AU1197799A - Granulocytic ehrlichia genes and uses thereof - Google Patents

Description

WO 00/06744 PCT/US98/22512 GRANULOCYTE EHRLICHIA GENES AND USES THEREOF 5 Background of the Invention Field of the Invention The present invention relates, in general, to granulocytic Ehrlichia (GE) proteins. In particular, the present invention relates to nucleic acid molecules coding for WI1, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 proteins; 10 purified WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 proteins and polypeptides; recombinant nucleic acid molecules; cells containing the recombinant nucleic acid molecules; antibodies having binding affinity specifically to WI, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 proteins and polypeptides; hybridomas containing the antibodies; nucleic acid probes for 15 the detection of nucleic acids encoding WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 proteins; a method of detecting nucleic acids encoding WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 proteins or polypeptides in a sample; kits containing nucleic acid probes or antibodies; bioassays using the nucleic acid sequence, protein or antibodies of this 20 invention to diagnose, assess, or prognose a mammal afflicted with ehrlichiosis; therapeutic uses, specifically vaccines comprising WI1, WI2, WI3, WI4, WIC, NYI1, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2 proteins or polypeptides; and methods of preventing ehrlichiosis in an animal. Related Art 25 Granulocytic ehrlichiosis is an acute, potentially fatal tick-borne infection. The causative agent, granulocytic ehrlichia (GE), has been identified by the polymerase chain reaction (PCR) using universal primers for eubacterial 16S ribosomal RNA (rRNA) to amplify the DNA of infected patients' blood (Chen et al., J. Clin. Micro. 32:589-595 (1994)). Comparison of the 16S rRNA gene sequence of GE to other known 16S rDNA 30 sequences revealed a nearly identical match to the 16S genes of Ehrlichia phagocytophila and Ehrlichia equi (Chen et al., 1994). Two other groups of Ehrlichia species have also WO 00/06744 PCT/US98/22512 been categorized according to their 16S rRNA gene sequences, the Ehrlichia canis and Ehrlichia sennetsu groups. The E. canis and E. sennetsu species predominantly infect mononuclear phagocytes (Dumler et al., N. Eng. J. Med. 325:1109-1110 (1991)), whereas members of the E. phagocytophila group including GE are tropic for granulocytes (Ristic 5 et al., in Bergey's Manual of Systemic Bacteriology, Kreig et al., eds., (1984), pp. 704 709). The near identity of the 16S rRNA gene sequences and the sharing of significant antigenicity by IFA and immunoblot (Dumler et al., J. Clin. Micro. 33:1098-1103 (1995)) indicate that E. phagocytophila, E. equi, and GE are closely related. Full classification of the E. phagocytophila species including antigenic relationships 10 among the individual isolates has been impeded by the inability to cultivate these organisms in cell culture. It has been shown that GE can be successfully cultivated in HL60 cells, a human promyelocytic leukemia cell line (Coughlin et al., PCT Application No. PCT/US96/10117; Goodman et al., N. Eng. J. Med. 334:209-215 (1996)). Walker et al., PCT Application No. PCT/US97/09147 teaches an isolated gene encoding a 120 kDa 15 immunodominant antigen of E. chaffeensis that stimulates production of specific antibodies in infected humans. The present invention describes GE specific genes encoding thirteen proteins (WI, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2) which can be used as diagnostic reagents and vaccines. 2 WO 00/06744 PCT/US98/22512 Summary of the Invention The invention provides isolated nucleic acid molecules coding for polypeptides comprising amino acid sequences corresponding to WI1, WI2, WI3, W.14, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 proteins. 5 The invention further provides purified polypeptides comprising amino acid sequences corresponding to WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 proteins. The invention also provides nucleic acid probes for the specific detection of the presence of WI1, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, 10 and SLOV2 proteins or polypeptides in a sample. The invention further provides a method of detecting nucleic acid encoding WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2 protein in a sample. The invention also provides a kit for detecting the presence of nucleic acid 15 encoding WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 protein in a sample. The invention further provides a recombinant nucleic acid molecule comprising, 5' to 3', a promoter effective to initiate transcription in a host cell and the above-described isolated nucleic acid molecule. 20 The invention also provides a recombinant nucleic acid molecule comprising a vector and the above-described isolated nucleic acid molecule. The invention further provides a recombinant nucleic acid molecule comprising a sequence complimentary to an RNA sequence encoding an amino acid sequence corresponding to the above-described polypeptide. 25 The invention also provides a cell that contains the above-described recombinant nucleic acid molecule. The invention further provides a non-human organism that contains the above described recombinant nucleic acid molecule. The invention also provides an antibody having binding affinity specifically to a 30 WI, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 protein or polypeptide. 3 WO 00/06744 PCT/US98/22512 The invention further provides a method of detecting WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 protein or polypeptide in a sample. The invention also provides a method of measuring the amount of WIl, WI2, WI3, 5 WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 protein or polypeptide in a sample. The invention further provides a method of detecting antibodies having binding affinity specifically to a WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI1, or SLOV2 protein or polypeptide. 10 The invention further provides a diagnostic kit comprising a first container means containing the above-described antibody, and a second container means containing a conjugate comprising a binding partner of the monoclonal antibody and a label. The invention also provides a hybridoma which produces the above-described monoclonal antibody. 15 The invention further provides diagnostic methods for ehrlichiosis. More specifically, the invention further provides a method for identifying granulocytic Ehrlichia in an animal comprising analyzing tissue or body fluid from the animal for a WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 nucleic acid, protein, polysaccharide, or antibody. 20 The invention also provides methods for therapeutic uses involving all or part of the WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 nucleic acid or protein. More specifically, the invention further provides a vaccine comprising a WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 protein or nucleic acid together with a pharmaceutically acceptable diluent, 25 carrier, or excipient, wherein the protein or nucleic acid is present in an amount effective to elicit a beneficial immune response in an animal to the protein. The invention also provides a method of preventing or inhibiting ehrlichiosis in an animal comprising administering to the animal the above-described vaccine. Further objects and advantages of the present invention will be clear from the 30 description that follows. 4 WO 00/06744 PCT/US98/22512 Definitions In the description that follows, a number of terms used in recombinant DNA (rDNA) technology are extensively utilized. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, 5 the following definitions are provided. Isolated Nucleic Acid Molecule. An isolated nucleic acid molecule, as is generally understood and used herein, refers to a polymer of nucleotides, and includes but should not be limited to DNA and RNA. Recombinant DNA. Any DNA molecule formed by joining DNA segments from 10 different sources and produced using recombinant DNA technology (i.e., molecular genetic engineering). DNA Segment. A DNA segment, as is generally understood and used herein, refers to a molecule comprising a linear stretch of nucleotides wherein the nucleotides are present in a sequence that can encode, through the genetic code, a molecule comprising a 15 linear sequence of amino acid residues that is referred to as a protein, a protein fragment or a polypeptide. Gene. A DNA sequence related to a single polypeptide chain or protein, and as used herein includes the 5' and 3' untranslated ends. The polypeptide can be encoded by a full-length sequence or any portion of the coding sequence, so long as the functional 20 activity of the protein is retained. Complementary DNA (cDNA). Recombinant nucleic acid molecules synthesized by reverse transcription of messenger RNA (mRNA). Structural Gene. A DNA sequence that is transcribed into mRNA that is then translated into a sequence of amino acids characteristic of a specific polypeptide. 25 Open Reading Frame (orf). The property of some nucleic acid sequences to encode for more than one peptide within the same sequence, which is possible because these sequences contain a series of triplets coding for amino acids without any termination codons interrupting the relevant reading frames. Restriction Endonuclease. A restriction endonuclease (also restriction enzyme) is 30 an enzyme that has the capacity to recognize a specific base sequence (usually 4, 5, or 6 base pairs in length) in a DNA molecule, and to cleave the DNA molecule at every place 5 WO 00/06744 PCT/US98/22512 where this sequence appears. For example, EcoRI recognizes the base sequence GAATTC/CTTFAAG. Restriction Fragment. The DNA molecules produced by digestion with a restriction endonuclease are referred to as restriction fragments. Any given genome can 5 be digested by a particular restriction endonuclease into a discrete set of restriction fragments. Agarose Gel Electrophoresis. To determine the length of restriction fragments, an analytical method for fractionating double-stranded DNA molecules on the basis of size is required. The most commonly used technique (though not the only one) for achieving 10 such a fractionation is agarose gel electrophoresis. The principle of this method is that DNA molecules migrate through the gel as though it were a sieve that retards the movement of the largest molecules to the greatest extent and the movement of the smallest molecules to the least extent. Note that the smaller the DNA fragment, the greater the mobility under electrophoresis in the agarose gel. 15 The DNA fragments fractionated by agarose gel electrophoresis can be visualized directly by a staining procedure if the number of fragments included in the pattern is small. The DNA fragments of genomes can be visualized successfully. However, most genomes, including the human genome, contain far too many DNA sequences to produce a simple pattern of restriction fragments. For example, the human genome is digested into 20 approximately 1,000,000 different DNA fragments by EcoRI. In order to visualize a small subset of these fragments, a methodology referred to as the Southern hybridization procedure can be applied. Southern Transfer Procedure. The purpose of the Southern transfer procedure (also referred to as blotting) is to physically transfer DNA fractionated by agarose gel 25 electrophoresis onto a nitrocellulose filter paper or another appropriate surface or method, while retaining the relative positions of DNA fragments resulting from the fractionation procedure. The methodology used to accomplish the transfer from agarose gel to nitrocellulose involves drawing the DNA from the gel into the nitrocellulose paper by capillary action or electrophonetic transfer. 30 Nucleic Acid Hybridization. Nucleic acid hybridization depends on the principle that two single-stranded nucleic acid molecules that have complementary base sequences will reform the thermodynamically favored double-stranded structure if they are mixed 6 WO 00/06744 PCT/US98/22512 under the proper conditions. The double-stranded structure will be formed between two complementary single-stranded nucleic acids even if one is immobilized on a nitrocellulose filter as by the Southern hybridization transfer procedures. In the Southern hybridization procedure, the latter situation occurs. As noted previously, the DNA of the individual to 5 be tested is digested with a restriction endonuclease, fractionated by agarose gel electrophoresis, converted to the single-stranded form, and transferred to nitrocellulose paper, making it available for reannealing to the hybridization probe. Examples of hybridization conditions can be found in Ausubel, F.M. et al., Current Protocols in Molecular Biology, John Wily & Sons, Inc., New York, NY (1989). For examples, a 10 nitrocellulose filter is incubated overnight at 68oC with labeled probe in a solution containing 50% formamide, high salt (either 5X SSC [20X: 3M NaCl/0.3M trisodium citrate] or 5X SSPE [20X: 3.6M NaCI/0.2M NaH 2

