AU1501800A - Biological compositions, components thereof and uses therefor - Google Patents

Description

WO 00/28009 PCT/AU99/00993 BIOLOGICAL COMPOSITIONS, COMPONENTS THEREOF AND USES THEREFOR 5 FIELD OF THE INVENTION The present invention relates generally to an isolated Hepatitis B virus (HBV) with a surface component exhibiting an altered immunological profile relative to a reference HBV. A reference HBV is considered herein to comprise a composite or consensus 10 nucleotide or amino acid sequence from HBV genotypes A through F. The isolated HBV of the present invention is considered herein to be a HBV variant relative to the reference HBV. The altered immunological profile renders the HBV variants of the present invention less susceptible to vaccines directed to the surface component. The HBV variants of the present invention generally arise from selective pressure following one or 15 both of anti-HBV chemical therapy and in particular chemical therapy aimed at disrupting HBV polymerase activity or function and/or following immune pressure directed to the surface component. Immune pressure may result from natural exposure to HBV or following vaccination with an avirulent or attenuated HBV or with a component of an HBV. The present invention further provides a recombinant polypeptide and derivatives 20 and chemical equivalents thereof corresponding to the surface component of the HBV variants. The HBV variants and recombinant polypeptides and their derivatives and chemical equivalents of the present invention are useful in biological compositions capable of inducing a neutralizing immune response to the HBV variant. 25 BACKGROUND OF THE INVENTION Bibliographic details of the publications numerically referred to in this specification are collected at the end of the description. 30 The rapidly increasing sophistication of recombinant DNA technology is greatly WO 00/28009 PCT/AU99/00993 -2 facilitating advances in the medical and allied health fields. This is particularly the case with the generation of recombinant vaccines and therapeutic compositions. Recombinant technology is providing the means to generate recombinant components of vaccines as well as providing genetic bases for screening or identifying useful components for therapeutic 5 compositions. Hepatitis B virus (HBV) can cause debilitating disease conditions ranging from subclinical infection to chronic active and fulminant hepatitis and can lead to acute liver failure. 10 The HBV genome comprises a series of overlapping genes in a circular, partially double stranded DNA molecule (1) [see also Figure 1]. For example, the gene encoding DNA polymerase overlaps the viral envelope genes, Pre-S1, Pre-S2 and S and partially overlaps the X and core genes. The HBV envelope comprises small, middle and large HBV surface proteins. The large protein component is generally referred to as the HBV surface antigen 15 (HBsAg) and is encoded by the S gene sequence. The Pre-S1 and Pre-S2 gene sequences encode the other envelope components (2). The HBsAg comprises an antigenic region referred to as the "a" determinant (3). The "a" determinant is complex, conformational and dependent upon disulphide bonding among 20 highly conserved cysteine residues. Genetic variation leading to changes in the "a" determinant has been implicated in mutants of HBV which "escape" the immunological response generated to conventional vaccines (4-8). One particularly common mutation is a glycine (G) to arginine (R) substitution at amino acid position 145 (G145R) of HBsAg. This mutation affects the "a" epitope region. 25 The increasing reliance on chemical and immunological intervention in treating or preventing HBV infection is resulting in greater selective pressure for the emergence of variants of HBV which are resistant to the interventionist therapy. Such variants are referred to as "escape" mutants. 30 WO 00/28009 PCT/AU99/00993 -3 There is a need to foreshadow potential vaccine escape variants of HBV such that biological compositions can be quickly prepared for use as vaccines directed against the modified virus or its altered antigenic components. 5 SUMMARY OF THE INVENTION Specific mutations in amino acid sequence are represented herein as "XaainXaa 2 " where Xaai is the original amino acid residue before mutation, n is the residue number and Xaa 2 is the mutant amino acid. The abbreviation "Xaa" may be the three letter or single letter 10 amino acid code. A mutation in single letter code is represented, for example, by X 1 nX 2 where X, and X 2 are the same as Xaa, and Xaa 2 , respectively. The amino acid residues for Hepatitis B virus DNA polymerase are numbered with the residue methionine in the motif Tyr Met Asp Asp (YMDD) being residue number 550. 15 The reference HBV is considered herein to comprise a composite or consensus nucleotide or amino acid sequence from HBV genotypes A through F. One aspect of the present invention provides a variant HBV comprising a surface component exhibiting an altered immunological profile compared to a reference HBV. 20 Another aspect of the present invention is directed to a variant HBV comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or a truncation compared to a surface antigen from a reference HBV and wherein an antibody generated to the reference surface antigen exhibits reduced 25 capacity for neutralizing said HBV variant. Yet another aspect of the present invention provides an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the amino acid sequence set forth in 30 Formula I and wherein the surface antigen of the variant HBV exhibits an altered WO 00/28009 PCT/AU99/00993 -4 immunological profile compared to the surface antigen defined by Formula I and wherein the variant HBV is selected for by a nucleoside analogue of the HBV DNA polymerase. Still another aspect of the present invention is directed to an HBV variant comprising a 5 surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the amino acid sequence set forth in Formula I and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the surface antigen defined by Formula I and wherein the variant HBV is selected for following immunological therapy directed against 10 the surface antigen as defined in Formula I. Even still another aspect of the present invention provides an HBV variant comprising a nucleotide sequence comprising a single or multiple nucleotide substitution, addition and/or deletion to the nucleotide sequence set forth in Formula III and which HBV variant 15 has a surface antigen exhibiting an altered immunological profile relative to a surface antigen defined by Formula I. Another aspect of the present invention provides an isolated HBsAg or a recombinant form thereof or derivative or chemical equivalent thereof. 20 Yet another aspect of the present invention is directed to an isolated variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent exhibits an altered immunological profile compared to an HBsAg from a reference HBV. 25 Still yet another aspect of the present invention provides an isolated variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent comprises an amino acid sequence with a single or multiple amino acid substitution, addition and/or 30 deletion or a truncation compared to an HBsAg from a reference HBV and wherein a WO 00/28009 PCT/AU99/00993 -5 neutralising antibody directed to a reference HBV exhibits no or reduced neutralising activity to an HBV carrying said variant HBsAg. Another aspect of the present invention contemplates a biological composition comprising a 5 variant HBV or an HBsAg from said variant HBV or a recombinant or derivative form thereof or its chemical equivalent.

WO 00/28009 PCT/AU99/00993 -.6 BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a diagrammatic representation showing overlapping genome of HBV. 5 Figure 2 is a representation of the amino acid consensus sequence from HBV DNA polymerase proteins encompassing regions which are conserved in the RNA polymerase protein. These regions are shown as domains A-E and are underlined. In the consensus sequence the M in the YMDD motif is designated as amino acid number 550. The amino 10 acids which are subject to mutation during 3TC and/or FCV treatment are shown in bold. An asterisk (*) indicates greater than three amino acid possibilities at this position of the consensus sequence. The HBsAg major hydrophilic region containing the neutralisation domain is indicated by a double line and the polymerase mutations which alter the HBsAg are indicated in italics. 15 Figure 3 is a representation of the nucleotide sequence from various strains of HBV encoding the surface antigen. The amino acid sequence of the surface antigen beginning at amino acid 108 is shown above the nucleotide sequence. 20 Figure 4 is a graphical representation showing HBsAg binding assay with wild-type (i.e. reference HBV) and various mutants (1, mock; 2; wild-type; 3, F512L; 4, V519L; 5, M5501; 6, S565P; 7, double mutant L256M + M550V; 8, triple mutant V519L + L526M + M550V; 9, W499Q). 25 WO 00/28009 PCT/AU99/00993 -7 DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention is predicated in part on the identification of HBV variants exhibiting an altered immunological profile with respect to a surface component relative to a 5 reference standard. The term "variant" is used in its broadest context and includes mutants such as vaccine escape mutants, derivatives, modified forms of and altered forms of an HBV relative to a reference HBV. A variant generally contains a single or multiple nucleotide substitution, addition and/or deletion or a truncation mutation in the viral genome and a corresponding single or multiple amino acid substitution, addition and/or 10 deletion or truncation in a viral peptide, polypeptide or protein. A preferred variant in accordance with the present invention with an altered immunological profile is one which would substantially not be affected by a neutralizing immune response directed to a conventional HBV vaccine such as a vaccine comprising a 15 reference HBV or a surface component thereof. The expression "substantially not affected" includes reduced susceptibility to the immune response generated by a vaccine. Reduced susceptibility may also be conveniently determined by reduced susceptibility to chemical agents such as nucleoside analogues which target HBV DNA polymerase. Due to the overlapping nature of reading frames for DNA polymerase and certain viral surface 20 components, an altered surface component may have a corresponding alteration in the DNA polymerase. The preferred surface component of the HBV of the present invention is the HBV surface antigen (HBsAg). It is proposed in accordance with the present invention that the HBsAg 25 of the HBV variants exhibit an altered immune profile relative to an HBsAg from a reference HBV. For the purposes of the present invention, a reference HBV conveniently comprises an HBsAg with an amino acid sequence substantially as set forth by Norder et al. (9) which encompasses all known genotypes of HBV (currently A through F). The amino acid sequence of an HBsAg and which is considered to define a reference HBV is 30 set forth below in Formula I: WO 00/28009 PCT/AU99/00993 FORMULA I M X, X 2

