AU1619999A - Transdermal delivery of particulate vaccine compositions - Google Patents

Description

WO99/27961 PCT/US98/25563 5 TRANSDERMAL DELIVERY OF PARTICULATE VACCINE COMPOSITIONS Technical Field The invention relates to particulate 10 compositions. More particularly, the invention relates to methods of delivering particulate formulations, as well as methods for forming crystalline particles from pharmaceutical compositions and then delivering the same to a subject. The 15 particulate compositions are particularly suitable for transdermal vaccine delivery using a needleless syringe system. Background of the Invention 20 The ability to deliver agents into and through skin surfaces (transdermal delivery) provides many advantages over parenteral delivery techniques. In particular, transdermal delivery provides a safe, convenient and noninvasive alternative to traditional 25 administration systems, conveniently avoiding the major problems associated with parenteral delivery, e.g., needle pain, the risk of introducing infection to treated individuals, the risk of contamination or infection of health care workers caused by accidental 30 needle-sticks and the disposal of used needles. In addition, such delivery affords a high degree of control over blood concentrations of administered drugs. Recently, a novel transdermal drug delivery 35 system that entails the use of a needleless syringe to fire solid drug-containing particles in controlled -1- WO99/27961 PCT/US98/25563 doses into and through intact skin has been described. In particular, commonly owned U.S. Patent No. 5,630,796 to Bellhouse et al., describes a needleless syringe that delivers pharmaceutical particles 5 entrained in a supersonic gas flow. The needleless syringe (also referred to as "the PowderJect needleless syringe device") is used for transdermal delivery of powdered drug compounds and compositions, for delivery of genetic material into living cells 10 (e.g., gene therapy) and for the delivery of biopharmaceuticals to skin, muscle, blood or lymph. The needleless syringe can also be used in conjunction with surgery to deliver drugs and biologics to organ surfaces, solid tumors and/or to surgical cavities 15 (e.g., tumor beds or cavities after tumor resection). Pharmaceutical agents that can be suitably prepared in a substantially solid, particulate form can be safely and easily delivered using such a device. One particular needleless syringe generally 20 comprises an elongate tubular nozzle having a rupturable membrane initially closing the passage through the nozzle and arranged substantially adjacent to the upstream end of the nozzle. Particles of a therapeutic agent to be delivered are disposed 25 adjacent to the rupturable membrane and are delivered using an energizing means which applies a gaseous pressure to the upstream side of the membrane sufficient to burst the membrane and produce a supersonic gas flow (containing the pharmaceutical 30 particles) through the nozzle for delivery from the downstream end thereof. The particles can thus be delivered from the needleless syringe at delivery velocities of between Mach 1 and Mach 8 which are readily obtainable upon the bursting of the rupturable 35 membrane. -2- WO99/27961 PCT/US98/25563 Another needleless syringe configuration generally includes the same elements as described above, except that instead of having the pharmaceutical particles entrained within a supersonic 5 gas flow, the downstream end of the nozzle is provided with a bistable diaphragm which is moveable between a resting "inverted" position (in which the diaphragm presents a concavity on the downstream face to contain the pharmaceutical particles) and an active "everted" 10 position (in which the diaphragm is outwardly convex on the downstream face as a result of a supersonic shockwave having been applied to the upstream face of the diaphragm). In this manner, the pharmaceutical particles contained within the concavity of the 15 diaphragm are expelled at a supersonic initial velocity from the device for transdermal delivery thereof to a targeted skin or mucosal surface. Transdermal delivery using the above described needleless syringe configurations is carried 20 out with particles having an approximate size that generally ranges between 0.1 and 250 pm. Particles larger than about 250 pm can also be delivered from the device, with the upper limitation being the point at which the size of the particles would cause 25 untoward damage to the skin cells. The actual distance which the delivered particles will penetrate depends upon particle size (e.g., the nominal particle diameter assuming a roughly spherical particle geometry), particle density, the initial velocity at 30 which the particle impacts the skin surface, and the density and kinematic viscosity of the skin. Target particle densities for use in needleless injection generally range between about 0.1 and 25 g/cm, and injection velocities generally range between about 200 35 and 3,000 m/sec. -3- WO99/27961 PCT/US98/25563 A particularly unique feature of the needleless syringe is the ability to closely control the depth of penetration of delivered particles, thereby allowing for targeted administration of 5 pharmaceuticals to various sites. For example, particle characteristics and/or device operating parameters can be selected to provide for varying penetration depths for, e.g., intradermal or subcutaneous delivery. One approach entails the 10 selection of particle size, particle density and initial velocity to provide a momentum density (e.g., particle momentum divided by particle frontal area) of between about 2 and 10 kg/sec/m, and more preferably between about 4 and 7 kg/sec/m. Such control over 15 momentum density allows for precisely controlled, tissue-selective delivery of the pharmaceutical particles. The above-described systems provide a unique means for delivering vaccine antigens into or across 20 skin or tissue. However, many antigens require the use of immunological adjuvants in order to increase antigenic potency. Immunological adjuvants act to augment cell-mediated and humoral immune responses. Such adjuvants include depot adjuvants, compounds 25 which adsorb and/or precipitate administered antigens and which serve to retain the antigen at the injection site. Typical depot adjuvants include aluminum compounds and water-in-oil emulsions. Depot adjuvants, although increasing 30 antigenicity, often provoke severe persistent local reactions, such as granulomas, abscesses and scarring, when injected subcutaneously or intramuscularly. Other adjuvants, such as lipopolysacharrides and muramyl dipeptides, can elicit pyrogenic responses 35 upon injection and/or Reiter's symptoms (influenza like symptoms, generalized joint discomfort and -4- WO99/27961 PCT/US98/25563 sometimes anterior uveitis, arthritis and urethritis). Accordingly, there is a continued need for effective and safe delivery methods of adjuvants for enhancing immune responses to a given antigen. 5 Summary of the Invention The present invention provides unique adjuvant and vaccine compositions as well as a unique 10 system for delivering particulate pharmaceutical compositions, including vaccines and other therapeutic agents. Novel methods for making particulate pharmaceutical compositions are also provided. In one embodiment, then, a method is 15 provided for enhancing the immunogenicity of a selected antigen. The method comprises: (a) administering an effective amount of the antigen to a vertebrate subject; and (b) administering an amount of a particulate 20 adjuvant composition sufficient to enhance the immunogenicity of the antigen, wherein the adjuvant is delivered into or across skin or tissue of the vertebrate subject and further wherein the administering is carried out using a transdermal 25 delivery technique. The antigen and adjuvant may be present in the same or different compositions and may be administered to the same or different sites in the vertebrate subject. Furthermore, the antigen may be 30 administered prior or subsequent to, or concurrently with the adjuvant composition. In particularly preferred embodiments, the adjuvant and/or antigen are administered using a needleless syringe delivery device. 35 In another embodiment, the subject invention is directed to a method for eliciting an immune -5- WO 99/27961 PCT/US98/25563 response in a vertebrate subject. The method comprises transdermally delivering a particulate vaccine composition into or across skin or tissue of the vertebrate subject. The particulate vaccine 5 composition comprises: (a) an effective amount of a selected antigen; and (b) an amount of an adjuvant sufficient to enhance the immunogenicity of the antigen. 10 In yet another embodiment, the invention is directed to a particulate adjuvant composition suitable for delivery into or across skin or tissue of a vertebrate subject using a transdermal delivery technique. The particulate adjuvant composition can 15 be used to elicit a physiological effect in a vertebrate subject by administering an amount of the particulate adjuvant composition into or across skin or tissue of the vertebrate subject sufficient to bring about the physiological effect. 20 In another embodiment, a method is provided for converting conventional pharmaceutical formulations into crystallized particles that are optimally suited for transdermal delivery using a needleless syringe. Thus, in one aspect of the 25 invention, a liquid pharmaceutical formulation (e.g., either in aqueous form, or a reconstituted lyophilized product), is combined with a suitable excipient, for example a sugar, and then dried to provide a crystalline composition. The excipient is selected to 30 provide for sufficient rigidity, structure, and density in the resulting crystalline product. The crystalline composition, now having a sufficient density, can be used directly in a needleless syringe delivery technique, or can be further processed to 35 provide a more finely divided and/or uniform crystalline composition. -6- WO99/27961 PCT/US98/25563 In a further embodiment of the invention, a crystalline pharmaceutical composition is delivered to a subject in order to bring about a desired treatment. In one particular aspect, a crystalline vaccine 5 composition is delivered to a subject via needleless injection in order to provide for a biological response in the subject. In a preferred embodiment, the crystalline vaccine composition is delivered to the subject to elicit an antigen-specific immune 10 response in the subject. In yet another embodiment of the invention, a crystalline pharmaceutical composition is provided. The crystalline pharmaceutical has sufficient particle structure, rigidity and/or density characteristics 15 which renders it suitable for delivery into and/or through skin or mucosal tissue using a needleless syringe system. The crystalline pharmaceutical composition of the present invention can be made using the methods of the invention, and thus includes 20 vaccine compositions. These and other embodiments of the invention will readily occur to those of ordinary skill in the art in view of the disclosure herein. 25 Brief Description of the Drawings Figures 1A and lB depict the results of Example 1 where the effect of particle size on IgG antibody response was assessed in particulate vaccine formulations. 30 Figures 2-4 depict ELISA results from sera obtained from mice immunized with a crystalline Hib conjugate vaccine composition delivered using a needleless syringe. In Figure 2, the PRP-CRM197 conjugate was used as the capture phase, in Figure 3, 35 diphtheria toxoid was used as the capture phase, and -7- WO99/27961 PCT/US98/25563 in Figure 4, a PRP-HSA conjugate was used as the capture phase. Figure 5 depicts the IgG antibody response in subjects receiving descending doses of the Hib 5 conjugate vaccine compositions in either particulate or liquid form. Figures 6A and 6B depict the duration of immunity provided by the Hib conjugate vaccine compositions in either particulate or liquid form. 10 Figure 7 depicts antibody responses to an inactivated influenza virus vaccine composition delivered in either particulate or liquid form. The data represent geometric mean serum IgG titers from pooled sera. 15 Figures 8A and 8B depict the results of an influenza virus challenge study in subjects immunized with an inactivated influenza virus vaccine composition delivered in either particulate or liquid form. Subjects in Figure 8A received 25 Ag of 20 inactivated virus, while subjects in Figure 8B received 5 Ag of inactivated virus. The data represent weight loss as mean percentage of initial body weight. Figure 9 depicts the results of an influenza 25 virus challenge study in subjects immunized with an inactivated influenza virus vaccine composition adjuvanted with an Alum adjuvant and delivered in either particulate or liquid form. The data represent weight loss as the mean percentage of initial body 30 weight from eight animals. Figure 10 depicts the results of an influenza virus challenge study in subjects immunized with an inactivated influenza virus vaccine composition adjuvanted with a PCPP adjuvant and 35 delivered in either particulate or liquid form. The -8- WO99/27961 PCT/US98/25563 data represent weight loss as the mean percentage of initial body weight from eight animals. Figures 11A and 11B depict the results of influenza virus challenge studies in subjects 5 immunized with an inactivated influenza virus vaccine composition adjuvanted with a CpG adjuvant and delivered in either particulate (Figure 11A) or liquid (Figure 11B) form. The data represent weight loss as the mean percentage of initial body weight from eight 10 animals. Figure 12 depicts the results of an influenza virus challenge study in subjects immunized with an inactivated influenza virus vaccine composition adjuvanted with a MPL adjuvant and 15 delivered in either particulate or liquid form. The data represent weight loss as the mean percentage of initial body weight from eight animals. Detailed Description of the Preferred Embodiments 20 Before describing the present invention in detail, it is to be understood that this invention is not limited to particular pharmaceutical formulations or process parameters as such may, of course, vary. It is also to be understood that the terminology used 25 herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting. It must be noted that, as used in this specification and the appended claims, the singular 30 forms "a", "an" and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a pharmaceutical agent" includes a mixture of two or more pharmaceutical agents, reference to "an antigen" includes a mixture 35 of two or more antigens, reference to "an excipient" -9- WO99/27961 PCT/US98/25563 includes mixtures of two or more excipients, and the like. A. Definitions 5 Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although a number of methods and materials similar or equivalent 10 to those described herein can be used in the practice of the present invention, the preferred materials and methods are described herein. In describing the present invention, the following terms will be employed, and are intended to 15 be defined as indicated below. By "transdermal delivery" is meant delivery of particles to target tissue to provide a local, regional or systemic response. This contrasts with the direct introduction of substances across cell 20 membranes into living cells and tissue which is designed to operate on an intracellular level. Preferably, the particle size of the administered substance is larger than the cells present in the targeted tissue. Generally, for mammalian cells, 25 particles larger than 10

