The values of these control measurements were subtracted from the values obtained with specific peptide-HLA complex and used to calculate binding affinities expressed as the dissociation constant, Kd (Price & Dwek, Principles and Problems in Physical Chernistry for Biochemists ( 2 nd Edition) 1979, Clarendon Press, Oxford). 10 The Kd value obtained (1.8pM) is close to that reported for the interaction between A6 Tax sTCR without the novel di-sulphide bond and pMHC (0.91 [M - Ding et al, 1999, Immunity 11:45-56). 15 Example 4 - Production of soluble JM22 TCR containing a novel disulphide bond. The P chain of the soluble A6 TCR prepared in Example 1 contains in the native sequence a BglII restriction site (AAGCTT) suitable for use as a ligation site. 20 PCR mutagenesis was carried as detailed below to introduce a BamH1 restriction site (GGATCC) into the c chain of soluble A6 TCR, 5' of the novel cysteine codon. The sequence described in Figure la was used as a template for this mutagenesis. The following primers were used: 25 JBamHI 1 5 ' -ATATCCAGAACCCgGAtCCTGCCGTGTA- 3 ' (SEQ ID NO: 7) 5' -TACACGGCAGGAaTCcGGGTTCTGGATAT-3' (SEQ ID NO: 8) 100 ng of plasmid was mixed with 5 p1 10 mM dNTP, 25 pl 1 OxPfu-buffer 30 (Stratagene), 10 units Pfu polymerase (Stratageae) and the final volume was adjusted to 240 pl with H 2 0. 48 pl of this mix was supplemented with primers diluted to give a final concentration of 0.2 piM in 50 pl final reaction volume. After an initial WO 2006/037960 PCT/GB2005/003752 - 33 denaturation step of 30 seconds at 95'C, the reaction mixture was subjected to 15 rounds of denaturation (95'C, 30 sec.), annealing (55'C, 60 sec.), and elongation (73 C, 8 min.) in a Hybaid PCR express PCR machine. The product was then digested for 5 hours at 37'C with 10 units of DpnI restriction enzyme (New England 5 Biolabs). 10 pl of the digested reaction was transformed into competent XL1 -Blue bacteria and grown for 18 hours at 37 0 C. A single colony was picked and grown over night in 5 ml TYP + ampicillin (16 g/l Bacto-Tryptone, 16 g/l Yeast Extract, 5 g/l NaCl, 2.5 g/l K 2

