AU2003292376A1 - Protein production in transgenic avians using lentiviral system - Google Patents

Description

WO 2004/047531 PCT/GB2003/005191 1 1 "Protein Production in Transgenic Avians" 2 3 The present invention relates to the generation of 4 transgenic avians and the production of recombinant 5 proteins. More particularly, the invention relates 6 to the enhanced transduction of avian cells by 7 exogenous genetic material so that the genetic 8 material is incorporated into an avian genome in 9 such a way that the modification becomes integrated 10 into the germline and results in expression of the 11 encoded protein within the avian egg. 12 13 The ability to manufacture large amounts of 14 pharmaceutical grade proteins is becoming 15 increasingly important in the biotechnology and 16 pharmaceutical arenas. Recent successes of such 17 products in the marketplace, especially those of 18 monoclonal antibodies, have put an enormous strain 19 on already stretched global manufacturing 20 facilities. This heightened demand for 21 manufacturing capacity, the consequential high 22 premiums on capacity and the long wait for WO 2004/047531 PCT/GB2003/005191 2 1 production space, plus the cost of and issues 2 involved in producing proteins in cell lines, has 3 prompted companies to look beyond traditional modes 4 of production (Andersson & Myhanan, 2001). 5 Traditional methods for manufacture of recombinant 6 proteins include production in bacterial or 7 mammalian cells. One of the alternative 8 manufacturing strategies is the use of transgenic 9 animals and plants for production of proteins. 10 11 It was by genetic engineering that the first 12 genetically modified (transgenic) animal was 13 produced, by transferring the gene for the protein 14 of interest into the target animal. Current 15 transgenic technology can be traced back to a series 16 of pivotal experiments conducted between 1968 and 17 1981 including: the generation of chimeric mice by 18 blastocyst injection of embryonic stem cells 19 (Gardner, 1968), the delivery of foreign DNA to 20 rabbit oocytes by spermatozoa (Brackett et al, 21 1971), the production of transgenic mice made by 22 injecting viral DNA into pre-implantation 23 blastocysts (Jaenisch & Mintz, 1974) and germline 24 transmission of transgenes in mouse by pronuclear 25 injection (Gordon & Ruddle, 1981). For the early 26 part of transgenics' history, the focus was upon 27 improving the genetic makeup of the animal and thus 28 the yield of wool, meat or eggs (Curtis & Barnes, 29 1989; Etches & Gibbins, 1993). However in recent 30 years there has been interest in utilising 31 transgenic systems for medical applications such as 32 organ transplantation, models for human disease or WO 2004/047531 PCT/GB2003/005191 3 1 for the production of proteins destined for human 2 use. 3 4 A number of protein based biopharmaceuticals have 5 been produced in the milk of transgenic mice, 6 rabbits, pigs, sheep, goats and cows at reasonable 7 levels, but such systems tend to have long 8 generation times - some of the larger mammals can 9 take years to develop from the founder transgenic to 10 a stage at which they can produce milk. Additional 11 difficulties relate to the biochemical complexity of 12 milk and the evolutionary conservation between 13 humans and mammals, which can result in adverse 14 reactions to the pharmaceutical in the mammals which 15 are producing it (Harvey et al, 2002). 16 17 There is increasing interest in the use of chicken 18 eggs as a potential manufacturing vehicle for 19 pharmaceutically important proteins, especially 20 recombinant human antibodies. Huge amounts'of 21 therapeutic antibodies are required by the medical 22 community each year, amounts which can be kilogram 23 or metric tons per year, so a manufacturing 24 methodology which could address this shortage would 25 be a great advantage. Once optimised, a 26 manufacturing method based on chicken eggs has 27 several advantages as compared to mammalian cell 28 culture or use of transgenic mammalian systems. 29 Firstly, chickens have a short generation time (24 30 weeks), which would allow transgenic flocks to be 31 established rapidly. The following table shows a 32 comparison between the different types of transgenic WO 2004/047531 PCT/GB2003/005191 4 1 systems. Secondly, the capital outlays for a 2 transgenic animal production facility are far lower 3 than that for cell culture. Extra processing 4 equipment is minimal in comparison to that required 5 for cell culture (BioPharm, 2001). As a consequence 6 of these lower capital outlays, the production cost 7 per unit of therapeutic will be lower than that 8 produced by cell culture. In addition, transgenic 9 systems provide significantly greater flexibility 10 regarding purification batch size and frequency and 11 this flexibility may lead to further reduction of, 12 capital and operating costs in purification through 13 batch size optimisation. The third advantage of 14 increased speed to market should become apparent 15 when the technology has been developed to a 16 commercially viable degree. Transgenic mammals are 17 capable of producing several grams of protein 18 product per litre of milk, making large-scale 19 production commercially viable (Weck, 1999). 20 Mammals do not have a significant advantage in terms 21 of the time take to scale up production, since 22 gestation periods for cows and goats are 9 months 23 and 5 months respectively (Dove, 2000) and it can 24 take up to five years to produce a commercially 25 viable herd. However, once the herd is established, 26 the yield of product from milk will be high.