A

M will achieve this desired effect. Suitable size ranges for particles are discussed further below. Thus, the term "transdermal" delivery intends intradermal (e.g., into the dermis or 30 epidermis), transdermal (e.g., "percutaneous") and transmucosal administration, i.e., delivery by passage of an agent into or through skin or mucosal tissue. See, e.g., Transdermal Drug Delivery: Developmental Issues and Research Initiatives, Hadgraft and Guy 35 (eds.), Marcel Dekker, Inc., (1989); Controlled Drug Delivery: Fundamentals and Applications, Robinson and -10- WO99/27961 PCT/US98/25563 Lee (eds.), Marcel Dekker Inc., (1987); and Transdermal Delivery of Drugs, Vols. 1-3, Kydonieus and Berner (eds.), CRC Press, (1987). By "needleless syringe" is meant an 5 instrument which delivers a particulate composition transdermally, without a conventional needle that pierces the skin. Needleless syringes for use with the present invention are discussed througout this document. 10 As used herein, the term "pharmaceutical agent" intends any compound or composition of matter which, when administered to an organism (human or animal) induces a desired pharmacologic and/or physiologic effect by local and/or systemic action. 15 The term therefore encompasses those compounds or chemicals traditionally regarded as drugs and vaccines, as well as biopharmaceuticals including molecules such as peptides, hormones, nucleic acids, gene constructs and the like. 20 By "antigen" is meant a molecule which contains one or more epitopes that will stimulate a host's immune system to make a cellular antigen-specific immune response, or a humoral antibody response. Thus, antigens include proteins, 25 polypeptides, antigenic protein fragments, oligosaccharides, polysaccharides, and the like. Furthermore, the antigen can be derived from any known virus, bacterium, parasite, plants, protozoans, or fungus, and can be a whole organism. The term also 30 includes tumor antigens. Similarly, an oligonucleotide or polynucleotide which expresses an antigen, such as in DNA immunization applications, is also included in the definition of antigen. Synthetic antigens are also included, for example, polyepitopes, 35 flanking epitopes, and other recombinant or synthetically derived antigens (Bergmann et al. (1993) -11- WO99/27961 PCT/US98/25563 Eur. J. Immunol. 23:2777-2781; Bergmann et al. (1996) J. Immunol. 157:3242-3249; Suhrbier, A. (1997) Immunol. and Cell Biol. 75:402-408; Gardner et al. (1998) 12th World AIDS Conference, Geneva, 5 Switzerland, June 28-July 3, 1998). The term "vaccine composition" intends any pharmaceutical composition containing an antigen, which composition can be used to prevent or treat a disease or condition in a subject. The term thus 10 encompasses both subunit vaccines, i.e., vaccine compositions containing antigens which are separate and discrete from a whole organism with which the antigen is associated in nature, as well as compositions containing whole killed, attenuated or 15 inactivated bacteria, viruses, parasites or other microbes. Viral vaccine compositions used herein include, but are not limited to, those containing, or derived from, members of the families Picornaviridae 20 (e.g., polioviruses, etc.); Caliciviridae; Togaviridae (e.g., rubella virus, dengue virus, etc.); Flaviviridae; Coronaviridae; Reoviridae; Birnaviridae; Rhabodoviridae (e.g., rabies virus, etc.); Filoviridae; Paramyxoviridae (e.g., mumps virus, 25 measles virus, respiratory syncytial virus, etc.); Orthomyxoviridae (e.g., influenza virus types A, B and C, etc.); Bunyaviridae; Arenaviridae; Retroviradae (e.g., HTLV-I; HTLV-II; HIV-1; and HIV-2); simian immunodeficiency virus (SIV) among others. 30 Additionally, viral antigens may be derived from papillomavirus (e.g., HPV); a herpesvirus; a hepatitis virus, e.g., hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), the delta hepatitis virus (HDV), hepatitis E virus (HEV) and 35 hepatitis G virus (HGV); and the tick-borne encephalitis viruses. See, e.g. Virology, 3rd Edition -12- WO99/27961 PCT/US98/25563 (W.K. Joklik ed. 1988); Fundamental Virology, 2nd Edition (B.N. Fields and D.M. Knipe, eds. 1991), for a description of these and other viruses. Bacterial vaccine compositions used herein include, but are not 5 limited to, those containing or derived from organisms that cause diphtheria, cholera, tuberculosis, tetanus, pertussis, meningitis, and other pathogenic states, including, Meningococcus A, B and C, Hemophilus influenza type B (HIB), and Helicobacter pylori. 10 Examples of anti-parasitic vaccine compositions include those derived from organisms causing malaria and Lyme disease. A composition which contains a selected antigen along with an adjuvant, or a vaccine 15 composition which is coadministered with the subject adjuvant, displays "enhanced immunogenicity" when it possesses a greater capacity to elicit an immune response than the immune response elicited by an equivalent amount of the antigen administered without 20 the adjuvant. Thus, a vaccine composition may display "enhanced immunogenicity" because the antigen is more strongly immunogenic or because a lower dose or fewer doses of antigen are necessary to achieve an immune response in the subject to which the antigen is 25 administered. Such enhanced immunogenicity can be determined by administering the adjuvant composition and antigen controls to animals and comparing antibody titers and/or cellular-mediated immunity against the two using standard assays such as radioimmunoassay, 30 ELISAs, CTL assays, and the like, well known in the art. For purposes of the present invention, an "effective amount" of an adjuvant will be that amount which enhances an immunological response to a coadministered antigen such that the antigen displays 35 enhanced immunogenicity as described above. -13- WO99/27961 PCT/US98/25563 Similarly, an "effective amount" of an antigen is an amount which will stimulate an immune response in the subject to which the antigen is administered. The immune response may be a humoral, 5 cell-mediated and/or protective immune response. As used herein, the term "coadministered" such as when an adjuvant is coadministered with a vaccine antigen, intends either the simultaneous or concurrent administration of adjuvant and antigen, 10 e.g., when the two are present in the same composition or administered in separate compositions at nearly the same time but at different sites, as well as the delivery of adjuvant and antigen in separate compositions at different times. For example, the 15 adjuvant composition may be delivered prior to or subsequent to delivery of the antigen at the same or a different site. The timing between adjuvant and antigen deliveries can range from about several minutes apart, to several hours apart, to several days 20 apart. Furthermore, although the adjuvant composition is delivered to the skin using transdermal delivery methods such as a needleless syringe, the vaccine composition may be delivered using conventional delivery techniques, such as by conventional syringes 25 and conventional vaccine guns. As used herein, the term "treatment" includes any of following: the prevention of infection or reinfection; the reduction or elimination of symptoms; and the reduction or complete elimination of 30 a pathogen. Treatment may be effected prophylactically (prior to infection) or therapeutically (following infection). By "vertebrate subject" is meant any member of the subphylum cordata, particularly mammals, 35 including, without limitation, humans and other primates. The term does not denote a particular age. -14- WO99/27961 PCT/US98/25563 Thus, both adult and newborn individuals are intended to be covered. Pharmaceutical agents, alone or in combination with other drugs or agents, are typically 5 prepared as pharmaceutical compositions which can contain one or more added materials such as carriers, vehicles, and/or excipients. "Carriers," "vehicles" and "excipients" generally refer to substantially inert materials which are nontoxic and do not interact 10 with other components of the composition in a dele terious manner. These materials can be used to increase the amount of solids in particulate pharmaceutical compositions, such as those prepared using spray-drying or lyophilization techniques. 15 Examples of normally employed "excipients" or "carriers" include pharmaceutical grades of dextrose, sucrose, lactose, trehalose, mannitol, sorbitol, inositol, dextran, starch, cellulose, sodium or calcium phosphates, calcium sulfate, citric or 20 tartaric acids (and pharmaceutically acceptable salts thereof), glycine, high molecular weight polyethylene glycols (PEG), and combinations thereof. Exemplary excipients that serve as stabilizers include commonly available cryoprotectants and antioxidants. 25 B. General Methods The invention provides for delivery of particulate pharmaceutical compositions, particularly vaccine compositions. These particualte compositions 30 can be delivered to a subject using a transdermal needleless syringe delivery device. The ability to transdermally administer vaccine compositions in particulate (powder) form to tissue such as the skin provides a significant improvement over prior 35 vaccination methods which generally rely on conventional needle and syringe injection techniques. -15- WO99/27961 PCT/US98/25563 In this regard, almost all current vaccines are administered by intramuscular injection. However, injected vaccines need to get to local draining lymph nodes in order to initiate an immune response. A 5 large portion of a vaccine composition injected intramuscularly will rapidly diffuse into surrounding tissue and circulation, thus becoming lost or diluted. In contrast, when vaccine compositions are delivered transdermally, e.g., to skin, such losses will not 10 occur. This is because the top layers of skin have stronger antigen retaining ability due to poor vascularity. Particulate vaccine compositions are also better retained in the skin because of a slower dissolving process. The cellular component in the 15 skin may also contribute to improved vaccine performance following transdermal administration. This is because there is a dense network of Langerhans cells in the epidermal layer and dendritic cells in the cutaneous layer of skin. These cells are 20 important in the initiation and maintenance of an immune response. By delivering vaccine compositions in the proximity of these immune cells, it is feasible to achieve a stronger immune response than by conventional intramuscular injection. These immune 25 cells may also pick up the vaccine and migrate to the local draining lymph node, thereby initiating an immune response. Transdermal administration of particulate compositions to skin or mucosal tissue also improves 30 the safety and efficacy of commonly used immunomodulators such as adjuvants. Immunomodulators are often important components of vaccines and immune therapeutics. Immunomodulators have many functions including, for example, immune enhancement, 35 immunosuppression, and immune modulation. Immune enhancement improves the efficacy of a vaccine or -16- WO99/27961 PCT/US98/25563 immunotherapeutics. Immune enhancement also enables the immune system to respond to smaller doses of vaccine compositions. For example, the aluminum (Alum) adjuvant immunomodulator is used to formulate 5 diphtheria and tetanus toxoid vaccines to improve their immunogenicity. Some immunomodulators that have immunosuppressive properties are also useful in treating certain diseases, such as autoimmune diseases and organ transplantation. Immunomodulators can also 10 direct the immune systems to generate either a Thl- or Th2-type of response, or to switch one type of established response to another type. This immune modulating property is very important in immunotherapy. For example, subjects having an immune 15 system biased toward a Th2-type response tend to have allergies. Immunomodulators which can help promote a Thl-type response are thus useful in immune therapy to desensitize those individuals. As with conventional vaccine compositions, 20 immunomodulators are typically administered by intramuscular injection. One of the problems with this injection method is the toxicity of immunomodulators after they have reached systemic circulation. It is for this reason that many 25 immunomodulators can not be used in humans. Intramuscular injection also requires a high dose of immunomodulators (relative to transdermally delivered immunomodulators) in order to be effective since a large portion of injected material will rapidly 30 diffuse from the injection site, generally entereing into the circulation. In this regard, an adjuvant may need to exert its activities at the injection site or in the local draining lymph node(s) to enhance vaccine performance. 