PO

4 /0.02M EDTA, pH 7.7]), 5X Denhardt's solution, 1% SDS, and 100 pg/ml denatured salmon sperm DNA. This is followed by several washes in 0.2X SSC/0.1% SDS at a temperature selected based on the 15 desired stringency: room temperature (low stringency), 42oC (moderate stringency) or 68oC (high stringency). The temperature selected is determined based on the melting temperature (Tm) of the DNA hybrid. Hybridization Probe. To visualize a particular DNA sequence in the Southern hybridization procedure, a labeled DNA molecule or hybridization probe is reacted to the 20 fractionated DNA bound to the nitrocellulose filter. The areas on the filter that carry DNA sequences complementary to the labeled DNA probe become labeled themselves as a consequence of the reannealing reaction. The areas of the filter that exhibit such labeling are visualized. The hybridization probe is generally produced by molecular cloning of a specific DNA sequence. 25 Oligonucleotide or Oligomer. A molecule comprised of two or more deoxyribonucleotides or ribonucleotides, preferably more than three. Its exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. An oligonucleotide can be derived synthetically or by cloning. Sequence Amplification. A method for generating large amounts of a target 30 sequence. In general, one or more amplification primers are annealed to a nucleic acid sequence. Using appropriate enzymes, sequences found adjacent to, or in between the primers are amplified. 7 WO 00/06744 PCT/US98/22512 Amplification Primer. An oligonucleotide which is capable of annealing adjacent to a target sequence and serving as an initiation point for DNA synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is initiated. 5 Vector. A plasmid or phage DNA or other DNA sequence into which DNA can be inserted to be cloned. The vector can replicate autonomously in a host cell, and can be further characterized by one or a small number of endonuclease recognition sites at which such DNA sequences can be cut in a determinable fashion and into which DNA can be inserted. The vector can further contain a marker suitable for use in the identification of 10 cells transformed with the vector. Markers, for example, are tetracycline resistance or ampicillin resistance. The words "cloning vehicle" are sometimes used for "vector." Expression. Expression is the process by which a structural gene produces a polypeptide. It involves transcription of the gene into mRNA, and the translation of such mRNA into polypeptide(s). 15 Expression Vector. A vector or vehicle similar to a cloning vector but which is capable of expressing a gene which has been cloned into it, after transformation into a host. The cloned gene is usually placed under the control of (i.e., operably linked to) certain control sequences such as promoter sequences. Expression control sequences will vary depending on whether the vector is 20 designed to express the operably linked gene in a prokaryotic or eukaryotic host and can additionally contain transcriptional elements such as enhancer elements, termination sequences, tissue-specificity elements, and/or translational initiation and termination sites. Functional Derivative. A functional derivative of a sequence, either protein or nucleic acid, is a molecule that possesses a biological activity (either functional or 25 structural) that is substantially similar to a biological activity of the protein or nucleic acid sequence. A functional derivative of a protein can contain post-translational modifications such as covalently linked carbohydrate, depending on the necessity of such modifications for the performance of a specific function. The term "functional derivative" is intended to include the fragments, segments, variants, analogs, or chemical derivatives of a molecule. 30 As used herein, a molecule is said to be a chemical derivative of another molecule when it contains additional chemical moieties not normally a part of the molecule. Such moieties can improve the molecule's solubility, absorption, biological half life, and the 8 WO 00/06744 PCT/US98/22512 like. The moieties can alternatively decrease the toxicity of the molecule, eliminate or attenuate any undesirable side effect of the molecule, and the like. Moieties capable of mediating such effects are disclosed in Remington's Pharmaceutical Sciences (1980). Procedures for coupling such moieties to a molecule are well known in the art. 5 Variant. A variant of a protein or nucleic acid is meant to refer to a molecule substantially similar in structure and biological activity to either the protein or nucleic acid. Thus, provided that two molecules possess a common activity and can substitute for each other, they are considered variants as that term is used herein even if the composition or secondary, tertiary, or quaternary structure of one of the molecules is not identical to 10 that found in the other, or if the amino acid or nucleotide sequence is not identical. Allele. An allele is an alternative form of a gene occupying a given locus on the chromosome. Mutation. A mutation is any detectable change in the genetic material which can be transmitted to daughter cells and possibly even to succeeding generations giving rise to 15 mutant cells or mutant individuals. If the descendants of a mutant cell give rise only to somatic cells in multicellular organisms, a mutant spot or area of cells arises. Mutations in the germ line of sexually reproducing organisms can be transmitted by the gametes to the next generation resulting in an individual with the new mutant condition in both its somatic and germ cells. A mutation can be any (or a combination of) detectable, 20 unnatural change affecting the chemical or physical constitution, mutability, replication, phenotypic function, or recombination of one or more deoxyribonucleotides; nucleotides can be added, deleted, substituted for, inverted, or transposed to new positions with and without inversion. Mutations can occur spontaneously and can be induced experimentally by application of mutagens. A mutant variation of a nucleic acid molecule results from a 25 mutation. A mutant polypeptide can result from a mutant nucleic acid molecule. Species. A species is a group of actually or potentially interbreeding natural populations. A species variation within a nucleic acid molecule or protein is a change in the nucleic acid or amino acid sequence that occurs among species and can be determined by DNA sequencing of the molecule in question. 30 Purified. A purified protein or nucleic acid is a protein or nucleic acid that has been separated from a cellular component. Purified proteins or nucleic acids have been purified to a level of purity not found in nature. 9 WO 00/06744 PCT/US98/22512 Brief Description of the Figures FIGURE 1 is a diagrammatic representation of the GE160 gene (S2 clone) showing the approximate location of the primer sets used for PCR amplification -using DNA extracted from the blood of infected animals including humans. Thin line: DNA sequence; 5 Box: coding region with nucleotide numbering shown at the start and stop codon based on the S2 clone. FIGURE 2 shows the alignment of the nucleotide sequences derived from the representative clones of the invention WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2. S2 GE160 is designated as usg3, WIC is 10 designated as widog, EQ is designated as equi, and BOV is designated as swedbovine. FIGURE 3 shows the DNA sequence of representative clone WIC (SEQ ID NO:1). FIGURE 4 shows the DNA sequence of representative clone SWED (SEQ ID NO:2). FIGURE 5 shows the DNA sequence of representative clone EQ (SEQ ID NO:3). 15 FIGURE 6 shows the DNA sequence of representative clone BOV (SEQ ID NO:4). FIGURE 7 shows the DNA sequence of representative clone WII (SEQ ID NO:5). FIGURE 8 shows the DNA sequence of representative clone WI2 (SEQ ID NO:6). FIGURE 9 shows the DNA sequence of representative clone WI3 (SEQ ID NO:7). 20 FIGURE 10 shows the DNA sequence of representative clone WI4 (SEQ ID NO:8). FIGURE 11 shows the DNA sequence of representative clone NY1 (SEQ ID NO:9). FIGURE 12 shows the DNA sequence of representative clone NY2 (SEQ ID 25 NO:10). FIGURE 13 shows the DNA sequence of representative clone NY3 (SEQ ID NO: 11). FIGURE 14 shows the DNA sequence of representative clone SLOV1 (SEQ ID NO:12). 30 FIGURE 15 shows the DNA sequence of representative clone SLOV2 (SEQ ID NO:13). 10 WO 00/06744 PCT/US98/22512 FIGURE 16 shows the amino acid sequence of representative clone WIC (SEQ ID NO: 14). FIGURE 17 shows the amino acid sequence of representative clone SWED (SEQ ID NO:15). 5 FIGURE 18 shows the amino acid sequence of representative clone EQ (SEQ ID NO:16). FIGURE 19 shows the amino acid sequence of representative clone BOV (SEQ ID NO:17). FIGURE 20 shows the amino acid sequence of representative clone WI I (SEQ ID 10 NO:18). FIGURE 21 shows the amino acid sequence of representative clone WI2 (SEQ ID NO: 19). FIGURE 22 shows the amino acid sequence of representative clone WI3 (SEQ ID NO:20). 15 FIGURE 23 shows the amino acid sequence of representative clone WI4 (SEQ ID NO:21). FIGURE 24 shows the amino acid sequence of representative clone NY I (SEQ ID NO:22). FIGURE 25 shows the amino acid sequence of representative clone NY2 (SEQ ID 20 NO:23). FIGURE 26 shows the amino acid sequence of representative clone NY3 (SEQ ID NO:24). FIGURE 27 shows the amino acid sequence of representative clone SLOV1 (SEQ ID NO:25). 25 FIGURE 28 shows the amino acid sequence of representative clone SLOV2 (SEQ ID NO:26). FIGURE 29 shows the alignment of the deduced amino acid sequence corresponding to the representative clones of this invention WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2. S2 GEl60 is designated as 30 usg3, WIC is designated as widog, EQ is designated as equi, and BOV is designated as swedbovine. 11 WO 00/06744 PCT/US98/22512 Detailed Description of the Preferred Embodiments The sequencing and protein analysis of thirteen recombinant clones (WI, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2) identified by PCR amplification of DNA in the blood of various animals including humans infected 5 with GE is described. These clones were proven to encode the GE160 gene (see Storey et al., Infect. hmun. 66:1356-1363 (1998)). Previous analysis by the inventors of a genomic expression library made from the DNA of strain USG3, has identified three genes by screening the library with convalescent dog sera. The genes described herein most likely encode the immunoreactive GE160 10 antigen. Other immunodominant rickettsial antigens have been shown to be important diagnostic reagents and vaccine targets including the outer membrane polypeptides of Anaplasma marginale (Tebele et al., Infect. Inmun. 59:3199-3204 (1991)), immunogenic proteins of Cowdria rumnantiun (Mahan et al., Microbiology 140:2135-2142 (1994); van Vliet et al., Infect. Immun. 62:1451-1456 (1994)), the 120 kDa immunodominant protein 15 of E. chaffeensis (Yu et al., J. Clin. Micro. 34:2853-2855 (1996)), the immunodominant surface protein antigen of Rickettsia prowazekii (Dasch et al., in Microbiology, D. Schlessinger (ed.), American Society for Microbiology, Washington, D.C., (1984), pp. 251-256,) and two Rickettsia rickettsii surface proteins (Anacker et al., Infect. Anmun. 55:825-827 (1987); Sumner et al., Vaccine 13:29-35 (1995)). Many of these proteins 20 contain highly repeated regions similar to those found for GE proteins. Repetitive protein domains have been shown to function in ligand binding (Wren, Mol. Microbiol. 5:797-803 (1991)) and may function to facilitate rickettsial uptake by host cell membranes. For purposes of clarity of disclosure, and not by way of limitation, the detailed description of the invention is divided into the following subsections: 25 I. Isolated Nucleic Acid Molecules Coding for WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 Polypeptides; II. Recombinantly Produced WIH, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 Polypeptides; III. A Nucleic Acid Probe for the Specific Detection of WII, WI2, WI3, WI4, 30 WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2; 12 WO 00/06744 PCT/US98/22512 IV. A Method of Detecting The Presence of WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 in a Sample; V. A Kit for Detecting the Presence of WI1, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 in a Sample; 5 VI. DNA Constructs Comprising WIH, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 Nucleic Acid Molecule and Cells Containing These Constructs; VII. An Antibody Having Binding Affinity to WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 Polypeptide and a 10 Hybridoma Containing the Antibody; VIII.A Method of Detecting a WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 Polypeptide or Antibody in a Sample; IX. A Diagnostic Kit Comprising WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 Protein or Antibody; 15 X. Diagnostic Screening; and XI. Vaccines I. Isolated Nucleic Acid Molecules Coding for WI1, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 Polypeptides In one embodiment, the present invention relates to isolated amino acid molecules 20 comprising: (a) a nucleotide sequence encoding the WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2 polypeptide comprising the complete amino acid sequence in SEQ ID NOS: 5, 6, 7, 8, 1, 9, 10, 11, 2, 4, 3, 12, and 13 respectively; (b) a nucleotide sequence encoding the WIl, WI2, WI3, WI4, WIC, NY1, NY2, 25 NY3, SWED, BOV, EQ, SLOVI, and SLOV2 polypeptide comprising the complete amino acid sequence encoded by the polynucleotide; and (c) a nucleotide sequence complementary to any of the nucleotide sequences in (a) or (b). In one preferred embodiment, the isolated nucleic acid molecule comprises a WII, 30 WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 nucleotide sequence corresponding to SEQ ID NOS: 5, 6, 7, 8, 1, 9, 10, 11, 2, 4, 3, 12 or 13 WO 00/06744 PCT/US98/22512 13. In another preferred embodiment, the isolated nucleic acid molecule comprises the WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 nucleotide sequence present in SEQ ID NOS: 5, 6, 7, 8, 1, 9, 10, 11, 2, 4, 3, 12, and 13 respectively. In another embodiment, the isolated nucleic acid molecule encodes the WI1, 5 WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 amino acid sequence present in SEQ ID NOS: 18, 19, 20, 21, 14, 22, 23, 24, 15, 17, 16, 25, and 26, respectively. Also included within the scope of this invention are the functional equivalents of the herein-described isolated nucleic acid molecules and derivatives thereof. For example, 10 the nucleic acid sequences depicted in SEQ ID NOS: 5, 6, 7, 8, 1, 9, 10, 11, 2, 4, 3, 12 or 13 can be altered by substitutions, additions or deletions that provide for functionally equivalent molecules. Due to the degeneracy of nucleotide coding sequences, other DNA sequences which encode substantially the amino acid sequence corresponding to the amino acid sequence of the peptide encoded by SEQ ID NOS: 18, 19, 20, 21, 14, 22, 23, 24, 15, 15 17, 16, 25, and 26 can be used in the practice of the present invention. These include but are not limited to nucleotide sequences comprising all or portions of WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2 nucleic acid depicted in SEQ ID NOS: 5, 6, 78, 1, 9, 10, 11, 2, 4, 3, 12, or 13 respectively which are altered by the substitution of different codons that encode a functionally equivalent amino 20 acid residue within the sequence. In addition, the nucleic acid sequence can comprise a nucleotide sequence which results from the addition, deletion or substitution of at least one nucleotide to the 5'-end and/or the 3'-end of the nucleic acid formula shown in SEQ ID NOS: 5, 6, 7, 8, 1, 9, 10, 11, 2, 4, 3, 12, and 13 or a derivative thereof. Any nucleotide or polynucleotide can be 25 used in this regard, provided that its addition, deletion or substitution does not substantially alter the amino acid sequence of SEQ ID NOS: 18, 19, 20, 21, 14, 22, 23, 24, 15, 17, 16, 25, and 26, which is encoded by the nucleotide sequence. Moreover, the nucleic acid molecule of the present invention can, as necessary, have restriction endonuclease recognition sites added to its 5'-end and/or 3'-end. All variations of the 30 nucleotide sequence of the WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV 1, and SLOV2 gene and fragments thereof permitted by the genetic code are, therefore, included in this invention. 14 WO 00/06744 PCT/US98/22512 Further, it is possible to delete codons or to substitute one or more codons by codons other than degenerate codons to produce a structurally modified polypeptide, but one which has substantially the same utility or activity of the polypeptide produced by the unmodified nucleic acid molecule. As recognized in the art, the two polypeptides are 5 functionally equivalent, as are the two nucleic acid molecules which give rise to their production, even though the differences between the nucleic acid molecules are not related to degeneracy of the genetic code. A. Isolation of Nucleic Acid In one aspect of the present invention, isolated nucleic acid molecules coding for 10 polypeptides having amino acid sequences corresponding to WI, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 are provided. In particular, the nucleic acid molecule can be isolated from a biological sample (preferably of mammalian or tick origin) containing GE RNA or DNA. The nucleic acid molecule can be isolated from a biological sample containing GE 15 RNA using the techniques of cDNA cloning and subtractive hybridization. The nucleic acid molecule can also be isolated from a cDNA library using a homologous probe. The nucleic acid molecule can be isolated from a biological sample containing genomic DNA or from a genomic library. Suitable biological samples include, but are not limited to, whole organisms, organs, tissues, blood and cells. The method of obtaining the 20 biological sample will vary depending upon the nature of the sample. One skilled in the art will realize that genomes can be subject to slight allelic variations between individuals. Therefore, the isolated nucleic acid molecule is also intended to include allelic variations, so long as the sequence is a functional derivative of the WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, and 25 SLOV2 coding sequence. When a WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 allele does not encode the identical sequence to that found in SEQ ID NOS: 5, 6, 7, 8, 1, 9, 10, 11, 2, 4, 3, 12, or 13 it can be isolated and identified as WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 using the same techniques used herein, and especially PCR techniques to amplify the 30 appropriate gene with primers based on the sequences disclosed herein. 15 WO 00/06744 PCT/US98/22512 One skilled in the art will realize that organisms other than GE will also contain WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2 genes. The invention is intended to include, but not be limited to WII,.WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2 nucleic acid molecules 5 isolated from the above-described organisms. Also, infected eukaryotes (for example, mammals including humans, birds, and fish) may contain the WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 genes. B. Synthesis of Nucleic Acid Isolated nucleic acid molecules of the present invention are also meant to include 10 those chemically synthesized. For example, a nucleic acid molecule with the nucleotide sequence which codes for the expression product of WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV 1, or SLOV2 gene can be designed and, if necessary, divided into appropriate smaller fragments. Then an oligomer which corresponds to the nucleic acid molecule, or to each of the divided fragments, can be 15 synthesized. Such synthetic oligonucleotides can be prepared, for example, by the triester method of Matteucci et al., I. Am. Chemn. Soc. 103:3185-3191 (1981) or by using an automated DNA synthesizer. An oligonucleotide can be derived synthetically or by cloning. If necessary, the 5'-ends of the oligomers can be phosphorylated using T4 polynucleotide kinase. Kinasing 20 of single strands prior to annealing or for labeling can be achieved using an excess of the enzyme. If kinasing is for the labeling of probe, the ATP can contain high specific activity radioisotopes. Then, the DNA oligomer can be subjected to annealing and ligation with T4 ligase or the like. II. Recombinantly Produced WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, 25 BOV, EQ, SLOVI, and SLOV2 Polypeptides In another embodiment, the present invention relates to a purified polypeptide (preferably, substantially pure) having an amino acid sequence corresponding to the polypeptide sequence encoded by the nucleic acid sequence corresponding to WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 or a functional 16 WO 00/06744 PCT/US98/22512 derivative thereof or mutant or species variation thereof, or at least six amino acids thereof (preferably, at least 10, 15, 20, 25 or 50 contiguous amino acids thereof). In a preferred embodiment, the invention relates to WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 epitopes. The epitope of these 5 polypeptides is an immunogenic or antigenic epitope. An immunogenic epitope is that part of the protein which elicits an antibody response when the whole protein is the immunogen. An antigenic epitope is a fragment of the protein which can elicit an antibody response. Methods of selecting antigenic epitope fragments are well known in the art. (Sutcliffe et al., Science 219:660-666 (1983)). Antigenic epitope-bearing peptides 10 and polypeptides of the invention are useful to raise an immune response that specifically recognizes the polypeptides. Antigenic epitope-bearing peptides and polypeptides of the invention comprise at least 7 amino acids (preferably, 9, 10, 12, 15, or 20 amino acids) of the proteins of the invention. Amino acid sequence variants of WI, WI2, WI3, WI4, WIC, NY1, NY2, NY3, 15 SWED, BOV, EQ, SLOV1, and SLOV2 can be prepared by mutations in the DNA. Such variants include, for example, deletions from, or insertions or substitutions of, residues within the amino acid sequence of the peptide encoded by SEQ ID NOS: 18, 19, 20, 21, 14, 22, 23, 24, 15, 17, 16, 25, or 26. Any combination of deletion, insertion, and substitution can also be made to arrive at the final construct, provided that the final 20 construct possesses the desired activity. While the site for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined. For example, to optimize the performance of a mutation at a given site, random mutagenesis can be conducted at the target codon or region and the expressed WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, 25 EQ, SLOV1, and SLOV2 variants screened for the optimal combination of desired activity. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, for example, site-specific mutagenesis. Preparation of a WI 1, WI2, WI3, WI4, WIC, NY 1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 variant in accordance herewith is preferably achieved by site-specific 30 mutagenesis of DNA that encodes an earlier prepared variant or a nonvariant version of the protein. Site-specific mutagenesis allows the production of WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 variants through the use 17 WO 00/06744 PCT/US98/22512 of specific oligonucleotide sequences that encode the DNA sequence of the desired mutation. In general, the technique of site-specific mutagenesis is well known in the art, as exemplified by publications such as Adelman et al., DNA 2:183 (1983) and Ausubel et al. "Current Protocols in Molecular Biology", J. Wiley & Sons, New York, NY, 1996. 5 As will be appreciated, the site-specific mutagenesis technique can employ a phage vector that exists in both a single-stranded and double-stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the M13 phage, for example, as disclosed by Messing et al., Third Cleveland Symposiun on Macronwlecules and Recombinant DNA, A. Walton (ed.), Elsevier, Amsterdam (1981). These phage are readily 10 commercially available and their use is generally well known to those skilled in the art. Alternatively, plasmid vectors that contain a single-stranded phage origin of replication (Vieira et al., Meth. Enzvmol. 153:3 (1987)) can be employed to obtain single-stranded DNA. In general, site-directed mutagenesis in accordance herewith is performed by first 15 obtaining a single-stranded vector that includes within its sequence a DNA sequence that encodes the relevant protein. An oligonucleotide primer bearing the desired mutated sequence is prepared, generally synthetically, for example, by the method of Crea et al., Proc. Natl. Acad. Sci. (USA) 75:5765 (1978). This primer is then annealed with the single-stranded protein-sequence-containing vector, and subjected to DNA-polymerizing 20 enzymes such as E. coli polymerase I Klenow fragment, to complete the synthesis of the mutation-bearing strand. Thus, a mutated sequence and the second strand bears the desired mutation. This heteroduplex vector is then used to transform appropriate cells and clones are selected that include recombinant vectors bearing the mutated sequence arrangement. 25 After such a clone is selected, the mutated protein region can be removed and placed in an appropriate vector for protein production, generally an expression vector of the type that can be employed for transformation of an appropriate host. Amino acid sequence deletions generally range from about I to 30 residues, more preferably 1 to 10 residues, and typically are contiguous. 30 Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions of from one residue to polypeptides of essentially unrestricted length, as well as intrasequence insertions of single or multiple amino acid residues. Intrasequence 18 WO 00/06744 PCT/US98/22512 insertions (i.e., insertions within the complete WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 sequence) can range generally from about 1 to 10 residues, more preferably 1 to 5. The third group of variants are those in which at least one amino acid residue in 5 the WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 molecule, and preferably, only one, has been removed and a different residue inserted in its place. Such substitutions preferably are made in accordance with the following Table I when it is desired to modulate finely the characteristics of WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2. 