WO 2004/047531 PCT/GB2003/005191 5 Animal Gestation Maturity/ Offspring Time to Protein Founder Generation Produced Production (per animal time Herd/Flock litre/ development egg per cost day) Cow 9 months 2 years 1 per year 5+ years 15g $5-10M Goat 5 months 8 months 2-4 per 3-5 years 8g $3M year Sheep 5 months 8 months 2 per year 3-5 years 8g $2M Pigs 4 months 8 months 10 ? 4.1g ? Rabbits 1 month 5 months 8 ? 0.05g ? Chicken 21 days 6 months 21 per 18 months 0.3g $0.25M month A comparison between the various transgenic animal production systems (Dove, 2000). 1 The short generation time for birds also allows for 2 rapid scale-up. The incubation period of a chicken 3 is only 21 days and it reaches maturity within six 4 months of hatch. Indeed, once the founder animals 5 of the flock have been established, a flock can be 6 established within 18 months (Dove, 2000). The 7 process of scaling up the production capability 8 should be simpler and far faster than a herd of 9 sheep, goats or cows. 10 11 A further advantage rests in the fact that eggs are 12 naturally sterile vessels. One of the inherent 13 problems with cell culture methods of production is 14 the risk of microbial contamination, since the 15 nutrient rich media used tends to encourage 16 microbial growth. Transgenic production offers a 17 lower risk alternative, since the production of the 18 protein will occur within the animal itself, whose WO 2004/047531 PCT/GB2003/005191 6 1 own body will combat most infections. Chicken eggs 2 provide an even lower risk alternative: the eggs are 3 sealed within the shell and membrane and thus 4 largely separated from the environment. The 5 evolutionary distance between humans and birds means 6 that few diseases are common to both. 7 8 Still a further potential advantage lies in the 9 post-translational modification of chicken proteins. 10 The issue of how well a production process can 11 reproduce the natural sugar profile on the proteins 12 which are produced, is now recognised as a crucial 13 element of the success of a production technology 14 (Parekh et al, 1989; Routier et al, 1997; Morrow, 15 2001; Raju et al, 2000, 2001). The main cell types 16 used in cell culture processes are either hamster or 17 mouse-derived, so do not produce the same sugar 18 pattern on proteins as human cells (Scrip, June 8th 19 2001). Mammalian and particularly plant transgenic 20 systems produce different types of post 21 translational modifications on expressed proteins. 22 The sugar profile is crucially important to the 23 manner in which the human immune system reacts to 24 the protein. Raju et al, (2000) found that 25 glycosylated chicken proteins have a sugar profile 26 that is more similar to that of glycosylated human 27 proteins than non-human mammalian proteins, which 28 should be a significant advantage in developing a 29 therapeutic product. 30 31 It can therefore be seen that the avian egg, 32 particularly from the chicken, offers several major WO 2004/047531 PCT/GB2003/005191 7 1 advantages over cell culture as a means of 2 production and the other transgenic production 3 systems based upon mammals or plants. 4 Direct application of the methods used in the 5 production of transgenic mammals to the genetic 6 manipulation of birds has not been possible because 7 of specific features of the reproductive system of 8 the laying hen. Following either natural or 9 artificial insemination, hens will lay fertile eggs 10 for approximately 10 days. They ovulate once per 11 day, and fertilisation occurs almost immediately, 12 while the ovum is at the top of the oviduct. The egg 13 spends the next 20-24 hours in the oviduct, where 14 the albumen (egg white) is laid down around the 15 yolk, plumping fluid is added to the albumen and 16 finally the shell membranes and the shell itself are 17 laid down. During this time, cell division is rapid, 18 such that by the time the egg is laid, the embryo 19 comprises a blastoderm, a disc of approximately 20 60,000 relatively undifferentiated cells, lying on 21 the yolk. 22 23 The complexities of egg formation make the earliest 24 stages of chick-embryo development relatively 25 inaccessible. Methods employed to access earlier 26 stage embryos usually involve sacrificing the donor 27 hen to obtain the embryo or direct injection into 28 the oviduct. Methods for the production of 29 transgenic mammals have focused almost exclusively 30 on the microinjection of a fertilised egg, whereby a 31 pronucleus is microinjected in vitro with DNA and 32 the manipulated eggs are transferred to a surrogate WO 2004/047531 PCT/GB2003/005191 8 1 mother for development to term, this method is not 2 feasible in hens. Four general methods for the 3 creation of transgenic avians have been developed. 4 A method for the production of transgenic chickens 5 using DNA microinjection into the cytoplasm of the 6 germinal disk was developed. The chick zygotes are 7 removed from the oviduct of laying hens before the 8 first cleavage division, transferred to surrogate 9 shells, manipulated and cultured through to hatch 10 (Perry, 1988; Roslin US 5,011,780 and EP0295964). 11 Love et al, (1994) analysed the embryos that 12 survived for at least 12 days in culture and showed 13 that approximately half of the embryos contained 14 plasmid DNA, with 6% at a level equivalent to one 15 copy per cell. Seven chicks, 5.5% of the total 16 number of ova injected, survived to sexual maturity. 17 One of these, a cockerel identified as a potential 18 mosaic transgenic bird, transmitted the transgene to 19 3.4% of his offspring. These birds have been bred to 20 show stable transmission of the transgene. As in 21 transgenic mice generated by pro-nuclear injection, 22 integration of the plasmid DNA is apparently a 23 random event. However, direct DNA microinjection 24 into eggs results in low efficiencies of transgene 25 integration (Sang & Perry, 1989). It has been 26 estimated that only 1% of microinjected ova give 27 rise to transgenic embryos and of these 10% survive 28 to hatch. The efficiency of this method could be 29 improved by increasing the survival rate of the 30 cultured embryos and the frequency of chromosomal 31 integration of the injected DNA. 32 WO 2004/047531 PCT/GB2003/005191 9 1 A second method involves the transfection of 2 primordial germ cells in vitro and transplantation 3 into a suitably prepared recipient. Successful 4 transfer of primordial germ cells has been achieved, 5 resulting in production of viable gametes from the 6 transferred germ cells. Transgenic offspring, as a 7 result of gene transfer to the primordial germ cells 8 before transfer, have not yet been described. 9 10 The third method involves the use of gene transfer 11 vectors derived from oncogenic retroviruses. The 12 early vectors were replication competent (Salter, 13 1993) but replication defective vectors have been 14 developed (see, eg. US Patent 5,162,215 and WO 15 97/47739). These systems use either the 16 reticuloendotheliosis virus type A (REV-A) or avian 17 leukosis virus (ALV). The efficiency of these 18 vectors, in terms of production of founder 19 transgenic birds, is low and inheritance of the 20 vector from these founders is also inefficient 21 (Harvey et al, 2002). These vectors may also be 22 affected by silencing of expression of the 23 transgenes they carry as reports suggest that 24 protein expression levels are low (Harvey et al, 25 2002) 26 27 The fourth method involves the culture of chick 28 embryo cells in vitro followed by production of 29 chimeric birds by introduction of these cultured 30 cells into recipient embryos (Pain et al, 1996). The 31 embryo cells may be genetically modified in vitro 32 before chimera production, resulting in chimeric WO 2004/047531 PCT/GB2003/005191 10 1 transgenic birds. No reports of germline 2 transmission from genetically modified cells are 3 available. 4 5 Although much work has been carried out on 6 retroviral vectors derived from viruses such as ALV 7 and REV as mentioned previously, the limitations of 8 such vectors have prevented more widespread 9 application. Much of the research and development 10 of viral vectors was based on their use in gene 11 therapy applications and so resulted in the 12 demonstration that vectors based on lentiviruses 13 were able to infect nondividing cells, a clear 14 advantage in clinical gene therapy applications. 15 Lentiviruses are a subgroup of the retroviruses 16 which include a variety of primate viruses eg. human 17 immunodeficiency viruses HIV-1 and 2 and simian 18 immunodeficiency viruses (SIV) and non-primate 19 viruses (eg. maedi-visna virus (MVV), feline 20 immunodeficiency virus (FIV), equine infectious 21 anemia virus (ETAV), caprine arthrithis encephalitis 22 virus (CAEV) and bovine immunodeficiency virus 23 (BIV). These viruses are of particular interest in 24 development of gene therapy treatments, since not 25 only do the lentiviruses possess the general 26 retroviral characteristics of irreversible 27 integration into the host cell DNA, but as mentioned 28 previously, also have the ability to infect non 29 proliferating cells. The dependence of other types 30 of retroviruses on the cell proliferation status has 31 somewhat limited their use as gene transfer 32 vehicles. The biology of lentiviral infection can WO 2004/047531 PCT/GB2003/005191 11 1 be reviewed in Coffin et al, (1997) and Sanjay et 2 al, (1996). 3 4 An important consideration in the design of a viral 5 vector is the ability to be able to stably integrate 6 into the genome of cells. Previous work has shown 7 that oncoretroviral vectors used as gene transfer 8 vehicles have had somewhat limited success due to 9 the gene silencing effects during development. 10 Jahner et al, (1982) showed that use of the vector 11 based on the Moloney murine leukemia virus (MoMLV) 12 for example, is unsuitable for production of 13 transgenic animals due to silencing of the virus 14 during the developmental phase, leading to very low 15 expression of the transgene. It is therefore 16 essential that any viral vector used for production 17 of transgenic birds does not exhibit gene silencing. 18 The work of Pfeifer et al, (2002) and Lois et al, 19 (2002) on mice has shown that a lentiviral vector 20 based on HIV-I is not silenced during development. 21 22 The bulk of the developmental work on lentiviral 23 vectors has been focused upon HIV-1 systems, largely 24 due to the fact that HIV, by virtue of its 25 pathogenicity in humans, is the most fully 26 characterised of the lentiviruses. Such vectors 27 tend to be engineered as to be replication 28 incompetent, through removal of the regulatory and 29 accessory genes, which render them unable to 30 replicate. The most advanced of these vectors have 31 been minimised to such a degree that almost all of WO 2004/047531 PCT/GB2003/005191 12 1 the regulatory genes -and all of the accessory genes 2 have been removed. 3 4 The lentiviral group have many similar 5 characteristics, such as a similar genome 6 organisation, a similar replication cycle and the 7 ability to infect mature macrophages (Clements & 8 Payne, 1994). One such lentivirus is Equine 9 Infectious Anemia Virus (EIAV). Compared with the 10 other viruses of the lentiviral group, EIAV has a 11 relatively simple genome: in addition to the 12 retroviral gag, pol and env genes, the genome only 13 consists of three regulatory/accessory genes (tat, 14 rev and S2). The development of a safe and 15 efficient lentiviral vector system will be dependent 16 on the design of the vector itself. It is important 17 to minimise the viral components of the vector, 18 whilst still retaining its transducing vector 19 function. A vector system derived from EIAV has been 20 shown to transduce dividing and non-dividing cells 21 with similar efficiencies to HIV-based vectors 22 (Mitrophanous et al, 1999). Oncoretroviral and 23 lentiviral vectors systems may be modified to 24 broaden the range of tranducible cell types and 25 species. This is achieved by substituting the 26 envelope glycoprotein of the virus with other virus 27 envelope proteins. These include the use of the 28 amphotropic MLV envelope glycoprotein (Page et al, 29 1990), the baculovirus GP64 envelope glycoprotein 30 (Kumar et al, 2003), the adenovirus ADS fiber 31 protein (Von Seggern et al, 2000) rabies G-envelope 32 glycoprotein (Mazarakis et al, 2001) or the WO 2004/047531 PCT/GB2003/005191 13 1 vesicular stomatitis virus G-protein (VSV-G) (Yee et 2 al, 1994). The use of VSV-G pseudotyping also 3 results in greater stability of the virus particles 4 and enables production of virus at higher titres. 5 6 It is an aim of the present invention to provide an 7 efficient method for transferring a transgene 8 construct to avian embryonic cells so as to create a 9 transgenic bird which expresses the gene in its 10 tissues, especially, but not exclusively, in the 11 cells lining the oviduct so that the translated 12 protein becomes incorporated into the produced eggs. 13 14 It is also an aim of the present invention to 15 provide a vehicle and a method for transferring a 16 gene to avian embryonic cells so as to create a 17 transgenic bird which has stably incorporated the 18 transgene into a proportion or all of its germ 19 cells, resulting in transmission of the transgene to 20 a proportion of the offspring of the transgenic 21 bird. This germ line transmission will result in a 22 proportion of the offspring of the founder bird 23 exhibiting the altered genotype. 24 25 It is a further aim of the present invention to 26 provide an efficient method for genetic modification 27 of avians, enabling production of germ line 28 transgenic birds at high frequency and reliable 29 expression of transgenes. 30 31 According to the present invention there is provided 32 a method for the production of transgenic avians, WO 2004/047531 PCT/GB2003/005191 14 1 the method comprising the step of using a lentivirus 2 vector system to deliver exogenous genetic material 3 to avian embryonic cells or cells of the testes. 4 5 The lentivirus vector system includes a lentivirus 6 transgene construct in a form which is capable of 7 being delivered to and integrated with the genome of 8 avian embryonic cells or cells of the testes. 9 10 Preferably the lentivirus vector system is delivered 11 to and integrated at an early stage of development 12 such as early cleavage when there have only been a 13 few cell divisions. 14 15 In one embodiment the lentivirus transgene construct 16 is injected into the subgerminal cavity of the 17 contents of an opened egg which is then allowed to 18 develop. 19 20 The Perry Culture system of surrogate shells may be 21 used. 22 23 Alternatively methods used by Bosselmann et al. or 24 Speksnijder and Ivarie of windowing of the egg can 25 be used. In these methods an embryo in a newly laid 26 egg may be accessed by cutting a window in the egg 27 shell and injecting the lentivirus vector system 28 into the embryonic subgerminal cavity. The egg may 29 then be sealed and incubated. 30 31 In another embodiment the construct is injected 32 directly into the sub-blastodermal cavity of an egg.