35 Transdermal delivery of immunomodulators to skin or mucosal tissue in accordance with the present -17- WO99/27961 PCT/US98/25563 invention is advantageous for the following reasons. First, the skin and mucosa are very potent parts of the immune system. As discussed above, there is a dense network of immune cells in the various layers of 5 skin (e.g., Langerhans cells in the epidermal layer and dendritic cells in the cutaneous layer). Mucosal epithelium cells contain large number of intraepithelial dendritic cells. These cells are important in the initiation and maintenance of an 10 immune response, making them prime targets for immunomodulation. By delivering immunomodulators in close proximity to these cells, and avoiding rapid loss by diffusion, it is feasible to achieve a stronger immunomodulation effect than by intramuscular 15 injection. The effective dose of immunomodulators can also be significantly reduced. A lower dose helps reduce toxicity associated with many immunomodulators. Accordingly, in one embodiment, the 20 invention entails a procedure for forming crystalline particles (suitable for transdermal delivery) from conventional pharmaceutical preparations. Although the methods of the invention are broadly applicable to any pharmaceutical composition, the invention is 25 exemplified herein with particular reference to methods which use liquid (aqueous) or reconstituted dried vaccine compositions as starting materials. One common method of preparing and storing vaccine pharmaceuticals involves lyophilization 30 (freeze-drying). Lyophilization relates to a technique for removing moisture from a material and involves rapid freezing at a very low temperature, followed by rapid dehydration by sublimation in a high vacuum. This technique typically yields low-density 35 porous particles having an open matrix structure. Such particles are chemically stable, but are rapidly -18- WO99/27961 PCT/US98/25563 reconstituted (disintegrated and/or brought into solution) when introduced into an aqueous environment. Another method of preparing and storing vaccine compositions from delicate or heat-sensitive 5 biomolecules is spray-drying. Spray-drying relates to the atomization of a solution of one or more solids using a nozzle, spinning disk or other device, followed by evaporation of the solvent from the droplets. More particularly, spray-drying involves 10 combining a highly dispersed liquid pharmaceutical preparation (e.g., a solution, slurry, emulsion or the like) with a suitable volume of hot air to produce evaporation and drying of the liquid droplets. Spray dried pharmaceuticals are generally characterized as 15 homogenous spherical particles that are frequently hollow. Such particles have low density and exhibit a rapid rate of solution. In one method of the invention, a liquid composition, (an aqueous or a reconstituted spray 20 dried or lyophilized composition) is converted into a dry, crystalline powder suitable for delivery into and/or through skin or mucosal tissues. The liquid composition can be combined with a suitable carrier or excipient which provides for enhanced crystal 25 formation, particle structure, rigidity and/or density characteristics. Preferred carriers or excipients include pharmaceutical-grade sugars and the like including, for example, trehalose. The composition is then allowed to dry under suitable evaporative 30 conditions, resulting in a crystallized composition. The crystals can then be removed from the drying surface or container, and lightly broken up, for example, using mortar and pestle. The resulting crystalline powder can then be loaded into suitable 35 delivery cassettes for delivery to a subject using a needleless syringe. -19- WO99/27961 PCT/US98/25563 Although not limiting in the present invention, the above-described method can be used to obtain crystalline particles having a size ranging from about 0.1 to about 250 Am, preferably about 10 to 5 about 250 pm and a particle density ranging from about 0.1 to about 25 g/cm. These crystalline particles can be used in the treatment or prevention of a variety of diseases. In another embodiment, the invention 10 pertains to delivery of particulate compositions, particularly adjuvant and vaccine compositions. The adjuvant and vaccine compositions may be in crystalline form, as described above, or may be delivered in an uncrystallized, particulate state. 15 Antigens for use with the present invention can be produced using a variety of methods known to those of skill in the art. In particular, the antigens can be isolated directly from native sources, using standard purification techniques. 20 Alternatively, the antigens can be produced recombinantly using known techniques. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Vols. I, II and III, Second Edition (1989); DNA Cloning, Vols. I and II (D.N. Glover ed. 25 1985). Antigens for use herein may also be synthesized, based on described amino acid sequences, via chemical polymer syntheses such as solid phase peptide synthesis. Such methods are known to those of skill in the art. See, e.g., J. M. Stewart and J. D. 30 Young, Solid Phase Peptide Synthesis, 2nd Ed., Pierce Chemical Co., Rockford, IL (1984) and G. Barany and R. B. Merrifield, The Peptides: Analysis, Synthesis, Biology, editors E. Gross and J. Meienhofer, Vol. 2, Academic Press, New York, (1980), pp. 3-254, for solid 35 phase peptide synthesis techniques; and M. Bodansky, Principles of Peptide Synthesis, Springer-Verlag, -20- WO99/27961 PCT/US98/25563 Berlin (1984) and E. Gross and J. Meienhofer, Eds., The Peptides: Analysis, Synthesis, Biology, supra, Vol. 1, for classical solution synthesis. Once obtained, the antigen of interest is 5 formed into a particulate vaccine composition as described herein and administered to a subject, generally along with an immunological adjuvant which serves to enhance the immune response to the antigen. As explained above, the adjuvant can be present in the 10 same or a separate composition and can be delivered simultaneously with the vaccine composition, or prior or subsequent to antigen delivery. Additionally, adjuvant delivery can be at the same or a different site. 15 Unfortunately, most known adjuvants are highly toxic. Thus, the only adjuvant currently approved for human usage is alum, an aluminum salt composition. A number of adjuvants are, however, used in animal 20 studies and several adjuvants for human use are undergoing preclinical and clinical studies. Surprisingly, adjuvants which are generally considered too toxic for human use may be administered with the present methods. Without being 25 bound by a particular theory, it appears that delivery of adjuvants to the skin, using transdermal delivery methods, allows interaction with Langerhans cells in the epidermal layer and dendritic cells in the cutaneous layer of the skin. These cells are 30 important in initiation and maintenance of an immune response. Thus, an enhanced adjuvant effect can be obtained by targeting delivery to or near such cells. Additionally, because the top layers of the skin are poorly vascularized, the amount of adjuvant entering 35 the systemic circulation is reduced, thereby reducing the toxic effect. Furthermore, because skin cells are -21- WO99/27961 PCT/US98/25563 constantly being sloughed, residual adjuvant is eliminated rather than absorbed. Moreover, less adjuvant can be administered than that delivered using conventional techniques such as intramuscular 5 injection. Accordingly, the present invention may effectively be used with a large variety of adjuvants without concomitant toxicity. Such adjuvants include, without limitation, adjuvants formed from aluminum salts (alum), such as aluminum hydroxide, aluminum 10 phosphate, aluminum sulfate, etc; oil-in-water and water-in-oil emulsion formulations, such as Complete Freunds Adjuvant (CFA) and Incomplete Freunds Adjuvant (IFA); adjuvants formed from bacterial cell wall components such as adjuvants including monophosphoryl 15 lipid A (MPL) (Imoto et al. (1985) Tet. Lett. 26:1545 1548), trehalose dimycolate (TDM), and cell wall skeleton (CWS); adjuvants derived from ADP ribosylating bacterial toxins, a group of potent toxins to humans, include diphtheria toxin, pertussis 20 toxin (PT), cholera toxin (CT), the E. coli heat labile toxins (LT1 and LT2), Pseudomonas endotoxin A, C. botulinum C2 and C3 toxins, as well as toxins from C. perfringens, C. spiriforma and C. difficile, particularly ADP-ribosylating bacterial toxin mutants 25 such as CRM 197 , a non-toxic diphtheria toxin mutant (see, e.g., Bixler et al. (1989) Adv. Exp. Med. Biol. 251:175; and Constantino et al. (1992) Vaccine); saponin adjuvants such as Quil A (U.S. Pat. No. 5,057,540), or particles generated from saponins such 30 as ISCOMs (immunostimulating complexes); cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e.g., gamma interferon), macrophage colony stimulating factor (M CSF), tumor necrosis factor (TNF), etc; muramyl 35 peptides such as N-acetyl-muramyl-L-threonyl-D isoglutamine (thr-MDP), N-acetyl-normuramylL-alanylD -22- WO99/27961 PCT/US98/25563 isoglutamine (nor-MDP) , N-acetylmuramylalanylD isoglutaminyl-'-alanine-2 - (1'-2'-dipalmitoyl-sn glycero-3 huydroxyphosphoryloxy)-ethylamine (MTP-PE), etc.; adjuvants derived from the CpG family of 5 molecules, CpG dinucleotides and synthetic oligonucleotides which comprise CpG motifs (see, e.g., Krieg et al. Nature (1995) 374:546 and Davis et al. J. Immunol. (1998) 160:870-876) such as TCCATGACGTTCCTGATGCT (SEQ ID NO:l) and 10 ATCGACTCTCGAGCGTTCTC (SEQ ID NO:2); and synthetic adjuvants such as PCPP (Poly[di(carboxylatophenoxy)phosphazene) (Payne et al. Vaccines (1998) 16:92-98). Such adjuvants are commercially available from a number of distributors 15 such as Accurate Chemicals; Ribi Immunechemicals, Hamilton, MT; GIBCO; Sigma, St. Louis, MO. Once obtained, the adjuvant, with or without the antigen of interest, is formed into a particle suitable for transdermal delivery using any suitable 20 particle formation technique, such as air-drying (crystallization) freeze-drying (lyophilization), spray-coating or supercritical fluid techniques. The compositions may also be prepared as crystalline compositions, as described above. 25 Following their formation, the subject particles are delivered transdermally to mammalian tissue using a suitable transdermal delivery technique. Various particle acceleration devices suitable for transdermal delivery of the substance of 30 interest are known in the art, and will find use in the practice of the invention. A particularly preferred transdermal delivery system employs a needleless syringe to fire solid drug-containing particles in controlled doses into and through intact 35 skin and tissue. See, e.g., U.S. Patent No. 5,630,796 to Bellhouse et al. which describes a needleless -23- WO99/27961 PCT/US98/25563 syringe (also known as "the PowderJect® needleless syringe device"). Other needleless syringe configurations are known in the art and are described herein. 5 The particles are administered to the subject in a manner compatible with the dosage formulation, and in an amount that will be effective to achieve the desired physiological response. Generally, the response generated will be 10 prophylactically and/or therapeutically effective. Thus, for example, if an antigen or vaccine composition is being delivered, the amount administered will be sufficient to generate an immune response. If an adjuvant is coadministered with the 15 antigen, it will be delivered in an amount sufficient to enhance the immune response to the coadministered antigen. It is readily apparent that the amount of the composition to be delivered depends on the particular substance administered, the subject to be 20 treated and the disease to be prevented or treated. Generally about .5 pg to 1000 yg of adjuvant, more generally 1 jg to about 500 Ag of adjuvant and most preferably about 5 jg to about 300 pg of adjuvant will be effective to enhance an immune 25 response of a given antigen. Thus, for example, for CpG, doses in the range of about .5 to 50 jg, more preferably 1 to about 25 jg, preferably 5 to about 20 jg, will find use with the present methods. Similarly, for alum or PCPP, a dose of about 25 jg to 30 about 500 jg, preferably about 50 to about 250 jg, and most preferably about 75 to about 150 jg, will find use herein. For MPL, a dose in the range of about 10 to 250 jg, preferably about 20 to 150 jg, and most preferably about 40 to about 75 jg, will find use with 35 the present methods. -24- WO99/27961 PCT/US98/25563 Doses for other adjuvants can readily be determined by one of skill in the art using routine methods. The amount to administer will depend on a number of factors including the coadministered 5 antigen, as well as the ability of the adjuvant to act as an immune stimulator. Similarly, if an antigen is administered transdermally, either in the same or a different composition, generally 50 ng to 1 mg and more 10 preferably 1 Ag to about 50 Ag of antigen, will be useful in generating an immune response. The exact amount necessary will vary depending on the age and general condition of the subject to be treated, the severity of the condition being treated and the 15 particular antigen or antigens selected, the site of administration, as well as other factors. An appropriate effective amount can be readily determined by one of skill in the art upon reading the instant specification and through routine trials. 20 Dosage treatment may be a single dose schedule or a multiple dose schedule. For vaccine compositions, a multiple dose schedule is one in which a primary course of vaccination may be with 1-10 separate doses, followed by other doses given at 25 subsequent time intervals, chosen to maintain and/or reinforce the immune response, for example at 1-4 months for a second dose, and if needed, a subsequent dose(s) after several months. The dosage regimen will also, at least in part, be determined by the need of 30 the subject and be dependent on the judgment of the practitioner. Furthermore, if prevention of disease is desired, the compositions are generally administered prior to primary infection with the pathogen of interest. If treatment is desired, e.g., 35 the reduction of symptoms or recurrences, the -25- WO99/27961 PCT/US98/25563 compositions are generally administered subsequent to primary infection. 5 C. Experimental Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present 10 invention in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for. 15 C.1 Particle Formulations and Particle Formation Techniques Example 1 20 Particulate Vaccine Compositions The following study was carried out to assess the effect that various excipients and particle formation processes have on the physical properties of 25 the resultant particulate vaccine compositions, and the immunogenicity of such reformulated vaccines. Diphtheria toxoid (dT), a purified subunit protein antigen, was selected for formulation with different excipients including mannitol (plus 30 polyvinylpyrrolidone (PVP)), sucrose, and trehalose. Two powder processing techniques, freeze-drying and air-drying (evaporative drying), were also compared. For each formulation tested, the resulting particulate composition was classified in the following particle 35 fractions: <20pm, 20-38gm, 38-53gm, and 53-75gm using 3" diameter stainless steel sieves. -26- WO99/27961 PCT/US98/25563 Physical characterization of the particulate vaccine compositions included an assessment of size distribution, penetration energy, optical microscopy, scanning electronic microscopy, absolute density, pore 5 size distribution, surface area analysis, and X-ray powder diffraction. To determine immunogenicity of reformulated vaccine delivered with a needleless syringe device (e.g., a PowderJect® needleless syringe device) or by 10 conventional syringe/needle injection, Balb/C mice (female, 6-8 weeks old) were vaccinated on weeks 0 and 4. Mice vaccinated with the PowderJect® needleless syringe device received 5pg of vaccine formulated with 1 mg of excipient. Control mice were injected 15 intraperitoneally with a conventional needle and syringe. Two weeks post boost, sera was collected and pooled from 8 mice, and antibodies to dT were determined by ELISA. The result of the physical characterization 20 of the particulate compositions was as follows: (1) the air-drying process yielded high density crystal particles, while freeze-drying yielded relatively low density amorphous powders; and (2) particle size distribution appeared to be independent of excipients 25 and the particle formation process used. The particles were fractionated by sieving into 5 sizes (<20pm, 20-38pm, 38-53pm, 53-75pm, and >75pm, and the mass distribution for each fraction is about equivalent. 