X

3

X

4 S G X 5 L X 6 P L X 7 V L Q A X 8 X F X 1 0 L T X 11 1X 1 2

X

1 3 1 P

X

14

SLX

1

,

5 S WWTSLNFLGX 1 6

X

7

X

8

X,CX

2 0

GX

21

NX

2 2 QS 5 X 23

X

24 S X 2 5 H X 2 6 P X 2 7

X

2 8 C P P X 2 9 C X 3 G Y R W M C L X 31 R F I I F L X 32 I L L L C L I F L L V L L D X 33 Q G M L X 34 V C P L X 35 P X 3 6

X

37

X

3 8 T T S X 3 9

X

4 0 X 4 1 C X 42 T C X 43

X

44

X

4 5

X

4 6 Q G X 47 S X 4 8

X

4 9 P X 5 0 X 5 1 C C X 5 2 K P X 53

X

5 4 G N C T C I P 1 P S X 55 W A X 56

X

57

X

58

X

59 L W E X 60

X

6 1 S X 62 R X 63 S W L X, 4

LLX

65

X

66 F V Q X 6 7

X

68

X

69

X

70 L X 71 P X 7 2 V W 10 X 7 3

X

74

X

75 I W X 76

X

77 W X 78 W X 79 P X 80

X

81

X

8 2

X

83 1 X 84

X

85 P F X 8 6 P L L P I F X 87

X

8 8 L X 89

X

90

X

91 I wherein: X, is E or G or D; 15 X 2 isNorSorK;

X

3 is I or T;

X

4 is T or A;

X

5 is F or L;

X

6 is G or R; 20 X 7 is L or R;

X

8 is G or V;

X

9 is F or C;

X

10 is L or S or W;

X

1 , is R or K; 25 X 12 is L or R;

X

13 is T or K;

X

14 is Q or K; WO 00/28009 PCT/AU99/00993 -9

X

1 5 is D or H;

X

16 is G or E or A;

X

17 is S or A or V or T or L;

X

18 is P or T; 5 X 19 is V or R or T or K or G;

X

20 is L or P;

X

21 is Q or L or K;

X

2 2 is S or L;

X

23 is P or Q; 10 X 24 is T or i;

X

25 is N or S;

X

2 6 is S or L;

X

27 is T or i;

X

2 8 is S or C; 15 X 29 is I or T;

X

30 is P or A;

X

3 1 is R or Q;

X

32 is F or C;

X

33 is Y or C; 20 X 34 is P or H or S;

X

35 is I or L;

X

36 is G or R;

X

37 is S or T;

X

38 is T or S; 25 X 39 is T or V or A;

X

40 is G or E or Q;

X

41 is P or A or S; WO 00/28009 PCT/AU99/00993 - 10

X

42 is K or R;

X

43 is T or M;

X

4 4 is T or I or S or A;

X

45 is P or T or A or I or L; 5 X 46 is A or V;

X

47 is N or T;

X

48 is M or K or L;

X

49 is F or Y or i;

X

5 0 is S or Y; 10 X 51 is C or S;

X

52 is T or I or S;

X

53 is T or S;

X

54 is D or A;

X

55 is S or T; 15 X 56 is F or L;

X

57 is A or G orV;

X

58 is K or R or T;

X

59 is Y or F;

X

60 is W or G; 20 X 61 is A or G;

X

62 is V or A;

X

63 is F or L;

X

64 is S or N;

X

65 is V or A; 25 X 66 is P or Q;

X

67 is W or C or S;

X

68 is F or C; WO 00/28009 PCT/AU99/00993 - 11 X 69 is V or D or A;

X

70 is G or E;

X

71 is S or F;

X

7 2 is T or i; 5 X 7 3 is L or P;

X

74 is S or L;

X

75 is A or V;

X

76 is M or i;

X

77 is M or I; 10 X 78 is Y or F;

X

79 is G or E;

X

80 is S or N or K;

X

81 is L or Q;

X

82 is Y or F or H or C; 15 X 8 3 is S or G or N or D or T;

X

84 is V or L;

X

8 5 is S or N;

X

86 is I or M or L;

X

87 is F or C; 20 X 88 is C or Y;

X

89 is W or R;

X

9 0 is V or A; and

X

91 is Y or I or S. 25 Accordingly, one aspect of the present invention provides a variant HBV comprising a surface component exhibiting an altered immunological profile compared to a reference

HBV.

WO 00/28009 PCT/AU99/00993 - 12 More particularly, the present invention is directed to a variant HBV comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or a truncation compared to a surface antigen from a reference HBV and wherein an antibody generated to the reference surface antigen exhibits reduced 5 capacity for neutralizing said HBV variant. The amino acid sequence of the HBsAg of the reference HBV is as set forth in Formula I above. 10 The HBV variant of the present invention is also referred to herein as an "escape" mutant since it is substantially incapable of being adversely effected by chemical therapy directed against the HBV polymerase or vaccine therapy directed against the surface antigen. The term "escape" mutant also encompasses reduced susceptibility to chemical or vaccine therapy directed to the reference HBV. 15 The HBV variant of the present invention is also preferably in isolated form. An isolated HBV includes reference to a biologically pure form of the virus. The term "isolated" means the virus has undergone at least one purification or isolation step away from non viral components. Preferably, the viral preparation comprises at least about 10%, more 20 preferably at least about 20%, still more preferably at least about 30%, even more preferably at least about 40%, yet more preferably at least about 50% or greater of HBV variant relative to the non-viral components as measured by viral infectivity, immunological interactivity, DNA polymerase activity, molecular weight, carbohydrate content or other suitable means. 25 The preferred variants of the present invention are obtained following selective pressure. The preferred selective pressure is chemical pressure (e.g. via nucleoside analogues) directed to the HBV DNA polymerase which selects for a mutation in the gene encoding HBV DNA polymerase and a corresponding mutation in the gene encoding HBsAg. This 30 is due to the overlapping open reading frames for HBV DNA polymerase and HBsAg. A WO 00/28009 PCT/AU99/00993 - 13 mutation in one or more nucleotides encoding HBV DNA polymerase may have an effect on the nucleotide sequence encoding HBsAg. The present invention also extends to changes in the HBsAg following immunological selection based on vaccines comprising HBsAg or a derivative thereof or an HBV comprising same and wherein the HBsAg 5 comprises an amino acid sequence substantially as set forth in Formula I. Accordingly, another aspect of the present invention provides an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the amino acid sequence 10 set forth in Formula I and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the surface antigen defined by Formula I and wherein the variant HBV is selected for by a nucleoside analogue of the HBV DNA polymerase. 15 In a related embodiment the present invention is directed to an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the amino acid sequence set forth in Formula I and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the surface antigen defined by Formula I and 20 wherein the variant HBV is selected for following immunological therapy directed against the surface antigen as defined in Formula I. Reference to an altered immunological profile in accordance with the present invention in relation to the surface antigen includes reference to an altered humoral or T cell response. 25 Examples of an altered immunological profile include altered specificity to antibodies, altered amino acid sequences of an epitope or within the "a" determinant, an altered capacity to induce proliferation of T cells primed to an HBsAg from a reference HBV. Preferably, the altered immunological profile means that neutralising antibodies which are capable of substantially neutralising or otherwise reducing serum or blood levels of the 30 reference HBV are substantially incapable of or exhibit reduced capacity to neutralise WO 00/28009 PCT/AU99/00993 - 14 and/or clear the variant HBV. A viral variant may, in accordance with a preferred aspect of the present invention, carry a mutation only in the DNA polymerase or the surface antigen or may carry a mutation in 5 both molecules. The term "mutation" is to be read in its broadest context and includes a silent mutation not substantially affecting the normal function of the DNA polymerase or surface antigen or may be an active mutation having the effect of selection of nucleoside analogue resistance or a vaccine escape mutant phenotype. Where multiple mutations occur in accordance with the present invention or where multiple phenotypes result from a 10 single mutation, at least one mutation must be active or the virus must exhibit at least one altered phenotype such as nucleoside analogue resistance or reduced immunological interactivity to the surface antigen of a reference HBV. The present invention extends to any novel mutant or novel use of a mutant of the HBsAg 15 carrying a single or multiple substitution, addition and/or deletion or truncation in the amino acid sequence of HBsAg as compared to the amino acid sequence set forth in Formula I. In an alternative yet related embodiment, the present invention extends to any single or multiple amino acid substitution, addition and/or deletion or truncation in the amino acid sequence of HBsAg relative to the amino acid sequence set forth in Formula I 20 as defined by a single or multiple amino acid substitution, addition and/or deletion to the catalytic region of the HBV DNA polymerase set forth below in Formula II: FORMULA II 25 SZ, LSWLS LDVSAAFYHZ 2 P LH PAAM P H LLZ 3 GSSG