HPO

4 , 100 mg/i Ampicillin). Plasmid DNA was purified on a Qiagen mini-prep column according to the manufacturer's instructions and the sequence was 10 verified by automated sequencing. The mutations introduced into, the a chain were "silent", therefore the amino acid sequence of this chain remained unchanged from that detailed in Figure 2a. The DNA sequence for the mutated a chain is shown in Figure 3a. 15 In order to produce a soluble JM22 TCR incorporating a novel disulphide bond, A6 TCR plasmids containing the a chain BamH1 and P chain BglII restriction sites were used as templates. The following primers were used: I Ndel 20 5' -GGAGATATACATATGCAACTACTAGAACAA-3' (SEQ ID NO: 9) 5 ' -TACACGGCAGGATCCGGGTTCTGGATATT-3 '(SEQ ID NO: 10) I BamHI 25 INdel I 5' -GGAGATATACATATGGTGGATGGTGGAATC-3' (SEQ ID NO: 11) 5' -CCCAAGCTTAGTCTGCTCTACCCCAGGCCTCGGC-3' (SEQ ID NO: 12) I Bg1ii 1 30 JM22 TCR a and p-chain constructs were obtained by PCR cloning as follows. PCR reactions were performed using the primers as shown above, and templates containing the JM22 TCR chains. The PCR products were restriction digested with the relevant restriction enzymes, and cloned into pGMT7 to obtain expression plasmids. The sequence of the plasmid inserts were confirmed by automated DNA WO 2006/037960 PCT/GB2005/003752 -34 sequencing. Figures 3b and 3c show the DNA sequence of the mutated a and P chaixis of the JM22 TCR respectively, and Figures 4a and 4b show the resulting amino acid sequences. 5 The respective TCR chains were expressed, co-refolded and purified as described in Examples 1 and 2. A Biacore analysis of the binding of the JM22 TCR to pMHC was carried out as described in Example 3. The Kd of this disulphide-linked TCR for the HLA-flu 10 complex was determined to be 7.9 ± 0.5 1pjM Example 5 - Production of soluble AH-1.23 TCR containing a novel disulphide inter chain bond 15 cDNA encoding AH-1.23 TCR was isolated from T cells supplied by Hill Gaston (Medical School, Addenbrooke's Hospital, Cambridge) according to known techniques. cDNA encoding NY-ESO TCR was produced by treatment of the mRNA with reverse transcriptase. 20 In order to produce a soluble AH-1.23 TCR incorporating a novel disulphide bond, TCR plasmids containing the ac chain BamHI and P chain BglII restriction sites were used as a framework as described in Example 4. The following primers were used: I NdeI 1 25 5' -- GGGAAGCTTACATATGAAGGAGGTGGAGCAGAATTCTGG-3 ' (SEQ ID NO: 13) 5' -TACACGGCAGGATCCGGGTTCTGGATATT-3 ' (SEQ ID NO: 14) I BamHI Nde I 30 5' -TTGGAATTCACATATGGGCGTCATGCAGAACCCAAGACAC-3 (SEQ ID NO: 15) 5' -CCCAAGCTTAGTCTGCTCTACCCCAGGCCTCGGC-3 ' (SEQ ID NO: 16) IBgiIII WO 2006/037960 PCT/GB2005/003752 - 35 AH-1.23 TCR a and p-chain constructs were obtained by PCR cloning as follows. PCR reactions were performed using the primers as shown above, and templates containing the AH-1.23 TCR chains. The PCR products were restriction digested with the relevant restriction enzymes, and cloned into pGMT7 to obtain expression 5 plasmids. The sequence of the plasmid inserts were confirmed by automated DNA sequencing. Figures 5a and 5b show the DNA sequence of the mutated a and P chains of the AH-1.23 TCR respectively, and Figures 6a and 6b show the resulting amino acid sequences. 10 The respective TCR chains were expressed, co-refolded and purified as described in Example 2. Example 6 - Production of a soluble A H- .23 TCR - IL-10 fusion protein. 15 Synthetic genes including the mature human IL-10 DNA sequence detailed in Figure 7a and one of a number of DNA extensions at the 5' end of the IL- 10 DNA sequence can then be produced. The 5' DNA extensions are linker sequences used to attach the IL-10 DNA to that encoding the AH1.23 TCR P chain. 20 Linker sequences: cccggz - which encodes a Pro-Gly linker including a Xmal restriction enzyme site gateeggcggtccg - (SEQ ID NO: 17) which encodes a Gly-Ser-Gly-Gly-Pro (SEQ ID NO: 18) linker including a BamH1 restriction enzyme site. 25 ggateggtgggggcggaagtggaggcageggtegatccggcggtccg - (SEQ ID NO:19) which encodes a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro (SEQ ID NO: 20) linker including two BamH1 restriction enzyme sites. One of the above synthetic genes is then sub-cloned into the pGMT7 plasmid 30 containing the AH1.23 TCR P chain, produced as described in Example 5 to form a DNA sequence encoding the TCR P chain-linker-IL-10 fusion protein.