WO 2004/047531 PCT/GB2003/005191 15 1 2 Typically the genetic material encodes a protein. 3 4 The genetic material may encode for any of a large 5 number of proteins having a variety of uses 6 including therapeutic and diagnostic applications 7 for human and/or veterinary purposes and may include 8 sequences encoding antibodies, antibody fragments, 9 antibody derivatives, single chain antibody 10 fragments, fusion proteins, peptides, cytokines, 11 chemokines, hormones, growth factors or any 12 recombinant protein. 13 14 The invention thus provides a transgenic avian. 15 16 Preferably the transgenic avian produced by the 17 method of the invention has the genetic material 18 incorporated into at least a proportion of germ 19 cells such that the genetic material will be 20 transmitted to at least a proportion of the 21 offspring of the transgenic avian. 22 23 The invention also provides the use of a lentivirus 24 vector system in the production of a transgenic 25 avian. 26 27 It has been surprisingly observed that the use of 28 lentiviral transgene constructs described by the 29 present invention transduce germ cells of avian 30 embryos with unexpectedly high efficiency. 31 Resulting avians subsequently transmit the 32 integrated vector to a high proportion of offspring WO 2004/047531 PCT/GB2003/005191 16 1 and the transgene carried by the vector may be 2 expressed at relatively high levels. 3 4 The invention thus provides further transgenic 5 avians. 6 7 According to the present invention there is also 8 provided a method for production of an heterologous 9 protein in avians, the method comprising the step of 10 delivering genetic material encoding the protein 11 within a lentivirus vector construct to avian , 12 embryonic cells so as to create a transgenic avaian 13 which expresses the genetic material in its tissues. 14 15 Preferably the transgenic avian expresses the gene 16 in the oviduct so that the translated protein 17 becomes incorporated into eggs. 18 19 The protein can then be isolated from eggs by known 20 methods. 21 22 The invention provides the use of a lentivirus 23 construct for the production of transgenic avians. 24 25 The invention also provides the use of a lentivirus 26 vector construct for the production of proteins in 27 transgenic avians. 28 29 Preferably the lentivirus vector construct is used 30 for the expression of heterologous proteins in 31 specific tissues, preferably egg white or yolk. 32 WO 2004/047531 PCT/GB2003/005191 17 1 The lentivirus as used in this application may be 2 any lentiviral vector but is preferably chosen from 3 the group consisting of EIAV, HIV, SIV, BIV and FIV. 4 5 A particularly preferred vector is EIAV. 6 7 Any commercially available lentivirus vector may be 8 suitable to be used as a basis for a construct to 9 deliver exogeneous genetic material. 10 11 Preferably the construct includes suitable enhancer 12 promoter elements for subsequent production of 13 protein. 14 15 A specific promoter may be used with a lentiviral 16 vector construct to result in tissue specific 17 expression of the DNA coding sequence. This may 18 include promoters such as CMV, pCAGGS or any 19 promoter based upon a protein usually expressed in 20 an avian egg, such as ovalbumin, lysozyme, 21 ovotransferrin, ovomucoid, ovostatin, riboflavin 22 binding protein or avidin. 23 24 Preferably the vector construct particles are 25 packaged using a commercially available packaging 26 system to produce vector with an envelope, typically 27 a VSV-G envelope. 28 29 Typically the vector may be based on EIAV available 30 from ATCC under accession number VR-778 or other 31 commercially available vectors. 32 WO 2004/047531 PCT/GB2003/005191 18 1 Commercial lentivirus-based vectors for use in the 2 methods of the invention are capable of infecting a 3 wide range of species without producing any live 4 virus and do not cause cellular or tissue toxicity. 5 6 The methods of the present invention can be used to 7 generate any transgenic avian, including but not 8 limited to chickens, turkeys, ducks, quail, geese, 9 ostriches, pheasants, peafowl, guinea fowl, pigeons, 10 swans, bantams and penguins. 11 12 These lentivirus-based vector systems also have a 13 large transgene capacity which are capable of 14 carrying larger protein encoding constructs such as 15 antibody encoding constructs. 16 17 A preferred lentiviral vector system is the 18 LentiVector@ system of Oxford BioMedica. 19 20 The invention further provides a method to determine 21 the likelihood of expression of a protein in vivo, 22 the method comprising the step of measuring 23 expression of the protein in avian oviduct cells in 24 vitro. 25 26 The invention therefore provides the use of avian 27 cells in vitro to determine the likelihood of 28 expression in vivo. 29 30 The invention is exemplified with reference to the 31 following non-limiting experiments and with 32 reference to the accompanying drawings wherein: WO 2004/047531 PCT/GB2003/005191 19 1 2 Figure 1 illustrates a schematic representation of 3 the EIAV vectors used in this study. 4 Figure 2 illustrates Southern transfer analysis of 5 genomic DNA from individual birds to identify 6 proviral insertions. 7 8 Figure 3 illustrates reporter gene expression in 9 pONY8.OcZ and pONY8.0G Gi transgenic birds. 10 11 Figure 4 illustrates reporter gene expression in 12 pONY8.4GCZ G3 transgenic birds. 13 14 Figure 5 illustrates reporter gene expression in G2 15 transgenic birds. 16 17 Figure 6 illustrates Western analysis of pONY8.4GCZ 18 Gi birds. 19 20 Figure 7 illustrates reporter gene expression in 21 pONY8.OcZ G 2 birds. 22 23 Figure 8 illustrates lacZ expression in the oviduct 24 of a transgenic bird. 25 26 Experiment 1 27 28 Freshly laid, fertile hen's eggs were obtained which 29 contain developing chick embryos at developmental 30 stages X-XIII (Eyal-Giladi & Kochav, 1976). An egg 31 was opened, the contents transferred to a dish and WO 2004/047531 PCT/GB2003/005191 20 1 2-3 microlitres of a suspension of lentiviral vector 2 virus particles was injected into the subgerminal 3 cavity, below the developing embryo but above the 4 yellow yolk. The vector used was derived from Equine 5 Infectious Anaemia Virus (EIAV) and carried a 6 reporter gene, $-galactosidase (lacZ), under the 7 control of the CMV (cytomegalovirus) 8 enhancer/promoter. The packaging system used to 9 generate the vector viral particles resulted in 10 production of the vector with a VSV-G envelope. The 11 estimated concentration of viral transducing 12 particles was between 5 x 107 and 1 x 109 per ml. The 13 embryos were allowed to develop by culturing them 14 using the second and third phases of the Perry 15 culture system (Perry, 1988). 12 embryos were 16 removed and analysed for expression of lacZ after 2 17 days of incubation and 12 embryos after 3 days of 18 incubation. The embryos and surrounding membranes 19 were dissected free of yolk, fixed and stained to 20 detect expression of the lacZ reporter gene. All 21 embryos showed expression of lacZ in some cells of 22 the embryo and surrounding membranes. The expression 23 was highest in the developing extraembryonic 24 membrane close to the embryo and was limited to a 25 small number of cells in the embryos analysed. These 26 results indicated that all the embryos had been 27 successfully transduced by the injected lentiviral 28 vector. 29 30 Experiment 2 31 WO 2004/047531 PCT/GB2003/005191 21 1 In a further experiment 40 laid eggs were injected 2 each with 2-3 microlitres of a suspension of the 3 EIAV vector at a titre of 5 x 108 per ml., into the 4 sub-blastodermal cavity. 13 chicks hatched (33%) and 5 were screened to identify transgenic offspring 6 carrying the lentiviral vector sequence. Samples of 7 the remaining extraembryonic membrane were recovered 8 from individual chicks after hatch, genomic DNA 9 extracted and the DNA analysed by PCR using primers 10 specific to the lentiviral vector sequence. The 11 screen identified 11 chicks as transgenic (85%). The 12 vector sequence was detected in the extraembryonic 13 membrane at a copy number of between 0.4% and 31%, 14 indicating that the chicks were mosaic for 15 integration of the vector. This result was predicted 16 as the embryos were injected with the vector at a 17 stage at which they consisted of at least 60,000 18 cells. It is unlikely that all the cells in the 19 embryo would be transduced by the viral vector, 20 resulting in chicks that were chimeric for 21 integration of the vector. The 11 chicks were raised 22 to sexual maturity and 7 found to be males. Semen 23 samples were obtained from the cockerels when they 24 reached 16-20 weeks of age. DNA from these samples 25 was screened by PCR and the seven cockerels found to 26 have lentiviral vector sequence in the semen at 27 levels estimated as between 0.1% and 80%. The 28 majority of the samples contained vector sequence at 29 a level above 10%. This suggested that at least 10% 30 of the offspring of these cockerels will be 31 transgenic. Semen was collected from one cockerel, 32 code no. LEN5-20, that had been estimated to have a WO 2004/047531 PCT/GB2003/005191 22 1 copy number of the viral vector in DNA from a blood 2 sample as 6%. The copy number estimated from the 3 semen sample was 80%. The semen was used to 4 inseminate stock hens, and the fertile eggs 5 collected and incubated. 9 embryos were recovered 6 after 3 days of incubation, screened by PCR to 7 identify transgenic embryos and stained for 8 expression of the lacZ reporter gene. 3 of the 9 9 embryos were transgenic and all 3 expressed lacZ but 10 at a very low level in a small number of cells. 12 11 embryos were recovered after 10 days of incubation 12 and screened as above. 6 embryos were identified as 13 transgenic and lacZ expression detected in 4. The 14 expression was high in several tissues in one embryo 15 and lower in the other 3. These results indicate 16 that 43% of the offspring of cockerel LEN5-20 were 17 transgenic. The expression of the reporter construct 18 carried by the lentiviral vector varied between 19 individual transgenic chicks. It is likely that the 20 individual chicks had copies of the vector genome 21 integrated at different chromosomal sites, which may 22 affect the expression of the transgene. It is also 23 possible that some chicks carried more than one copy 24 of the transgene. 25 26 The results outlined here demonstrate that a 27 specific EIAV-derived lentiviral vector, pseudotyped 28 with the VSV envelope protein, can transduce the 29 germ cells of chick embryos with very high 30 efficiency. The resulting birds then transmit the 31 integrated vector to a high proportion of their 32 offspring. The transgene carried by the vector may WO 2004/047531 PCT/GB2003/005191 23 1 be expressed to give a functional protein at 2 relatively high levels. The transgene carried by the 3 vector may be designed to express foreign proteins 4 at high levels in specific tissues. 5 6 The lentiviral vector may be introduced into the 7 chick at different developmental stages, using 8 modifications of the method described in the example 9 above. 10 11 The viral suspension may be injected above the 12 blastoderm embryo in a new laid egg . 