30 The results of the immunogenicity assessment are depicted in Tables 1 and 2 below, and in Figure 1. As can be seen, immunogenicity between the various particulate vaccine compositions was very similar (among all formulations and different size fractions 35 for the same formulation). All of the particulate compositions delivered by needleless syringe elicited -27- WO99/27961 PCT/US98/25563 higher antibody titers than the control group (conventional needle and syringe delivery). The trehalose excipient appeared to perform slightly better than the other formulations, and the 20-53pm 5 fractions appeared to be more immunogenic (see Figure 1). However, both the <20Am and the >75Am particle fractions were more immunogenic than the control (aqueous compositions, conventional needle and syringe delivery). It can also be seen that needleless 10 syringe (PowderJect®) delivery of the crystalline vaccine composition particles resulted in a higher seroconversion rate than the control (conventional needle and syringe) injection method (see Table 2). In this regard, 97% (157 out of 162) of animals 15 developed serum antibodies after a single PowderJect® vaccination, while the seroconversion rate was 37.5% (3 out of 8 ) for the control group. 20 25 30 35 -28- WO 99/27961 PCT/US98/25563 Table 1 IgG Antibodies to dT (Pooled Serum) Excipient Particle Particle Delivery Prime Boost Formation Size Method Method (Am) 5 saline control - syringe 1220 111600 and needle trehalose Air-dry <20 PJ* 1550 616380 trehalose Air-dry 20-38 PJ 5460 1390700 10 trehalose Air-dry 38-53 PJ 7295 1282100 trehalose Air-dry 53-75 PJ 2690 577080 trehalose Air-dry >75 PJ 2310 620460 trehalose/ Freeze- 20-38 PJ 1590 441140 mannitol dry trehalose + Freeze- 38-53 PJ 4590 686540 15 mannitol dry trehalose + Freeze- 53-75 PJ 2850 657780 mannitol dry trehalose + Freeze- >75 PJ 1940 282630 mannitol dry sucrose Air-dry 20-38 PJ 4650 1160220 20 sucrose Air-dry 38-53 PJ 3040 515760 sucrose Air-dry 53-75 PJ 1750 372160 sucrose Air-dry >75 PJ 5230 759240 sucrose Freeze- 20-38 PJ 1525 618100 dry 25 sucrose Freeze- 38-53 PJ 2950 614780 dry sucrose Freeze- 53-75 PJ 7830 802850 dry sucrose Freeze- >75 PJ 1800 780710 dry 30 Mannitol/PVP Freeze- 20-38 PJ 3700 494330 dry Mannitol/PVP Freeze- 38-53 PJ 2810 609940 dry Mannitol/PVP Freeze- 53-75 PJ 4580 935700 dry 35 Mannitol/PVP Freeze- >75 PJ 1590 447630 dry PJ = PowderJect Note: Week 0 sera had a titer <200. The dT dose for all vaccination is 5 jg. -29- WO99/27961 PCT/US98/25563 Table 2 Seroconversion Rate Excipient Particle Seroconverted/Total Animals Formulatio n Method <20 20-38 38-53 53-75 >75 5 Trehalose Air-Dry 4/4 7/8 7/8 7/8 8/8 Trehalose Freeze-Dry - 8/8 8/8 8/8 7/8 + Mannitol Sucrose Air-Dry - 7/8 8/8 7/7 7/7 Sucrose Freeze-Dry - 8/8 8/8 8/8 6/8 10 Mannitol/P Freeze-Dry - 8/8 7/8 8/8 7/8 VP DT/injecti - 3/8 on 15 C.2 Formation and Assessment of Crystalline Vaccine Compositions Example 2 Formulation of Crystalline Vaccine Compositions A number of conventional vaccine 20 compositions were crystallized using the following methods. Pneumococcus capsular polysaccharide #14 (CPl4) was obtained as a lyophilized powder from the ATCC. A volume of 1 ml of Water for Injection was 25 dispensed into a 2 mg vial of CPl4, and the resulting suspension was continuously mixed at 4 0 C overnight as specified by the manufacturer's instructions. 100 p~l aliquots of the mixture were made and frozen until needed. A quantity of 99.5 mg trehalose (Sigma) 30 powder was weighed and mixed with defrosted aliquots of the CPl4 suspension to provide a 500 pg total of CP14. Approximately 1200 .l of Water for Injection was used to dissolve the CPl4/trehalose mixture, and the solution was thoroughly mixed. 100 Al aliquots of 35 the solution were then dispensed onto the surface of weigh boats, and placed in the constant airflow -30- WO99/27961 PCT/US98/25563 provided by a fume hood. The droplets were then dried evaporatively over the next 1-2 days to form a crystalline product. The crystals were removed from the weigh boats and ground lightly using mortar and 5 pestle. One standard adult vial of Engerix-B® (Smith Kline Beecham), which contains 20 pg of the HepB surface antigen adsorbed onto 0.5 mg aluminum hydroxide (alum) was combined with 10 mg trehalose, 10 and the resulting solution mixed thoroughly. 100 Al droplets were dispensed onto weigh boats, and desiccated as described herein above. After approximately 36 hours of evaporative drying, crystalline vaccine residues were carefully removed 15 from the weigh boats using a spatula. The crystalline composition was then ground lightly using mortar and pestle until the larger crystals had been visibly reduced in size. 1.25 + 0.25 mg aliquots were dispensed into drug cassettes, providing a nominal 20 dose of 2.5 Ag of the Hepatitis B surface antigen. A quantity of Hepatitis B surface antigen (HbsAg), purified from human plasma, was obtained (Biodesign International). The HbsAg was combined with trehalose and dl water solution. The resulting 25 solution was gently mixed, poured into a glass petri dish and allowed to air-dry for 2 days under a fume hood. Further drying was carried out for an additional day in a desiccator (Nalgene Plastic desiccator) which was purged with N 2 gas. The dried 30 solid composition was collected by scraping and then comminuted using a mortar and pestle. The resultant dry powder was weighed, and the amount of dry material for each dose was determined by dividing the total weight by the number of doses formulated. Particle 35 size distribution of the formulated HbsAg vaccine composition varied over a broad range (1-100 pm). -31- WO99/27961 PCT/US98/25563 Typically, each dose required about 1-2 mg of dry mass, with a weighing variation of about 10% or less. A quantity HibTITER® (Wyeth Lederle), which is comprised of a PRP-CRM197 conjugate vaccine 5 composition, was obtained. The composition contains polyribosyl ribose phosphate (polysaccharide from type b Haemophilus influenzae) conjugated to the CRM197 mutant diphtheria toxin carrier, and is referred to herein as the "Hib conjugate vaccine composition." 10 The Hib conjugate vaccine composition was combined with trehalose, and the resulting solution mixed thoroughly. The solution was then dispensed onto weigh boats, and desiccated as previously described. After evaporative drying, crystalline vaccine residues 15 were obtained from the weigh boats, and the crystalline composition was ground lightly using mortar and pestle, and appropriate dosages thereof were measured into cassettes for delivery from a needleless syringe. 20 A quantity of influenza virus, PR8 strain, was obtained from Spafas (Storrs, CT). In addition, a quantity of influenza virus, Aichi strain, was obtained from Dr. Yoshihero Kawaoka, Veterinary School, University of Wisconsin (Madison, Wisconsin). 25 Each virus was inactivated by standard formalin treatment (1:4,000, 48 hours at 4 0 C). Inactivated virus (either PR8 or Aichi) was then combined with trehalose and dl water solution. The resulting solution was gently mixed, poured into a glass petri 30 dish and allowed to air-dry for 2 days under a fume hood. Further drying was carried out for an additional day in a desiccator (Nalgene Plastic desiccator) which was purged with N 2 gas. The dried solid composition was collected by scraping and then 35 comminuted using a mortar and pestle. The resultant dry powder was weighed, and the amount of dry material -32- WO99/27961 PCT/US98/25563 for each dose was determined by dividing the total weight by the number of doses formulated. Particle size distribution of the formulated whole-inactivated virus vaccine composition varied over a broad range 5 (1-100 p.m). Typically, each dose required about 1-2 mg of dry mass, with a weighing variation of about 10% or less. A quantity of Diphtheria toxoid was obtained (Accurate Chemical & Scientific Corp., manufactured by 10 Statems Serum Institute, Denmark). The toxoid was combined with trehalose and dl water solution. The resulting solution was gently mixed, poured into a glass petri dish and allowed to air-dry for 2 days under a fume hood. Further drying was carried out for 15 an additional day in a desiccator (Nalgene Plastic desiccator) which was purged with N 2 gas. The dried solid composition was collected by scraping and then comminuted using a mortar and pestle. The resultant dry powder was weighed, and the amount of dry material 20 for each dose was determined by dividing the total weight by the number of doses formulated. Particle size distribution of the formulated Diphtheria toxoid vaccine composition varied over a broad range (1-100 Am). Typically, each dose required about 1-2 mg of 25 dry mass, with a weighing variation of about 10% or less. Example 3 Vaccination with the Crystalline 30 Vaccine Compositions Devices: Unless otherwise noted, the needleless syringe delivery devices used in skin delivery studies (either the PowderJect® ND device series or Oral PowderJect® device series) were 35 obtained from PowderJect Technologies, Ltd., Oxford, UK. The PowderJect® ND device is generally described -33- WO99/27961 PCT/US98/25563 in commonly owned U.S. Patent No. 5,630,796. The Oral PowderJect® device is generally described in commonly owned International Publication No. WO 96/20022. The gas cylinders in the devices used herein were 5 typically filled with helium gas between 40 and 60 bar pressure, although anywhere from 30 to 80 bar pressure can also be used. In operation, compressed helium in the gas cylinder is released upon actuation of the device, rupturing the membranes of the particle 10 containing payload cassette. A supersonic condition is created, and the resulting high velocity gas flow propels the particles as projectiles into the target tissue surface. Varying the pressure of the helium gas in the gas cylinder can control the depth of 15 penetration. For conventional needle and syringe delivery, disposable syringes were fitted with 26.5 gauge needles. Mice and vaccination: Female Balb/c mice or Swiss Webster mice, 7 weeks of age were purchased from 20 an authorized vendor (e.g., HSD) and acclimated for 1 week at a mouse facility before vaccination. Mice were anesthetized by an intraperitoneal (IP) injection of 100mg/kg ketamine mixed withl0 mg/kg xylazine, and the abdominal skin at the target site was depilated by 25 shaving. The needleless syringe device was gently pressed against the vaccination site and abutted. A typical immunization regime consisted of two vaccinations, four weeks apart, with blood collection via retro-orbital bleeding under anesthesia prior to 30 each vaccination and two weeks post boost. ELISA: In general, antibody response to the reformulated vaccines was determined by an ELISA. A 96-well plate was coated with 0.1Ag of detecting antigen in PBS per well overnight at 4 0 C. The plates 35 were washed 3 times with TBS containing 0.1% Brij-35, and incubated with test sera diluted in PBS containing -34- WO99/27961 PCT/US98/25563 1% BSA for 1.5 hours. A serum standard, which contains high level of antibodies to specific antigen, was added to each plate and used to standardize the titer in the final data analysis. The plates were then 5 washed and incubated with biotin-labeled goat antibodies specific for mouse immunoglobulin IgG or IgG subclasses (1:8,000 in PBS, Southern Biotechnology) for 1 hr at room temperature. Following three additional washes, the plates were 10 incubated with strepavidin-horseradish peroxidase conjugates (1:8,000 in PBS, Southern Biotechnology) for 1 hr at room temperature. Finally, the plates were washed and developed with a TMB substrate kit (obtained from Bio-Rad, Richmond, CA). Endpoint 15 titers of the test sera were determined using the Softmax Pro 4.1 program (Molecular Devices) as the calibrated highest dilution with an A450 that exceeded the mean background by 0.1. Mean background absorbence was determined by wells that received all 20 reagents but test sera. 1. Vaccination with crystalline pneumococcus capsular polysaccharide #14 (CPl4). Experimental groups of Balb/c mice were randomly 25 formed based on the route of administration (intraperitoneal (IP) or intradermal (ID)), and formulation, as shown in the test matrix of Table 3. The mice were given a prime and a boost four weeks after the prime using the above-described crystalline 30 CP14 vaccine composition, and then bled 10 days after the boost. For the boost, the mice were anesthetized with an injection of a mouse anesthetic to enable retro-orbital bleeding prior to booster administration. For needleless syringe delivery, fur 35 was removed by clipping, and delivery was carried out using 60 bar gaseous pressure from the PowderJect® -35- WO99/27961 PCT/US98/25563 needleless syringe delivery device. Serum samples are then analyzed to determine antibody titers to pneumococcus. 5 Table 3 Group n Delivery Pressure Formulation CP dose # Route (bar) (pg) I 3 N/S-IP --- CP14 + 5 Trehalose with alum 10 II 3 N/S-IP --- CP14 + 5 Trehalose III 3 N/S-IP --- CP14 + Alum 5 IV 4 PJ-ID 60 CP14 + 5 Trehalose V 4 PJ-ID 60 CP14 + 10 15 Trehalose VI 4 PJ-ID 60 CP14 50 VII 2 PJ-ID 60 Trehalose 0 only 2. Vaccination with the crystalline 20 Hepatitis B (HepB) surface antigen vaccine composition. The crystalline HepB vaccine composition (as described above) was administered (in 2.5 jg carbohydrate doses) to mice as follows. Eight Balb/c mice were divided into two cohorts based on the 25 vaccine composition and delivery technique used: (1) intraperitoneal using a needle-syringe to deliver conventional (liquid) Engerix-B® vaccine composition (n=2); and (2) intradermal using a PowderJect® needleless syringe to deliver the crystalline vaccine 30 composition (n=6). Delivery pressure from the PowderJect® device ranged from 40 to 60 bar. All animals were boosted three weeks after priming, and bled 10 days following the boost. Antibody titers to the Hepatitis B surface 35 antigen were then determined by ELISA using the blood samples obtained 10 days post administration of the -36- WO 99/27961 PCT/US98/25563 boost. The results are depicted below in Table 4. Titers greater than about 10 mIU/mL are considered sero-protective. As can be seen, 5 out of 6 of the animals receiving the crystalline composition via 5 needleless syringe were protected by the crystalline vaccine composition. Table 4 Mouse Delivery Route Po Comments 10 # (bar) 1 Needle-syringe --- -- (IP) 2 Needle-syringe --- -- (IP) 3 PowderJect® (ID) 40 Prime: poor 15 delivery 4 PowderJect® (ID) 40 Prime: good 5 PowderJect® (ID) 40 Prime: OK 6 PowderJect® (ID) 60 Prime: OK 7 PowderJect® (ID) 60 Prime: OK 20 8 PowderJect® (ID) 60 Prime: microbleeds A subsequent boost using the same crystalline HepB surface antigen vaccine composition was sufficient to significantly raise all antibody titers in the animals receiving the needleless 25 injection (via the PowderJect® device), such that all 6 animals were protected by the crystalline vaccine composition. 