WO 2006/037960 PCT/GB2005/003752 - 36 The DNA and amino acid sequence of the AHI.23 TCR P chain - Pro-Gly - IL- 10 fusion is detailed in Figures 8a and 8b respectively. The DNA and amino acid sequence of the AH1.23 TCR P chain - Gly-Ser-Gly-Gly 5 Pro (SEQ ID NO: 18) - IL-10 fusion is detailed in Figures 9a and 9b respectively. The DNA and amino acid sequence of the AH1.23 TCR P chain - Gly-Ser-Gly-Gly Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly -Pro- (SEQ ID NO: 20) IL- 10 fusion is detailed in Figures 1 Oa and 1 Ob respectively. 10 These AH1.23 TCR P chain - Linker- IL-10 fusion proteins are then refolded with the AH1.23 TCR a chain using the methods detailed in Example 2 to produce the complete soluble AH1.23 TCR-IL-10 fusion protein. 15 The methods detailed above describe the production of a soluble apTCR onto which an IL-10 monomer is attached to the C-terminus of the TCR P chain. IL-10 is often found in the form of a homodimer. Therefore, it may be advantageous to dimerise the IL-10 polypeptide attached to the soluble AH1.23 TCR. This can be achieved in a number of ways. For example, a single-chain version of the mature form human IL-10 20 homodimer can be fused to the TCR p prior to refolding with the TCR a chain. Alternatively, mature form human IL-10 can be added in solution to either the TCR Chain-IL-10 fusion proteins formed as described above prior to refolding with the soluble TCR a chain, or to the refolded apTCR-IL-10 fusion proteins. Alternatively, an additional IL-10 molecule can be added to the TCR a chain as a fusion protein 25 using the methods described in this example for the production of the TCR P chain IL- 10 fusion protein. The two TCR chain-IL- 10 fusion proteins can then be re-folded together using the methods described in Example 2. Finally, complexes comprising two TCR, each containing a single IL-10 polypeptide linked to the TCR P chain, may be formed by homo-dimerisation of the IL-10 polypeptides. This would result in the 30 formation of a complex of the following type: apTCR-IL-10 homodimer-apTCR WO 2006/037960 PCT/GB2005/003752 - 37 Example 7- Production of soluble AH-1.23 TCR - IL-4 and AH-1.23 TCR - IL-13 fusion proteins. The methods detailed in Example 6 can also be used to produce fusion proteins 5 containing the soluble AH-1.23 TCR linked to other polypeptides. Synthetic genes including the mature human IL-4 DNA sequence detailed in Figure 11 a and one of the 5' DNA extension sequences listed in Example 6 can be constructed and sub-cloned into the pGMT7 plasmid containing the AH1.23 TCR P 10 chain, produced as described in Example 5 to form a DNA sequence encoding the TCR P chain-linker- IL-4 fusion proteins. The DNA and amino acid sequence of the AH1.23 TCR P chain - Pro-Gly - IL-4 fusion is detailed in Figures 12a and 12b respectively. 15 The DNA and amino acid sequence of the AH1.23 TCR P chain - Gly-Ser-Gly-Gly Pro- (SEQ ID NO: 18) - IL-4 fusion is detailed in Figures 13a and 13b respectively. The DNA and amino acid sequence of the AH1.23 TCR P chain - Gly-Ser-Gly-Gly 20 Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro-(SEQ ID NO: 20)- IL-4 fusion is detailed in Figures 14a and 14b respectively. Synthetic genes including the mature human IL-13 DNA sequence detailed in Figure 15a and one of the 5' DNA extension sequences listed in Example 6 can be 25 constructed and sub-cloned into the pGMT7 plasmid containing the AH1.23 TCR P chain, produced as described in Example 5 to form a DNA sequence encoding the TCR P chain-linker- IL-4 fusion proteins. The DNA and amino acid sequence of the AH1.23 TCR p chain - Pro-Gly - IL-13 30 fusion is detailed in Figures 16a and 16b respectively. The DNA and amino acid sequence of the AH1.23 TCR p chain - Gly-Ser-Gly-Gly Pro (SEQ ID NO: 18)- IL-13 fusion is detailed in Figures 17a and 17b respectively.