13 The viral suspension may be injected into the newly 14 fertilised egg or the early cleavage stages, up to 15 stageX (Eyal-Giladi & Kochav, 1976), by utilizing 16 the culture method of Perry (1988) or recovering 17 eggs from the oviduct and then returning them to a 18 recipient hen by ovum transfer. 19 20 The viral suspension may be injected above or below 21 the blastoderm embryo in a freshly laid egg which 22 has been accessed by cutting a window in the shell. 23 The window may be resealed and the egg incubated to 24 hatch (Bosselman et al, 1989). 25 26 The viral suspension may be injected into the testes 27 of cockerels and semen screened to detect 28 transduction of the spermatogonia and consequent 29 development of transgenic sperm. 30 31 Experiment 3 32 WO 2004/047531 PCT/GB2003/005191 24 1 Materials and Methods 2 3 EIAV vectors and preparation of virus stocks 4 The vectors pONY8.OcZ and pONY8.OG have been 5 described previously (Pfeifer et al, 2002). The 6 vector pONY8.4GCZ has a number of modifications 7 including alteration of all ATG sequences in the 8 gag-derived region to ATTG, to allow expression of 9 eGFP downstream of the 5'LTR. The 3' U3 region has 10 been modified to include the Moloney leukaemia virus 11 U3 region. Vector stocks were generated by FuGENE6 12 (Roche, Lewes, U.K.) transfection of HEK 293T cells 13 plated on 10cm dishes with 2 pg of vector plasmid, 14 2pg of gag/pol plasmid (pONY3.1) and lpg of VSV-G 15 plasmid (pRV67) (Lois et al, 2002). 36-48 hours 16 after transfection supernatants were filtered 17 (0.22pm) and stored at -70'C. Concentrated vector 18 preparations were made by initial low speed 19 centrifugation at 6,000xg for 16 hours at 4)C 20 followed by ultracentrifugation at 50,500xg for 90 21 minutes at 4 0 C. The virus was resuspended in 22 formulation buffer (Lois et al, 2002) for 2-4 hours, 23 aliquoted and stored at -80 0 C. 24 25 Production and analysis of transgenic birds 26 Approximately 1-2pl of viral suspension was 27 microinjected into the sub-germinal cavity beneath 28 the blastodermal embryo of new-laid eggs. Embryos 29 were incubated to hatch using phases II and III of 30 the surrogate shell ex vivo culture system (Challita 31 & Kohn, 1994). DNA was extracted from the CAM of 32 embryos that died in culture at or after more than WO 2004/047531 PCT/GB2003/005191 25 1 twelve days of development using Puregene genomic 2 DNA purification kit (Flowgen, Asby de la Zouche, 3 U.K.). Genomic DNA samples were obtained from CAM of 4 chicks at hatch, blood samples from older birds and 5 semen from mature cockerels. PCR analysis was 6 carried out on 5Ong DNA samples for the presence of 7 proviral sequence. To estimate copy number control 8 PCR reactions were carried out in parallel on 50ng 9 aliquots of chicken genomic DNA with vector plasmid 10 DNA added in quantities equivalent to that of a 11 single copy gene (1x), a 10-fold dilution (0.1x) and 12 a 100-fold dilution (0.Ox) as described previously 13 (Perry, 1988). Primers used: 14 5'CGAGATCCTACAGTTGGCGCCCGAACAG3' and 15 5'ACCAGTAGTTAATTTCTGAGACCCTTGTA-3'. The number of 16 proviral insertions in individual G, birds was 17 analysed by Southern transfer. Genomic DNA extracted 18 from whole blood was digested with XbaI or BamHI. 19 Digested DNA was resolved on a 0.6%(w/v) agarose gel 20 then transferred to nylon membrane (Hybond-N, 21 Amersham Pharmacia Biotech, Amersham U.K.). 22 Membranes were hybridised with 32 P-labelled probes 23 for the reporter gene lacZ or eGFP at 650C. 24 Hybridisation was detected by autoradiography. All 25 experiments, animal breeding and care procedures 26 were carried out under license from the U.K. Home 27 Office. 28 29 Expression analysis 30 Adult tissues were isolated and fixed for 30 min in 31 4% paraformaldehyde, 0.25% gluteraldehyde, in 32 phosphate buffered saline (PBS). Tissues were cryo- WO 2004/047531 PCT/GB2003/005191 26 1 embedded and sectioned at 14 pm. D-galactosidase 2 activity was detected by incubating at 37'C in 5mM 3 potassium ferricyanide, 5mM potassium ferrocyanide, 4 2mM MgC1 2 , 0.5mg/ml X-gal for 90 min (sections) or 4 5 hours (embryos). GFP images of hatchlings were 6 captured using Fujifilm digital camera (Nikon 60mm 7 lens) shot through a GFsP-S lens system (BLS, Ltd, 8 Czech Republic). Selected tissues were snap-frozen 9 and total protein was extracted by homogenization in 10 PBS containing protease inhibitors (complete mini, 11 Roche, Lewes, U.K.). Protein concentration was 12 determined by Bradford assay. Either 50pg (Fig. 4) 13 or 100 pg (Fig. 3) of protein extract was resolved 14 on 12% polyacrylamide gels (Invitrogen, Paisley, 15 U.K.) and transferred to PDVF membranes. Membranes 16 were incubated with mouse anti-p-galactosidase 17 antibody (Promega, Southampton, U.K.) at 1:5000 18 dilution and donkey anti-mouse IgG-HRP antibody 19 (Santa Cruz Biotech) at 1:2000 dilution and 20 visualized with the ECL western blotting detection 21 system (Amersham Biosciences, Amersham, U.K.) . ELISA 22 was performed using p-gal Elisa kit (Roche, Lewes, 23 U.K.). 24 25 Results 26 Detailed Figure legends 27 28 Figure 1. Schematic representation of the EIAV 29 vectors used in this study. 30 The light grey box represents the EIAV packaging 31 signal, and the diagonal lined box in pONY8.4GCZ the 32 MLV U3 region. Restriction sites (XbaI [X], BstEII WO 2004/047531 PCT/GB2003/005191 27 1 [B] utilised for Southern blot analysis are 2 indicated. The reporter gene lacZ was used as a 3 probe (Fig. 2). 4 5 Figure 2. Southern transfer analysis of genomic DNA 6 from individual birds to identify proviral 7 insertions. Genomic DNA samples were digested with 8 XbaI (a, c, d) or BstEII (b) and hybridised with a 9 probe for lacZ. (a, b) Analysis of 14 G1 offspring 10 of GO bird no. 1-4 (Table 1) revealed multiple 11 proviral insertions in the G1 birds. (c) Analysis of 12 GI bird no. 2-2/19 (lane 1) and 14 of his G2 13 offspring (lanes 2-15) and (d) GI bird 2-2/6 (lane 14 1) and 9 of his G2 offspring (lanes 2-10), 15 demonstrated stability of the proviral insertions 16 after germ line transmission. 17 18 Figure 3. Reporter gene expression in pONY8.OcZ and 19 pONY8.OG Gitransgenic birds. 20 a Western blot analysis of liver, heart, skeletal 21 muscle, brain, oviduct, skin, spleen, intestine, 22 kidney, pancreas and bone marrow protein extracts 23 from 5 adult Gi birds each containing single, 24 independent insertions of pONY8.OcZ. 100Ig of 25 protein was loaded per lane and p-galactosidase 26 protein detected as described in Experimental 27 Protocols. b Sections of skin, pancreas, and 28 intestine from Gi 2-2/19 stained for P 29 galactosidase activity and comparable sections of a 30 non-transgenic control bird (arrowheads indicate 31 epidermis of skin, villi of intestine) . Bar = 0.5mm. 32 c Sections of breast muscle, pancreas, and skin from WO 2004/047531 PCT/GB2003/005191 28 1 a single copy transgenic or a wildtype bird were 2 visualized for GFP fluorescence (arrowhead indicates 3 epidermis of skin) . Bar = 0.5mm. 4 5 Figure 4. Reporter gene expression in pONY8.4GCZ Gi 6 transgenic birds. 7 a Sections of tissues from a single copy Gi bird was 8 stained for p-galactosidase activity (arrow 9 indicates smooth muscle of intestine) . Bar = 0.5mm. 10 Panel A: higher magnification of oviduct section. 11 Arrows identify cells lining tubular glands cut in 12 cross-section. Bar = 0.05mm. b Levels of P 13 galactosidase protein were determined for pONY8.OcZ 14 and pONY8.4GCZ lines. Data points were generated 15 from three independent experiments. 16 17 Figure 5. Reporter gene expression in G2 transgenic 18 birds. 19 a Western analysis of protein extracted from 20 int-estine, skin, liver and pancreas of Gi cockerels 21 2-2/19 and 2-2/6 and two G2 offspring of each bird. b 22 Top panel: five Gi offspring of bird ID 4-1. The 4 23 birds on the left are transgenic for pONY8.0G and 24 express eGFP. The bird on the right is not 25 transgenic. Bottom panel: five G2 offspring of bird 26 ID 4-1/66. The bird in the center is not transgenic. 27 28 Figure 6. Western analysis of pONY8.4GCZ G1 birds. 29 Western blot analysis of liver, heart, skeletal 30 muscle, brain, oviduct, skin, spleen, intestine, 31 kidney, pancreas and bone marrow protein extracts 32 from 4 adult Gi birds each containing single, WO 2004/047531 PCT/GB2003/005191 29 1 independent insertions of pONY8.4GCZ. 100ig of 2 protein was loaded per lane and @-galactosidase 3 protein detected as described in Experimental 4 Protocols. 5 6 Figure 7. Reporter gene expression in pONY8.OcZ G2 7 transgenic birds. 8 Sections of skin, pancreas and intestine (arrowhead 9 indicates epidermis, arrow indicates feather 10 follicle) from a G2 offspring of 2-2/19 stained for 11 p-galactosidase activity and comparable sections of 12 a non-transgenic control bird. Bar = 0.5mm 13 14 Production of Go transgenic birds 15 Three different self-inactivating EIAV vectors 16 (Fig.1) were used, pseudotyped with vesicular 17 stomatitis virus glycoprotein (VSV-G). These vectors 18 have previously been used to transduce a number of 19 tissues in several animal model systems, both in 20 vitro and in vivo (Pfeifer et al, 2002; Rholl et al, 21 2002; Corcoran et al, 2002; Azzouz et al, 2002). The 22 pONY8.4 vector was modified from pONY8.0 by 23 substitution of Moloney murine leukaemia virus 24 (MoMLV) sequence in the 5' LTR and deletion of the 25 majority of the viral env gene. The vector 26 preparations were concentrated to give titres of 27 approximately 107 to 10 transducing units per 28 millilitre (T.U./ml). One to two microlitres of 29 concentrated vector was injected into the 30 subgerminal cavity below the developing embryonic 31 disc of new-laid eggs, which were then cultured to 32 hatch. Genomic DNA was extracted from WO 2004/047531 PCT/GB2003/005191 30 1 chorioallantoic membrane (CAM) of hatched Go chicks 2 and analysed by PCR to detect the EIAV packaging 3 site sequence. The approximate copy number of the 4 vector with respect to the amount of genomic DNA 5 present was estimated, with a range from the 6 equivalent of one copy per genome to 0.01 copies per 7 genome (see Experimental Protocol). All chicks were 8 raised to sexual maturity and genomic DNA from semen 9 samples from males was similarly screened by PCR. 10 11 Four experiments were carried out. The virus 12 pONY8.OcZ was injected at a titre of 5 x 107 T.U./ml 13 in experiment 3.1 and 5 x 108 T.U./ml in experiment 14 3.2. In experiment 3.3 the virus pONY8.4GCZ was 15 injected at a concentration of 7.2 x 108 T.U./ml and 16 in experiment 3.4 pONY8.OG was used at 9.9 x 109 17 T.U./ml. A total of 73 eggs were injected in the 18 four experiments from which 20 (27%) chicks hatched. 19 The results of the PCR screen of hatched male and 20 female chicks from each experiment are shown in 21 Table 1. Fourteen of the twenty Go birds contained 22 vector sequences at levels estimated to be between 23 0.5 to 0.01 copies per genome equivalent. The vector 24 pONY8.0cZ transduced the chick embryos more 25 efficiently than the vector pONY8.4GCZ when injected 26 at a similar concentration, possibly due to the 27 presence of the viral cPPT sequence that is involved 28 in nuclear import of the viral DNA genome (Lois et 29 al, 2002). The results also show that transgenic 30 birds can be produced using titres as low as 5 x 107 31 T.U./ml, but that transduction frequency increases 32 if higher titres are used.