LZ

4 RY VARLS S ZS Z 6

Z

7 XN ZQ ZZ XXXZ L HZ2Z13 CS R Z 14 L Y V S L Z 15 L L Y Z1 6 T Z 1 7 G Z 18 K L H L Z 19 Z20 H P I Z21 L G F R K Z 22 P M G Z 23 G L S P F L L A Q F T S A Z 4

Z

2 5

Z

2 6

Z

27

Z

2 8 R A F Z 29 H C Z 30

Z

31 F Z 32 Y M* D D Z 33 V L G A Z 3 4 Z 3 5

Z

3 6

Z

37 H Z 3 8 E Z 3 9 L Z 4 0

Z

4 1 WO 00/28009 PCT/AU99/00993 - 15 Z 42

Z

43

Z

44

Z

4 5

Z

4 6 L L Z47 Z4 8 G I H L NP Z 4 9 K T K R W G Y S L N F M G

YZ

50 I G wherein: 5 X is any amino acid; Z, is N or D;

Z

2 is I or P;

Z

3 is I or V;

Z

4 is S or D; 10 Z 5 is T or N;

Z

6 is R or N;

Z

7 is N or i;

Z

8 is N or Y or H;

Z

9 is H or Y; 15 Z 10 is G or R;

Z

1 , is D or N;

Z

12 is D or N;

Z

13 is S or Y;

Z

14 is N or Q; 20 Z 1 5 is L or M;

Z

1 6 is K or Q;

Z

17 is Y or F;

Z

18 is R or W;

Z

19 is Y or L; 25 Z 20 is S or A;

Z

21 is I or V;

Z

2 2 is I or L; WO 00/28009 PCT/AU99/00993 - 16 Z 23 is V or G;

Z

24 is C or L;

Z

25 is A or S;

Z

2 6 is V or M; 5 Z 27 is V or T;

Z

28 is R or C;

Z

29 is F or P;

Z

30 is L or V;

Z

31 is A or V; 10 Z 32 is S or A;

Z

33 is V or L or M;

Z

34 is K or R;

Z

35 is S or T;

Z

36 is V or G; 15 Z 37 is Q or E;

Z

38 is L or S or R;

Z

39 is S or F;

Z

40 is F or Y;

Z

4 1 is T or A; 20 Z 42 is A or S;

Z

43 is V or 1;

Z

44 is T or C;

Z

45 is N or S;

Z

46 is F or V; 25 Z 47 is S or D;

Z

4 8 is L or V;

Z

49 is N or Q; WO 00/28009 PCT/AU99/00993 - 17

Z

50 is V or 1; and M* is amino acid 550. Preferred mutations in the amino acid sequence of HBsAg are amino acid substitutions, 5 deletions and/or additions or truncations in amino acids 1-10, 5-15, 10-20, 15-25, 20-30, 25 35, 30-40, 35-45, 40-50, 45-55, 50-60, 55-65, 60-70, 65-75, 70-80, 75-85, 80-90, 85-95, 90 100, 95-105, 100-110, 105-115, 110-120, 115-125, 120-130, 125-135, 130-140, 135-145, 140-150, 145-155, 150-160, 155-165, 160-170, 165-175, 170-180, 175-185, 180-190, 185 195, 190-200, 195-205, 200-210, 205-215, 210-220, 215-225, 220-226 (referring to the 10 numbering of Formula I) of HBsAg. Particularly useful mutations are GI 12R, T123P Y/F134S, D144E, G145R, A157D, E164D, F170L, M1951, W196L, S196W, W196 STOP, M1981, W199S, S204T and S210R. The term "stop" means a stop codon. Even more preferred mutations are D144E, G145R, A157D, E164D, M1951, W196L, 15 S196W, W196 STOP, M1981, W199S and S210R. The HBsAg mutations of the present invention may also be defined in terms of a corresponding mutation in the HBV DNA polymerase. A mutation in the HBV DNA polymerase may be in amino acids 421-431, 426-436, 431-441, 436-446, 441-451, 446-456, 20 451-461, 456-466, 461-471, 466-476, 471-481, 476-486, 481-491, 486-496, 491-501, 496 506, 501-511, 506-516, 511-521, 516-526, 521-531, 526-536, 531-541, 536-546, 541-551, 546-556, 551-561, 556-566, 561-571, 566-576, 571-581, 576-586, 581-591, 586-596, 591 601, 596-601 (referring to number of Formula II). 25 Preferred HBV DNA polymerase mutations include Q476, N480G, N485K, K495R, R4990, G499E, W499Q, FJ12L, 1515L, V519L, L526M, M550V, M550I, V5531, S565P. Useful multiple mutants include L526M/M5501, L526M/M55OV, V519L/L526M/M550V and V519L/L526M/M550I. 30 The altered HBsAg molecules of the HBV variants of the present invention may also be WO 00/28009 PCT/AU99/00993 - 18 defined at the nucleotide level. The nucleotide sequence encoding the HBsAg from a reference HBV is set forth below in Formula III: FORMULA III 5 ACN, AAACCTN 2

N

3 G GAN 4 G GAAAN 5 TG CAC N 6 TGTA TTCC CATC C CATCH N 7 TC N 8 TG GG C TTTCG NgAA N 1 O AT Nj, CCTATG G GAG N 2 G G G C CTCAG N 1 3 CC GTTT

CTCN

4 TGGCTCAGTTTACTAGTGCCATTTGTTCA 10 GTGGTTCGN 15

AGGGCTTTCCCCCACTGTN

16 TGG

CTTTCAGN

17

TATATGGATGATGTGGTN

18 TTGGGG

GCCAAGTCTGTACAN

1 9

CATCN

2 0 TGAGTCCCTTT

N

21 T N 2 2 C C N 23 CT N 2 4 TTAC CAATTTT C TT N 2 5 TG TCT N 2 6 TGGG N 27 ATACATT 15 wherein: N, is A or C;

N

2 isTorA;

N

3 is C or T; 20 N 4 is C or T;

N

5 is C or T;

N

6 is C or T;

N

7 is A or G;

N

8 is T or C; 25 N 9 is C or G;

N

1 0 is G or A;

N

1 1 is T or A;

N

12 is T or G; WO 00/28009 PCT/AU99/00993 - 19 N 13 is T or C;

N

14 is C or T;

N

1 5 is T or C;

N

1 6 is T or C; 5 N 17 is T or C;

N

18 is A or T;

N

1 9 is A or G;

N

20 is T or G;

N

21 is A or T; 10 N 22 is A or G;

N

23 is T or G;

N

24 is A or G;

N

25 is T or C;