WO 2006/037960 PCT/GB2005/003752 - 38 The DNA and amino acid sequence of the AHI.23 TCR 3 chain - Gly-Ser-Gly-Gly Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro- (SEQ ID NO: 20)- IL-13 fusion is detailed in Figures 18a and 18b respectively. 5 These AH1.23 TCR P chain - Linker- interleukin fusion proteins are then refolded with the AH1.23 TCR a chain using the methods detailed in Example 2 to produce the complete soluble AH1.23 TCR-interleukin fusion protein. 10 Example 10 - Thymidine incorporation assay for assessing the ability of AH1.23 TCR-IL-10 fusion proteins to cause Mast cell proliferation. 5 x10 6 cells of the D36 murine mast cell line which proliferates in response to human IL-10 in the presence of IL-4 are cultured in RPMI 1640 medium. 15 A range (0, 0.01, 0.1, 0.5 and 1pM of the AH1.23 TCR-IL-10 fusion protein prepared as described in Example 9 and IL-4 are added to the above culture. (Schlaak et al., (1994) J Immunological Methods 168 49-54) 20 1.85 MBq / ml of H 3 Thymidine is then added to 1 x 10 5 cells of the above culture in a 96 well plate. These cultures are then incubated for a further 8 hours at 37'C, 5% Co 2 . The cells are harvested using a cell-harvester, and the level of thymidine incorporation into the cells is measured using a Top Count p counter. 25 A reduction in thymidine incorporation into the D36 cells in the presence of the AH1.23 TCR-IL-10 fusion protein, compared to that seen in the absence of the fusion protein indicates that the IL-10 part of the fusion protein is active and causing D36 mast cell proliferation. 30 Example 11 -Preparation of high affinity NY-ESO MTCR - therapeutic agent fusion proteins.

WO 2006/037960 PCT/GB2005/003752 - 39 Synthetic genes comprising the DNA sequence encoding the soluble high affinity c61 NY-ESO TCR P chain detailed in Figure 23a linked via a DNA sequence encoding a peptide linker to DNA encoding a number of imunomodulaotory agents were synthesised: 5 There are a number of companies that provide a suitable DNA service, such as Geneart (Germany) Figure 24a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR 10 beta chain linked at the C-terminus thereof via a peptide linker to IL-18. Figure 24b details the AA sequence of this fusion protein, the peptide linker is underlined. Figure 25a details the DNA sequence encoding IL-18 pro-protein linked at the C terminus thereof via a peptide linker to the high affinity c61 NY-ESO MTCR beta 15 chain. The pro-IL- 18 DNA sequence has been altered to encode a Factor X cleavage site which facilitates post translation removal of the amino acids within the pro sequence. Figure 25b details the AA sequence of this fusion protein, the peptide linker is underlined. 20 Figure 26a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-10. Figure 26b details the AA sequence of this fusion protein, the peptide linker is underlined. Figure 27a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR 25 beta chain linked at the C-terminus thereof via a peptide linker to IL-13. Figure 27b details the AA sequence of this fusion protein, the peptide linker is underlined. Figure 28a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to the "KDEL" variant 30 of the PE38 exotoxin. Figure 28b details the AA sequence of this fusion protein the peptide linker is underlined.