10 Table 1 Original Residue (3-letter abbreviation) Exemplary Substitutions (3-letter abbreviation) Ala Gly; Ser Arg Lys Asn Gin; His 15 Asp Glu Cys Ser Gin Asn Glu Asp Gly Ala; Pro 20 His Asn; Gin Ile Leu; Val Leu Ile; Val Lys Arg; Gln; Glu Met Leu; Tyr; Ile 25 Phe Met; Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe 30 Val Ile; Leu Substantial changes in functional or immunological identity are made by selecting substitutions that are less conservative than those in Table 1, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, 35 (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. The substitutions that in general are expected are those in which (a) glycine and/or proline is substituted by another amino acid or is deleted or inserted; (b) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, 19 WO 00/06744 PCT/US98/22512 e.g., leucyl, isoleucyl, phenylalanyl, valyl, or alanyl; (c) a cysteine residue is substituted for (or by) any other residue; (d) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) a residue having an electronegative charge, e.g., glutamyl or aspartyl; or (e) a residue having a bulky side chain, e.g., phenylalanine, is 5 substituted for (or by) one not having such a side chain, e.g., glycine. Some deletions and insertions, and substitutions are not expected to produce radical changes in the characteristics of WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will 10 appreciate that the effect will be evaluated by routine screening assays. For example, a variant typically is made by site-specific mutagenesis of the native WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 encoding-nucleic acid, expression of the variant nucleic acid in recombinant cell culture, and, optionally, purification from the cell culture, for example, by immunoaffinity adsorption on a column 15 (to absorb the variant by binding it to at least one remaining immune epitope). The activity of the cell lysate or purified WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 molecule variant is then screened in a suitable screening assay for the desired characteristic. For example, a change in the immunological character of the WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, 20 BOV, EQ, SLOVI, or SLOV2 molecule, such as affinity for a given antibody, is measured by a competitive type immunoassay. Changes in immunomodulation activity are measured by the appropriate assay. Modifications of such protein properties as redox or thermal stability, hydrophobicity, susceptibility to proteolytic degradation or the tendency to aggregate with carriers or into multimers are assayed by methods well known to the 25 ordinarily skilled artisan. A variety of methodologies known in the art can be utilized to obtain the peptide of the present invention. In one embodiment, the peptide is purified from tissues or cells which naturally produce the peptide. Alternatively, the above-described isolated nucleic acid fragments can be used to express the WI, WI2, WI3, WI4, WIC, NYI, NY2, NY3, 30 SWED, BOV, EQ, SLOV1, or SLOV2 protein in any organism. The samples of the present invention include cells, protein extracts or membrane extracts of cells, or 20 WO 00/06744 PCT/US98/22512 biological fluids. The sample will vary based on the assay format, the detection method and the nature of the tissues, cells or extracts used as the sample. Any prokaryotic (preferably, a granulocytic ehrlichia) organism can be used as a source for the peptide of the invention, as long as the source organism naturally contains 5 such a peptide. A eukaryotic organism infected with granulocytic ehrlichia can also be used as the source organism. As used herein, "source organism" refers to the original organism from which the amino acid sequence of the subunit is derived, regardless of the organism the subunit is expressed in and ultimately isolated from. One skilled in the art can readily follow known methods for isolating proteins in 10 order to obtain the peptide free of natural contaminants. These include, but are not limited to: immunochromotography, size-exclusion chromatography, HPLC, ion-exchange chromatography, and immuno-affinity chromatography. III. A Nucleic Acid Probe for the Specific Detection of WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 15 In another embodiment, the present invention relates to a nucleic acid probe for the specific detection of the presence of WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 nucleic acid in a sample comprising the above described nucleic acid molecules or at least a fragment thereof which binds under stringent conditions to WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, 20 or SLOV2 nucleic acid. In one preferred embodiment, the present invention relates to an isolated nucleic acid probe consisting of 10 to 1000 nucleotides (preferably, 10 to 500, 10 to 100, 10 to 50, 10 to 35, 20 to 1000, 20 to 500, 20 to 100, 20 to 50, or 20 to 35) which hybridizes preferentially to RNA or DNA of granulocytic ehrlichia but not to RNA or DNA of non 25 granulocytic ehrlichia organisms (example, humans), wherein said nucleic acid probe is or is complementary to a nucleotide sequence consisting of at least 10 consecutive nucleotides (preferably, 15, 20, 25, or 30) from the nucleic acid molecule comprising a polynucleotide sequence at least 90% identical to a sequence selected from: (a) a nucleotide sequence encoding the WIl, WI2, WI3, WI4, WIC, NY 1, NY2, 30 NY3, SWED, BOV, EQ, SLOV1, or SLOV2 polypeptide comprising the complete amino 21 WO 00/06744 PCT/US98/22512 acid sequence corresponding to the amino acid sequence of the peptide encoded by SEQ ID NOS: 5, 6, 7, 8, 1, 9, 10, 11, 2, 4, 3, 12, or 13; (b) a nucleotide sequence encoding the WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 polypeptide comprising the complete amino 5 acid sequence encoded by the polynucleotide; (c) a nucleotide sequence complementary to any of the nucleotide sequences in (a) or (b); and (d) a nucleotide sequence as previously described above. The nucleic acid probe can be used to probe an appropriate chromosomal or cDNA 10 library by usual hybridization methods to obtain another nucleic acid molecule of the present invention. A chromosomal DNA or cDNA library can be prepared from appropriate cells according to recognized methods in the art (cf. Molecular Cloning: A Laboratory Manual, 2nd edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, 1989). 15 In the alternative, chemical synthesis is carried out in order to obtain nucleic acid probes having nucleotide sequences which correspond to amino-terminal and carboxy terminal portions of the amino acid sequence corresponding to the amino acid sequence of the peptide encoded by SEQ ID NOS: 5, 6, 7, 8, 1, 9, 10, 11, 2, 4, 3, 12, or 13. Thus, the synthesized nucleic acid probes can be used as primers in a polymerase chain reaction 20 (PCR) carried out in accordance with recognized PCR techniques, essentially according to PCR Protocols, A Guide to Methods and Applications, edited by Michael et al., Academic Press, 1990, utilizing the appropriate chromosomal, cDNA or cell line library to obtain the fragment of the present invention. One skilled in the art can readily design such probes based on the sequence 25 disclosed herein using methods of computer alignment and sequence analysis known in the art (cf. Molecular Cloning: A Laboratory Manual, 2nd edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, 1989). The hybridization probes of the present invention can be labeled by standard labeling techniques such as with a radiolabel, enzyme label, fluorescent label, biotin-avidin 30 label, chemiluminescence, and the like. After hybridization, the probes can be visualized using known methods. 22 WO 00/06744 PCT/US98/22512 The nucleic acid probes of the present invention include RNA, as well as DNA probes, such probes being generated using techniques known in the art. In one embodiment of the above described method, a nucleic acid probe is immobilized on a solid support. Examples of such solid supports include, but are not 5 limited to, plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, and acrylic resins, such as polyacrylamide and latex beads. Techniques for coupling nucleic acid probes to such solid supports are well known in the art. The test samples suitable for nucleic acid probing methods of the present invention include, for example, cells or nucleic acid extracts of cells, or biological fluids. The 10 sample used in the above-described methods will vary based on the assay format, the detection method and the nature of the tissues, cells or extracts to be assayed. Methods for preparing nucleic acid extracts of cells are well known in the art and can be readily adapted in order to obtain a sample which is compatible with the method utilized. IV. A Method of Detecting The Presence of WI1, WI2, WI3, WI4, WIC, NYI, NY2, 15 NY3, SWED, BOV, EQ, SLOV1, and SLOV2 in a Sample In another embodiment, the present invention relates to a method of detecting the presence of WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 nucleic acid in a sample comprising a) contacting the sample with the above described nucleic acid probe, under specific hybridization conditions such that 20 hybridization occurs, and b) detecting the presence of the probe bound to the nucleic acid molecule. Alternatively, in another preferred embodiment, the method of detecting the presence of WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 nucleic acid in a sample may comprise a) amplifying the nucleic acid in the sample with the nucleic acid probe wherein the amplification uses PCR techniques and b) 25 detecting the presence of the amplified nucleic acid molecules. One skilled in the art would select the nucleic acid probe according to techniques known in the art as described above. Samples to be tested include but should not be limited to RNA samples from human tissue. 23 WO 00/06744 PCT/US98/22512 V. A Kit for Detecting the Presence of WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 in a Sample In another embodiment, the present invention relates to a kit for detecting the presence of WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or 5 SLOV2 nucleic acid in a sample comprising at least one container means having disposed therein the above-described nucleic acid probe. In a preferred embodiment, the kit further comprises other containers comprising one or more of the following: wash reagents and reagents capable of detecting the presence of bound nucleic acid probe. Examples of detection reagents include, but are not limited to radiolabelled probes, enzymatic labeled 10 probes (horse radish peroxidase, alkaline phosphatase), and affinity labeled probes (biotin, avidin, or steptavidin). In detail, a compartmentalized kit includes any kit in which reagents are contained in separate containers. Such containers include small glass containers, plastic containers or strips of plastic or paper. Such containers allow the efficient transfer of reagents from 15 one compartment to another compartment such that the samples and reagents are not cross-contaminated and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another. Such containers will include a container which will accept the test sample, a container which contains the probe or primers used in the assay, containers which contain wash reagents (such as phosphate 20 buffered saline, Tris-buffers, and the like), and containers which contain the reagents used to detect the hybridized probe, bound antibody, amplified product, or the like. One skilled in the art will readily recognize that the nucleic acid probes described in the present invention can readily be incorporated into one of the established kit formats which are well known in the art. 25 VI. DNA Constructs Comprising an WI1, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 Nucleic Acid Molecule and Cells Containing These Constructs In another embodiment, the present invention relates to a recombinant DNA molecule comprising, 5' to 3', a promoter effective to initiate transcription in a host cell 30 and the above-described nucleic acid molecules. In another embodiment, the present invention relates to a recombinant DNA molecule comprising a vector and an above described nucleic acid molecule. 24 WO 00/06744 PCT/US98/22512 In another embodiment, the present invention relates to a nucleic acid molecule comprising a transcriptional control region functional in a cell, a sequence complimentary to an RNA sequence encoding an amino acid sequence corresponding to the above described polypeptide, and a transcriptional termination region functional in the cell. 5 Preferably, the above-described molecules are isolated and/or purified DNA molecules. In another embodiment, the present invention relates to a cell or non-human organism that contains an above-described nucleic acid molecule. In another embodiment, the peptide is purified from cells which have been altered 10 to express the peptide. As used herein, a cell is said to be "altered to express a desired peptide" when the cell, through genetic manipulation, is made to produce a protein which it normally does not produce or which the cell normally produces at low levels. One skilled in the art can readily adapt procedures for introducing and expressing either genomic, cDNA, or 15 synthetic sequences into either eukaryotic or prokaryotic cells. A nucleic acid molecule, such as DNA, is said to be "capable of expressing" a polypeptide if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are "operably linked" to nucleotide sequences which encode the polypeptide. An operable linkage is a linkage in which the 20 regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene sequence expression. The precise nature of the regulatory regions needed for gene sequence expression can vary from organism to organism, but shall in general include a promoter region which, in prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences 25 which, when transcribed into RNA, will signal synthesis initiation. Such regions will normally include those 5'-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like. If desired, the non-coding region 3' to the WI1, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 coding sequence can be obtained by the 30 above-described methods. This region can be retained for its transcriptional termination regulatory sequences, such as termination and polyadenylation. Thus, by retaining the 3' region naturally contiguous to the DNA sequence encoding an WI1, WI2, WI3, WI4, 25 WO 00/06744 PCT/US98/22512 WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 gene, the transcriptional termination signals can be provided. Where the transcriptional termination signals are not satisfactorily functional in the expression host cell, then a 3' region functional in the host cell can be substituted. Two DNA sequences (such as a promoter region sequence and an 5 WI, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 coding sequence) are said to be operably linked if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region sequence to direct the transcription of a WI, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 10 coding sequence, or (3) interfere with the ability of the WIl, WI2, WI3, WI4, WIC, NYI, NY2, SWED, BOV, EQ, SLOVI, or SLOV2 coding sequence to be transcribed by the promoter region sequence. Thus, a promoter region would be operably linked to a DNA sequence if the promoter were capable of effecting transcription of that DNA sequence. The present invention encompasses the expression of the WIH, WI2, WI3, WI4, 15 WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 coding sequence (or a functional derivative thereof) in either prokaryotic or eukaryotic cells. Prokaryotic hosts are, generally, the most efficient and convenient for the production of recombinant proteins and, therefore, are preferred for the expression of the WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 coding sequence. 