WO 2004/047531 PCT/GB2003/005191 31 1 2 Germ line transmission from Go males 3 Semen samples were collected from the 12 Go males 4 when they reached sexual maturity, between 16 and 20 5 weeks of age. The results of PCR screens of genomic 6- DNA extracted from these samples are given in Table 7 1. These showed that vector sequences were present 8 in the germ line of all the cockerels, even those 9 that had been scored as not transgenic when screened 10 at hatch. This was confirmed by breeding from 10 of 11 the 12 cockerels by crossing to stock hens and 12 screening their G, offspring to identify transgenic 13 birds. All 10 cockerels produced transgenic 14 offspring, with frequencies ranging from 4% to 45%. 15 The frequencies of germ line transmission were very 16 close to those predicted from the PCR analysis of 17 semen DNA but, in every case, higher than predicted 18 from analysis of DNA from CAM samples taken at 19 hatch. Blood samples were taken from several 20 cockerels and PCR analysis closely matched the 21 results from the CAM DNA analysis (data not shown). 22 The results suggest a germ line transduction 23 frequency approximately 10-fold higher than that of 24 somatic tissues. 25 26 Analysis of G, transgenic birds and transmission to 27

G

2 28 The founder transgenic birds were transduced at a 29 stage of development when embryos consist of an 30 estimated 60,000 cells, approximately 50 of which 31 are thought to give rise to primordial germ cells 32 (Bienemann et al, 2003; Ginsburg & Eyal-Giladi, WO 2004/047531 PCT/GB2003/005191 32 1 1987) . We predicted that the Gi birds to result from 2 separate transduction events of individual 3 primordial germ cells and that different birds would 4 have independent provirus insertions, representing 5 transduction of single germ cell precursors. It was 6 also possible that individual cells would have more 7 than one proviral insertion. Four Go cockerels, 8 transduced with pONY8.OcZ (experiments 3.1 and 3.2), 9 were selected for further analysis of their 10 transgenic offspring (Table 2). Genomic DNA from 11 individual G 1 birds was analysed by Southern blot. 12 Samples were digested separately with XbaI and Bst 13 EII, restriction enzymes that cut within the 14 integrated EIAV provirus but outside the probe 15 region (Fig. 1), and hybridised with probes to 16 identify restriction fragments that would represent 17 the junctions between the proviral insertions and 18 the genomic DNA at integration sites. This enabled 19 estimation of the number of proviral insertions in 20 each G 1 bird and of the number 'of different 21 insertions present in the offspring of each Go 22 analysed. An example of this analysis is shown in 23 Fig. 2a,b and the results summarised in Table 2. The 24 majority of G 1 birds carried single proviral 25 insertions but several contained multiple copies, 26 with a maximum of 4 detected in one bird. Some 27 offspring of each Go bird carried the same proviral 28 insertion, indicating that they were derived from 29 the same germ cell precursor. 30 31 Three male G 1 offspring of bird 2-2 (2-2/6,16 and 32 19) were crossed to stock hens to analyse WO 2004/047531 PCT/GB2003/005191 33 1 transmission frequency to the G 2 generation. 2 Cockerels 2-2/6 and 2-2/19 had single proviral 3 insertions and the ratios of transgenic to non 4 transgenic offspring, 14/30 (47%) and 21/50 (42%), 5 did not differ significantly from the expected 6 Mendelian ratio. Cockerel 2-2/16 had two proviral 7 insertions and 79% (27/34) of the G2 offspring were 8 transgenic, reflecting the independent transmission 9 of two insertions. Southern transfer analysis was 10 used to compare the proviral insertion present in 11 birds 2-2/6 and 2-2/19 with 9 and 14 of their G 2 12 offspring, respectively (Fig, 2c,d). Identical 13 restriction fragments were observed in parents and 14 offspring, indicating that the proviruses were 15 stable once integrated into the genome. 16 17 Transgene expression in G 1 and G 2 transgenic birds 18 The vectors pONY8.OcZ and pONY8.4GCZ carried the 19 reporter gene lacZ under control of the human 20 cytomegalovirus (CMV) immediate early 21 enhancer/promoter (CMVp) and pONY8.0G carried the 22 reporter eGFP, also controlled by CMVp. Expression 23 of lacZ was analysed by staining of tissue sections 24 to detect P-galactosidase activity and by western 25 analysis of protein extracts from selected tissues 26 isolated from adult birds, to identify P 27 galactosidase protein. Expression of eGFP was 28 analysed using UV illumination. 29 30 Protein extracts were made from a range of tissues 31 from seven pONY8.0cZ 01 birds, each containing a 32 different single provirus insertion. A protein of WO 2004/047531 PCT/GB2003/005191 34 1 the expected 110kDa was detected in some tissues in 2 each transgenic bird. Expression was consistently 3 high in pancreas and lower levels of protein were 4 present in other tissues, including liver, intestine 5 and skeletal muscle. The analysis of five of these 6 birds is shown in Figure 3a. f-galactosidase was 7 detected in most tissues on longer exposures of the 8 western blot (data not shown). The pattern of 9 expression was consistent between the individual 10 birds but the overall amounts of protein varied. 11 Sections of tissues from an adult pONY8.OcZ G1 bird 12 were stained (Fig. 3b). Intense staining was 13 observed throughout the exocrine pancreas and in 14 other tissues, such as the epithelium of the skin 15 and villi of the small intestine. Expression 16 analysis of GFP in sections of tissue from a 17 pONY8.0G bird detected expression in the pancreas, 18 skin and breast muscle (Fig. 3c) and weak expression 19 in the intestine (data not shown). These results 20 show that transgenic birds produced with the same 21 EIAV vector but carrying different reporter genes 22 showed similar patterns of expression. 23 24 Western analysis of tissues from six G, birds 25 carrying different single proviral insertions of 26 pONY8.4GCZ detected lacZ expression in four birds, 27 in a pattern similar to that seen in the pONY8.OcZ 28 transgenic birds (Fig.6). However, staining of 29 tissue sections revealed a more extensive pattern of 30 expression than was observed in birds transgenic for 31 pONY8.OcZ. $-galactosidase activity was detected 32 additionally in the smooth muscle of the intestine, WO 2004/047531 PCT/GB2003/005191 35 1 blood vessels underlying the epidermis and in 2 tubular gland cells of the oviduct (Fig. 4a). An 3 ELISA assay was used to quantify the differences in 4 levels of expression of -galactosidase between 5 transgenic birds carrying the pONY8.0 and pONY8.4 6 vectors (Fig. 4b). -galactosidase levels were 7 higher in pONY8.4GCZ birds in all tissues assayed 8 than in pONY8.OcZ birds. Levels in pancreatic 9 extracts were approximately 6-fold higher and 10 expression in bird no. 3-5/337 was 30pg per 11 microgram of tissue, or 3% of total protein. 12 13 To establish if transgene expression was maintained 14 after germ line transmission, expression in G 2 birds 15 carrying the vectors pONY8.OcZ and pONY8.OG was 16 examined. Western analysis was carried out on tissue 17 extracts from two G, cockerels, 2-2/6 and 2-2/19, 18 that each had a single proviral insertion, and two 19 G 2 offspring from each cockerel (Fig. 5a). 20 galactosidase protein levels are very similar in the 21 parent and two offspring and the patterns of 22 expression, predominantly in the pancreas, are also 23 very similar. Staining of tissue sections from a G 2 24 bird demonstrated expression patterns comparable to 25 that observed in the parent (Fig. 7). GFP 26 fluorescence was readily detected in live G, chicks 27 carrying pONY8.OG and the G 2 offspring of one of 28 these birds showed a similar level of expression 29 (Fig. 5b). 30 31 Figure 8 shows a range of sections from the oviduct 32 of a transgenic hen carrying the vector pONY8.4GCZ WO 2004/047531 PCT/GB2003/005191 36 1 carrying the reporter gene lac Z. Blue stain is 2 apparent in the sections illustrating expression of 3 lacZ. 4 5 Discussion 6 We have demonstrated that the lentiviral vector 7 system that we have tested is a very efficient 8 method for production of germ line transgenic birds. 9 In the experiments described here twelve cockerels 10 were produced after injection of concentrated 11 suspension of viral vector particles immediately 12 below the blastoderm stage embryo in new laid eggs. 13 We bred from ten founder cockerels and all produced 14 transgenic offspring, with frequencies from 4 to 15 45%. Even the lowest frequency of germ line 16 transmission obtained is practical in terms of 17 breeding to identify several G, transgenic birds from 18 one founder cockerel, in order to establish 19 independent lines carrying different proviral 20 insertions. This method of sub-blastodermal 21 injection is very similar to the methods used 22 previously (Salter & Crittenden, 1989; Bosselman et 23 al, 1989; Harvey et al, 2002) to introduce 24 retroviruses into the chicken. The high success rate 25 may be due to a number of factors, including the 26 ability of lentivral vectors to transduce non 27 dividing cells, the use of the VSV-G pseudotype, 28 that has previously been used to introduce a 29 retroviral vector into quail (Karagenc et al, 1996), 30 and the high titres used compared to previous 31 transgenic studies. The chick embryo in a laid egg 32 is a disc consisting of a single layer of cells, WO 2004/047531 PCT/GB2003/005191 37 1 lying on the surface of the yolk, with cells 2 beginning to move through the embryo to form the 3 hypoblast layer below the embryonic disc (Mizuarai 4 et al, 2001). Primordial germ cells also migrate 5 from the embryonic disc, through the subgerminal 6 cavity and on to the hypoblast below. It is possible 7 that during the developmental stages immediately 8 after the virus injection, the primordial germ cells 9 migrate through the suspension of viral particles, 10 thus accounting for the higher frequency of germ 11 cell transduction compared to that of cells of the 12 CAM or blood. 