WO 2006/037960 PCT/GB2005/003752 - 40 The DNA sequences above c61 NY-ESO TCR beta chain can be ligated into the pEX821 vector. (See Figures 19 and 20 for the DNA sequence and plasmid map of this vector respectively) 5 Disulfide-linked apTCR-therapeutic agents are then produced following the methods substantially as described in Example 2. Briefly, DNA encoding the high affinity c61 NY-ESO alpha chain detailed in Figure 29a is synthesised and ligated into the pEX954 vector. (See Figures 21 and 22 for the DNA sequence and plasmid map of this vector respectively) The TCR beta chain fusion proteins described above are then 10 refolded in the presence of the c61 NY-ESO TCR alpha chain. Figure 29a details the DNA sequence encoding the high affinity c58 NY-ESO MTCR alpha chain and Figure 29b details the AA sequence encoded by the DNA sequence of Figure 29a. 15 Example 12 -MTCR-PE-38 fusion protein cytotoxicity assay. 1x10~6 of the required target cells (e.g. SK-MEL tumour cells or J82 cells) were suspended in 10 ml RPMI media + 10% fetal calf serum (FCS). If required the target 20 cells were then pulsed with 10 gM of cognate peptide for 2 hours at 37'C. The samples were then washed three times in RPMI + 10% FCS, centrifuging at 1200 rpm for 5 min in between each wash. The washed cells were then re-counted and re suspended in the appropriate volume of RPMI + 10% FCS media to provide a final cell density of 2 x 105 cells/ml. 25 The MTCR-PE38 fusion proteins prepared as described in Example 11 were diluted in RPMI media + 10% FCS to a final concentration of 2 x 10-6 M to provide a working standard. This working standard was then used to prepare a set of serial dilutions. 30 Preparation of experimental and control samples in microtitre plate wells: WO 2006/037960 PCT/GB2005/003752 -41 Experimental sample wells were filled with 50 pl mTCR-PE38 in media and 50 tl cells in medium. To produce a total volume of 100 [1 in 96 well flat bottom white opaque walled plates (Nunc 136101). The mTCR-PE38 serial dilutions prepared above were used to provide a range of mTCR-PE38 concentrations in these wells. 5 Control sample wells were prepared using either 100 pl of cells (cell-only controls) or 100 [1 of mTCR-PE38 and media (effector-only controls). The experimental and control samples were then incubated at 37"C, 5% CO 2 for 48 or 10 96 hours. The number of viable cells remaining in each well was then assessed using a CellTiter-Glo* Luminescent assay (Promega Cat No: G7572) following the manufacturers instructions. Results 15 Figures 30a and 30b demonstrate that the NY-ESO* SK-MEL 37 and Mel 624 tumour cell lines can be killed by the 1G4 MTCR-PE38 fusion protein. EC50 values for the effect of the 1G4 MTCR-PE38 fusion protein on the SK-MEL 37 20 and Mel 624 tumour cell lines after 48 hours incubation of 5.9 x 10~' and 1 x 10~' M respectively were calculated from the data presented in Figure 30a. EC50 values for the effect of the 1G4 MTCR-PE38 fusion protein on the SK-MEL 37 and Mel 624 tumour cell lines after 96 hours incubation of 5.7 x 10~' and 2.1 x 10~' M 25 respectively were calculated from the data presented in Figure 30b. The results provided by Figures 30a and 30b both demonstrate that pulsing the J82 target cells with the cognate SLLMWITQC NY-ESO peptide leads to more efficient killing of these cells by the NY-ESO TCR-PE38 construct compared to that observed 30 with unpulsed J82 target cells.

Claims (37)

1. A dimeric TCR (dTCR) or single-chain TCR (scTCR) associated with a therapeutic agent, wherein said agent is selected from IL-1, IL-la, IL-3, IL-4, IL-5, 5 IL-6, IL-7, IL-10, IL-11, IL-12, IL-13, IL-15, IL-21, IL-23, TGF-6, IFN-y, Lymphotoxin, TNFa, Anti-CD2 antibody, Anti-CD3 antibody, Anti-CD4 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti-CD45RA antibody, Anti-CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 antibody, Antilymphocyte globulin, Anti-apTCR antibody, Anti-y6TCR antibody, Anti-CD49a antibody, Anti-CD49b 10 antibody, Anti-CD49c antibody,Anti-CD49d antibody,Anti-CD49e antibody,Anti CD49f antibody, Anti-TCR V38 antibody, Anti-CD 16 antibody, Anti-CD28 antibody, CTLA-4-Ig, Anti-B7.2 antibody, Anti-CD40L antibody, Anti-ICAM-1 antibody, ICAM-1, Anti-Mac antibody, Anti-LFA-1 antibody, Anti-IFN-y antibody IFN-y, IFN yR/IgG1 fusions, Anti-IL-2R antibodies, IL-2R antibody, IL-2 Diptheria-toxin 15 protein, Anti-IL-12 antibody, IL-12 Antagonist (p40), Anti-IL-1 antibody, IL-1 Antagonist, Glutamic acid decarboxylase (GAD), Anti-GAD antibody, Viral proteins and peptides, Bacterial proteins or peptides, A-Galactosyl-ceramide, Calcitonin, Nicotinamide, Anti-oxidants (Vitamin E, Probucol analog, Probucol + deflazacoert or Aminoguanidine), Anti-Inflammatory agents (Pentoxifylline or Rolipram), 20 Immunomodulators (Linomide, Ling-zhi-8, D-Glucan, Multi-functional protein 14, Ciamexon, Cholera toxin B, Vanadate or Vitamin D3 analogue, small molecule CD80 inhibitors, Androgens, IGF-I, Immunomanipulation (Natural antibodies), Lupus idiotype, Lipopolysaccaride), Sulfatide, Bee venom, Kampo formulation, Silica, Ganglioside, Antiasialo GM-1 antibody, Hyaluronidase, Concanavalin A, Anti-Class 25 I MHC antibody, or Anti-Class II MHC antibody, Cyclosporin, FK-506, Azathioprine, Rapamycin or Deoxyspergualin, PE38 Pseudomonas exotoxin, and wherein said TCR comprises a first segment constituted by an amino acid sequence corresponding to a TCR a 30 chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR a chain constant domain extracellular sequence, WO 2006/037960 PCT/GB2005/003752 - 43 a second segment constituted by an amino acid sequence corresponding to a TCR P chain variable domain fused to the N terminus of an amino acid sequence corresponding to TCR P chain constant domain extracellular sequence, 5 a disulfide bond between the first and second chains, said disulfide bond being one which has no equivalent in native cpT cell receptors, and in the case of said scTCRs further comprising a linker sequence linking the C terminus of the first segment to the N terminus of the second segment, or vice versa, 10 the length of the linker sequence and the position of the disulfide: bond being such that the variable domain sequences of the first and second segments are mutually orientated substantially as in native up T cell receptors.