20 Prokaryotes most frequently are represented by various strains of E. coli. However, other microbial strains can also be used, including other bacterial strains. In prokaryotic systems, plasmid vectors that contain replication sites and control sequences derived from a species compatible with the host can be used. Examples of suitable plasmid vectors include pBR322, pUCI8, pUC19, pUC118, pUC119 and the like; suitable 25 phage or bacteriophage vectors include gtl0, Xgtl 1 and the like; and suitable virus vectors include pMAM-neo, pKRC and the like. Preferably, the selected vector of the present invention has the capacity to replicate in the selected host cell. Recognized prokaryotic hosts include bacteria such as E. coli, Bacillus, Streptonvces, Pseudomonas, Salmonella, Serratia, and the like. However, under such 30 conditions, the peptide will not be glycosylated. The prokaryotic host must be compatible with the replicon and control sequences in the expression plasmid. 26 WO 00/06744 PCT/US98/22512 To express WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 in a prokaryotic cell, it is necessary to operably link the, WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 coding sequence to a functional prokaryotic promoter. Such promoters can be either constitutive 5 or, more preferably, regulatable (i.e., inducible or derepressible). Examples of constitutive promoters include the int promoter of bacteriophage X, the bla promoter of the 3 lactamase gene sequence of pBR322, and the CAT promoter of the chloramphenicol acetyl transferase gene sequence of pBR325, and the like. Examples of inducible prokaryotic promoters include the major right and left promoters of bacteriophage X (PL and PR), the 10 trp, recA, lacZ, lacI, and gal promoters of E. coli, the a -amylase (Ulmanen et al., J. Bacteriol. 162:176-182 (1985)) and the C-28-specific promoters of B. subtilis (Gilman et al., Gene Sequence 32:11-20 (1984)), the promoters of the bacteriophages of Bacillus (Gryczan, In: The Molecular Biology of the Bacilli, Academic Press, Inc., NY (1982)), and Streptonmyices promoters (Ward et al., Mol. Gen. Genet. 203:468-478 (1986)). 15 Prokaryotic promoters are reviewed by Glick (J. Ind. Microbiol. 1:277-282 (1987)); Cenatiempo (Biochimie 68:505-516 (1986)); and Gottesman (Ann. Rev. Genet. 18:415-442 (1984)). Proper expression in a prokaryotic cell also requires the presence of a ribosome binding site upstream of the gene sequence-encoding sequence. Such ribosome binding 20 sites are disclosed, for example, by Gold et al. (Ann. Rev. Microbiol. 35:365-404 (1981)). The selection of control sequences, expression vectors, transformation methods, and the like, are dependent on the type of host cell used to express the gene. As used herein, "cell", "cell line", and "cell culture" can be used interchangeably and all such designations include progeny. Thus, the words "transformants" or "transformed cells" include the 25 primary subject cell and cultures derived therefrom, without regard to the number of transfers. It is also understood that all progeny can not be precisely identical in DNA content, due to deliberate or inadvertent mutations. However, as defined, mutant progeny have the same functionality as that of the originally transformed cell. Host cells which can be used in the expression systems of the present invention are not strictly limited, 30 provided that they are suitable for use in the expression of the WI1, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 peptide of interest. Suitable hosts include eukaryotic cells. 27 WO 00/06744 PCT/US98/22512 Preferred eukaryotic hosts include, for example, yeast, fungi, insect cells, mammalian cells either in vivo, or in tissue culture. Preferred mammalian cells include HeLa cells, cells of fibroblast origin such as VERO or CHO-Kl, or cells of lymphoid origin and their derivatives. 5 In addition, plant cells are also available as hosts, and control sequences compatible with plant cells are available, such as the cauliflower mosaic virus 35S and 19S, and nopaline synthase promoter and polyadenylation signal sequences. Another preferred host is an insect cell, for example Drosophila larvae. Using insect cells as hosts, the Drosophila alcohol dehydrogenase promoter can be used, (Rubin, 10 Science 240:1453-1459 (1988)). Alternatively, baculovirus vectors can be engineered to express large amounts of WI, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV 1, or SLOV2 in insect cells (Jasny, Science 238:1653 (1987); Miller et al., In: Genetic Engineering (1986), Setlow, J.K., et al., eds., Plenum, Vol. 8, pp. 277-297). Different host cells have characteristic and specific mechanisms for the 15 translational and post-translational processing and modification (e.g., glycosylation, cleavage) of proteins. Appropriate cell lines or host systems can be chosen to ensure the desired modification and processing of the foreign protein expressed. Any of a series of yeast gene sequence expression systems can be utilized which incorporate promoter and termination elements from the actively expressed gene sequences 20 coding for glycolytic enzymes. These enzymes are produced in large quantities when yeast are grown in mediums rich in glucose. Known glycolytic gene sequences can also provide very efficient transcriptional control signals. Yeast provides substantial advantages in that it can also carry out post-translational peptide modifications. A number of recombinant DNA strategies exist which utilize 25 strong promoter sequences and high copy number of plasmids which can be utilized for production of the desired proteins in yeast. Yeast recognizes leader sequences on cloned mammalian gene sequence products and secretes peptides bearing leader sequences (i.e., pre-peptides). For a mammalian host, several possible vector systems are available for the expression of WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, 30 or SLOV2. A wide variety of transcriptional and translational regulatory sequences can be employed, depending upon the nature of the host. The transcriptional and translational 28 WO 00/06744 PCT/US98/22512 regulatory signals can be derived from viral sources, such as adenovirus, bovine papilloma virus, simian virus, or the like, where the regulatory signals are associated with a particular gene sequence which has a high level of expression. Alternatively, promoters from mammalian expression products, such as actin, collagen, myosin, and the like, can be 5 employed. Transcriptional initiation regulatory signals can be selected which allow for repression or activation, so that expression of the gene sequences can be modulated. Of interest are regulatory signals which are temperature-sensitive so that by varying the temperature, expression can be repressed or initiated, or are subject to chemical (such as metabolite) regulation. 10 As discussed above, expression of WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI1, or SLOV2 in eukaryotic hosts requires the use of eukaryotic regulatory regions. Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis. Preferred eukaryotic promoters include, for example, the promoter of the mouse metallothionein I gene sequence (Hamer et al., 15 J. Mol. Appl. Gen. 1:273-288 (1982)); the TK promoter of Herpes virus (McKnight, Cell 31:355-365 (1982)); the SV40 early promoter (Benoist et al., Nature (London) 290:304 310 (1981)); the yeast gal 4 gene sequence promoter (Johnston et al., Proc. Natl. Acad. Sci. (USA) 79:6971-6975 (1982); Silver et al., Proc. Natl. Acad. Sci. (USA) 81:5951-5955 (1984)) and the CMV immediate-early gene promoter (Thomsen et al., Proc. Natl. Acad. 20 Sci. (USA) 81:659-663 (1984). As is widely known, translation of eukaryotic mRNA is initiated at the codon which encodes the first methionine. For this reason, it is preferable to ensure that the linkage between a eukaryotic promoter and a WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 coding sequence does not contain any 25 intervening codons which are capable of encoding a methionine (i.e., AUG). The presence of such codons results either in a formation of a fusion protein (if the AUG codon is in the same reading frame as the WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV 1, or SLOV2 coding sequence) or a frame-shift mutation (if the AUG codon is not in the same reading frame as the WII, WI2, WI3, WI4, WIC, NYI, NY2, 30 NY3, SWED, BOV, EQ, SLOVI, and SLOV2 coding sequence). A WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 nucleic acid molecule and an operably linked promoter can be introduced into a 29 WO 00/06744 PCT/US98/22512 recipient prokaryotic or eukaryotic cell either as a non-replicating DNA (or RNA) molecule, which can either be a linear molecule or, more preferably, a closed covalent circular molecule. Since such molecules are incapable of autonomous replication, the expression of the gene can occur through the transient expression of the introduced 5 sequence. Alternatively, permanent expression can occur through the integration of the introduced DNA sequence into the host chromosome. In one embodiment, a vector is employed which is capable of integrating the desired gene sequences into the host cell chromosome. Cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or 10 more markers which allow for selection of host cells which contain the expression vector. The marker can provide for prototrophy to an auxotrophic host, biocide resistance, e.g., antibiotics, or heavy metals, such as copper, or the like. The selectable marker gene sequence can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection. Additional elements can also be needed 15 for optimal synthesis of single chain binding protein mRNA. These elements can include splice signals, as well as transcription promoters, enhancer signal sequences, and termination signals. cDNA expression vectors incorporating such elements include those described by Okayama, Molec. Cell. Biol. 3:280 (1983). In a preferred embodiment, the introduced nucleic acid molecule will be 20 incorporated into a plasmid or viral vector capable of autonomous replication in the recipient host. Any of a wide variety of vectors can be employed for this purpose. Factors of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector can be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector 25 which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species. Preferred prokaryotic vectors include plasmids such as those capable of replication in E. coli (such as, for example, pBR322, ColEI, pSC101, pACYC 184, ntVX. Such plasmids are, for example, disclosed by Sambrook (cf. Molecular Cloning: A Laboratory Manual, second edition, edited by 30 Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, 1989). Bacillus plasmids include pC194, pC221, pT127, and the like. Such plasmids are disclosed by Gryczan (In: The Molecular Biology of the Bacilli, Academic Press, NY (1982), pp. 307-329). Suitable 30 WO 00/06744 PCT/US98/22512 Streptomvces plasmids include pIJ101 (Kendall et al., J. Bacteriol. 169:4177-4183 (1987)), and streptomyces bacteriophages such as (C31 (Chater et al., In: Sixth International Symposium on Actinonmycetales Biology, Akademiai Kaido, Budapest, Hungary (1986), pp. 45-54). Pseudomonas plasmids are reviewed by John et al. (Rev. hnfect. Dis. 8:693-704 5 (1986)), and Izaki (Jpn. J. Bacteriol. 33:729-742 (1978)). Preferred eukaryotic plasmids include, for example, BPV, vaccinia, SV40, 2-micron circle, and the like, or their derivatives. Such plasmids are well known in the art (Botstein et al., Miami Wntr. Symp. 19:265-274 (1982); Broach, In: The Molecular Biology of the Yeast Saccharomnyces: Life Cycle and hInheritance, Cold Spring Harbor Laboratory, Cold 10 Spring Harbor, NY, p. 445-470 (1981); Broach, Cell 28:203-204 (1982); Bollon et al., J. Clin. Hematol. Oncol. 10:39-48 (1980); Maniatis, In: Cell Biology: A Comprehensive Treatise, Vol. 3, Gene Sequence Expression, Academic Press, NY, pp. 563-608 (1980)). Once the vector or nucleic acid molecule containing the construct(s) has been prepared for expression, the DNA construct(s) can be introduced into an appropriate host 15 cell by any of a variety of suitable means, i.e., transformation, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, calcium phosphate-precipitation, direct microinjection, and the like. After the introduction of the vector, recipient cells are grown in a selective medium, which selects for the growth of vector-containing cells. Expression of the cloned gene molecule(s) results in the production of WII, WI2, WI3, 20 WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2. This can take place in the transformed cells as such, or following the induction of these cells to differentiate (for example, by administration of bromodeoxyuracil to neuroblastoma cells or the like). VII. An Antibody Having Binding Affinity to a WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 Polypeptide and a Hybridonma 25 Containing the Antibody In another embodiment, the present invention relates to an antibody having binding affinity specifically to a WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVl, or SLOV2 polypeptide as described above or specifically to a WII, WI2, WI3, WI4, WIC, NY 1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 polypeptide binding 30 fragment thereof. An antibody binds specifically to a WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 polypeptide or to consensus sequences 31 WO 00/06744 PCT/US98/22512 described herein corresponding to the amino- and/or carboxy-terminus regions shared by WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 or binding fragment thereof if it does not bind to non-WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 polypeptides. Those which bind 5 selectively to WI, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 or to consensus sequences described herein corresponding to the amino- and/or carboxy-terminus regions shared by WI1, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2 would be chosen for use in methods which could include, but should not be limited to, the analysis of altered WII, WI2, WI3, WI4, WIC, o10 NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 expression in tissue containing WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2. The WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 proteins, or proteins including the consensus sequences corresponding to the amino- and/or carboxy-terminus regions shared by the proteins of the present invention 15 can be used in a variety of procedures and methods, such as for the generation of antibodies, for use in identifying pharmaceutical compositions, and for studying DNA/protein interaction. The WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 proteins, or proteins including the consensus sequences corresponding to the 20 amino and/or carboxy terminus regions shared by the above listed proteins of the present invention can be used to produce antibodies or hybridomas. One skilled in the art will recognize that if an antibody is desired, such a peptide would be generated as described herein and used as an immunogen. The antibodies of the present invention include monoclonal and polyclonal 25 antibodies, as well as fragments of these antibodies. The invention further includes single chain antibodies. Antibody fragments which contain the idiotype of the molecule can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab'), fragment; the Fab' fragments, Fab fragments, and Fv fragments. Of special interest to the present invention are antibodies to WI, WI2, WI3, WI4, 30 WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2 or to proteins, or proteins including the consensus sequences corresponding to the amino- and/or carboxy-terminus regions shared by WII, WI2, WI3, WI4, WIC, NY .1, NY2, NY3, SWED, BOV, EQ, 32 WO 00/06744 PCT/US98/22512 SLOV1, and SLOV2 which are produced in humans, or are "humanized" (i.e.; non immunogenic in a human) by recombinant or other technology. Humanized antibodies can be produced, for example by replacing an immunogenic portion of an antibody with a corresponding, but non-immunogenic portion (i.e., chimeric antibodies) (Robinson et al., 5 PCT Application No. PCT/US86/02269; Akira et al., European Patent No. 184,187; Taniguchi, European Patent No. 171,496; Morrison et al., European Patent No. 173,494; Neuberger et al., PCT Application WO 86/01533; Cabilly et al., European Patent No. 125,023; Better, et al., Science 240:1041-1043 (1988); Liu et al., Proc. Natl. Acad. Sci. USA 84:3439-3443 (1987); Liu et al., J. Inmnunol. 