13 14 We have shown that the majority of G1 transgenic 15 birds contain a single proviral insertion but that 16 some birds contain multiple insertions. These 17 results indicate that it will be easy to use this 18 vector system to generate transgenic birds with 19 single vector-transgene insertions and to breed 20 several lines from the same Go bird, with the 21 provirus inserted at different chromosomal loci. 22 Levels of expression of a transgene, introduced by a 23 particular vector but integrated at different sites 24 within the chicken genome, are likely to vary. The 25 analysis of transmission from G 1 to G 2 indicates that 26 it will be simple to establish lines carrying stable 27 transgene insertions, using the lentiviral vectors 28 described. 29 30 Expression of the reporter gene lacZ was detected in 31 founder (Go), G 1 and G 2 birds. The expression of lacZ 32 was directed by human CMVp (nucleotides -726 to + WO 2004/047531 PCT/GB2003/005191 38 1 78), an enhancer/promoter generally described as 2 functioning ubiquitously in many cell types. This is 3 usually the case if it is used in cell culture 4 transfection experiments but expression in 5 transgenic mice from the CMVp varies between 6 tissues. In particular, it has been reported that 7 CMVp transgene shows predominant expression in 8 exocrine pancreas in transgenic mice (Eyal-Giladi & 9 Kochav, 1976). We have shown that the pattern of 10 expression of both lacZ and GFP in embryos and birds 11 is predominantly in the pancreas, although it is 12 expressed at varying levels in most tissues. 13 Expression from the third generation EIAV vector 14 pONY8.4 was significantly higher than from the 15 pONY8.0 vector, possibly due to increase in mRNA 16 stability in the former resulting from removal of 17 instability elements in the env region. Transgene 18 expression was not detected in a small number of 19 pONY8.4GCZ transgenic birds, possibly due to the 20 inclusion of MoMLV sequence in the vector that may 21 induce silencing (Zhan et al, 2000). The expression 22 pattern seen in G, birds is maintained after germ 23 line transmission to G 2 . These results indicate that 24 transgene-specific expression, from transgenes 25 introduced using lentiviral vectors, is maintained 26 after germ line transmission, as has been described 27 in the mouse and rat (Naldini et al, 1996). The size 28 of transgenes that can be incorporated in lentiviral 29 vectors is limited and therefore some tissue 30 specific regulatory sequences may be too big for use 31 in these vectors. The limit has yet to be defined 32 but is likely to be up to 8kb, as EIAV vectors of WO 2004/047531 PCT/GB2003/005191 39 1 9kb have been successfully produced (Lois et al, 2 2002) 3 4 Expression of lacZ in the oviduct (Fig. 8) 5 demonstrates that the cells which synthesize egg 6 white proteins can express foreign proteins in 7 transgenic birds carrying an integrated lentiviral 8 vector system encoding a protein. 9 10 The study described here is an evaluation of the 11 possible application of lentiviral vectors for the 12 production of transgenic birds. We have shown that 13 we can obtain a very high frequency of germline 14 transgenic birds, stable transmission from one 15 generation to the next, and a pattern of transgene 16 expression that is maintained after germline 17 transmission. These results indicate that the use of 18 lentiviral vectors will overcome many of the 19 problems encountered so far in development of a 20 robust method for production of transgenic birds. 21 The application of this method for transgenic 22 production will allow many transgene constructs to 23 be tested to determine those that express in 24 appropriate tissues and at required levels. Recently 25 an ALV vector has been used to generate a transgenic 26 line in which expression and accumulation in egg 27 white of low amounts of biologically active protein 28 was demonstrated (Rapp et al, 2003). Although the 29 amounts of protein produced, micrograms of protein 30 per egg, is not at a level that will facilitate 31 commercial production, the analysis of the protein 32 purified from egg white supports the aim that WO 2004/047531 PCT/GB2003/005191 40 1 transgenic hens may be used as bioreactors. The use 2 of lentiviral vectors may overcome the problems 3 associated with transgene incorporation and 4 expression using oncoretroviral vectors. The 5 development of an efficient method for production of 6 transgenic birds is particularly timely as the 7 chicken genome sequence is due to be completed this 8 year and the value of the chick as a model for 9 analysis of vertebrate gene function is increasing 10 (Mozdziak et al, 2003). 11 12 Experiment 4 13 14 Experiments are being carried out with the 15 Invitrogen ViraPower system. The chickenised R24 16 minibody coding sequence is inserted into the 17 pLenti6/V5 plasmid immediately downstream of the 18 constitutive CMV promoter. ViraPowerm 293FT cells 19 are then cotransfected with the pLenti6/V5/R24 20 expression construct and the optimised ViraPowerTM 21 packaging mix. Finally packaged virus-containing 22 tissue culture supernatant is harvested. One 23 intended use for the Invitrogen ViraPower system is 24 as a high efficiency transfection reagent. The 25 presence of the blasticidin resistance gene on the 26 pLenti6/V5 plasmid confers the ability to 27 preferentially select transduced populations. This 28 means relatively low titre viral harvests are 29 adequate. However, for the experimental work 30 described below, more concentrated viral harvests 31 are required. Two methods of viral concentration 32 are being evaluated. First, the use of spin WO 2004/047531 PCT/GB2003/005191 41 1 concentration via Centrikon Plus20 spin columns. 2 Second, the use of a standard ultracentrifugation 3 protocol. 4 5 The structure of the RNA genome of the concentrated 6 packaged viral vectors is being analysed by both 7 Northern blotting and Reverse Transcriptase 8 Polymerase Chain Reaction (RT-PCR). Reverse 9 transcription is carried out with several reverse 10 primers, oligo dT, random hexamers and a primer 11 specific to the 3'LTR, to ensure that a 12 representative sample of viral genomes are converted 13 to cDNA. The integrity of the cR24 coding sequence 14 in the cDNA samples is verified using individual PCR 15 reactions optimised to amplify specific sequences. 16 17 The packaged pLenti6/V5/R24 viral vector is also 18 being used for transduction of 293T cells in vitro. 19 Multiple pLenti6/V5/R24 viral dilutions are prepared 20 in standard tissue culture medium with the addition 21 of polybrene. The virus/medium/polybrene mixes are 22 then added to cells. After three hours the tissue 23 culture medium is replenished until after a further 24 72hrs the medium is harvested. The level of 25 secreted cR24 minibody is then quantified via ELISA. 26 Transduced cells are also selected with blasticidin 27 for a period of 7-10 days before medium is 28 harvested. Here also the level of secreted cR24 29 minibody is quantified via ELISA. 30 31 Furthermore, the packaged pLenti6/V5/R24 viral 32 vector is also being used for the transduction of WO 2004/047531 PCT/GB2003/005191 42 1 chick embryos in vivo via injection into the 2 subgerminal cavity, below the developing embryo but 3 above the yellow yolk. 4 5 6 Bibliography 7 8 Andersson, R. & Mynahan, R. May 2001 'The Protein 9 Production Challenge' In Vivo: The Business and 10 Medicine Report 15 (5) Windhover Information Inc. 11 12 Azzouz, M. et al 2002 'Multicistronic lentiviral 13 vector-mediated striatal gene transfer of aromatic 14 L-amino acid decarboxylase, tyrosine, hydrolase and 15 GTP cyclohydrolase I induces sustained transgene 16 expression, dopamine production and functional 17 improvement in a rat model of Parkinson's disease' 18 J. Neurosci. 22 10302-10312. 19 20 Bienemann, A.S. et al 2003 'Long-term replacement of 21 a mutated non-functional CNS gene: reversal of 22 hypothalamic diabetes insipidus using an EIAV-based 23 lentiviral vector expressing arginine vasopressin' 24 Mol. Ther. 7 588-596 25 26 Biopharm Cost of Goods Analysis: A Comparison 27 between Transgenic and Cell Culture Manufacture. 28 November 2001. 29 30 Bosselmann, R.A., Hsu, R.Y., Boggs, T., Hu, S., 31 Bruszewski, J., Ou, S., Kozar, L., Martin, F. Green, 32 C, and Jacobsen, F. 1989 'Germline transmission of WO 2004/047531 PCT/GB2003/005191 43 1 exogenous genes in the chicken' Science 243 (4890) 2 p533-535. 3 4 Brackett, B.G., Baranska, W., Sawicki, W., 5 Koprowski, H. 1971 'Uptake of heterologous genome by 6 mammalian spermatozoa and its transfer to ova 7 through fertilization'. Proc. Natl. Acad. Sci. USA. 8 68 (2) 353-7. 9 10 Challita, P.M. & Kohn, D.B. 1994 'Lack of expression 11 from a retroviral vector after transduction of 12 murine haematopoietic stem cells is associated with 13 methylation in vivo' Proc. Natl. Acad. Sci. USA. 91 14 2567-2571. 15 16 Clements, J.E. and Payne, S.L. 1994 'Molecular basis 17 of the pathobiology of lentiviruses' Virus Research 18 32 (2) p97-109. 19 20 Coffin, J.M., Hughes-, S.M. and Varmus, H.E. 1997 21 'Retroviruses' Cold Spring Harbor Laboratory Press. 22 23 Corcoran et al 2002 'Retinoic acid receptor P2 and 24 neurite outgrowth in the adult mouse spinal cord in 25 vitro' J. Cell Sci. 115 3779-3786 26 27 Curtis, H. & Barnes, N.S. 1989 'Biology' 5 th Edition 28 Worth Publishers, Inc. 29 30 Dove, A. 2000 'Milking the genome for profit' 31 Nature Biotechnology 18 p1045-1050. 32 WO 2004/047531 PCT/GB2003/005191 44 1 Etches, R.J. & Gibbins, A.M. (Eds) 2000 2 'Manipulation of the Avian Genome' CRC Press. 3 4 Eyal-Giladi, H. and Kochav, S. 1976 'From cleavage 5 to primitive streak formation.' Developmental 6 Biology 49(2) p321-337. 7 8 Gardner, R.L. 1968 'Mouse chimeras obtained by the 9 injection of cells into the blastocyst'. Nature 10 220 (167) p596-7. 11 12 Ginsburg, M. & Eyal-Giladi, H. 1987 'Primordial germ 13 cells of the young chick blastoderm originate from 14 the central zone of the A. pellucida irrespective of 15 the embryo-forming process' Development 101 209-211 16 17 Gordon, J.W. & Ruddle, F.H. 1981 'Integration and 18 stable germline transmission of genes injected into 19 mouse pronuclei'. Science 214 (4526) p1244-6. 20 21 Harvey, A.J., Speksnijder, G., Baugh, L. R., Morris, 22 J.A. and Ivarie, R. 2002 'Expression of exogenous 23 protein in the egg white of transgenic chickens' 24 Nature Biotechnology 19 p 3 9 6