N

26 is T or C; and 15 N 27 is T or C. The present invention extends to nucleotide sequences which exhibit at least about 60% nucleotide sequence identity to Formula III or is a sequence capable of hybridising thereto under low stringency conditions at 42 'C and which encode an HBsAg with an altered 20 immunological profile relative to an HBsAg from a reference HBV. Accordingly, another aspect of the present invention provides an HBV variant comprising a nucleotide sequence comprising a single or multiple nucleotide substitution, addition and/or deletion to the nucleotide sequence set forth in Formula III and which HBV variant has a 25 surface antigen exhibiting an altered immunological profile relative to a surface antigen defined by Formula I. Preferably, the HBV variant comprises a nucleotide sequence having at least about 80% identity to the nucleotide sequence set forth in Formula III or is capable of hybridising WO 00/28009 PCT/AU99/00993 - 20 thereto under medium stringency conditions at 42 'C. Preferably, the percentage identity is at least about 85%, at least about 90%, at least about 95%, but less than 100% relative to the nucleotide sequence set forth in Formula III. 5 The term "similarity" as used herein includes exact identity between compared sequences at the nucleotide or amino acid level. Where there is non-identity at the nucleotide level, "similarity" includes differences between sequences which result in different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. Where there is non-identity at the amino acid level, "similarity" 10 includes amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. In a particularly preferred embodiment, nucleotide and sequence comparisons are made at the level of identity rather than similarity. Any number of programs are available to compare nucleotide and amino acid sequences. Preferred programs have regard to an appropriate alignment. One such program is Gap 15 which considers all possible alignment and gap positions and creates an alignment with the largest number of matched bases and the fewest gaps. Gap uses the alignment method of Needleman and Wunsch (10). Gap reads a scoring matrix that contains values for every possible GCG symbol match. GAP is available on ANGIS (Australian National Genomic Information Service) at website http://mell.angis.org.au.. 20 Reference herein to a low stringency at 42 0 C includes and encompasses from at least about 0% v/v to at least about 15% v/v formamide and from at least about IM to at least about 2M salt for hybridisation, and at least about IM to at least about 2M salt for washing conditions. Alternative stringency conditions may be applied where necessary, such as medium 25 stringency, which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5M to at least about 0.9M salt for hybridisation, and at least about 0.5M to at least about 0.9M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01M to at least about 0.15M salt for 30 hybridisation, and at least about 0.01M to at least about 0.15M salt for washing conditions. In general, washing is carried out Tm = 69.3 + 0.41 (G+C)% [11]. However, the Tm of a WO 00/28009 PCT/AU99/00993 -21 duplex DNA decreases by 1C with every increase of 1% in the number of mismatch base pairs (12). The present invention further extends to an isolated surface component from the HBV 5 variants herein described. More particularly, the present invention provides an isolated HBsAg or a recombinant form thereof or derivative or chemical equivalent thereof. The isolated surface component and, more particularly, isolated HBsAg or its recombinant, derivative or chemical equivalents are useful in the development of biological compositions such as vaccine formulations. 10 Accordingly, another aspect of the present invention is directed to an isolated variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent exhibits an altered immunological profile compared to an HBsAg from a reference HBV. 15 More particularly, the present invention provides an isolated variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent comprises an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or a 20 truncation compared to an HBsAg from a reference HBV and wherein a neutralising antibody directed to a reference HBV exhibits no or reduced neutralising activity to an HBV carrying said variant HBsAg. The term "isolated" means the same as it does in relation to an isolated HBV variant. 25 The reference HBV is conveniently defined herein as comprising an HBsAg with an amino acid sequence as set forth in Formula I or as indirectly defined by the amino acid sequence for HBV DNA polymerase set forth in Formula II or by the nucleotide sequence set forth in Formula III encoding an HBsAg. 30 As stated above, the present invention extends to derivatives and chemical equivalents (i.e.

WO 00/28009 PCT/AU99/00993 - 22 analogues) of the HBV surface component and in particular HBsAg. Derivatives include single or multiple amino acid substitutions, additions and/or deletions to the HBsAg molecule. "Additions" to amino acid sequences include fusions with other peptides, polypeptides or proteins or fusions to nucleotide sequences including fusions to other viral 5 components. Analogues of the variant HBsAg contemplated herein include, but are not limited to, modification to side chains, incorporating of unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other 10 methods which impose conformational constraints on the proteinaceous molecule or their analogues. These types of modifications are useful in stabilizing the immunointeractive molecules for use in diagnostic assays or in therapeutic protocols. Examples of side chain modifications contemplated by the present invention include 15 modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH 4 ; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with 20 pyridoxal-5-phosphate followed by reduction with NaBH 4 . The guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal. 25 The carboxyl group may be modified by carbodiimide activation via 0-acylisourea formation followed by subsequent derivitisation, for example, to a corresponding amide. Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed 30 disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4-chloromercuribenzoate, WO 00/28009 PCT/AU99/00993 - 23 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2-chloromercuri-4 nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH. Tryptophan residues may be modified by, for example, oxidation with N-bromosuccinimide 5 or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides. Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative. Modification of the imidazole ring of a histidine residue may be accomplished by alkylation 10 with iodoacetic acid derivatives or N-carbethoxylation with diethylpyrocarbonate. Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3-hydroxy 5-phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, 15 ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D isomers of amino acids. A list of unnatural amino acid, contemplated herein is shown below in Table 1. The inclusion of such unnatural amino acids or other derivations described herein may assist in stabilising the molecule in a vaccine composition. 20 WO 00/28009 PCT/AU99/00993 - 24 TABLE 1 Non-conventional Code Non-conventional Code amino acid amino acid 5 a-aminobutyric acid Abu L-N-methylalanine Nmala a-amino-a-methylbutyrate Mgabu L-N-methylarginine Nmarg aminocyclopropane- Cpro L-N-methylasparagine Nmasn carboxylate L-N-methylaspartic acid Nmasp 10 aminoisobutyric acid Aib L-N-methylcysteine Nmcys aminonorbomyl- Norb L-N-methylglutamine Nmgln carboxylate L-N-methylglutamic acid Nmglu cyclohexylalanine Chexa L-N-methylhistidine Nmhis cyclopentylalanine Cpen L-N-methylisolleucine Nmile 15 D-alanine Dal L-N-methylleucine Nmleu D-arginine Darg L-N-methyllysine Nmlys D-aspartic acid Dasp L-N-methylmethionine Nnmet D-cysteine Dcys L-N-methylnorleucine Nmnle D-glutamine Dgln L-N-methylnorvaline Nnva 20 D-glutamic acid Dglu L-N-methylorithine Nmor D-histidine Dhis L-N-methylphenylalanine Nmphe D-isoleucine Dile L-N-methylproline Nmpro D-leucine Dleu L-N-methylserine Nmser D-lysine Dlys L-N-methylthreonine Nmthr 25 D-methionine Dmet L-N-methyltryptophan Nmtrp D-ornithine Dom L-N-methyltyrosine Nmtyr D-phenylalanine Dphe L-N-methylvaline Nmval D-proline Dpro L-N-methylethylglycine Nmetg D-serine Dser L-N-methyl-t-butylglycine Nmtbug 30 D-threonine Dthr L-norleucine Nme D-tryptophan Dtrp L-norvaline Nva WO 00/28009 PCT/AU99/00993 -25 D-tyrosine Dtyr ac-methyl-aminoisobutyrate Maib D-valine Dval ax-methyl-y-aminobutyrate Mgabu D-cz-methylalanine Dmala ca-methylcyclohexylalanine Mehexa D-a-methylarginine Dmarg u-methylcylcopentylalanine Mepen 5 D-a-methylasparagine Dmasn ca-methy1-u-napthylalanine Manap D-oa-methylaspartate Dmasp a-methylpenicillamine Mpen D-oa-methylcysteine Dmcys N-(4-aminobutyl)glycine Nglu D-u-methylglutamine Dmgln N-(2-aminoethyl)glycine Naeg D-a-methylhistidine Dnmhis N-(3 -aminopropyl)glycine Nomn 10 D-a-methylisoleucine Dmile N-amino-a-methylbutyrate Nmaabu D-a-methylleucine Dmleu a-napthylalanine Anap D-ca-methy11ysine Dmlys N-benzylglycine Nphe D-ca-methylmethionine Dmmet N-(2-carbamylethyl)glycine Ngln D-a-methylomithine Dmom N-(carbamylmethyl)glycine Nasn 15 D-a-methylphenylalanine Dmphe N-(2-carboxyethyl)glycine Nglu D-a-methylproline Dmpro N-(carboxymethyl)glycine Nasp D-c*-methylserine Dmser N-cyclobutylglycine Nebut D-cu-methylthreonine Dmthr N-cycloheptylglyeine Nchep D-u-methyltryptophan Dmtrp N-cyclohexylglycine Nchex 20 D-a-methyltyrosine Dmty N-cyclodecylglycine Ncdec D-oa-methylvaline Dmval N-cylcododecylglycine Ncdod D-N-methylalanine Dnmala N-cyclooctylglycine Ncoct D-N-methylarginine Dnmarg N-cyclopropylglycine Ncpro D-N-methylasparagine Dnmasn N-cycloundecylglycine Ncund 25 D-N-methylaspartate Dnmasp N-(2,2-diphenylethyl)glycine Nbhm D-N-methylcysteine Dnmcys N-(3 ,3 -diphenylpropyl)glycine Nbhe D-N-methylglutamine Dnmgln N-(3-guanidinopropyl)glycine Narg D-N-methylglutamate Dnmglu N-( 1 -hydroxyethyl)glycine Nthr D-N-methylhistidine Dnnmhis N-(hydroxyethyl))glycine Nser 30 D-N-methylisoleucine Dnmile N-(imidazolylethyl))glycine Nhis D-N-methylleucine Dnmleu N-(3-indolylyethyl)glycine Nhtrp WO 00/28009 PCT/AU99/00993 - 26 D.-N-methyllysine Dnmlys N-methyl-y-aminobutyrate Nmgabu N-methylcyclohexylalanine Nmchexa D-N-methylmethionine Dnmmet D-N-methylomnithine Dnmorn N-methylcyclopentylalanine Nmcpen N-methylglycine Nala D-N-methylphenylalanine Dnmphe 5 N-methylamninoisobutyrate Nmaib D-N-methylproline Dnmpro N-( 1 -methylpropyl)glycine Nile D-N-methylserine Dnmser N-(2-methylpropyl)glycine Nleu D-N-methylthreonine Dnmthr D-N-methyltryptophan Dnmtrp N-( 1 -methylethyl)glycine Nval D-N-methyltyrosine Dnmtyr N-methyla-napthylalanine Nmanap 10 D-N-methylvaline Dnmval N-methylpenicillamnine Nmpen y-aminobutyric acid Gabu N-(p-hydroxyphenyl)glycine Nhtyr L-t-butylglycine Tbug N-(thiomethyl)glycine Ncys L-ethylglycine Etg penicillamnine Pen L-homnophenylalanine Hphe L-oa-methylalanine Mala 15 L-a-methylarginine Marg L-a-methylasparagine Masn L-a-methylaspartate Masp L-a-methyl-t-butylglycine Mtbug L-oa-methylcysteine Moys L-methylethylglycine Metg L-ca-methylglutamine Mgln L-ou-methylglutamate Mglu L-oa-methylhistidine Mhis L-oa-methylhomophenylalanine Mhphe 20 L-a-methylisoleucine Mile N-(2-methylthioethyl)glycine Nmet L-u-methylleucine Mleu L-oa-methyllysine Mlys L-u-methylmethionine Mmet L-u-methylnorleucine Mnle L-a-methylnorvaline Mnva L-a-methylornithine Morn L-a-methylphenylalanine Mphe L-a-methylproline Mpro 25 L-a-methylserine Mser L-ca-methylthreonine Mthr L-oa-methyltryptophan Mtrp L-ca-methyltyrosine Mtyr L-ca-methylvaline Mval L-N-methylhomophenylalanine Nmhphe WO 00/28009 PCT/AU99/00993 - 27 N-(N-(2,2-diphenylethyl) Nnbhm N-(N-(3,3-diphenylpropyl) Nnbhe carbamylmethyl)glycine carbamylmethyl)glycine 1 -carboxy- 1-(2,2-diphenyl- Nmbc ethylamino)cyclopropane 5 Crosslinkers can be used, for example, to stabilise 3D conformations, using homo bifunctional crosslinkers such as the bifunctional imido esters having (CH2)n spacer groups with n=1 to n=6, glutaraldehyde, N-hydroxysuccinimide esters and hetero-bifunctional 10 reagents which usually contain an amino-reactive moiety such as N-hydroxysuccinimide and another group specific-reactive moiety such as maleimido or dithio moiety (SH) or carbodiimide (COOH). In addition, peptides can be conformationally constrained by, for example, incorporation of C, and Ne-methylamino acids, introduction of double bonds between C, and C, atoms of amino acids and the formation of cyclic peptides or analogues 15 by introducing covalent bonds such as forming an amide bond between the N and C termini, between two side chains or between a side chain and the N or C terminus. As stated above, these types of modifications may be important to stabilise the variant HBsAg molecule if administered to an individual or for use as a diagnostic reagent. 20 Other derivatives contemplated by the present invention include a range of glycosylation variants from a completely unglycosylated molecule to a modified glycosylated molecule. Altered glycosylation patterns may result from expression of recombinant molecules in different host cells. 25 Another aspect of the present invention extends to the variant HBsAg molecule or its recombinant, derivative or chemical form or a variant HBV comprising said HBsAg in composition form. Such compositions are particularly useful as therapeutic compositions and may be referred to herein interchangeably as biological, vaccine or pharmaceutical 30 compositions. The biological compositions are particularly useful in inducing immunological memory against infection by an HBV variant such as an HBV escape WO 00/28009 PCT/AU99/00993 - 28 mutant controlling by administering a variant HBsAg or a recombinant, derivative or chemical form thereof or an HBV comprising same capable of inducing an immune response including immunological memory agents. 5 Accordingly, the present invention contemplates a biological composition comprising a variant HBV or an HBsAg from said variant HBV or a recombinant or derivative form thereof or its chemical equivalent. Generally, if an HBV is used, it is first attenuated. The biological composition according to 10 this aspect of the present invention generally further comprises one or more pharmaceutically acceptable carriers and/or diluents. The biological composition may comprise an HBsAg or like molecule from one HBV variant or the composition may be a cocktail of HBsAgs or like molecules from a range of 15 HBV variants including the referenced HBV. Similar inclusions apply where the composition comprises an HBV. The biological composition forms suitable for injectable use include sterile aqueous solutions (where water soluble) or sterile powders for the extemporaneous preparation of 20 sterile injectable solutions. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or diluent containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The preventions of the action of 25 microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum 30 monostearate and gelatin.