139:3521-3526 (1987): Sun, et al., 10 Proc. Natl. Acad. Sci. USA 84:214-218 (1987); Nishimura et al., Cane. Res. 47:999-1005 (1987); Wood et al., Nature 314:446-449 (1985)); Shaw et al., I. Natl. Cancer Inst. 80:1553-1559 (1988). General reviews of "humanized" chimeric antibodies are provided by Morrison (Science, 229:1202-1207 (1985)) and by Oi et al., BioTechniques 4:214 (1986)). Suitable "humanized" antibodies can be alternatively produced by CDR or CEA 15 substitution (Jones et al., Nature 321:552-525 (1986); Verhoeyan et al., Science 239:1534 (1988); Beidler et al., J. Inmunnol. 141:4053-4060 (1988)). In another embodiment, the present invention relates to a hybridoma which produces the above-described monoclonal antibody. A hybridoma is an immortalized cell line which is capable of secreting a specific monoclonal antibody. 20 In general, techniques for preparing monoclonal antibodies and hybridomas are well known in the art (Campbell, "Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology," Elsevier Science Publishers, Amsterdam, The Netherlands (1984); St. Groth et al., J. inimunol. Methods 35:1-21 (1980)). 25 Any animal (mouse, rabbit, and the like) which is known to produce antibodies can be immunized with the selected polypeptide. Methods for immunization are well known in the art. Such methods include subcutaneous or interperitoneal injection of the polypeptide. One skilled in the art will recognize that the amount of polypeptide used for immunization will vary based on the animal which is immunized, the antigenicity of the 30 polypeptide and the site of injection. The polypeptide can be modified or administered in an adjuvant in order to increase the peptide antigenicity. Methods of increasing the antigenicity of a polypeptide 33 WO 00/06744 PCT/US98/22512 are well known in the art. Such procedures include coupling the antigen with a heterologous protein (such as globulin or P3-galactosidase) or through the inclusion of an adjuvant during immunization. For monoclonal antibodies, spleen cells from the immunized animals are removed, 5 fused with myeloma cells, and allowed to become monoclonal antibody producing hybridoma cells. Any one of a number of methods well known in the art can be used to identify the hybridoma cell which produces an antibody with the desired characteristics. These include screening the hybridomas with an ELISA assay, Western blot analysis, or 10 radioimmunoassay (Lutz et al., Exp. Cell Res. 175:109-124 (1988)). Hybridomas secreting the desired antibodies are cloned and the class and subclass is determined using procedures known in the art (Campbell, Monoclonal Antibody Technology: Laboratory Techniques in Biochemistr , and Molecular Biology, supra (1984)). 15 For polyclonal antibodies, antibody containing antisera is isolated from the immunized animal and is screened for the presence of antibodies with the desired specificity using one of the above-described procedures. In another embodiment of the present invention, the above-described antibodies are detectably labeled. Antibodies can be detectably labeled through the use of radioisotopes, 20 affinity labels (such as biotin, avidin, and the like), enzymatic labels (such as horseradish peroxidase, alkaline phosphatase, and the like) fluorescent labels (such as FITC or rhodamine, and the like), paramagnetic atoms, and the like. Procedures for accomplishing such labeling are well-known in the art, for example, see (Sternberger et al., J. Histochem. Cytochemn. 18:315 (1970); Bayer et al., Meth. Enzym. 62:308 (1979); Engval et al., 25 Inmnunol. 109:129 (1972); Goding, J. Inmnunol. Meth. 13:215 (1976)). The labeled antibodies of the present invention can be used for in vitro, in vivo, and in situ assays to identify cells or tissues which express a specific peptide. In another embodiment of the present invention the above-described antibodies are immobilized on a solid support. Examples of such solid supports include plastics such as 30 polycarbonate, complex carbohydrates such as agarose and sepharose, acrylic resins and such as polyacrylamide and latex beads. Techniques for coupling antibodies to such solid supports are well known in the art (Weir et al., "Handbook of Experimental Immunology" 34 WO 00/06744 PCT/US98/22512 4th Ed., Blackwell Scientific Publications, Oxford, England, Chapter 10 (1986); Jacoby et al., Meth. Enzvm. 34 Academic Press, N.Y. (1974)). The immobilized antibodies of the present invention can be used for in vitro, in vivo, and in situ assays as well as in immunochromatography. 5 Furthermore, one skilled in the art can readily adapt currently available procedures, as well as the techniques, methods and kits disclosed above with regard to antibodies, to generate peptides capable of binding to a specific peptide sequence in order to generate rationally designed antipeptide peptides, for example see Hurby et al., "Application of Synthetic Peptides: Antisense Peptides", In Synthetic Peptides, A User's Guide, W.H. 10 Freeman, NY, pp. 289-307 (1992), and Kaspczak et al., Biochemistry , 28:9230-8 (1989). Anti-peptide peptides can be generated in one of two fashions. First, the anti peptide peptides can be generated by replacing the basic amino acid residues found in the WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2 peptide sequence or consensus sequences described herein with acidic residues, while 15 maintaining hydrophobic and uncharged polar groups. For example, lysine, arginine, and/or histidine residues are replaced with aspartic acid or glutamic acid and glutamic acid residues are replaced by lysine, arginine or histidine. VIII. A Method of Detecting a WIJ, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV, or SLOV2 Polypeptide or Antibody in a Sample 20 In another embodiment, the present invention relates to a method of detecting a WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 polypeptide including the consensus sequence corresponding to the amino- and/or carboxy terminus regions shared by the polypeptide in a sample, comprising: a) contacting the sample with an above-described antibody (or protein), under conditions such that 25 immunocomplexes form, and b) detecting the presence of the antibody bound to the polypeptide. In detail, the methods comprise incubating a test sample with one or more of the antibodies of the present invention and assaying whether the antibody binds to the test sample. Altered levels of peptides WII, WI2, WI3, WI4, WIC, NY 1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 or in a sample as compared to normal levels can indicate a 30 specific disease. 35 WO 00/06744 PCTIUS98/22512 In a further embodiment, the present invention relates to a method of detecting a WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 antibody in a sample, comprising: a) contacting the sample with an above-described WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 5 polypeptide, including the consensus sequence corresponding to the amino- and/or carboxy-terminus regions shared by WIH, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 polypeptide under conditions such that immunocomplexes form, and b) detecting the presence of the protein bound to the antibody or antibody bound to the protein. In detail, the methods comprise incubating a 10 test sample with one or more of the proteins of the present invention and assaying whether the antibody binds to the test sample. The presence of antibodies to WI1, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 may indicate exposure to GE, the potential need for therapy of the affected individual, or GE contamination of a biological sample. 15 Conditions for incubating an antibody with a test sample vary. Incubation conditions depend on the format employed in the assay, the detection methods employed, and the type and nature of the antibody used in the assay. One skilled in the art will recognize that any one of the commonly available immunological assay formats (such as radioimmunoassays, enzyme-linked immunosorbent assays, diffusion'based Ouchterlony, or 20 rocket immunofluorescent assays) can readily be adapted to employ the antibodies of the present invention. Examples of such assays can be found in Chard, An Introduction to Radioimmunoassay and Related Techniques, Elsevier Science Publishers, Amsterdam, The Netherlands (1986); Bullock et al., Techniques in hnmnunocytochemistry, Academic Press, Orlando, FL Vol. 1 (1982), Vol. 2 (1983), Vol. 3 (1985); Tijssen, Practice and Theory of 25 Enzyme Inmnunoassays: Laboratory Techniques in Biochemistry and Molecular Biology, Elsevier Science Publishers, Amsterdam, The Netherlands (1985). The immunological assay test samples of the present invention include cells, protein or membrane extracts of cells, or biological fluids such as blood, serum, plasma, or urine. The test sample used in the above-described method will vary based on the assay 30 format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing protein extracts or membrane extracts of cells are 36 WO 00/06744 PCT/US98/22512 well known in the art and can be readily be adapted in order to obtain a sample which is capable with the system utilized. IX. A Diagnostic Kit Comprising WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 Protein or Antibody 5 In another embodiment of the present invention, a kit is provided which contains all the necessary reagents to carry out the previously described methods of detection. The kit can comprise: i) a first container means containing an above-described antibody, and ii) second container means containing a conjugate comprising a binding partner of the antibody and a label. 10 The kit can comprise: i) a first container means containing an above-described protein, and preferably, ii) second container means containing a conjugate comprising a binding partner of the protein and a label. More specifically, a diagnostic kit comprises WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2 or a peptide having consensus sequences corresponding to the amino and/or carboxy terminus 15 regions shared by WIH, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2 protein as described above, to detect antibodies in the serum of potentially infected animals or humans. In another preferred embodiment, the kit further comprises one or more other containers comprising one or more of the following: wash reagents and reagents capable 20 of detecting the presence of bound antibodies. Examples of detection reagents include, but are not limited to, labeled secondary antibodies, or in the alternative, if the primary antibody is labeled, the chromophoric, enzymatic, or antibody binding reagents which are capable of reacting with the labeled antibody. The compartmentalized kit can be as described above for nucleic acid probe kits. 25 One skilled in the art will readily recognize that the antibodies described in the present invention can readily be incorporated into one of the established kit formats which are well known in the art. X. Diagnostic Screening It is to be understood that although the following discussion is specifically directed 30 to human patients, the teachings are also applicable to any animal which can be infected with GE. 37 WO 00/06744 PCT/US98/22512 The diagnostic and screening methods of the invention are especially useful for a patient suspected of being at risk for developing ehrlichiosis. According to the invention, a pre- and post-symptomatic screening of an individual in need of such screening is now possible using DNA encoding the WIl, WI2, WI3, WI4, 5 WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 protein or fragment thereof, or a protein having consensus sequences corresponding to the amino and/or carboxy terminus regions shared by WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 of the invention. The screening method of the invention allows a presymptomatic diagnosis of the presence of WII, WI2, WI3, WI4, 10 WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 protein or DNA in individuals, and thus an opinion concerning the likelihood that such individual would develop or has developed ehrlichiosis. Early diagnosis is desired to maximize appropriate timely intervention. In one preferred embodiment of the method of screening, a tissue sample would be 15 taken from an individual, and screened for (1) the presence of the WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 DNA coding sequence; (2) the presence of WII, WI2, WI3, WI4, WIC, NY 1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 mRNA; (3) the presence of WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 protein; and/or (4) the presence of antibody to 20 WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 protein. A preferred method of detecting the presence of WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 protein and/or the presence of antibody to WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 25 protein comprises: a) contacting the sample with a polypeptide or antibody to a polypeptide having the amino acid sequence of WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 or a fragment thereof under conditions such that immunocomplexes form; and b) detecting the presence of the immunocomplexed antibody and polypeptide. 