-

3 9 9 . 25 26 Jaenisch, R. & Mintz, B. 1974 'Simian virus 40 DNA 27 sequences in DNA of healthy adult mice derived from 28 preimplantation blastocysts injected with viral 29 DNA'. Proc. Natl. Acad. Sci. USA. 71 (4) 1250-4. 30 31 Jahner, D., Stuhlmann, H., Stewart, C.L., Harbers, 32 K., Lohler, J., Simon, I. and Jaenisch, R. 1982 'De WO 2004/047531 PCT/GB2003/005191 45 1 novo methylation and expression of retroviral 2 genomes during mouse embryogenesis' Nature 298 3 (5875) p623-628. 4 5 Karagenc, L., Cinnamon, Y., Ginsburg, M. & Petitte, 6 J. 1996 'Origin of primordial germ cells in the 7 prestreak chick embryo' Dev. Genet. 19 290-301 8 9 Kumar, M., Bradow, B.P. and Zimmerberg, J. 2003 10 'Large-scale production of pseudotyped lentiviral 11 vectors using baculovirus GP64' Human Gene Therapy 12 14 67-77 13 14 Lois, C., Hong, E.J., Pease, S., Brown, E.J. and 15 Baltimore, D. 2002 'Germline Transmission and 16 Tissue-specific Expression of Transgenes delivered 17 by Lentiviral Vectors' Science 295 868-872. 18 19 Love, J., Gribbin, C., Mather, C and Sang, H. 1994 20 'Transgenic Birds by Microinjection' Biotechnology 21 12. 22 23 Mazarakis, N.D., Azzouz, M., Rohll, J.B., Ellard, 24 F.M., Wilkes, F.J., Olsen, A.L., Carter, E.E., 25 Barber, R.D., Baban, D.F., Kingsman, S.M., Kingsman, 26 A.J., O'Malley, K and Mitrophanous, K.A. 2001 27 'Rabies virus glycoprotein pseudotyping of 28 lentiviral vectors enables retrograde axonal 29 transport and access to the nervous system after 30 peripheral delivery' Hum. Mol. Genet. 10(19) 2109 31 2021 32 WO 2004/047531 PCT/GB2003/005191 46 1 Mitrophanous, K.A., Yoon, S., Rohl, J.B., Patil, D., 2 Wilkes, F.J., Kim, V.N., Kingsman, S.M., Kingsman, 3 A.K. and Mazarakis, N.D. 1996 'Stable Gene Transfer 4 to the Nervous System using a Non-Primate Lentiviral 5 Vector' Gene Therapy 6 p1808-1818. 6 7 Mizuarai, S., Ono, K., Yamaguchi, K., Nishijima, K., 8 Kamihira, M. & Iijima, S., 2001 'Production of 9 transgenic quails with high frequency of germ-line 10 transmission using VSV-G pseudotyped retroviral 11 vector' Biochem. Biophys. Res. Commun. 286 456-463 12 13 Mozdziak, P.E., Borwornpinyo, S., McCoy, D.W., 14 Petitte, J.N. 2003 'Development of transgenic 15 chickens expressing bacterial S-galactosidase' Dev. 16 Dyn. 226 439-445 17 18 Morrow, K.J.Jr. 2001 'Antibody Production: Planning 19 Well Ahead to Meet Future Demand' Genetic 20 Engineering News 21(7) April 1. 21 22 Mozdziak, P.E., Borwornpinyo, S., McCoy, D.W. & 23 Petitte, J.N. 2003 'Development of transgenic 24 chickens expresing bacterial 25 26 Naldini, L., Blomer, U., Gallay, P., Ory, D., 27 Mulligan, R., Gage, F.H. & Verma Trono, D. 1996 'In 28 vivo gene delivery and stable transduction of 29 nondividing cells by a lentiviral vector' Science 30 272 263-267 31 WO 2004/047531 PCT/GB2003/005191 47 1 Pain, B., Clark, E.M., Shen, M., Nakazawa, H., 2 Sakurai, M., Samarut, J. and Etches, R.J. 1996 3 'Long-term in vitro culture and characterisation of 4 avian embryonic stem cells with multiple 5 morphogenetic potentialities' Development 122 p2339 6 2348. 7 8 Parekh, R.B., Dwek, R.A., Rudd, P.M., Thomas, J.R., 9 Rademacher, T.W., Warren, T., Wun, T-C., Hebert, B., 10 Reitz, B., Palmier, M., Ramabhadran, T & Tierneier, 11 D.C. 1989 'N-Glycosylation and In vitro Enzymatic 12 Activity of Human Recombinant Tissue Plasminogen 13 Activator Expressed in Chinese Hamster Ovary Cells 14 and a Murine Cell Line' Biochemistry 28 7670-7679 15 16 Perry, M.M. 1988 'A complete culture system for the 17 chick embryo' Nature 331 (6151) p 70