WO 00/28009 PCT/AU99/00993 - 29 Sterile injectable solutions are prepared by incorporating the HBsAg or like molecule or HBV variant or reference strain in the required amount in the appropriate solvent or diluent as followed by sterilization such as by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are 5 vacuum drying and the freeze-drying technique which yield a powder of the immunointeractive molecule plus any additional desired ingredient from previously sterile-filtered solution thereof. Routes of administration contemplated by the present invention including intravenous, intraperitoneal, intrathelial, subcutaneous and intracerebral. 10 The biological composition of the present invention may also be given in oral, bucal, nasal spray, inhalation, patch, drip or suppository form. Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion 15 media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the immunointeractive molecule, use thereof in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the 20 compositions. The HBsAg or like molecule or HBV variant or reference strain will be added in a concentration effective to induce an interact immune response against the same molecule or an HBV carrying the same or an immunologically similar molecule. For example, an 25 effective amount of HBsAg may range from about 10 mg to about 2000 ng, or 50 ng to about 1000 mg or 100 ng to about 500 mg or other suitable effective amount. It is sometimes more convenient to express dosage amounts in terms of body weight. Accordingly, the effective amounts may be from, for example, about 0.5 ng/kg body weight to about 500 mg/kg body weight or an amount there between. 30 The present invention is further described by the following non-limiting Examples.

WO 00/28009 PCT/AU99/00993 - 30 EXAMPLE 1 OVERLAPPING GENOME OF HBV The overlapping genome of HBV is represented in Figure 1. The gene encoding DNA 5 polymerase (P), overlaps the viral envelope genes, Pre-S I and Pre-S2, and partially overlaps the X and core (C) genes. The HBV envelope comprises small, middle and large HBV surface antigens. The large protein component is referred to as the HBV surface antigen (HBsAg) and is enclosed by the S gene sequence. The Pre-SI and Pre-S2 gene sequences encode the other envelope components. 10 EXAMPLE 2 AMINO ACID CONSENSUS SEQUENCE FO HBV DNA POLYMERASE The amino acid consensus sequence for HBV DNA polymerase protein from genotypes A 15 through F is shown in Figure 2. EXAMPLE 3 CONSENSUS SEQUENCE OF HBsAg 20 The nucleotide sequence from various strains of HBV encoding the surface antigen is shown in Figure 3. The amino acid sequence of the surface antigen beginning at amino acid 108 is shown above the nucleotide sequence. EXAMPLE 4 25 HBsAg BINDING ASSAY The effect of the Pre-S/S gene escape mutations on the binding of anti-HBs antibody is assessed using an RIA binding assay. The results are shown in Figure 4. Briefly, the expressed mutant HBsAg from transfected cell cultures is purified through a sucrose 30 density gradient. The ability of subviral and viral particles to block the binding of wild type HBsAg to anti-HBs antibody, which does not recognise S gene escape mutants, is assessed WO 00/28009 PCT/AU99/00993 -31 in an RIA format (AUSAB, Abbott). This analysis involves the binding of anti-HBs in pooled vaccine serum to increasing concentrations of wild type and mutant S protein using limiting concentrations of serum and detecting the unbound anti-HBs by AUSAB RIA. 5 The mutant S proteins analysed are shown on the right of Figure 4 together with mock and wild type HBV. As the concentration of HBsAg decreases the amount of unbound anti HBs increase, leaving a higher anti-HBs concentration to be detected by the AUSAB assay. Even at high concentration of HBsAg from the W499Q mutant the amount of residual anti HBs detected is similar to that of the mock transfected sample (these are represented by the 10 two curves at the top of the graph). In contrast, the amount of residual anti-HBs after binding of antibody with the other mutant HBsAg proteins is analogous to the wild type HBsAg, indicating that these variant vHBsAg proteins recognise the anti-HBs with similar efficiency as the wild type protein. 15 Two of the mutant S proteins (Figure 4: V519L and the triple mutant which contains the mutations V519L + L526M +M550V with respect to the polymerase protein in the overlapping reading frame) had partial binding of anti-HBsAg. The binding efficacy of the mutant S proteins to HBsAg is altered when compared to wild type HBsAg. This suggests that viruses carrying these mutations may not be detected by anti-HBsAg as efficiently as 20 wild type virus and thus may escape immune detection. Hepatitis B virus with these and/or other HBsAg mutations, which have partial binding to anti-HBsAg, may also escape immune detection and protection. The dual mutant in Figure 4 represents L526M/M550V while the triple mutant represents 25 V519L/L526M/M550V. EXAMPLE 5 HBV VARIANTS PRODUCED BY SITE DIRECTED MUTAGENESIS 30 Table 2 provides a summary of some of the HBV variants produced by site directed mutagenesis.