30 Individuals not infected with GE do not have WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 DNA, mRNA, or protein. 38 WO 00/06744 PCT/US98/22512 The screening and diagnostic methods of the invention do not require that the entire WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 coding sequence be used for the probe. Rather, it is only necessary to use a fragment or length of nucleic acid that is sufficient to detect the presence of the WII, 5 WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 nucleic acid in a DNA preparation from an individual. Analysis of nucleic acid specific to GE can be by PCR techniques or hybridization techniques (cf. Molecular Cloning: A Laboratoy Manual, 2nd edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, 1989; Eremeeva et al., J. Clin. 10 Microbiol. 32:803-810 (1994) which describes differentiation among spotted fever group Rickettsiae species by analysis of restriction fragment length polymorphism of PCR-amplified DNA). Nucleic acid probes used to analyze GE genomic DNA via PCR analysis have been described in Chen et al., J. Clin. Microbiol. 32:589-595 (1994). XL. Vaccines 15 In another embodiment, the present invention relates to a vaccine comprising a WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 protein or a fragment thereof, or a protein having consensus sequences corresponding to any shared amino and/or carboxy terminus regions (preferably, an immunologically active fragment) together with a pharmaceutically acceptable diluent, carrier, or excipient, wherein the protein is present 20 in an amount effective to elicit a beneficial immune response in an animal to GE. WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 protein, or a protein having consensus sequences corresponding to any shared amino- and/or carboxy terminus region may be obtained as described above and using methods well known in the art. An immunologically active fragment comprises an epitope-bearing portion of the protein. 25 In a further preferred embodiment, the present invention relates to a composition comprising a WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 protein or fragment thereof, or a protein having consensus sequences corresponding to any shared amino- and/or carboxy-terminus regions and a carrier. In another embodiment, the present invention relates to a vaccine comprising a WII, 30 WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 nucleic acid (preferably, DNA) or a fragment thereof (preferably, a fragment encoding an immunologically 39 WO 00/06744 PCT/US98/22512 active protein or peptide), or nucleic acid coding for a polypeptide, or a protein having consensus sequences corresponding to any shared amino and/or carboxy terminus regions together with a pharmaceutically acceptable diluent, carrier, or excipient, wherein the nucleic acid is present in an amount effective to elicit a beneficial immune response in an animal to 5 GE. WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 nucleic acid may be obtained as described above and using methods well known in the art. An immunologically active fragment comprises an epitope-bearing portion of the nucleic acid. In a further preferred embodiment, the present invention relates to a composition comprising a WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or 10 SLOV2 nucleic acid (preferably, DNA) or fragment thereof (preferably, encoding an immunologically reactive protein or fragment - antigenic epitope) and a carrier. In a further preferred embodiment, the present invention relates to a method of producing an immune response which recognizes GE in a host comprising administering to the host the above-described composition. 15 In a preferred embodiment, the animal to be protected is selected from humans, horses, deer, cattle, pigs, sheep, dogs, and chickens. In a more preferred embodiment, the animal is a human or a dog. In a further embodiment, the present invention relates to a method of preventing ehrlichiosis in an animal comprising administering to the animal the above-described vaccine, 20 wherein the vaccine is administered in an amount effective to prevent or inhibit Ehrlichiosis. The vaccine of the invention is used in an amount effective depending on the route of administration. Although intranasal, subcutaneous or intramuscular routes of administration are preferred, the vaccine of the present invention can also be administered by an oral, intraperitoneal or intravenous route. One skilled in the art will appreciate that the amounts to 25 be administered for any particular treatment protocol can be readily determined without undue experimentation. Suitable amounts are within the range of 2 pg of the WI, WI2, WI3, WI4, WIC, NY 1, NY2, NY3, SWED, BOV, EQ, SLOV 1, and SLOV2 protein, or a protein having consensus sequences corresponding to any amino and/or carboxy terminus regions per kg body weight to 100 pg per kg body weight (preferably, 2 pg to 50 pg, 2 pg to 25 Vg, 5 pg to 50 pg, 30 or 5 pg to 10 pg). Examples of vaccine formulations including antigen amounts, route of administration and addition of adjuvants can be found in Kensil, Therapeutic Drug Carrier Systems 13:1-55 40 WO 00/06744 PCT/US98/22512 (1996), Livingston et al., Vaccine 12:1275 (1994), and Powell et al., AIDS RES, Human Retroviruses 10:5105 (1994). The vaccine of the present invention may be employed in such forms as capsules, liquid solutions, suspensions or elixirs for oral administration, or sterile liquid forms such as 5 solutions or suspensions. Any inert carrier is preferably used, such as saline, phosphate buffered saline, or any such carrier in which the vaccine has suitable solubility properties. The vaccines may be in the form of single dose preparations or in multi-dose flasks which can be used for mass vaccination programs. Reference is made to Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, Osol (ed.) (1980); and New Trends and 10 Developments in Vaccines, Voller et al. (eds.), University Park Press, Baltimore, MD (1978), for methods of preparing and using vaccines. The vaccines of the present invention may further comprise adjuvants which enhance production of antibodies and immune cells. Such adjuvants include, but are not limited to, various oil formulations such as Freund's complete adjuvant (CFA), the dipeptide known as 15 MDP, saponins (e.g., QS-21, U.S. Patent No. 5,047,540), aluminum hydroxide, or lymphatic cytokines. Freund's adjuvant is an emulsion of mineral oil and water which is mixed with the immunogenic substance. Although Freund's adjuvant is powerful, it is usually not administered to humans. Instead, the adjuvant alum (aluminum hydroxide) may be used for administration to a human. Vaccine may be absorbed onto the aluminum hydroxide from 20 which it is slowly released after injection. The vaccine may also be encapsulated within liposomes according to Fullerton, U.S. Patent No. 4,235,877. The present invention is described in further detail in the following non-limiting examples. Examples 25 The following Protocols A-G and experimental details are referenced in the non limiting examples, Examples 1-6. Protocol A: Cultivation of GE in HL60 cells The GE-infected HL60 cell line, USG3, is obtained by co-culturing HL60 cells (ATCC CCL 240) with blood cells from dogs challenged with field collected Ixodes scapullaris ticks. 30 After degenerative cell morphology becomes noticeable, the infected cells are passed over 41 WO 00/06744 PCT/US98/22512 fresh uninfected HL60 cells to maintain the culture. USG3 is grown in RPMI 1640 containing 10-20% heat-inactivated fetal bovine serum, 2 mM 1-glutamine, 1 mM sodium pyruvate, 0.1 mM MEM non-essential amino acids and is split into fresh HL60 cells two to three times per week. This procedure is also outlined in Coughlin et al., PCT Application No. 5 PCT/US96/10117 and has also been demonstrated by Goodman et al., N. Eng. J. Med. 334:209-215 (1996). Protocol B: GE Purification USG3 cultures at approximately 80% cell lysis (monitored microscopically) are centrifuged at 840 x g for 15 min at 4 0 C to remove host HL60 cell debris. The supernatant is 10 filtered through a Poretics (Livermore, CA) 5 pm polycarbonate membrane, 47 mm in diameter, followed by a Poretics 3 pm filter under negative pressure. The USG3 filtrate is centrifuged at 9460 x g in a Sorvall centrifuge for 30 min at 4 0 C. Following centrifugation, the GE pellet is resuspended in 5 ml 25 mM Tris, pH 8.0, 10 mM MgC1, and 0.9% NaC1. DNase I (Life Technologies, Gaithersburg, MD) is added to a final concentration of 9 pg per 15 ml and the solution is incubated for 15 min at 37 0 C. Following incubation, the DNase is inactivated by the addition of 0.5 ml of 0.5 M EDTA and the GE is pelleted at 14,000 x g in a Sorvall centrifuge for 30 min at 4 0 C. Protocol C: Construction of the GE Genomnic Library Genomic DNA is isolated from purified GE using the QIAamp Genomic DNA kit 20 (Qiagen, Chatsworth, CA) for library preparation (Stratagene, La Jolla, CA). The DNA is mechanically sheared to a 4-10kb size range and ligated to EcoRI linkers. Linkered fragments are ligated into the EcoRI site of Lambda Zap II and the library is amplified in E. coli strain XLI-Blue MFR' to a titer of 101 Pfu/ml. Protocol D: Preparation of the Screening Sera 25 Dog sera: Adult Ixodes scaptlaris ticks collected from regions of the eastern United States having a high incidence of human Lyme disease are applied to dogs as described (Coughlin et al., J. Ifect. Dis. 171:1049-1052 (1995)). Sera from the dogs is tested for immunoreactivity to E. equi by an immunofluorescence assay. Positive sera from infected dogs is pooled and used for immunoscreening of the GE genomic library. 42 WO 00/06744 PCT/US98/22512 Mouse sera: Proteins contained in SDS-disrupted whole GE are separated by SDS PAGE and forty-six individual bands are excised from each of two gels, 10% and 15% acrylamide. Each gel fragment is mashed, added to buffer and Ribi adjuvant and used to immunize two mice. Sera with similar immuno reactivity patterns against GE antigen as 5 determined by Western blot are pooled into separate groups. Goat sera: Mixtures of 100 pg of purified heat-inactivated USG3 antigen are used to immunize goats. Goats receive three subcutaneous doses of antigen at bi-weekly intervals. Serum is collected two weeks following the third immunization and is used for immunoscreening of the GE genomic DNA library. 10 Protocol E: Screening of the GE Genomnic DNA library Bacteriophage are diluted and plated with XLl-Blue MRF' cells on NZY agar plates. Plates are prepared giving approximately 50,000 plaques per plate. Phages are induced to express cloned protein with 10 mM IPTG (Sigma, St. Louis, Missouri) and transferred to nitrocellulose filters. For immunoscreening, filters are blocked in TBS (25mM Tris HC1, pH 15 7.5,0.5 M NaCI) containing 0.1% polyoxyethylene 20 cetyl ether (Brij 58) and incubated with pooled dog sera, pooled mouse sera, or pooled goat sera. The filters are washed and then reacted with anti-dog HRP conjugated antibody, anti-mouse HRP conjugated antibody, or anti goat HRP conjugated antibody. The filters are washed again and developed with 4 chloronapthol (Bio-Rad). 20 Positive plaques are isolated, replated and rescreened twice to achieve purity. Plasmid DNA containing the putative recombinant clones is obtained by plasmid rescue (Strategene, La Jolla, CA). Protocol F: DNA Analysis Restriction enzyme analysis: Standard techniques are followed according to the 25 protocols of Sambrook et al., Molecular Cloning (2nd ed.), Cold Spring Harbor Laboratory Press, New York (1989)). DNA sequencing and sequencing analysis: DNA sequencing of recombinant clones was performed using the primer walking method and a DNA sequencer such as for example the ABI 373A DNA sequencer (ACGT, Northbrook, IL; Lark Technologies, Houston, TX; and 30 Sequegen, Shrewsbury, MA). Sequences were analyzed by using the MacVector (Oxford 43 WO 00/06744 PCT/US98/22512 Molecular Group) sequence analysis program, version 6.0, or the GCG package. The BLAST algorithm, D version 1.4, was used to search for homologous nucleic acid and protein sequences available on the National Center for Biotechnology Information (NCBI) server. PCR amplification of target sequences: DNA oligonucleotide primer sets are designed 5 based on sequencing information from each individual clone. PCR primers were synthesized by standard oligonucleotide synthesis methods, or purchased for example from Life Technologies (Gaithersburg, MD). Templates for PCR are either purified plasmid DNA, purified GE or HL60 genomic DNA, genomic DNA isolated from infected blood or phage lysates. All reactions are performed using a Gene Amp 9600 thermal cycler (Perkin-Elmer, 10 CT), GenAmp reagents from Perkin-Elmer, and TaqStart antibody (Clontech, CA). The cycling program consists of 30 cycles, each of 30 s at 94'C, 30 s at 48°C to 55°C, and 1 min at 72°C, and an additional cycle of 10 min at 72°C. Alternatively, some PCR amplification was carried out using nested reactions as described by Massung et al., J. Clin. Micro. 36:1090 (1998). PCR products were analyzed on 4% Nusieve 3:1 agarose gels (FMC Bioproducts, 15 Rockland, ME). Protocol G: Protein Isolation and Analysis Overnight cultures of individual clones are diluted 1:25 into TP broth (per liter: 20 g bactotryptone, 2 g Na 2