2. A dTCR or scTCR associated with a therapeutic agent, as claimed in claim 1, 15 wherein the therapeutic agent is selected from IL-1, IL-la, IL-3, IL-5, IL-6, IL-7, IL 11, IL- 12, TGF-, Lymphotoxin, TNFa, Anti-CD2 antibody, Aiti-CD4 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti-CD45RA antibody, Anti-CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 antibody, Antilymphocyte globulin, Anti-apTCR antibody, Anti-ySTCR antibody, Anti-CD49a antibody, Anti-CD49b 20 antibody, Anti-CD49c antibody,Anti-CD49d antibody,Anti-CD49e antibody,Anti CD49f antibody, Anti-TCR Vp8 antibody, Anti-CD16 antibody, Anti-CD28 antibody, CTLA-4-Ig, Anti-B7.2 antibody, Anti-CD40L antibody, Anti-ICAM-1 antibody, ICAM-1, Anti-Mac antibody, Anti-LFA-1 antibody, Anti-IFN-y antibody IFN-y, IFN yR/IgG1 fusions, Anti-IL-2R antibodies, IL-2R antibody, IL-2 Diptheria-toxin 25 protein, Anti-IL-12 antibody, IL-12 Antagonist (p40), Anti-IL-1 antibody, IL-1 Antagonist, Glutamic acid decarboxylase (GAD), Anti-GAD antibody, Viral proteins and peptides, Bacterial proteins or peptides, A-Galactosyl-ceraniide, Calcitonin, Nicotinamide, Anti-oxidants (Vitamin E, Probucol analog, Probucol + deflazacoert or Aminoguanidine), Anti-Inflammatory agents (Pentoxifylline or Rolipram), 30 Immunomodulators (Linomide, Ling-zhi-8, D-Glucan, Multi-functional protein 14, Ciamexon, Cholera toxin B, Vanadate or Vitamin D3 analogue, small molecule CD80 inhibitors, Androgens, IGF-i, Inmunomanipulation (Natural antibodies), Lupus WO 2006/037960 PCT/GB2005/003752 -44 idiotype, Lipopolysaccaride), Sulfatide, Bee venom, Kampo formulation, Silica, Ganglioside, Antiasialo GM-1 antibody, Hyaluronidase, Concanavalin A, Anti-Class I MHC antibody, or Anti-Class II MHC antibody, Cyclosporin, FK-506, Azathioprine, Rapamycin or Deoxyspergualin. 5

3. A dTCR or scTCR associated with a therapeutic agent, as claimed in clain1 1, wherein the therapeutic agent is one of IL-10, IL-4 or IL-13.