WO 00/28009 PCT/AU99/00993 -32 EXAMPLE 6 FCV MUTATION Table 3 provides a summary of mutations induced by famciclovir (FCV). 5 Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to 10 or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

WO 00/28009 PCT/AU99/00993 - 33 TABLE 2 HBV VARIANTS PRODUCED BY SITE DIRECTED MUTAGENESIS Nucleotide analogue selected Polymerase mutations Corresponding surface S mutation 1. G499E (B domain) D144E 2. W499Q (B domain) G145R 3. F512L (B domain) A157D 4. V519L (B domain) E164D 5. L526M (B domain) no change 6. M550V (C domain) M1951 7. M550V (C domain) W196L 8. M5501 (C domain) Si96W 9. V5531 (C domain) M1981 10. V5531 (C domain) W199S 11. S565P S21OR Double polymerase mutation Corresponding S mutation 12. L526M/M550V M1951 13. L526M/M5501 196W Triple polymerase mutation Corresponding S mutation 14. V519L/L526M/M550V E164D, M1951, W196L 15. VS19L/L526M/M5501 E164D, S196W HBsAg escape mutant Corresponding HBV polymerase changes 16. K122R (loop 1 "a" determinant) Q476P 17. T126S (loop 1 "a" determinant) N480G 18. T131N (loop 1 "a" determinant) N485K 19. K141E (loop 2 "a" determinant) K495R 20. G145K (loop 2 "a" determinant) R499Q 21. R16ON 1515L WO 00/28009 PCT/AU99/00993 - 34 TABLE 3 FCV Mutations Number of patients with Mutation (%) S421L A Domain 1/34 3% N422K A Domain 1/34 3% L423L/M/V A Domain 1/34 3% S424T A Domain 2/34 6% S/D 455P 7/34* 20.5% N464D 1/34 3% Q471K/N 2/34 6% D/N 480E 1/34 3% T484H 1/34 3% R499K 4/34 12% V519L B Domain 3/34 9% L/M/V523L B Domain 1/34 3% F524L/F B Domain 1/34 3% L526M B Domain 5/34 15% A527T B Domain 1/34 3% 1533I/V 2/34 6% V5371 1/34 3% S565A 1/34 3% S/D576F/S D Domain 1/34 3% L593V 1/34 3% H/Y594H E Domain 1/34 3% T/M596M E Domain 1/34 3% Only detected in BMT patients on FCV WO 00/28009 PCT/AU99/00993 - 35 BIBLIOGRAPHY: 1. Tiollais et al. Nature 317: 489-495, 1985. 2. Gerlich et al. Viral Hepatitis and Liver Disease. F.B. Hollinger et al. eds Williams-Wilkens, Baltimore, MD, ppl2l-13 4 , 1991. 3. Carman et al. Gastroenterology 102:. 711-719, 1992. 4. Carman et al. Lancet 336: 325-329, 1990. 5. Okamoto et al. Paediatric Research 32: 264-268, 1992. 6. McMahon et al. Hepatology 15: 757-766, 1992. 7. Fujii et al. Biochem. Biophys. Res. Commun. 184: 1152-1157, 1992. 8. Harrison et al. J. Hepatol. 13: 5105-5107, 1991. 9. Norder et al. J. Gen. Virol. 74: 1341-1348, 1993. 10. Needleman and Wunsch J Mol. Biol. 48: 443-453, 1970. 11. Marmur and Doty J. Mol. Biol. 5: 109, 1962. 12. Bonner and Laskey Eur. J. Biochem. 46: 83, 1974.

Claims (17)

1. A variant Hepatitis B Virus (HBV) comprising a surface component exhibiting an altered immunological profile compared to a reference HBV.

2. A variant HBV according to claim 1 wherein the surface component on the variant is a surface antigen which comprises a single or multiple amino acid substitution, addition and/or deletion or truncation compared to a surface antigen from said reference HBV and wherein an antibody generated to the reference surface antigen from the reference HBV exhibits reduced capacity for neutralizing said variant HBV.

3. A variant HBV according to claim 2 wherein the surface antigen on the variant comprises an amino acid substitution, addition and/or deletion or truncation compared to the amino acid sequence setforth below: M X 1 X 2 X 3 X 4 S G X 5 L X 6 P L X 7 V L Q A X 8 X F X, 0 L T X, 11 X 1 2 X 1 3 1 P X 14 SLX 1 5 S WWTSLNFLGX 16 X 7 X 1 l 8 Xl 9 CX 2 0 GX 2 1 NX 2 2 QS X 23 X 2 4 S X 2 5 H X 2 6 P X 27 X 28 C P P X 2 9 C X 30 G Y R W M C L X 31 R F I I F L X 3 2 I L L L C L I F L L V L L D X 3 3 Q G M L X 3 4 V C P L X 35 P X 36 X 37 X 38 T T S X 3 9 X 4 0 X 4 1 C X 42 T C X 43 X 44 X 45 X 46 Q G X 47 S X 4 8 X 4 9 P X 50 X 5 1 C CX 5 2 KPX 5 3 X 5 4 GNCTCIP PSX 55 WAX 56 X 57 X 58 X 59 LWE X 60 X 61 S X 6 2 R X 6 3 S W L X 6 4 LLX 6 5 X 6 6 F V Q X 6 7 X 6 8 X 6 9 X 7 0 L X 71 P X 7 2 V W X 7 3 X 7 4 X 7 5 1 W X 7 6 X 7 7 W X 7 8 W X 7 9 P X 80 X 81 X 8 2 X 8 3 1 X 8 4 X 8 5 P F X 8 6 P L L P I F X 87 X 88 L X 8 9 X 9 0 X 91 I[Formula I]; wherein: X, is E or G or D; X 2 is N or S or K; X 3 is I or T; WO 00/28009 PCT/AU99/00993 - 37 X 4 is T or A; X 5 is F or L; X 6 isGorR; X 7 is L or R; X 8 is G or V; X 9 is F or C; X 1 0 is L or S or W; X 1 , is R or K; X 12 is L or R; X 13 is T or K; X 14 is Q or K; X 15 is D or H; X 16 is G or E or A; X 17 is S orA orV or T or L; X 18 is P or T; X 1 9 is V or R or T or K or G; X 20 is L or P; X 21 is Q or L or K; X 2 2 is S or L; X 23 is P or Q; X 24 is T or i; X 25 is N or S; X 2 6 is S or L; X 27 is T or i; X 2 8 is S or C; X 29 is I or T; X 30 is P or A; WO 00/28009 PCT/AU99/00993 - 38 X 31 is R or Q; X 32 is F or C; X 33 is Y or C; X 34 is P or H or S; X 3 5 is I or L; X 36 is G or R; X 37 is S or T; X 38 is T or S; X 39 is T or V or A; X 40 is G or E or Q; X 41 is P or A or S; X 42 is K or R; X 43 is T or M; X 44 is T or I or S or A; X 45 is P or T or A or I or L; X 46 is A or V; X 47 is N or T; X 48 is M or K or L; X 49 is F or Y or i; X 50 is S or Y; X 51 is C or S; X 52 is T or I or S; X 53 is T or S; X 54 is D or A; X 5 5 is S or T; X 5 6 is F or L; X 57 is A or G or V; WO 00/28009 PCT/AU99/00993 - 39 X 58 is K or R or T; X 5 9 is Y or F; X 6 0 is W or G; X 61 is A or G; X 62 is V or A; X 63 is F or L; X 64 is S or N; X 65 is V or A; X 66 is P or Q; X 67 is W or C or S; X 68 is F or C; X 69 is V or D or A; X 70 is G or E; X 71 is S or F; X 7 2 is T or i; X 7 3 is L or P; X 74 is S or L; X 75 is A or V; X 76 is M or i; X 77 is M or i; X 7 8 is Y or F; X 7 9 is G or E; X 8 0 is S or N or K; X 81 is L or Q; X 82 is Y or F or H or C; X 83 is S or G or N or D or T; X 84 is V or L; WO 00/28009 PCT/AU99/00993 - 40 X 8 5 is S or N; X 86 is I or M or L; X 87 is F or C; X 88 is C or Y; X 89 is W or R; X 90 is V or A; and X 91 is Y or I or S; and wherein the variant HBV is selected for by a nucleotide analogue of HBV DNA polymerase.