-

72 . 18 19 Pfeifer, A., Ikawa, M., Dayn, Y. and Verma, I.M. 20 2002 'Transgenesis by Lentiviral vectors: Lack of 21 gene silencing in mammalian embryonic stem cells and 22 preimplantation embryos' Proceedings of the National 23 Academy of Sciences 99(4) p21 4 0-2145. 24 25 Raju, T., Briggs', J., Borge, S., Jones, A. 2000 26 'Species-specific variation in Glycosylation of IgG: 27 evidence for the species-specific sialylation and 28 brand-specific galactosylation and importance for 29 engineering recombinant glycoprotein therapies'. 30 Glycobiology 10 477-486. 31 WO 2004/047531 PCT/GB2003/005191 48 1 Raju, T., Briggs, J., Chamow, S.M., Winkler, M.E. & 2 Jones, A.J.S. 2001 'Glycoengineering of Therapeutic 3 Glycoproteins: In vitro Galactosylation and 4 Sialylation of Glycoproteins with Terminal N 5 Acetylglucosamine and Galactose residues' 6 Biochemistry 40 8868-8876 7 8 Rapp, J.C., Harvey, A.J., Speksnijder, G.L., Hu, W. 9 & Ivarie, R. 2003 'Biologically active human 10 interferon a-2b produced in the egg white of 11 transgenic hens' Transgenic Res. 12 569-575 12 13 Rholl, J.B. et al 2002 'Design, production, safety, 14 evaluation and clinical applications of non-primate 15 lentiviral vectors' Methods Enzymol. 346 466-500 16 17 Routier, F.H., Davies, M.J., Bergemann, K and 18 Housell, E.F. 1997 'The glycosylation pattern of a 19 humanized IgG1 antibody (D1.3) expressed in CHO 20 cells' Glycoconjugate Journal 14 201-207 21 22 Salter, D.W. 1993 In: Manipulation of the Avian 23 Genome' (Etches, R.J. and Verrinder Gibbins, A.M. 24 eds.) 135-150 CRC Press. 25 26 Salter, D.W. & Crittenden, L.B. 1989 'Artificial 27 insertion of a dominant gene for resistance to avian 28 leucosis virus into the germ line of the chicken' 29 Theor. Apple. Genet. 77 457-461. 30 31 Sang, H. and Perry, M.M. 1989 'Episomal replication 32 of cloned DNA injected into the fertilised ovum of WO 2004/047531 PCT/GB2003/005191 49 1 the hen, Gallus domesticus' Molecular Reproductive 2 Development 1(2) 98-106. 3 4 Sanjay, J.V., Stephens, E.B. and Narayan, 0. 1996 5 'Lentiviruses' 3 rd Edition. Vol.2. Lippincott-Raven 6 Publishers, Philadelphia. 7 8 SCRIP, June 8th 2001 'Companies face up to biotech 9 manufacturing issues' p6 PJB Publications Ltd. -10 11 Speksnijder, G. and Ivarie, R. 2000 Poultry Science 12 79, 1430-1433. 13 14 Von Seggern, D.J., Huang, S., Fleck, S.K., 15 Stevenson, S.C. and Nemerow, G.R. 2000 'Adenovirus 16 vector pseudotyping in fiber-expressing cell lines: 17 improved transduction of Epstein-Barr virus 18 transformed B cells' J. Virol. 74(1) 354-36. 19 20 Weck, E. 1999 'Transgenic animals: Market 21 Opportunities now a Reality' D&MD Reports. 22 23 Yee, J.K., Friedmann, T and Burns, J.C. 1994 24 "Generation of high-titer pseudotyped retroviral 25 vectors with very broad host range' Methods of Cell 26 Biology 43 Pt A 99-112. 27 28 Zhan, Y., Brady, J.H., Johnston, A.M. & Lew, A.M. 29 2000 'Predominant transgene expression in exocrine 30 pancreas directed by the CMV promoter' DNA Cell. 31 Biol. 19 639-645 WO 2004/047531 PCT/GB2003/005191 50 Table 1. PCR analysis of hatched chicks and germline transmission from founder cockerels Experiment: Construct Genome Germline (Viral titre) equivalents transmission Bird No. CAM Semen Transgenics/total 1. pONY8.0cZ 1-1 0 0.05 1/14 (7%) 5 x 17 T.U./ml 1-2 0.01 1-3 0 1-4 0.01 0.5 16/55 (29%) 1-5 0.01 0.1 nd 2. pONY8.OcZ 2-1 0.1 5 x 108 T.U./ml 2-2 0.1 1.0 4/20 (20%) 2-3 0 0.01 nd 2-4 0.1 0.5 19/67 (28%) 2-5 0 2-6 0.05 2-7 0.05 2-8 0.05 0.5 15/60 (25%) 3. pONY8.4GCZ 3-1 0 0.05 1/25 (4%) 7.2 x 108 T.U./ml 3-2 0 0.05 3/64 (5%) 3-3 0.01 3-4 0.01 0.05 4/100 (4%) 3-5 0.01 0.1 9/82 (11%) 3-6 0.01 2 4. pONY8.OG 4-1 0.05 1.0 20/44 (45%) 9.9 x 109 T.U./ml WO 2004/047531 PCT/GB2003/005191 -51 Table 2. Estimation of number of provirus insertions in the genome of G 1 birds Bird no. Total G 1 Number of birds with N insertions Total no. analysed 1 2 3 4 independent insertions 1-4 14 11 3 0 0 10 2-2 4 3 1 0 0 4 2-4 14 11 2 1 0 14 2-8 14 10 1 2 1 19

Claims (1)

1. Claims

   1 A method for the production of transgenic avians, the method comprising the step of using a lentivirus vector system to deliver exogenous genetic material to avian embryonic cells or cells of the testes.

   2 A method as claimed in claim 1 wherein the lentivirus vector system includes a lentivirus transgene construct in a form which is capable of being delivered to and integrated with the genome of avian embryonic cells or cells of the testes.

   3 A method as claimed in claim 2 wherein the lentivirus construct is injected into the subgerminal cavity of the contents of an opened egg which is then allowed to develop.

   4 A method as claimed in claim 2 wherein the construct is injected directly into the sub- blastodermal cavity of an egg.

   5 A method as claimed in any of the preceding claims wherein the vector construct transduces germ cells at high efficiency.

   6 A method as claimed in any of the preceding claims wherein the genetic material encodes a protein.

   7 A transgenic avian produced by a method as claimed in any of the preceding claims. 8 A transgenic avian and subsequent transgenic offspring produced as the offspring of a transgenic avian as claimed in claim 7.

   9 A method for the production of an heterologous protein in avians, the method comprising the step of delivering genetic material encoding the protein within a lentivirus vector construct to avian embryonic cells so as to create a transgenic avaian which expresses the genetic material in its tissues.

   10 A method as claimed in claim 9 wherein the transgenic avian expresses the gene in the oviduct so that the translated protein becomes incorporated into eggs.

   11 A method as claimed in claim 10 further comprising the step of isolating the protein from the eggs.

   12 Use of a lentivirus construct for the production of transgenic avians.

   13 Use of a lentivirus vector construct for the production of proteins in transgenic avians.

   14 Use as claimed in claim 13 of lentivirus vector construct for the expression of heterologous proteins in specific tissues, preferably egg white or yolk. 15 Use as claimed in any of claims 12 to 14 wherein the lentivirus is chosen from the group consisting of EIAV, HIV, SIV, BIV and FIV.

   16 Use as claimed in any of claims 12 to 15 wherein the construct includes suitable enhancer promoter elements for subsequent production of protein.

   17 Use as claimed in any of claims 12 to 16 wherein the vector construct particles are packaged to produce vector with an envelope.

   18 A method of determining the likelihood of expression of a protein in a transgenic avian, the method comprising the step of detecting expression of the protein in oviduct cells in vitro.