4. A dTCR or scTCR associated with a therapeutic agent as claimed in any 10 preceding claim, wherein the dTCR or scTCR is tissue-specific.

5. A dTCR or scTCR associated with a therapeutic agent, as claimed in clain1 4, wherein the dTCR or scTCR is specific for a tissue which is a target for auto-reactive T cells in autoimmune disease, organ rejection or Graft Versus Host Disease 15 (GVHD).

6. A dTCR or scTCR associated with a therapeutic agent, as claimed in claincis 4 or 5, wherein the dTCR or scTCR is islet cell-specific. 20

7. A dTCR or scTCR associated with a therapeutic agent as claimed in claim 1, wherein the therapeutic agent consists of one of IL-15, IL-21, IL-23, PE38 Pseudomonas exotoxin, IFN-y or Anti-CD3 antibody.

8. A dTCR associated with a therapeutic agent as claimed in any preceding 25 claim.

9. An scTCR associated with a therapeutic agent as claimed in any preceding; claim. 30

10. An scTCR associated with a therapeutic agent, as claimed in claim 9 wherein the linker sequence links the C terminus of the first segment to the N terminus of the second segment. WO 2006/037960 PCT/GB2005/003752 - 45

11. A scTCR associated with a therapeutic agent, as claimed in claim 9 wherein the linker sequence has the formula -PGGG-(SGGGG),-P- wherein n is 5 or 6 and P is proline, G is glycine and S is serine. 5

12. A dTCR associated with a therapeutic agent, as claimed in claim 8 which is a dTCR comprising a first polypeptide wherein a sequence corresponding to a TCR a chain variable domain sequence is fused to the N terminus of a sequence corresponding to a TCR c chain constant domain extracellular sequence, and 10 a second polypeptide wherein a sequence corresponding to a TCR Pchain variable domain sequence fused to the N terminus a sequence corresponding to a TCR P chain constant domain extracellular sequence, 15 the first and second polypeptides being linked by a disulfide bond which has no equivalent in native cp T cell receptors.

13. A TCR associated with a therapeutic agent, as claimed in claim 8 which is a dTCR comprising 20 a first polypeptide wherein a sequence corresponding to a TCR a chain variable domain sequence is fused to the N terminus of a sequence corresponding to a TCR cc chain constant domain extracellular sequence, and a second polypeptide wherein a sequence corresponding to a TCR P chain variable 25 domain sequence is fused to the N terminus a sequence corresponding to a TCR P chain constant domain extracellular sequence, the first and second polypeptides being linked by a disulfide bond between cysteine residues substituted for Thr 48 of exon 1 of TRAC*01 and Ser 57 of exon 1 of 30 TRBC1*01 or TRBC2*01 or the non-human equivalent thereof. WO 2006/037960 PCT/GB2005/003752 - 46

14. A TCR associated with a therapeutic agent, as claimed in any preceding claim which dTCR or scTCR has amino acid sequences corresponding to human a.P TCR extracellular constant and variable domain sequences. 5

15. A TCR associated with a therapeutic agent, as claimed in claim 14 wherein a disulfide bond links amino acid residues of the said constant domain sequences, which disulfide bond has no equivalent in native TCRs.

16. A TCR associated with a therapeutic agent, as claimed in claim 15 wherein the 10 said disulfide bond is between cysteine residues corresponding to amino acid residues whose P carbon atoms are less than 0.6 nm apart in native TCRs.

17. A TCR associated with a therapeutic agent, as claimed in claim 15 wherein the said disulfide bond is between cysteine residues substituted for Thr 48 of exon 1 15 of TRAC*01 and Ser 57 of exon 1 of TRBC1*01 or TRBC2*01 or the non-human equivalent thereof.

18. A TCR associated with a therapeutic agent, as claimed in any preceding claim wherein the dTCR or scTCR includes a disulfide bond between residues 20 corresponding to those linked by a disulfide bond in native TCRs.