4. A variant HBV according to claim 2 wherein the surface antigen on the variant comprises an amino acid substitution, addition and/or deletion or truncation compared to the amino acid sequence setforth below: M X 1 X 2 X 3 X 4 S GX 5 L X 6 P LX 7 V L Q AX 8 X 9 F X 10 L T X 11 1 X 12 X 13 1 P X 14 S L X 1 5 S WWTSLNFLG X 16 X 1 7 X 1 8 X 19 C X 20 GX 21 NX 22 QS X 23 X 24 S X 2 5 H X 2 6 P X 2 7 X 2 8 C P P X 2 9 C X 3 0 G Y R W M C LX 3 1 R F I I F L X 32 I L L L C L I F L L V L L D X 33 Q G M L X 34 V C P L X 3 . P X 36 X 37 X 38 T TSX 3 9 X 4 0 X 4 1 C X 42 TCX 43 X 4 4 X 45 X 46 Q GX 47 S X 4 8 X 4 9 P X 50 X 51 C C X 52 KP X 5 3 X, 4 G N C T C IP I P S X 55 W AX 56 X 57 X 58 X 59 L W E X 60 X 61 S X 62 R X 63 S W L X 64 LLX 65 X 66 F V Q X 6 7 X 68 X 69 X 70 L X 71 P X 7 2 V W X 73 X 74 X 75 I W X 7 6 X 7 7 W X 78 W X 7 9 P X 80 X 81 X 82 X 83 1 X 84 X 8 5 P F X 86 P L L P I F X 87 X 88 L X 8 9 X 9 0 X 91 I[Formula 1]; WO 00/28009 PCT/AU99/00993 -41 wherein: X, is E or G or D; X 2 isNorSorK; X 3 is I orT; X 4 is T or A; X 5 is F or L; X 6 is G or R; X 7 is L or R; X 8 is G or V; X 9 is F or C; X 1 0 is L or S or W; X 1 , is R or K; X 1 2 is L or R; X 13 is T or K; X 14 is Q or K; X 15 is D or H; X 16 is G or E or A; X 17 is S or A or V or T or L; X 18 is P or T; X 19 is V or R or T or K or G; X 20 is L or P; X 21 is Q or L or K; X 22 is S or L; X 23 is P or Q; X 24 is T or i; X 25 is N or S; X 2 6 is S or L; WO 00/28009 PCT/AU99/00993 - 42 X 27 is T or 1; X 2 8 is S or C; X 29 is I orT; X 30 is P or A; X 31 is R or Q; X 32 is F or C; X 33 is Y or C; X 34 is P or H or S; X 3 5 is I or L; X 36 is G or R; X 37 is S or T; X 38 is T or S; X 39 is T or V or A; X 40 is G or E or Q; X 41 is P or A or S; X 42 is K or R; X 43 is T or M; X 44 is T or I or S or A; X 45 is P or T or A or I or L; X 46 is A or V; X 47 is N or T; X 48 is M or K or L; X 49 is F or Y or i; X 50 is S or Y; X 51 is C or S; X 5 2 is T or I or S; X 53 is T or S; WO 00/28009 PCT/AU99/00993 - 43 X 54 is D or A; X 55 is S or T; X 56 is F or L; X 57 is A or G or V; X 58 is K or R or T; X 59 is Y or F; X 60 is W or G; X 61 is A or G; X 62 is V or A; X 63 is F or L; X 64 is S or N; X 65 is V or A; X 66 is P or Q; X 67 is W or C or S; X 68 is F or C; X 69 is V or D or A; X 70 is G or E; X 71 is S or F; X 7 2 is T or i; X 7 3 is L or P; X 74 is S or L; X 75 is A or V; X 7 6 is M or i; X 7 7 is M or 1; X 7 8 is Y or F; X 79 is G or E; X 80 is S or N or K; WO 00/28009 PCT/AU99/00993 - 44 X 81 is L or Q; X 82 is Y or F or H or C; X 83 is S or G or N or D or T; X 84 is V or L; X 8 5 is S or N; X 86 is I or M or L; X 87 is F or C; X 88 is C or Y; X 89 is W or R; X 90 is V or A; and X 91 is Y or I or S. and wherein the variant HBV is selected for following immunological therapy directed against a surface antigen as defined in Formula I.

5. A variant HBV according to claim 1 comprising a nucleotide sequence having a single or multiple nucleotide substitution, addition and/or deletion or truncation of the nucleotide sequence as set forth in formula III below: A C N 1 A A A C C T N 2 N 3 G G A N 4 G G A A A N 5 T G C A C N 6 T G T A T T C C C A T C C C A T C N 7 T C N 8 T G G G C T T T C G N 9 A A N 1 0 A T N 1 1 C C T A T G G G A G N 12 G G G C T C A G N 13 C C G T T T C T C N 14 T G G C T C A G T T T A C T A G T G C C A T T T G T T C A G T G G T T C G N 15 A G G G C T T T C C C C C A C T G T N 1 6 T G G C T T T C A G N 17 T A T A T G G A T G A T G T G G T N 1 8 T T G G G G G C C A A G T C T G T A C A N 1 9 C A T C N 20 T G A G T C C C T T T N 21 T N 22 C C N 23 C T N 24 T T A C C A A T T T T C T T N 25 T G T CT N 2 6 TG G G N 27 ATAC ATT [Formula Ill]; WO 00/28009 PCT/AU99/00993 -45 wherein: N, isAorC; N 2 is T or A; N 3 is C or T; N 4 is C or T; N 5 is C or T; N 6 is C or T; N 7 is A or G; N 8 is T or C; N 9 is C or G; N 10 is G or A; N 1 , is T or A; N 12 is T or G; N 13 is T or C; N 14 is C or T; N 15 is T or C; N 16 is T or C; N 17 is T or C; N 18 is A or T; N 1 9 is A or G; N 20 is T or G; N 21 is A or T; N 22 is A or G; N 23 is T or G; N 24 is A or G; N 25 is T or C; N 26 is T or C; and WO 00/28009 PCT/AU99/00993 -46 N 27 is T or C. and wherein the HBV variant has a surface antigen exhibiting an altered immunological profile relative to the surface antigen as defined in Formula I.

6. An isolated variant Hepatitis B virus surface antigen (HBsAg) or a recombinant form thereof or a derivative or chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent exhibits an altered immunological profile compared to an HBsAg from a reference HBV.