30 3. Vaccination with the crystalline 30 Haemophilus influenzae polyribosyl ribose phosphate conjugate vaccine composition (Hib conjugate). The above-described crystalline Hib conjugate vaccine composition was administered to mice as follows. Swiss Webster mice were divided into experimental 35 groups based on administration technique, dosage, and -37- WO99/27961 PCT/US98/25563 formulation: (Group 1, 2 Ag (PRP carbohydrate) of a liquid Hib conjugate vaccine composition delivered IP using conventional needle and syringe, n=3); (Group 2, 2.5 Ag (PRP carbohydrate) of the crystalline Hib 5 conjugate vaccine composition delivered to skin using the PowderJect® needleless syringe, n=6); and (Group 3, control (naive), n=3). All vaccinated animals received a prime, followed by a boost at 4 weeks after prime. Serum samples were collected 2 weeks after 10 boost, pooled and antibody titers to immobilized PRP CRM197 were determined using ELISA. Due to observed differences in binding of human and mouse anti-Haemophilus polysaccharide (HbPs) antibodies, the HbO-HA ELISA described by Phipps et 15 al. (1990) J. Immunol. Methods 135:121-128, was adapted for use in testing mouse sera. The assay conditions adapted for the measurement of mouse anti HbPs antibodies are noted in Table 5 below. All other assay conditions are as described by Phipps et al. 20 Table 5 Human Mouse Antigen Coating PBS 50 mM HEPES Buffer 25 Serum Dilution PBS/0.3% Tween 50 mM HEPES/0.1% Buffer 20/0.01M EDTA Brij 35/1% FBS Serum Incubation 60 minutes at room Overnight @ 4 0 C Time & Temp temperature Secondary Antibody anti-human Ig* AP anti-mouse IgG* AP Conjugate 30 Secondary Conjugate PBS/0.05% Tween 20 50 mM HEPES/0.1% Buffer Brij 35/1% FBS Wash Buffer PBS/0.1% Tween 20 50 mM HEPES/0.1% Brij 35 *Evaluation has shown that quantitative antibody values in mouse sera measured using this ELISA are higher 35 than those measured using a radio-antigen binding assay (RABA) especially for sera with titers less than 10 Ag/mL in the RABA. -38- WO99/27961 PCT/US98/25563 The results of the ELISA are depicted below in Table 6. As can be seen, the crystalline vaccine composition gave comparable results with the 5 conventional vaccine composition. Table 6 Immunogenicity of Hib Conjugate in Mice Number ELISA Titer to of Ag X Mode of PRP-CRM197 10 Immunogen Mice Doses Delivery IgG IgM PRP- 3 2 jig X 2 Needle, 24,300 <100 CRM197 IP PRP- 6 2.5 jg X Dry 24,300 <100 CRM197 2 Powder, Skin 15 None 3 - Naive <100 <100 In order to further characterize the immune response in the animals receiving the Hib conjugate vaccine composition, the following study was carried 20 out. Three experimental groups of 6 mice each were 20 assembled as follows: (Group 1, 2 Ag dose (PRP carbohydrate) of the crystalline Hib conjugate vaccine composition delivered intradermally using the PowderJect® needleless syringe device); (Group 2, 2 pg 25 dose (PRP carbohydrate) of a conventional liquid Hib 25 conjugate vaccine composition delivered intraperitoneally (IP) using needle and syringe); and (Group 3, control). The animals were primed, and then boosted four weeks later. Sera collected 2 weeks 30 after boost were pooled, and serial dilutions were 30 assayed using the above-described ELISA techniques. In a first ELISA, the PRP-CRM197 conjugate was used as the capture phase. The results of this first ELISA are reported below in Table 7, and depicted in Figure 35 2. As can be seen, the crystalline composition 3935 -39- WO 99/27961 PCT/US98/25563 provided a substantially identical response relative to the conventional vaccine delivery. Table 7 5 Vaccine Response Dilu- IP* PJ* Naive tion 1 100 1.09 1.131 0.058 (0.024) (0.012) (0.019) 2 300 0.934 0.989 0.02 10 (0.053) (0.003) (0.016) 3 900 0.8015 0.774 0.02 (0.0445) (0.004) (0.014) 4 2700 0.449 0.502 0.015 (0.071) (0.002) (0.013) 5 8100 0.279 0.277 0.01 (0.006) (0.004) (0.001) 15 6 24300 0.129 0.115 0.009 (0.0315) (0.005) (0.001) 7 72900 0.0545 0.041 0.017 (0.0018) (0.001) (0.008) 8 21870 0.109 0.062 (0.02) 0.073 0 (0.005) (0.021) 20 * (IP) = intraperitoneal needle & syringe delivery, (PJ) = PowderJect® needleless syringe delivery. In order to assess the specificity of the immune response, a second ELISA was performed using 25 diphtheria toxoid as the capture phase. In this regard, CRM197 is a mutant form of the diphtheria toxoid, but CRM197 is highly cross-reactive. Binding of antisera to the diphtheria toxin was thus used to assess response toward the CRM197 carrier protein. 30 The results are reported below in Table 8, and are depicted in Figure 3. Again, the crystalline vaccine composition gave comparable results to the conventional vaccine composition. 35 -40- WO 99/27961 PCT/US98/25563 Table 8 1 2 3 4 Dilution Naive PJ* IP* 1 100 0.21 1.856 1.8 5 2 300 0.102 1.846 1.64 3 900 0.117 1.688 1.616 4 2700 0.084 1.38 1.194 5 8100 0.072 0.931 0.797 10 6 24300 0.077 0.578 0.512 7 82900 0.072 0.3 0.269 8 248700 0.072 0.165 0.17 * (IP) = intraperitoneal needle & syringe delivery, (PJ) = PowderJect® needleless syringe delivery. 15 In order to detect PRP-specific antibody response, a third ELISA was performed using a PRP human serum albumin (PRP-HSA) conjugate as the solid (capture) phase. Since the mice had not been immunized with the PRP-HSA conjugate, and had not been 20 exposed to HSA in other contexts, antibody binding is due to the presence of anti-PRP antibodies. The results of this ELISA are reported in Table 9 below, and depicted in Figure 4. As can be seen, the crystalline and the conventional (liquid) Hib 25 conjugate vaccine compositions gave comparable results. 30 35 -41- WO 99/27961 PCT/US98/25563 Table 9 1 2 3 4 Serum Naive PJ* IP* Dilution 5 1 200 0.184 1.244 1.649 2 400 0.143 0.731 0.956 3 800 0.113 0.455 0.625 4 1600 0.097 0.259 0.322 5 3200 0.075 0.159 0.171 10 6 6400 0.064 0.105 0.094 7 12800 0.064 0.078 0.068 * (IP) = intraperitoneal needle & syringe delivery, (PJ) = PowderJect® needleless syringe delivery. 15 In order to determine antibody responses to descending doses of Hib conjugate vaccine following PowderJect® delivery or conventional needle-syringe injection, the following study was carried out. Swiss Webster mice (female, 6-8 weeks old) were vaccinated 20 twice (prime and boost) with either a liquid Hib conjugate vaccine composition or the crystalline Hib conjugate vaccine composition at 4 week-intervals. Four doses (lyg, 0.2pg, 0.04Ag, and 0.01g per dose) of the Hib conjugate composition were tested. For 25 needleless syringe vaccination, each vaccine dose was formulated with 1 mg of trehalose. Control mice were injected intraperitoneally (IP) with a conventional needle and syringe. Blood samples were collected prior to each vaccination, and 2-weeks post boost. 30 Antibodies to PRP and CRM197 were assayed by ELISA as described above. Sera collected 2 weeks post boost were pooled, and the pooled sera were assayed using the above-described ELISA techniques. The results are depicted in Figure 5. As can be seen, at the lg 35 dose, the IgG titers appeared to be comparable between the mice immunized by PowderJect® needleless syringe -42- WO99/27961 PCT/US98/25563 delivery and the mice immunized using conventional needle and syringe. In the 0.01-0.2pg dose range, antibody levels in the mice immunized using the PowderJect® device appeared to be higher than mice in 5 the corresponding needle and syringe delivery groups. In addition, antibody responses to CRM197 were also measured in the immunized animals. Dose-dependent responses were seen in the groups immunized with the PowderJect® device (see Figure 5). Control mice 10 (those animals which were immunized by conventional needle and syringe injection) responded to vaccinations at the higher (lpg and 0.2pg) doses, but not at the lower doses. These data indicate that transdermal immunization of particulate vaccine 15 compositions using the PowderJect® needleless syringe device is more effective than delivery of liquid vaccine compositions using conventional needle and syringe injection techniques, especially for delivering antigens at low doses. 20 In order to assess the duration of immunity provided by the crystalline Hib conjugate vaccine composition, the following study was carried out. Swiss Webster mice (female, 6-8 weeks old) were vaccinated with two doses (prime and boost) of the Hib 25 conjugate crystalline vaccine composition at 4 week intervals. For PowderJect® needleless syringe vaccinations, lpg of vaccine was formulated with 1mg of the trehalose excipient. As controls, mice were injected IP with 5Ag of a liquid Hib conjugate vaccine 30 composition using conventional needle and syringe delivery techniques. Blood samples were collected before each vaccination, 2 weeks post boost, and monthly thereafter. Antibodies specific to PRP and CRM197 were assayed using the above-described ELISA 35 techniques. The results of the ELISA assays are depicted in Figures 6A and 6B. As can be seen, -43- WO99/27961 PCT/US98/25563 PowderJect® delivery of 1pg of the crystalline Hib conjugate vaccine composition generated levels of serum antibodies to PRP and CRM197 equivalent to that elicited by 5Ag of conjugate administered by 5 conventional needle and syringe injection. Antibodies peaked two weeks after boost and lasted for 8 months without significant reduction. The results indicate that transdermal delivery of the particulate vaccine composition with the PowderJect® device elicits a 10 long-lasting serum antibody response that is comparable to conventional needle and syringe delivery of a liquid vaccine composition. 4. Vaccination with the crystalline 15 inactivated influenza virus vaccine composition. In order to determine antibody responses to descending doses of influenza vaccine following PowderJect® delivery of a crystalline vaccine composition or conventional needle and syringe injection of a liquid 20 vaccine composition, the following study was carried out. Five experimental groups of Balb/c mice (female, 6-8 weeks old) were established in order to assess five different doses of the above-described crystalline inactivated influenza virus (Aichi strain) 25 composition. The five groups received vaccinations at weeks 0, 4 and 10.5 with 25Ag, 5pg, l 1 g, 0.2Ag, or 0.04Ag, respectively, of the inactivated influenza virus. For PowderJect® transdermal administration, each dose of the vaccine was formulated with 1 mg of 30 trehalose. Five groups of control mice were also established. These control mice received vaccinations at weeks 0, 4 and 10.5 with 25pg, 5pg lg, 0.2Ag, or 0.04Ag, respectively, of inactivated influenza virus in a liquid vaccine composition (administered IP by 35 conventional needle and syringe injection). Two weeks after the third vaccination, sera from 8 mice were -44- WO99/27961 PCT/US98/25563 collected and pooled, and an ELISA determined antibodies to influenza virus. Two weeks post boost, antibody titers in pooled sera were determined against the Aichi virus 5 using the above-described ELISA techniques. The results of the ELISA are depicted in Figure 7. As can be seen, there was a dose dependent antibody response for both the PowderJect® transdermal delivery of the crystalline composition and the conventional needle 10 and syringe injection of the liquid composition. However, at the same doses of vaccine, the PowderJect® vaccination elicited higher antibody titers than the needle and syringe injection, indicating that PowderJect® delivery of a crystalline vaccine to the 15 skin improves vaccine performance. Pooled sera were also tested for hemagglutination inhibition activity (HI). The results of the HI activity assay are depicted below in Table 10. As can be seen, there were dose-dependent 20 HI titers in the sera from the vaccinated animals. HI titers from animals receiving PowderJect® delivery and conventional needle and syringe injection are similar at the higher vaccine doses (25gg, 5pg and lpg). However, at the lower vaccine doses (0.2gg and 0.04gg) 25 HI titers were only elicited in animals receiving the crystalline composition from the PowderJect® system. 30 35 -45- WO99/27961 PCT/US98/25563 Table 10 HI Antibody Titer in Pooled Week 12 Sera Influenza PowderJect® Syringe and Vaccine (Ag) Delivery Needle Injection 5 25 40 80 5 20 20 1 20 10 0.2 10 10 0.04 10 In order to assess protection against a subsequent influenza virus challenge, the vaccinated animals were challenged on week 12 by intranasal 15 instillation of 1 x 106 PFU (100X LDs 5 o) of a mouse adapted Aichi influenza virus. More particularly, ten days after the final immunization, mice were anesthetized by an intraperitoneal injection of 100mg/kg ketamine mixed withl0 mg/kg xylazine. 1 x 106 20 particle forming units (PFUs) of influenza virus in 50 ~l of saline was slowly instilled into the opening of nasal cavity. The mice naturally inhaled the liquid. Animals were then allowed to recover. Body weight of the animals was taken prior to challenge and daily 25 post challenge for 14 days. Animals were monitored daily for symptoms and survival. Animals that lost 25% of pre-challenge body weight and became moribund were euthanized by CO 2 . Survival and body weight loss were recorded 30 daily for 14 days after the challenge. All animals lost weight during days 3-7 after challenge. Survivors gained their weight back by day 14. The results of the protection study are depicted below in Table 11. The survival statistics for animals 35 receiving the vaccine compositions containing 25Ag and 5Ag of the inactivated virus are depicted in Figures -46- WO99/27961 PCT/US98/25563 8A and 8B, respectively. As can be seen, at the 251g dose, PowderJect® administration of the crystalline composition gave better protection against mortality than the liquid composition when delivered via 5 conventional needle and syringe injection. A correlation between antibody response and survival was seen in that the animals that died had lower antibody titers. At the 5pg dose, PowderJect® administration of the crystalline composition provided partial 10 protection against mortality, compared with no protection in the animals receiving the same dose by conventional needle and syringe injection. Therefore, transdermal delivery of the crystalline composition via the PowderJect® device provided better protection 15 than conventional needle and syringe injection. Table 11 Influenza Challenge Experiment Survival/Total 20 Influenza Vaccine (pg) PowderJect® Syringe & Needle 25 7/8 5/8 5 3/8 0/8 1 0/8 0/8 25 0.2 0/8 0/8 0.04 0/8 0/8 Note: Mice received 3-vaccinations on weeks 0, 4 and 10, were challenged with 100X LD50 of a homolgous mouse adapated influenza virus on week 12. Data 30 represents protection for 2 weeks post-challenge. 