19. A TCR associated with a therapeutic agent, as claimed in any preceding claim wherein the dTCR or scTCR does not contain a sequence corresponding to transmembrane or cytoplasmic sequences of native TCRs. 25

20. A TCR associated with a therapeutic agent, as claimed in any preceding claim wherein said therapeutic agent is a PE38 exotoxin.

21. A TCR associated with a PE38 exotoxin as claimed in claim 20 comprising the 30 amino acid sequences of (SEQ ID NO: 73) and (SEQ ID NO: 71).

22. A TCR associated with a therapeutic agent, as claimed in any preceding claim wherein the TCR is associated with at least one polyalkylene glycol chain(s). WO 2006/037960 PCT/GB2005/003752 - 47

23. A TCR associated with a therapeutic agent, as claimed in claim 22, wherein the polyalkylene glycol chain(s) is/are covalently linked to the TCR. 5

24. A TCR associated with a therapeutic agent, as claimed in claim 22 or claim 23 wherein the polyalkylene glycol chain(s) comprise(s) at least two polyethylene glycol repeating units.

25. A multivalent TCR complex comprising at least two TCRs associated with a 10 therapeutic agent, as claimed in any preceding claim.

26. A multivalent TCR complex comprising at least two TCRs associated with a therapeutic agent, as claimed in any of claims 1 to 24 linked by a non-peptidic polymer chain or a peptidic linker sequence. 15

27. A multivalent TCR complex as claimed in claim 26 wherein the polymer chain or peptidic linker sequence extends between amino acid residues of each TCR associated with a therapeutic agent or a functional variant or fragment thereof, which are not located in a variable region sequence of the TCR. 20

28. A multivalent TCR complex as claimed in either of claims 26 or 27 in which the TCRs associated with a therapeutic agent, are linked by a polyalkylene glycol chain or a peptidic linker derived from a human multimerisation domain. 25

29. A multivalent TCR complex as claimed in claim 28 wherein a divalent alkylene spacer radical is located between the polyalkylene glycol chain and its point of attachment to a TCR associated with a therapeutic agent, of the complex.

30. A multivalent TCR complex as claimed in claim 28 or claim 29 wherein the 30 polyalkylene glycol chain comprises at least two polyethylene glycol repeating units.

31. A pharmaceutical composition comprising a TCR associated with a therapeutic agent, as claimed in any of claims 1 to 24 or a multivalent complex WO 2006/037960 PCT/GB2005/003752 -48 thereof as claimed in any of claims 25 to 30, together with a pharmaceutically acceptable carrier.

32. A method of treatment of cancer comprising administering to a subject 5 suffering such cancer an effective amount of a TCR associated with a therapeutic agent, as claimed in any of claims 1 to 24 or a multivalent complex thereof as claimed in any of claims 25 to 30 wherein said therapeutic agent is selected from those defined in claim 2. 10

33. The use of a TCR associated with a therapeutic agent, as claimed in any of claims 1 to 24 or a multivalent complex thereof as claimed in any of claims 25 to 30, wherein said therapeutic agent is selected from those defined in claim 2 in the preparation of a composition for the treatment of cancer. 15

34. A method of treatment of cancer comprising administering to a subject suffering such cancer an effective amount of the fusion protein as claimed in claims 20 or 21.

35. The use of the fusion protein as claimed in claims 20 or 21 in the preparation 20 of a composition for the treatment of cancer.

36. A method of treatment of autoimmune disease, organ rejection or GVHD comprising administering to a subject suffering such autoimmune disease, organ rejection or GVHD an effective amount of a TCR associated with a therapeutic agent, 25 as claimed in any of claims 1 to 24 or a multivalent complex thereof as claimed in any of claims 25 to 30, wherein said therapeutic agent is selected from those defined in claim 3.

37. The use of a TCR associated with a therapeutic agent, as claimed in as claimed 30 in any of claims 1 to 24, wherein said therapeutic agent is selected from those defined in claim 3 in the preparation of a composition for the treatment of autoimmune disease, organ rejection or GVHD.