7. An isolated variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof according to claim 6 wherein the variant HBsAg comprises an amino acid sequence having a single or multiple substitution, addition and/or deletion or truncation of the amino acid sequence set forth below: M X, X 2 X 3 X 4 S GX 5 L X 6 P LX 7 V L Q AX 8 X 9 F X 1 0 L T X 11 1 X 12 X 13 1 P X 1 4 SLX 1 ,S WWTSLNFLGX 1 6 X 17 X 1 8 X 19 C X 20 GX 21 NX 2 2 QS X 23 X 24 S X25HX26 P X 2 7 X 28 C P P X 2 9 C X30 G Y R W M C LX 31 R F I I F L X 3 2 I L L L C L I F L L V L L D X 3 3 Q G M L X 34 V C P L X 35 P X 36 X 37 X 38 TTSX 3 9 X 4 0 X 41 C X 4 2 TCX 4 3 X 4 4 X 4 5 X 4 6 QGX 4 7 S X 4 8 X 4 9 P X 50 X 51 C C X 52 KP X 5 3 X 5 4 G N C T C I P I P S X 55 WAX 5 . X 57 X 58 X 59 L W E X 60 X 61 S X 62 R X 63 S W L X 6 4 LLX 6 5 X,, F V Q X 6 7 X 6 8 X 6 9 X 7 o L X 7 1 P X 7 2 V W X 7 3 X 74 X 7 5 I W X 7 6 X 7 7 W X 7 8 W X7 9 P X 8 0 X 81 X 82 X 8 3 I X 8 4 X 8 5 P F X 8 6 P L L P I F X 87 X 8 , L X 89 X 90 X. 1 I[Formula I]; wherein: X, is E or G or D; X 2 isNorSorK; WO 00/28009 PCT/AU99/00993 - 47 X 3 is I or T; X 4 is T or A; X 5 is F or L; X 6 is G or R; X 7 is L or R; X 8 is G or V; X 9 is F or C; X 1 0 is L or S or W; X 1 , is R or K; X 12 is L or R; X 13 is T or K; X 14 is Q or K; X 15 is D or H; X 16 is G or E or A; X 17 is S orA or V or T or L; X 18 is P or T; X 19 is V or R or T or K or G; X 20 is L or P; X 21 is Q or L or K; X 2 2 is S or L; X 23 is P or Q; X 24 is T or 1; X 25 is N or S; X 2 6 is S or L; X 27 is T or i; X 2 8 is S or C; X 29 is I or T; WO 00/28009 PCT/AU99/00993 - 48 X 30 is P or A; X 31 is R or Q; X 32 is F or C; X 33 is Y or C; X 34 is P or H or S; X 3 5 is I or L; X 3 6 is G or R; X 37 is S or T; X 38 is T or S; X 3 9 is T or V or A; X 40 is G or E or Q; X 41 is P orA or S; X 42 is K or R; X 43 is T or M; X 44 is T or I or S or A; X 45 is P or T or A or I or L; X 46 is A or V; X 47 is N or T; X 48 is M or K or L; X 49 is F or Y or i; X 50 is S or Y; X 51 is C or S; X 52 is T or I or S; X 53 is T or S; X 54 is D or A; X 5 5 is S or T; X 5 6 is F or L; WO 00/28009 PCT/AU99/00993 - 49 X 57 is A or G or V; X 58 is K or R or T; X 59 is Y or F; X 60 is W or G; X 61 is A or G; X 62 is V or A; X 63 is F or L; X 64 is S or N; X 65 is V or A; X 66 is P or Q; X 67 is W or C or S; X 68 is F or C; X 69 is V or D or A; X 70 is G or E; X 71 is S or F; X 7 2 is T or i; X 7 3 is L or P; X 74 is S or L; X 7 5 is A or V; X 7 6 is M or I; X 7 7 is M or i; X 7 8 is Y or F; X 7 9 is G or E; X 80 is S or N or K; X 81 is L or Q; X 82 is Y or F or H or C; X 83 is S or G or N or D or T; WO 00/28009 PCT/AU99/00993 - 50 X 84 is V or L; X 85 is S or N; X 86 is I or M or L; X 87 is F or C; X 88 is C or Y; X 89 is W or R; X 90 is V or A; and X 9 1 is Y or I or S; and wherein a neutralizing antibody directed to a reference HBV exhibits no or reduced neutralizing activity to an HBV carrying said variant HBsAg.

8. An isolated variant HBsAg according to claim 7 encoded by a nucleotide sequence having a single or multiple nucleotide substitution, addition and/or deletion or truncation relative to the nucleotide sequence set forth below: A CNIAAA C C TN 2 N 3 G GAN 4 GGA AAN 5 TGCA CN 6 TG TA TTCCCATCCCATCN 7 T CNT G GG C TTT C GN

9 A A NO A TN 11 C C TATGG GA GN 1 2 GGGC C TCA GN 13 CC G TTTC TC N 1 4 TGGCTCAGTTTACTAGTGCCATTTGTTCAGTGG TTCGN 15 AGGGCTTTCCCCCACTGTN 16 TGGCTTTCA GN, 7 TATAT G GAT GAT GT G G TNI TT G G G GG C CAAG TCT G TAC AN 19 CAT CN 20 T GA G TC C C TT TN 21 TN 22 C CN 23 C TN 2 4 T TA C C AATTTTC TTN 25 TG TC TN 2 6 TGG GN 27 A TA C A T T [FORMULA III]; wherein: N, is A or C; WO 00/28009 PCT/AU99/00993 -51 N 2 is T or A; N 3 is C or T; N 4 is CorT; N 5 is C or T; N 6 is C or T; N 7 isAorG; N 8 is T or C; Ng is C or G; N 1 0 is G or A; N 1 1 is T or A; N 12 is T or G; N 13 is T or C; N 1 4 is C or T; N 1 5 is T or C; N 1 6 is T or C; N 17 is T or C; N 1 8 is A or T; N 1 9 is A or G; N 20 is T or G; N 21 is A or T; N 22 is A or G; N 23 is T or G; N 24 is A or G; N 2 5 is T or C; N 26 is T or C; and N 27 is T or C. WO 00/28009 PCT/AU99/00993 - 52 9. A variant HBV or an isolated HBsAg from said variant HBV wherein said variant HBV comprises an HBsAg having a single or multiple amino acid substitution, addition and/or deletion or truncation relative to the HBsAg on a reference HBV and whereas the HBsAg variant is defined by a single or multiple amino acid substitution, addition and/or truncation to the catalytic region of HBV DNA polymerase as defined below: SZLS WLS LD VSAAFY HZ 2 P LH PAAM PH L LZ 3 GSS G LZ 4 RYV A RLSSZ 5 SZ 6 Z 7 XNZ 8 QZZ 1 eXXXZ 1 1 L HZZ 1 3 C S R Z 14 L Y V S L Z 15 L L Y Z 16 T Z 1 7 G Z 18 K L H L Z 1 9 Z 20 H P I Z 21 L G F R K Z 22 P M G Z 23 G L S P F L L A Q F T S A 1 Z 24 Z 25 Z 26 Z 27 Z 28 R A F Z 2 9 H C Z 30 Z 31 F Z 32 Y M* D D Z 33 V L G A Z 3 4 Z 3 5 Z 3 6 Z 37 H Z 3 8 E Z 39 L Z 4 0 Z 41 Z 42 Z 43 Z 44 Z 4 5 Z4 6 L L Z47Z 4 G I H L N P Z 4 9 K T K R W G Y S L N F M G Y Z 50 I G [Formula 1l]; wherein: X is any amino acid; Z, is N or D; Z 2 is I or P; Z 3 is I or V; Z 4 is S or D; Z 5 is T or N; Z 6 is R or N; Z 7 is N or I; Z 8 is N orY or H; Z 9 is H or Y; Z 10 is G or R; Z 11 is D or N; Z 12 is D or N; WO 00/28009 PCT/AU99/00993 - 53 Z 13 is Sor Y; Z 1 4 is N or Q; Z 1 5 is Lor M; Z 16 is Kor Q; Z 17 is YorEF; Z 18 is R orW; Z 19 is Yor L; Z 20 is Sor A; Z 21 islIor V; Z 22 islIor L; Z 23 is Vor G; Z 24 is Cor L; Z 25 is Aor S; Z 26 is Vor M; Z 27 is Vor T; Z 28 is RorOC; Z 29 is For P; Z 30 is Lor V; Z 31 is Aor V; Z 32 is Sor A; Z 33 is Vor Lor M; Z 34 is Kor R; Z 35 is Sor T; Z 36 is Vor G; Z 3 7 is Qor E; Z 3 8 is Lor Sor R; Z 39 is Sor F; WO 00/28009 PCT/AU99/00993 - 54 Z 40 is F or Y; Z 41 is T or A; Z 42 is A or S; Z 43 is V or 1; Z 44 is T or C; Z 45 is N or S; Z 46 is F or V; Z 47 is S or D; Z 4 8 is L or V; Z 49 is N or Q; Z 50 is V or l; and M* is amino acid 550.

10. A variant HBV or variant HBsAg from said variant HBV comprising a mutation selected from the list consisting of G1 12R, T123P, Y/F134S, D144E, G145R, A157D, E164D, F170L, M1951, W196L, S196W, W196STOP, M1981, W199S, S204T and S21OR wherein "STOP" means a stop codon.

11. A variant HBV or variant HBsAg from said variant HBV comprising a mutation selected from the list consisting of : D144E, G145R, A157D, E164D, M1951, W196L, S196W, W196STOP, M1981, W199S and S2OR wherein "STOP" means a codon.

12. A variant HBV or variant HBsAg from said variant HBV comprising a mutation selected from the list consisting of: Q476. N480G, N485K, K495R, R4990, G499E, W499Q, F512L, 1515L, V519L, L526M, M550V, M550I, V5531 and S565P.

13. A composition comprising a variant HBV or variant HBsAg according to any one of WO 00/28009 PCT/AU99/00993 - 55 claims 1 to 12 or a recombinant or derivative form or its chemical equivalent.

14. A composition according to claim 13 further comprising one or more pharmaceutically acceptable carriers and/or diluents.

15. A method for the treatment or prophylaxis of HBV infection said method comprising administering to a subject an amount of a variant HBV or variant HBsAg according to any one of claims 1 to 12 or a composition according to claim 13 or 14, said amount being effective to induce an immune response to said variant HBV.

16. Use of a variant HBV or an HBsAg from said HBV in the manufacture of a medicament for the treatment or prophylaxis of infection by said variant HBV.

17. Use of a variant HBV or an HBsAg from said variant HBV in screening for an agent useful in the treatment or prophylaxis of infection by said variant HBV.