5. Vaccination with the crystalline Diphtheria toxoid (dT) vaccine composition. In order to determine antibody responses to descending doses of 35 dT vaccine following PowderJect® delivery of the 35 crystalline composition, and to compare these antibody -47- WO99/27961 PCT/US98/25563 responses with those attained from conventional needle and syringe injection, the following study was carried out. Two experimental groups of Balb/c mice (female, 6-8 weeks old) were established. The animals received 5 vaccinations at weeks 0 and 4 with a liquid dT vaccine composition (delivered by needle and syringe injection) or with a crystalline vaccine composition (delivered by the PowderJect® needleless syringe device). Two vaccine doses were tested, that is 10 vaccine compositions containing 5pg and 1pg of the dT toxoid. For PowderJect® vaccination, each dose of vaccine was formulated with 1 mg of trehalose. Control mice were injected IP with a conventional needle and syringe. Two weeks after the final 15 vaccinations, sera were collected and pooled from 8 mice, and antibodies to dT were determined by the above described ELISA techniques. The results of the ELISA are depicted below in Table 12. As can be seen, transdermal delivery of 20 the crystalline composition containing 1Ag of dT resulted in a serum antibody response that was 15-fold higher than in animals receiving the same dose of a liquid vaccine composition by conventional needle and syringe injection. This indicates that particle 25 mediated skin delivery is an effective way to administer the dT vaccine. At the 5Ag dose, serum antibody levels in animals receiving the crystalline composition by the PowderJect® device were similar to those seen in animals receiving the liquid composition 30 by conventional needle and syringe injection. 35 -48- WO99/27961 PCT/US98/25563 Table 12 IgG Titer to dT in Pooled Week 6 Sera Determined by ELISA dT (jg) Serum IgG Titer Serum IgG Titer (PowderJect®) (Syringe/Needle) 5 1 8130 570 5 188830 149560 C.3 Formation and Assessment of Particulate Adjuvant Compositions 10 Example 4 Formulation of Particulate Adjuvant Compositions A number of conventional adjuvant compositions were formulated in particulate (powder) 15 form pursuant to the methods of the invention. These and other adjuvants can be readily reformulated as powders using any number of conventional particle forming processes. Suitable excipients for the adjuvant compositions include trehalose, sucrose, 20 agarose, mannitol, or a mixture of these and/or other sugars. Particle formation techniques can include air-drying, freeze-drying, spray-coating, and supercritical fluid methods. However, all adjuvant formulations used in the following experiments were 25 prepared using the crystallization methods of the present invention (particularly as described above in Sections C.1 and C.2) unless expressly noted otherwise. The particulate adjuvant compositions were produced 30 as follows. A quantity of aluminum hydroxide and aluminum phosphate adjuvant ("Alum adjuvant") was obtained (manufactured by Superfow Biosector a/s, obtained from Accurate Chemical and Scientific Corp.). 35 The Alum adjuvant was combined with trehalose and dl water solution. The resulting solution was gently -49- WO99/27961 PCT/US98/25563 mixed, poured into a glass petri dish and allowed to air-dry for 2 days under a fume hood. Further drying was carried out for an additional day in a desiccator (Nalgene Plastic desiccator) which was purged with N 2 5 gas. The dried solid composition was collected by scraping and then comminuted using a mortar and pestle. The resultant dry powder was weighed, and the amount of dry material for each dose was determined by dividing the total weight by the number of doses 10 formulated. Particle size distribution of the formulated Alum adjuvant composition varied over a broad range (1-100 Am). Typically, each dose required about 1-2 mg of dry mass, with a weighing variation of about 10% or less. 15 A quantity of the MPL adjuvant (monophosphoryl Lipid A purified from S. minnesota R595) was obtained (RIBI ImmunoChem Research, Inc.). The MPL adjuvant was combined with trehalose and dl water solution. The resulting solution was gently 20 mixed, poured into a glass petri dish and allowed to air-dry for 2 days under a fume hood. Further drying was carried out for an additional day in a desiccator (Nalgene Plastic desiccator) which was purged with N 2 gas. The dried solid composition was collected by 25 scraping and then comminuted using a mortar and pestle. The resultant dry powder was weighed, and the amount of dry material for each dose was determined by dividing the total weight by the number of doses formulated. Particle size distribution of the 30 formulated MPL adjuvant composition varied over a broad range (1-100 Am). Typically, each dose required about 1-2 mg of dry mass, with a weighing variation of about 10% or less. A quantity of CpG adjuvant (20mer synthetic 35 oligonucleotides, CpG-1: ATCGACTCTCGAGCGTTCTC, SEQ ID NO. 1 and CpG-2: TCCATGACGTTCCTGATGCT, SEQ ID NO. 2) -50- WO99/27961 PCT/US98/25563 was obtained (GIBCO-BRL). The CpG adjuvant was combined with trehalose and dl water solution. The resulting solution was gently mixed, poured into a glass petri dish and allowed to air-dry for 2 days 5 under a fume hood. Further drying was carried out for an additional day in a desiccator (Nalgene Plastic desiccator) which was purged with N 2 gas. The dried solid composition was collected by scraping and then comminuted using a mortar and pestle. The resultant 10 dry powder was weighed, and the amount of dry material for each dose was determined by dividing the total weight by the number of doses formulated. Particle size distribution of the formulated CpG adjuvant composition varied over a broad range (1-100 Am). 15 Typically, each dose required about 1-2 mg of dry mass, with a weighing variation of about 10% or less. A quantity of PCPP adjuvant (a synthetic polymer- poly[di(carboxylatophenoxy)phosphazene]) was obtained (Virus Research Institute). The PCPP 20 adjuvant was combined with trehalose and dl water solution. The resulting solution was gently mixed, poured into a glass petri dish and allowed to air-dry for 2 days under a fume hood. Further drying was carried out for an additional day in a desiccator 25 (Nalgene Plastic desiccator) which was purged with N 2 gas. The dried solid composition was collected by scraping and then comminuted using a mortar and pestle. The resultant dry powder was weighed, and the amount of dry material for each dose was determined by 30 dividing the total weight by the number of doses formulated. Particle size distribution of the formulated PCPP adjuvant composition varied over a broad range (1-100 Am). Typically, each dose required about 1-2 mg of dry mass, with a weighing variation of 35 about 10% or less. -51- WO99/27961 PCT/US98/25563 Example 5 Vaccination with the Particulate Adjuvant Compositions The devices used to deliver the particulate 5 compositions (i.e., the PowderJect® needleless syringe devices) and the control (liquid) compositions (i.e., conventional needle and syringe) are as described above in Example 3. The experimental animals (female Balb/c mice) were handled as above, vaccine 10 compositions were also delivered as described above, and the same ELISA techniques as described above were used in the following studies. The crystalline and control (liquid) vaccine compositions which were used in the following studies were the inactivated whole 15 influenza virus (Aichi strain) compositions and the Diphtheria toxoid compositions described above in Example 2. Viral challenge studies (in the influenza studies) with the mouse-adapted Aichi influenza strain were carried out as described above in Example 3. 20 1. Vaccination studies with the particulate Alum adjuvant composition. The particulate Alum adjuvant composition was used as an adjuvant with the crystalline inactivated influenza 25 vaccine composition and delivered via the PowderJect® needleless syringe delivery system. Mice were vaccinated with 5pg or 1g of the crystalline inactivated influenza vaccine composition either with or without 100 Ag of the particulate Alum adjuvant 30 composition. Control animals were vaccinated subcutaneously ("S/C") with aqueous formulations of the same vaccine/ adjuvant compositions using a conventional needle and syringe. After three vaccinations were carried out (at weeks 0, 4, and 35 10.5), week 12 sera were pooled from 8 mice, and -52- WO99/27961 PCT/US98/25563 antibodies to influenza virus were determined by the above-described ELISA techniques. The results of the ELISA study are reported in Table 13 below. Following skin delivery of Alum 5 adjuvanted influenza vaccine, the serum antibody response was significantly higher when compared with animals receiving the same dose of vaccine without the adjuvant. Serum antibody levels in the animals that received the particulate compositions via the 10 PowderJect® device were similar to those from animals that were vaccinated with the same vaccine/adjuvant composition using conventional techniques. Accordingly, the Alum adjuvant can be delivered to the skin in powder form to enhance the immunogenicity of 15 an influenza vaccine. Table 13 Total IgG Titer in Pooled Week 12 Sera Determined by ELISA Aluminum Influenza Serum IgG Titer Serum IgG Titer 20 (gg) Vaccine (PowderJect®) (Syringe/Needle) (Ag) none 5 6790 1505 none 1 873 804 100 5 27180 19198 25 100 1 2539 9966 In order to assess protection against a subsequent influenza virus challenge, the vaccinated animals were challenged on week 12 by intranasal instillation of 1 x 106 PFU (100X LD 5 0 ) of a mouse 30 adapted Aichi influenza virus. More particularly, ten days after the final immunization, mice were anesthetized by an intraperitoneal injection of 100mg/kg ketamine mixed withl0 mg/kg xylazine. 1 x 106 particle forming units (PFUs) of influenza virus in 50 35 5 l of saline was slowly instilled into the opening of nasal cavity. The mice naturally inhaled the liquid. -53- WO 99/27961 PCT/US98/25563 Animals were then allowed to recover. Body weight of the animals was taken prior to challenge and daily post challenge. Animals were monitored daily for symptoms and survival. Animals that lost 25% of pre 5 challenge body weight and became moribund were euthanized by CO 2 . Survival and body weight loss were recorded daily for 14 days after the challenge. These results are reported below in Table 14 and depicted in Figure 10 9. As can be seen, the survival rate in mice receiving the Alum-adjuvanted vaccine was much greater than that in mice receiving the vaccine alone. PowderJect® delivery of the particulate Alum adjuvanted influenza vaccine composition offered 15 better protection against weight loss than syringe and needle injection (see Figure 9). Initially, both groups of mice lost 18% of their body weight, but the animals receiving the particulate compositions via the PowderJect® device regained their body weight at a 20 quicker rate than the subcutaneously vaccinated mice, indicating that transdermal delivery of particulate immunomodulators to skin is superior to the conventional needle and syringe delivery methodologies. 25 Table 14 Protection Against Influenza Challenge Aluminum Influenza Survived/Total Survived/Total (pg) Vaccine (Ag) (PowderJect®) (Syringe/Needle) none 5 3/8 0/8 30 none 1 0/8 0/8 100 5 8/8 7/8 100 1 5/7 6/8 - Naive mice 2/16 Note: Data is the number of animals survived for 14 days versus 35 the total number of animals challenged. -54- WO99/27961 PCT/US98/25563 The particulate Alum adjuvant composition was also used as an adjuvant with the crystalline Diphtheria toxoid (dT) vaccine composition and delivered via the PowderJect ® needleless syringe 5 delivery system. Mice were vaccinated with 5pg or lg of the crystalline dT vaccine composition either with or without 100 Ag of the particulate Alum adjuvant by transdermal delivery with the PowderJect® device. Control animals were vaccinated subcutaneously with 10 aqueous formulations of the same vaccine/ adjuvant composition using a conventional needle and syringe delivery system. Vaccinations were carried out at weeks 0 and 4. Week 6 sera were collected and pooled from 8 mice, and antibodies to dT were determined by 15 the above-described ELISA techniques. The results of the ELISA study are reported below in Table 15. As can be seen, serum antibody responses in animals receiving the particulate Alum adjuvanted dT vaccine composition via the PowderJect® 20 delivery device were significantly higher when compared with control animals receiving the same dose of vaccine without adjuvant. These serum antibody levels were similar to those seen in animals receiving the liquid vaccine/adjuvant composition by 25 conventional means. Table 15 IgG Titer in Pooled Week 6 Sera Determined by ELISA Aluminum dT (gg) Serum IgG Titer Serum IgG Titer (jig) (PowderJect®) (Syringe/Needle) 30 none 1 8130 570 100 1 58085 142120 The IgG subclass titers to dT were also determined by ELISA, the results of which are reported 35 below in Table 16. As can be seen, transdermal delivery of the particulate Alum-adjuvanted dT vaccine -55- WO99/27961 PCT/US98/25563 composition via the PowderJect® device elicited primarily an IgG1 response. A similar IgG subclass distribution was seen following conventional needle and syringe injection. This indicates that the Alum 5 adjuvant promotes a Th2-type immune response to the vaccine upon skin delivery. Thus, particulate Alum adjuvant can be delivered to skin following the methods of the invention and used to control the type of immune response to co-administered vaccines. 10 Table 16 IgG Subclass Distribution in Pooled Week 6 Sera by ELISA Aluminum dT PowderJect® Syringe/Needle (Ag) (Ag) 15 IgG1 IgG2a IgGl IgG2a none 5 140640 2170 114800 745 100 5 249070 810 359320 1145 2. Vaccination studies with the 20 particulate PCPP adjuvant composition. The particulate PCPP adjuvant composition was used as an adjuvant with the crystalline inactivated influenza vaccine composition and delivered via the PowderJect® needleless syringe delivery system. Mice were 25 vaccinated with 5pg or lg of the crystalline inactivated influenza vaccine composition either with or without 100

A

g of the particulate PCPP adjuvant composition. Control animals were vaccinated S/C with aqueous formulations of the same vaccine/ adjuvant 30 compositions using a conventional needle and syringe. After three vaccinations were carried out (at weeks 0, 4, and 10.5), week 12 sera were pooled from 8 mice, and antibodies to influenza virus were determined by the above-described ELISA techniques. The injection 35 sites were also visually and manually assessed for signs of toxicity (e.g., granuloma formation). -56- WO99/27961 PCT/US98/25563 Granulomas are a common form of local toxic effect seen with the administration of many adjuvants. Subcutaneous injection of the liquid PCPP-adjuvanted influenza vaccine composition resulted in granuloma 5 formation in the subcutaneous tissue at the injection site. In contrast, there were no detectable granulomas following PowderJect® delivery of the particulate composition based on gross hand and visual examination. These data suggest that transdermal 10 delivery of the particulate PCPP adjuvant reduces or even avoids the toxicity commonly associated with PCPP. In order to assess protection against a subsequent influenza virus challenge, the vaccinated 15 animals were challenged on week 12 by intranasal instillation of 1 x 106 PFU (100X LDso0) of a mouse adapted Aichi influenza virus. The challenge was carried out as described above. Survival and body weight loss were recorded daily for 14 days. The 20 survival rates are shown in Table 17 below, and body weights are depicted in Figure 10. As can be seen from Table 17, delivery of the particulate PCPP adjuvant with the crystalline influenza vaccine (at the 5pg dose) significantly increased the survival 25 rate when compared with unadjuvanted vaccine. Similar protection was seen with the control (liquid) animals at the same vaccine dose. However, as seen in Figure 10, PowderJect® delivery of the particulate PCPP adjuvanted influenza vaccine offered better protection 30 against weight loss than subcutaneous injection using a conventional needle and syringe system. In this regard, both groups of mice initially lost about 15% of their body weight, but PowderJect® vaccinated mice regained their body weight at a quicker rate than the 35 subcutaneously vaccinated mice. No significant protection was seen in the animals receiving the 1Ag -57- WO99/27961 PCT/US98/25563 dose of the influenza vaccine (with or without adjuvantation), when delivered in either the particulate or liquid form. The particulate PCPP adjuvant composition 5 was also used as an adjuvant with the crystalline Diphtheria toxoid (dT) vaccine composition and delivered via the PowderJect® needleless syringe delivery system. Mice were vaccinated with 5 Ag or 1g of the crystalline dT vaccine composition either with 10 or without 100 Ag of the particulate PCPP adjuvant by transdermal delivery with the PowderJect® device. Control animals were vaccinated subcutaneously with aqueous formulations of the same vaccine/ adjuvant composition using a conventional needle and syringe 15 delivery system. Vaccinations were carried out at weeks 0 and 4. Week 6 sera were collected and pooled from 8 mice, and antibodies to dT were determined by the above-described ELISA techniques. The results of the ELISA study are reported 20 below in Table 18. As can be seen, serum antibody responses in animals receiving the particulate PCPP adjuvanted dT vaccine composition via the PowderJect® delivery device were significantly higher when compared with control animals receiving the same dose 25 of vaccine without adjuvant. These serum antibody levels were similar to those seen in animals receiving the liquid vaccine/adjuvant composition by conventional means. 30 35 -58- WO99/27961 PCT/US98/25563 Table 17 Protection Against Influenza Challenge PCPP Influenza Survived/Total Survived/Total (Ag) Vaccine (Ag) (PowderJect®) (Syringe/Needle) 5 none 5 3/8 0/8 none 1 0/8 0/8 100 5 6/8 7/7 100 1 2/8 2/8 - Naive mice 2/16 10 Note: Data is the number of animals survived for 14 days versus the total number of animals challenged. Table 18 IgG Titer in Pooled Week 6 Sera Determined by ELISA 15 PCPP dT (pg) Serum IgG Titer Serum IgG Titer (gg) (PowderJect®) (Syringe/Needle) none 1 8130 570 100 1 248550 284415 20 The IgG subclass titers to dT were also determined by ELISA, the results of which are reported below in Table 19. As can be seen, transdermal delivery of the particulate PCPP-adjuvanted dT vaccine composition via the PowderJect ® device elicited 25 primarily an IgGl response. A similar IgG subclass distribution was seen following conventional needle and syringe injection. This indicates that the PCPP adjuvant promotes a Th2-type immune response to the vaccine upon skin delivery. Thus, particulate Alum 30 adjuvant can be delivered to skin following the methods of the invention and used to control the type of immune response to co-administered vaccines. 35 -59- WO99/27961 PCT/US98/25563 Table 19 IgG Subclass Distribution in Pooled Week 6 Sera by ELISA PCPP PowderJect® Syringe/Needle (gg)dT (pg) IgG1 IgG2a IgG1 IgG2a 5 none 5 140640 2170 114800 745 100 5 308160 3620 585810 3225 3. Vaccination studies with the particulate CpG adjuvant composition. The particulate 10 10 CpG adjuvant composition was used as an adjuvant with the crystalline inactivated influenza vaccine composition and delivered via the PowderJect® needleless syringe delivery system. Mice were vaccinated with 5pg or lig of the crystalline 15 inactivated influenza vaccine composition either with or without 100 gg of the particulate CpG adjuvant composition. Control animals were vaccinated S/C with aqueous formulations of the same vaccine/ adjuvant compositions using a conventional needle and syringe. 20 After three vaccinations were carried out (at weeks 0, 4, and 10.5), week 12 sera were pooled from 8 mice, and antibodies to influenza virus were determined by the above-described ELISA techniques. The results of the ELISA study are reported 25 25 in Table 20 below. Following delivery of the particulate CpG-adjuvanted influenza vaccine via the PowderJect® device, serum antibody responses were significantly higher when compared with animals receiving the same dose of vaccine without the 30 30 adjuvant. In addition, serum antibody levels in the animals that received the particulate compositions via the PowderJect® device were significantly higher than serum antibody levels in animals vaccinated with the same vaccine/adjuvant composition (in liquid form) 35 using conventional techniques. Accordingly, the CpG adjuvant can be delivered to the skin in powder form -60- WO 99/27961 PCT/US98/25563 to enhance the immunogenicity of an influenza vaccine. Delivery in this manner significantly improves the immune enhancement effect provided by the CpG adjuvant. 5 Table 20 Total IgG Titer in Pooled Week 12 Sera Determined by ELISA CpG Influenza Serum IgG Titer Serum IgG Titer (jig) Vaccine (Ag) (PowderJect®) (Syringe/Needle) 10 none 5 6790 1505 none 1 873 804 10 jig 5 6066 874 10 jig 1 2862 <100 15 IgG subclass titers to the influenza virus were also determined by ELISA. The results are reported below in Table 21. As can be seen, PowderJect® delivery of the unadjuvanted particulate influenza vaccine composition elicited primarily an IgGl response. A similar IgG subclass distribution was seen following conventional needle and syringe injection of the liquid 20 vaccine composition, except that the titer was much lower by this 20 route. These data indicate that influenza vaccine by itself elicits a Th2- type of immunity. PowderJect® delivery of the particulate CpG-adjuvanted influenza vaccine composition elicited primarily IgG2a antibodies, indicating that CpG promotes Thl response. Thus, skin is a superior site to deliver CpG adjuvant 25 or CpG adjuvanted vaccines. Table 21 IgG Subclass Distribution in Pooled Week 6 Sera by ELISA CpG Influenza PowderJect® Syringe & Needle (g) (jg) 30 IgGl IgG2a IgGl IgG2a none 1 367 <200 <200 <200 10 1 <200 1858 <200 <200 none 5 16340 <200 <200 <200 10 5 714 8711 <200 547 35 -61- WO99/27961 PCT/US98/25563 In order to assess protection against a subsequent influenza virus challenge, the vaccinated animals were challenged on week 12 by intranasal instillation of 1 x 106 PFU (100X LDs0) of a mouse 5 adapted Aichi influenza virus. The viral challenge was carried out as described above. Survival and body weight loss were recorded daily for 14 days. The survival rates are reported in Table 22. Body weight data are depicted in Figures 11A and 11B. As can be 10 seen from Table 22, a 100% survival rate was seen with animals receiving the particulate vaccine compositions (at both the lpg and 5pg doses) when adjuvanted with CpG and delivered transdermally via the PowderJect® device. In contrast, subcutaneous injection with the 15 liquid composition did not result in any protection with at the l1g dose. Therefore, PowderJect® delivery of the particulate CpG-adjuvanted influenza vaccine to the skin is more effective than subcutaneous injection. 20 Table 22 Protection Against Influenza Challenge CpG Influenza Survived/Total Survived/Total (pg) Vaccine (Ag) (PowderJect®) (Syringe/Needle) 25 none 5 3/8 0/8 none 1 0/8 0/8 10 5 7/7 7/8 10 1 8/8 3/8 - Naive mice 2/16 30 Note: Data is the number of animals survived for 14 days versus the total number of animals challenged. Referring now to Figures 11A and 11B, PowderJect® delivery of the particulate CpG-adjuvanted 35 influenza vaccine composition also offered significantly better protection against weight loss -62- WO99/27961 PCT/US98/25563 than subcutaneous injection of the same vaccine composition using conventional needle and syringe delivery. In this regard, there was less than a 10% initial weight loss seen in mice vaccinated with 5 either lg or 5Ag of the crystalline influenza vaccine adjuvanted with CpG, and these mice regained their body weight quickly. In contrast, subcutaneous injection offered much less protection. Specifically, there was nearly a 20% initial weight loss in mice 10 subcutaneously injected with the liquid CpG-adjuvanted vaccine (at the 5 Ag dose), and weight recovery took significantly longer. Subcutaneous injection of the liquid CpG-adjuvanted vaccine (at the 1 Ag dose) did not offer any protection. All animals in this control 15 group lost about 25% of their body weight by day 5 and died by day 7. These data suggest that CpG is a much more effective and potent immunomodulator when delivered to the skin using the PowderJect® system. The particulate CpG adjuvant composition was 20 also used as an adjuvant with the crystalline Diphtheria toxoid (dT) vaccine composition and delivered via the PowderJect® needleless syringe delivery system. Mice were vaccinated with 5Ag or lpg of the crystalline dT vaccine composition either with 25 or without 10 Ag of the particulate CpG adjuvant by transdermal delivery with the PowderJect® device. Control animals were vaccinated subcutaneously with aqueous formulations of the same vaccine/ adjuvant composition using a conventional needle and syringe 30 delivery system. Vaccinations were carried out at weeks 0 and 4. Week 6 sera were collected and pooled from 8 mice, and antibodies to dT were determined by the above-described ELISA techniques. The results of the ELISA study are reported 35 below in Table 23. As can be seen, serum antibody responses in animals receiving the particulate CpG -63- WO99/27961 PCT/US98/25563 adjuvanted dT vaccine composition via the PowderJect® delivery device were significantly higher when compared with control animals receiving the same dose of vaccine without adjuvant Serum antibody levels in 5 the animals receiving the particulate compositions via the PowderJect® delivery device were greater than ten fold higher than titers in animals vaccinated with the same vaccine/adjuvant composition (in liquid form) via conventional needle and syringe. Thus, delivery of 10 CpG in particulate form enhances the immunogenicity of the co-administered dT vaccine composition. Table 23 IgG Titer in Pooled Week 6 Sera Determined by ELISA 15 CpG dT (ag) Serum IgG Titer Serum IgG Titer (pg) (PowderJect®) (Syringe/Needle) none 1 8130 570 10 1 614470 33680 none 5 188830 149560 20 10 5 1483450 116660 IgG subclass titers to the dT antigen were also determined by ELISA. The results are reported below in Table 24. As can be seen, PowderJect® 25 delivery of the unadjuvanted particulate influenza vaccine composition elicited primarily an IgG1 response. A similar IgG subclass distribution was seen following conventional needle and syringe injection of the liquid vaccine composition, except 30 that the titer was much lower by this route. These data indicate that influenza vaccine by itself elicits a Th2- type of immunity. PowderJect® delivery of the particulate CpG-adjuvanted influenza vaccine composition elicited primarily IgG2a antibodies, 35 indicating that CpG promotes Thl response. A similar IgG subclass distribution was seen following -64- WO 99/27961 PCT/US98/25563 conventional needle and syringe injection of the same vaccine composition (but in liquid form), except that the titer was ten-fold lower by this route. Thus, skin is a superior site to deliver CpG adjuvant or CpG 5 adjuvanted vaccines. Table 24 IgG Subclass Distribution in Pooled Week 6 Sera by ELISA 10 CpG dT (jig) Delivery IgG Subclass Titer (jig) IgG1 IgG2a none 1 SC 7625 <200 none 1 PJ 605 <200 10 1 SC 297600 14165 15 10 1 PJ 41850 2350 none 5 SC 140640 2170 none 5 PJ 114800 745 10 5 SC 41050 140200 10 5 PJ 166130 4000 20 SC = subcutaneous injection, PJ = PowderJect® device. Vaccinations were given on weeks 0 and 4. 4. Vaccination studies with liquid and particulate MPL adjuvant compositions. In a first 25 study, a liquid MPL adjuvant composition was used as an adjuvant in combination with the crystalline inactivated influenza vaccine composition (delivered via the PowderJect® needleless syringe delivery device). Mice were vaccinated with 5pg or ltig of the 30 crystalline inactivated influenza vaccine composition either with or without 50 gg of the liquid MPL adjuvant composition. When MPL adjuvant was used, the liquid MPL composition was injected intradermally using a 27 gauge needle, and the crystalline vaccine 35 was administered 5 minutes later to the same site using the PowderJect® device. Control animals were -65- WO99/27961 PCT/US98/25563 vaccinated S/C with aqueous formulations of the same vaccine/ adjuvant compositions using a conventional needle and syringe. After three vaccinations were carried out (at weeks 0, 4, and 10.5), week 12 sera 5 were pooled from 8 mice, and antibodies to influenza virus were determined by the above-described ELISA techniques. The results of the ELISA study are reported in Table 25 below. Following skin delivery of the 10 MPL-adjuvanted influenza vaccine, the serum antibody response was significantly higher when compared with animals receiving the same dose of vaccine without the adjuvant. Serum antibody levels in the animals that received the particulate compositions via the 15 PowderJect® device were similar to those from animals that were vaccinated with the same vaccine/adjuvant composition using conventional techniques. Accordingly, the MPL adjuvant can be delivered to the skin in powder form to enhance the immunogenicity of 20 an influenza vaccine. Table 25 Total IgG Titer in Pooled Week 12 Sera Determined by ELISA 25 MPL Influenza Serum IgG Titer Serum IgG Titer (Ag) Vaccine (Cg) (PowderJect®) (Syringe/Needle) none 5 6790 1505 none 1 873 804 50 5 20042 10089 30 50 1 1158 2490 Note: Vaccinations were given on weeks 0, 4 and 10.5. MPL was injected intradermally using a 27 gauge needle, 5 minutes later vaccine powder was administered to the same site using a PowderJectO device. IgG subclass titers to the influenza virus 35 were also determined by ELISA. The results are reported below in Table 26. As can be seen, -66- WO99/27961 PCT/US98/25563 PowderJect® delivery of the unadjuvanted particulate influenza vaccine composition elicited primarily an IgGl response. A similar IgG subclass distribution was seen following conventional needle and syringe 5 injection of the liquid vaccine composition. The combination of intradermal MPL adjuvant and PowderJect® delivery of the crystalline influenza vaccine composition elicited both IgGl and IgG2a antibodies, indicating that skin delivery of MPL 10 induces a balanced Thl/Th2 response to the influenza vaccine. A similar IgG subclass distribution was seen following conventional needle and syringe injection of the liquid vaccine composition. 15 Table 26 IgG Subclass Distribution in Pooled Week 6 Sera by ELISA MPL Influenza PowderJect® Syringe & Needle (pg) (pg) IgG1 IgG2a IgG1 IgG2a none 5 16340 <200 <200 <200 20 50 5 18985 1848 9548 3700 In order to assess protection against a subsequent influenza virus challenge, the vaccinated animals were challenged on week 12 by intranasal 25 instillation of 1 x 106 PFU (100X LDsO) of a mouse adapted Aichi influenza virus. The challenge was carried out as described above. Survival and body weight loss were recorded daily for 14 days. The survival rates are shown in Table 27 below, and body 30 weight data are depicted in Figure 12. As can be seen from Table 27, 100% survival was seen in animals vaccinated with 5 Ag of the crystalline vaccine composition (delivered via PowderJect® device) adjuvanted with 50 Ag of MPL (delivered via 35 intradermal needle and syringe injection), while only 4 of 6 animals survived in the control (delivery via -67- WO99/27961 PCT/US98/25563 conventional needle and syringe) group receiving the same doses of vaccine and adjuvant. Partial protection was seen in animals receiving 1 Ag of the vaccine composition with 50 Ag MPL by both PowderJect® 5 and conventional needle and syringe delivery. Table 27 Protection Against Influenza Challenge MPL Influenza Survived/Total Survived/Total 10 (Qig) Vaccine (Ag) (PowderJect®) (Syringe/Needle) none 5 3/8 0/8 none 1 0/8 0/8 50 5 7/7 4/6 50 1 3/8 5/8 15 - Naive mice 2/16 Note: Data is the number of animals survived for 14 days versus the total number of animals after challenge with 106 PFUs of virus. Referring now to Figure 12, PowderJect® 20 delivery of the crystalline influenza vaccine composition 9at the 5 Ag dose) coupled with the MPL adjuvant offered significantly better protection against weight loss than subcutaneous injection of the same vaccine/adjuvant combination using conventional 25 needle and syringe delivery. There was maximal weight loss of 10% in animals receiving the 5pg vaccine dose (via transdermal PowderJect® delivery) with 50pg of the MPL adjuvant, however, these animals quickly regained their weight. In contrast, animals 30 vaccinated with the liquid composition (S/C) lost nearly 20% of their body weight, and their weight recovery progressed at a much slower rate. In a second study a particulate MPL composition was used as an adjuvant with the 35 crystalline Diphtheria toxoid (dT) vaccine composition and delivered via the PowderJect® needleless syringe -68- WO99/27961 PCT/US98/25563 delivery system. Mice were vaccinated with 5 pg or 1~g of the crystalline dT vaccine composition either with or without 50 Ag of the particulate MPL adjuvant composition by transdermal delivery with the 5 PowderJect® device. Control animals were vaccinated subcutaneously with aqueous formulations of the same vaccine/ adjuvant composition using a conventional needle and syringe delivery system. Vaccinations were carried out at weeks 0 and 4. Week 6 sera were 10 collected and pooled from 8 mice, and antibodies to dT were determined by the above-described ELISA techniques. Following transdermal delivery of the particulate MPL-adjuvanted dT vaccine composition, 15 serum antibody responses were marginally higher when compared with control animals receiving the same dose of vaccine without MPL. The level of the serum antibodies in the animals vaccinated via transdermal PowderJect® delivery was similar to titers from 20 animals vaccinated with the same vaccine/adjuvant composition by conventional needle and syringe injection. IgG subclass titers to dT were determined by ELISA. The results are reported in Table 28. As can 25 be seen, PowderJect® delivery of unadjuvanted dT vaccine primarily elicited an IgGl response. A similar IgG subclass distribution was seen following needle and syringe injection. The MPL-adjuvanted dT vaccine composition elicited both IgG1 and IgG2a 30 antibodies when delivered in particulate form from the PowderJect® device. A similar IgG subclass distribution was seen following needle and syringe injection, indicating that PowderJect® delivery of MPL to the skin can be used to induce a balanced Thl/ Th2 35 type of immunity. -69- WO99/27961 PCT/US98/25563 Table 28 IgG Subclass Distribution in Pooled Week 6 Sera by ELISA MPL dT Delivery IgG Subclass Titer (jug) (Ag) 5 IgGl IgG2a none 5 SC 140640 2170 none 5 PJ 114800 745 50 5 SC 258390 10150 50 5 PJ 353300 2925 10 Mouse strain = Balb/C, SC = subcutaneous injection, PJ = PowderJect ® device. Vaccinations were given on weeks 0 and 4. Accordingly, novel methods for delivering vaccines and adjuvant compositions transdermally are 15 disclosed. Additionally described are novel processed (crystalline) pharmaceutical compositions, and methods for making and using the same. Although preferred embodiments of the subject invention have been described in some detail, it is understood that 20 obvious variations can be made without departing from the spirit and the scope of the invention as defined by the appended claims. 25 30 35 -70-

Claims (70)

1. A method for enhancing the immunogenicity of a selected antigen, said method 5 comprising: (a) administering an effective amount of the antigen to a vertebrate subject; and (b) administering an amount of a particulate adjuvant composition sufficient to enhance the 10 immunogenicity of the antigen, wherein the adjuvant is delivered into or across skin or tissue of the vertebrate subject and further wherein said administering is carried out using a transdermal delivery technique. 15

2. The method of claim 1, wherein the antigen is in particulate form and is delivered into or across skin or tissue of the vertebrate subject using a transdermal delivery technique. 20

3. The method of claim 1, wherein the particulate adjuvant composition is administered using a needleless syringe delivery device. 25

4. The method of claim 1, wherein the antigen and adjuvant are present in separate compositions.

5. The method of claim 1, wherein the 30 antigen and adjuvant are present in the same composition.

6. The method of claim 1, wherein the antigen and adjuvant are administered to different 35 sites in the vertebrate subject. -71- WO 99/27961 PCT/US98/25563

7. The method of claim 1, wherein the antigen and adjuvant are administered to the same site in the vertebrate subject. 5

8. The method of claim 1, wherein the antigen is administered prior to the adjuvant composition.

9. The method of claim 1, wherein the 10 antigen is administered subsequent to the adjuvant composition.

10. The method of claim 1, wherein the antigen is administered concurrently with the adjuvant 15 composition.

11. The method of claim 1, wherein antigen is a viral antigen. 20

12. The method of claim 11, wherein the viral antigen is a viral protein.

13. The method of claim 11, wherein the viral antigen is a viral particle. 25

14. The method of claim 1, wherein the antigen is in a subunit vaccine composition.

15. The method of claim 1, wherein the 30 antigen is a bacterial antigen.

16. The method of claim 15, wherein the bacterial antigen is a bacterial protein or polysaccharide. 35 -72- WO 99/27961 PCT/US98/25563

17. The method of claim 1, wherein the antigen is a live, attenuated organism.

18. The method of claim 17, wherein the 5 attenuated organism is a virus.

19. The method of claim 17, wherein the attenuated organism is a bacterium. 10

20. The method of claim 1, wherein the particulate adjuvant composition is provided in a crystalline form suitable for transdermal delivery.

21. The method of claim 1, wherein the 15 adjuvant is a CpG oligonucleotide.

22. The method of claim 21, wherein the CpG oligonucleotide comprises the sequence TCCATGACGTTCCTGATGCT (SEQ ID NO:1). 20

23. The method of claim 21, wherein the CpG oligonucleotide comprises the sequence ATCGACTCTCGAGCGTTCTC (SEQ ID NO:2). 25

24. A method for eliciting an immune response in a vertebrate subject, said method comprising transdermally delivering a particulate vaccine composition into or across skin or tissue of the vertebrate subject, wherein the particulate 30 vaccine composition comprises: (a) an effective amount of a selected antigen; and (b) an amount of an adjuvant sufficient to enhance the immunogenicity of the antigen. 35 -73- WO99/27961 PCT/US98/25563

25. The method of claim 24, wherein the particulate vaccine composition is administered using a needleless syringe delivery device. 5

26. The method of claim 24, wherein the antigen is a viral antigen.

27. The method of claim 26, wherein the viral antigen is a viral protein. 10

28. The method of claim 26, wherein the viral antigen is a viral particle.

29. The method of claim 24, wherein the 15 vaccine composition is a subunit vaccine composition.

30. The method of claim 24, wherein the antigen is a bacterial antigen. 20

31. The method of claim 30, wherein the bacterial antigen is a bacterial protein or polysaccharide.

32. The method of claim 24, wherein the 25 antigen is a live, attenuated organism.

33. The method of claim 32, wherein the attenuated organism is a virus. 30

34. The method of claim 32, wherein the attenuated organism is a bacterium.

35. The method of claim 24, wherein the particulate vaccine composition is provided in a 35 crystalline form suitable for transdermal delivery. -74- WO99/27961 PCT/US98/25563

36. The method of claim 24, wherein the adjuvant is a CpG oligonucleotide.

37. The method of claim 36, wherein the CpG 5 oligonucleotide comprises the sequence TCCATGACGTTCCTGATGCT (SEQ ID NO:l).

38. The method of claim 36, wherein the CpG oligonucleotide comprises the sequence 10 ATCGACTCTCGAGCGTTCTC (SEQ ID NO:2).

39. A particulate adjuvant composition suitable for delivery into or across skin or tissue of a vertebrate subject using a transdermal delivery 15 technique.

40. Use of an adjuvant in the manufacture of a particulate composition for transdermal delivery into or across skin or tissue of a vertebrate subject. 20

41. The use according to claim 40, wherein the particulate composition comprises a selected antigen and the adjuvant enhances the immunogenicity of the antigen. 25

42. The use according to claim 40, wherein the particulate composition is delivered into or across skin or tissue of the vertebrate subject using a needleless syringe delivery device. 30

43. The use according to claim 40, wherein antigen is a viral antigen.

44. The use according to claim 43, wherein 35 the viral antigen is a viral protein. -75- WO99/27961 PCT/US98/25563

45. The use according to claim 43, wherein the viral antigen is a viral particle.

46. The use according to claim 40, wherein 5 the antigen is in a subunit vaccine composition.

47. The use according to claim 40, wherein the antigen is a bacterial antigen. 10

48. The use according to claim 47, wherein the bacterial antigen is a bacterial protein or polysaccharide.

49. The use according to claim 40, wherein 15 the antigen is a live, attenuated organism.

50. The use according to claim 49, wherein the attenuated organism is a virus. 20

51. The use according to claim 49, wherein the attenuated organism is a bacterium.

52. The use according to claim 40, wherein the particulate composition is provided in a 25 crystalline form suitable for transdermal delivery.

53. The use according to claim 40, wherein the adjuvant is a CpG oligonucleotide. 30

54. The use according to claim 53, wherein the CpG oligonucleotide comprises the sequence TCCATGACGTTCCTGATGCT (SEQ ID NO:1).

55. The use according to claim 53, wherein 35 the CpG oligonucleotide comprises the sequence ATCGACTCTCGAGCGTTCTC (SEQ ID NO:2). -76- WO 99/27961 PCT/US98/25563

56. A method of eliciting a physiological effect in a vertebrate subject comprising administering an amount of the particulate adjuvant composition of claim 39 into or across skin or tissue 5 of the vertebrate subject sufficient to bring about the physiological effect.

57. A method for forming a crystalline pharmaceutical composition, said method comprising: 10 (a) combining a liquid pharmaceutical formulation with a suitable pharmaceutical grade sugar to provide a composition; (b) allowing the composition to dry under suitable evaporative conditions which favor crystal 15 formation, thereby obtaining a crystalline composition having enhanced density characteristics; and (c) collecting the crystalline composition.

58. The method of claim 57, wherein the 20 pharmaceutical composition is a vaccine composition.

59. A crystalline pharmaceutical composition suitable for delivery into or across skin or tissue of a vertebrate subject. 25

60. The composition of claim 59, wherein said composition is a vaccine composition.

61. The composition of claim 60, wherein 30 said composition comprises an antigen and an excipient in an amount sufficient to enhance the density of the crystalline pharmaceutical composition.

62. The composition of claim 61, wherein 35 the antigen is a viral antigen. -77- WO99/27961 PCT/US98/25563

63. The composition of claim 61, wherein the antigen is a bacterial antigen.

64. A method for treating a subject, said 5 method comprising delivering the crystalline pharmaceutical composition of claim 59 into or across skin or tissue of said subject, wherein the crystalline composition is delivered in an amount sufficient to bring about a prophylactic or 10 therapeutic effect in the subject.

65. The method of claim 64, wherein the pharmaceutical composition is a vaccine composition comprising an antigen of interest. 15

66. The method of claim 65, wherein the vaccine composition is a subunit vaccine composition. 20

67. The method of claim 65, wherein the vaccine composition comprises a viral antigen.

68. The method of claim 65, wherein the vaccine composition comprises a bacterial antigen. 25

69. The method of claim 64, wherein the crystalline composition is delivered to the subject using a needleless syringe. 30

70. Use of a pharmaceutical agent in the manufacture of a crystalline composition for transdermal delivery into or across skin or tissue of a vertebrate subject. 35 -78-