HPO

4 , 1 g KH 2

PO

4 , 8 g NaC1, 15 g yeast extract) and grown at 37°C until an OD 6 00 of 0.5 to 1 is reached. A 1.5 ml aliquot of culture is harvested. IPTG is added 20 to a concentration of 5 mM and growth is continued for 3 hours at 37.C. The OD 60 0 is read and each culture is pelleted. Pellets are resuspended in 5X Laemmli buffer (12% glycerol, 0.2 M Tris-HC1, pH 6.8, 5% SDS, 5% P3-mercaptoethanol) at 200 pl per 1 OD unit. In the alternative, harvested GE protein preparations are pelletted and resuspended in 0.4% SDS, 12.5 mM Tris, pH 6.8 and heated at 90-100 0 C for 20 min. For cell lysis, 50 pl of a cocktail 25 consisting of RNase (33 pg/ml) and aprotinin (0.2 mg/ml) and 9 p1 of DNase (0.17 mg/ml) is added per 5 mg of GE. Twenty il of 25X Boehringer/Mannheim protease inhibitor cocktail (Cat. #1697498) is added per 0.5 ml cell suspension and 2 il of a PMSF solution (I M in DMSO) is added just prior to cell disruption. Cells are disrupted in 30 second intervals for a total of 3 min in a mini-beadbeater cell disrupter, Type BX-4(BioSpec), agitated at room 30 temperature for 30 min and centrifuged at 15,000 x g for 10 min. The pellet is suspended in 44 WO 00/06744 PCT/US98/22512 Laemmli sample buffer and adjusted to 1.4 mg SDS/mg protein. Samples are boiled and 10 pl of each were electrophoresed on SDS-PAGE gels. For Western blot analysis, gels are transferred to nitrocellulose filters, the filters are blocked in TBS/Brij 58 and the blots are probed with antisera. Blots are then washed and 5 incubated with HRP-conjugated secondary antibody. After a final washing step, blots are developed with 4-chloronapthol (Bio-Rad, Hercules, CA) or detected using enhanced chemiluminescence (Pierce, Rockford, IL). Example 1 10 Isolation of GE Clones WI1, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2 GE types found in the blood of three infected animals (one dog, one horse, and a cow) or ten humans (four patients from Wisconsin, three patients from New York, one patient from Sweden, and two patients from Slovenia), were characterized by PCR amplification of the 15 GEl60 gene. Based on the GE160 nucleotide sequence (designated S2) of USG3 isolated from the blood of an experimentally infected dog, nested primer sets were designed to encompass the entire coding region. Figure 1 shows the location of the primer sets (AQUI (SEQ ID NO:27) and AQ1R2 (SEQ ID NO:28); AQU2 (SEQ ID NO:29) and AQ1R1 (SEQ ID NO:30); AQ1F (SEQ ID NO:31) and AQ1R (SEQ ID NO:32); AQ2F (SEQ ID NO:33) and 20 AQ2R (SEQ ID NO:34); AQ3F (SEQ ID NO:35) and AQ3R (SEQ ID NO:36); AQ4F (SEQ ID NO:37) and AQ4R (SEQ ID NO:38); AQ4F1 (SEQ ID NO:39) and AQ4R1 (SEQ ID NO:40); AQ4F2 (SEQ ID NO:41) and AQD2 (SEQ ID NO:42); and AQ4F3 (SEQ ID NO:43) and AQD1 (SEQ ID NO:44)) and the corresponding PCR amplified fragments obtained. The primer sets shown in Table 2 were used to amplify regions of the listed GE clones WII, WI2, 25 WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2. Each oligonucleotide sequence is shown in the 5' to 3' orientation. Figure 2 shows the alignment of the DNA sequence of all thirteen amplified GEl60 genes compared to the S2 G160 gene (identified on the second line of the alignment as USG3). 45 WO 00/06744 PCT/US98/22512 Blood Sample Preparation One of ordinary skill will realize that the isolation of DNA for PCR amplification may be achieved using a variety of protocols known in the art such as for example that described in Massung et al., J. Clin. Microb. 36(4):1090-1095 (1998). 5 PCR Amplification Each 50 p l reaction contained 0.5 pM of each primer, IX PCR Supermix (Life Technologies, Gaithersburg, MD) and 2pl of blood mix corresponding to approximately 100 ng of DNA prepared from the individual blood samples. PCR amplification was performed as described in Protocol F. 10 Table 2 Forward Primer Reverse Primer AQUl: CAGATGTTGATTGGGAATGTGCG AQ1R2: AATAACTACTCTCCTTCC AQU2: CCCAGTGACAGGTGAAACGC AQlRl: TATACACCTGGAGTAGGAAC AQ1F: ATGTTACGCTGTAATAGCATGGAC AQIR: TGCCCCAGCTTCTACAACAC 15 AQ2F: TCTCCAGAACCAGCTATTAC AQ2R: GAGTATTAAGCAAGTCTCCG AQ3F: GTCTCGAAAGCATITGTCAAAC AQ3R: TITCTCCCTTrAGATGACGCC AQ4F: GAGCTGCAATTACTTCCGAG AQ4R: CTACCGCGACCTCCTT'TAC AQ4FI: GCTGCAATTACTTCCGAGGC AQ4Rl: GCGACCTCCTTITACAGACTTAG AQ4F2: TGCTCCGGATTCTACCAAAG AQD2: GCCTAAATACTCAGAAGCGCG 20 AQ4F3: AAGGAACTAACAAAAGCTCC AQD1: TATTGATCAAAGTACCTCAGCG (*) The approximate location is of each primer is shown in Figure 1 (designation are based on the nucleotide numbering of the S2 clone from USG3). The primer pairs were used in separate PCR reactions to amplify the GE160 nucleotide 25 sequence in the blood of three infected animals (one dog, one horse, and a cow) and ten humans (four patients from Wisconsin, three patients from New York, one patient from Sweden, and two patients from Slovenia). An aliquot from each PCR reaction was run on a 1% agarose gel and stained with Ethidium Bromide to ascertain the approximate size of the PCR amplified fragment. In most cases the size of the PCR product matched the expected 46 WO 00/06744 PCT/US98/22512 size based on the nucleotide sequence of S2 (data not shown). In some samples the PCR product fragments were found to contain deletion spanning nucleotides (1438-1518) corresponding to the deletion of the nucleotide encoding an entire 27 amino acid repeat. Example 2 5 DNA Sequencing and Sequence Analysis Sequencing was done by the primer walking method. Both strands of each insert were sequenced as described in Protocol F. The sequences of the thirteen clones shared considerable homology. The nucleotide sequences of all thirteen clones are shown in Figures 3-15. The GE clones are as follows: one dog (designated WIC; see Figure 3), one horse 10 (designated EQ; see Figure 5), a cow (designated BOV; see Figure 6) and ten humans, including four patients from Wisconsin (designated WIl, WI2, WI3, WI4; see Figures 7-10, respectively), three patients from New York (designated NYI, NY2, NY3; see Figures 11-13, respectively), one patient from Sweden (designated SWED; see Figure 4), and two patients from Slovenia (designated SLOVI and SLOV2; see Figures 14-15, respectively). The deduced 15 amino acid sequences of all thirteen clones are shown in Figures 16-28. The deduced amino acid sequences of the representative clones are as follows: one dog (designated WIC; see Figure 16), one horse (designated EQ; see Figure 18), a cow (designated BOV; see Figure 19) and ten humans, including four patients from Wisconsin (designated WII, WI2, WI3, WI4; see Figures 20-23, respectively), three patients from New York (designated NY1, NY2, NY3; see 20 Figures 24-26), one patient from Sweden (designated SWED; see Figure 17), and two patients from Slovenia (designated SLOVI and SLOV2; see Figures 27-28). The alignment of the derived amino acid sequences from all thirteen GE clones have been compared to the amino acid sequence of the S2 GE160 protein as shown in Figure 29. Sequence analysis (MacVector, Oxford Molecular Group) showed that each clone 25 contained a single large open reading frame encoded by the plus strand of the insert and each one appeared to be a complete gene. The WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2 clones of the invention were found to encode the S2 GE160 protein (160 kDa) which contains three groups of repeats. The first set consists of a number of ankyrin-like repeat units of 33 amino acids, the second consists of repeat units of 30 27 amino acids, and the third consists of repeat units of 11 amino acids. The ankyrin repeats 47 WO 00/06744 PCT/US98/22512 were revealed by a BLAST database search for protein homologies. Ankyrin repeats occur in at least four consecutive copies and are present in yeast, plants, bacteria, and mammals. Example 3 Cultivation of GE -WI, WI2, WI3, WI4, WIC, NY1, 5 NY2. NY3. SWED, BOV, EQ, SLOV1, and SLOV2 in HL60 cells The HL60 cell lines infected with the GE isolates of the present invention, are obtained by co-culturing HL60 cells (ATCC CCL 240) with blood cells from various animals and patients, as follows: one dog (designated WIC), one horse (designated EQ), a cow (designated BOV), and ten humans (four patients from Wisconsin (designated WI1, WI2, WI3, WI4), three 10 patients from New York (designated NY1, NY2, NY3), one patient from Sweden (designated SWED) and two patients from Slovenia (designated SLOV 1 and SLOV2)). After degenerative cell morphology becomes noticeable, the infected cells are passed over fresh uninfected HL60 cells to maintain the culture. GE is then grown in RPMI 1640 containing 10-20% heat inactivated fetal bovine serum, 2 mM 1-glutamine, 1 mM sodium pyruvate, 0.1 mM MEM 15 non-essential amino acids and is split into fresh HL60 cells two to three times per week. This procedure is also outlined in Coughlin et al., PCT Application No. PCT/US96/10117 and has also been demonstrated by Goodman et al., N. Eng. J. Med. 334:209-215 (1996). To confirm that the isolates are GE the 16S ribosomal genes are amplified and analyzed as follows. Cell extracts are prepared by lysis protocols as described supra. PCR 20 primers (specific for the 16S ribosomal DNA) are modified to include restriction enzyme recognition sites as follows: forward primer, 5'-CTGCAGGTTI'GATCCTGG-3' (PstI site) (SEQ ID NO:45); reverse primer, 5'-GGATCCTACCTTGTTACGACTT-3' (BamHI site)(SEQ ID NO:46). These primers (0.5 pM) are added to a 100 pl reaction mixture containing 1X PCR buffer II 25 (Perkin-Elmer Corp), 1.5 mM MgCl, (Perkin-Elmer Corp.), 200 pM each dATP, dGTP, dCTP and dTTP, 2.5 U of Amplitaq DNA polymerase and 20 pl of USG3 DNA. Amplification is performed as described in Protocol F. This amplification is expected to produce a 1500bp fragment which may be digested with Pst I and Bam HI and ligated to pUC19 linearized with the same enzymes. The resulting clones are then sequenced. 48 WO 00/06744 PCT/US98/22512 Example 4 Isolation of Clones Using Sera GE from the above cultures is purified according to Protocol B and a genomic library is constructed according to Protocol C. The library is screened using sera prepared as in 5 Protocol D or derived from the blood of different infected animals or patients as discussed. Screening is performed as in Protocol E. The identified clones are then purified as single plaques by a third immunoscreening. Plasmids are rescued according to the Stratagene protocol and DNA purified using Qiagen plasmid purification kits. Single enzyme digests are then performed with EcoRI, HindIII, BamHI, HincII, XbaI, PstI and Alw26I and in some 10 cases a number of double digests may be done. Based on these digests restriction maps are generated and compared to that deduced on the basis of the PCR derived nucleotide sequences of Example 1. Example 5 Verification that Clones WI, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EO. 15 SLOV1, and SLOV2 are GE Derived by PCR Analysis PCR primer sets are as described in Table 2. The sequences of each primer set indicated in Table 2 are used to amplify regions of the listed clones WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, and SLOV2. Each oligonucleotide sequence is shown in the 5' to 3' orientation. Each 50 pl reaction contained 0.5 pM of each 20 primer, IX PCR Supermix (Life Technologies, Gaithersburg, MD) and 100 ng of either purified GE DNA of the various types of 6E (WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, and SLOV2), 100 ng HL60 DNA or 200 ng plasmid DNA. PCR amplification is performed as described in Protocol F. These experiments will establish that the sequenced genes are derived from GE DNA and not HL60 DNA or other animal or patient 25 DNA. In each case the size of the PCR product using genomic DNA as template is expected to be the same as that generated by purified plasmid DNA and that observed in the initial PCR amplification (see Example 1). 49 WO 00/06744 PCT/US98/22512 Example 6 Further Characterization of Isolated GE Clones The isolated clones are induced to express the encoded protein and bacterial extracts are prepared for SDS-PAGE as outlined in Protocol G. SDS-PAGE and Western blot analysis 5 (using SDS-disrupted whole GE as a positive control and a non-protein expressing clone as a negative control) is expected to identify immunoreactive proteins for each clones using sera as described in Protocol D. The same proteins are expected to be detectable when probed with sera obtained form human patients with GE. Based on the amino acid sequences of these proteins, the calculated molecular weights are expected to be significantly lower than the O10 apparent molecular weights by SDS-PAGE. The calculated (based on the amino acid sequence) molecular weights of each protein encoded by the open reading frames of the clones is expected to be approximately 78 kDa, whereas the apparent (based on mobility on SDS PAGE) is expected to be 160 kDa. This phenomenon has been observed in other proteins (see Barbet et al., Infect. Imnmun. 59:971-976 (1991); Hollingshead et al., J. Biol. Chemn. 261:1677 15 1686 (1986); Yu et al., Gene 184:149:154 (1997)). One of skill in the art will appreciate that the isolation of purified protein samples from isolated clones is well known in the art. Similarly, having isolated the individual protein products one may proceed to produce polyclonal and/or monoclonal antibodies according to any of the many methods available in the field. 20 While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be appreciated by one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention and appended claims. 50

Claims (25)

1. An isolated nucleic acid molecule comprising a nucleotide sequence encoding the WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 polypeptide comprising the complete amino acid sequence in SEQ ID NOS:5, 6, 7, 8, 1, 9, 10, 5 11, 2, 4, 3, 12, or 13, respectively.

2. An isolated nucleic acid molecule comprising a nucleotide sequence complementary to the isolated nucleic acid molecule of claim 1.

3. The isolated nucleic acid molecule of claim 1, wherein the molecule encodes the polypeptide comprising the complete amino acid sequence set forth in SEQ ID NOS:5, 6, 10 7,8, 1,9, 10, 11,2,4,3, 12, or 13.

4. An isolated nucleic acid molecule consisting of 10 to 50 nucleotides which hybridizes preferentially to RNA or DNA of granulocytic ehrlichia but not to RNA or DNA of humans, wherein said nucleic acid molecule is a nucleotide sequence or is complementary to a nucleotide sequence consisting of at least 10 consecutive nucleotides from the nucleotide 15 sequence of claim 1.

5. The isolated nucleic acid molecule of claim 4, wherein the molecule consists of 10 to 35 nucleotides.

6. The isolated nucleic acid molecule of claim 4, wherein the molecule consists of 18 to 35 nucleotides. 20

7. The isolated nucleic acid molecule of claim 4, wherein said nucleic acid molecule is a nucleotide sequence or is complementary to a nucleotide sequence consisting of at least 18 consecutive nucleotides. 51 WO 00/06744 PCT/US98/22512

8. A method of detecting WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 nucleic acid in a sample comprising: (a) contacting said sample with the nucleic acid molecule of claim 4, under conditions such that hybridization occurs, and 5 (b) detecting the presence of said molecule bound to WII, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 nucleic acid.

9. A method of detecting WII, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV 1, or SLOV2 nucleic acid in a sample comprising: (a) amplifying nucleic acid in said sample with the nucleic acid molecule of 10 claim 4, wherein said amplification uses polymerase chain reaction (PCR) techniques; and (b) detecting the presence of said amplified WIl, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2 nucleic acid.

10. A kit for detecting the presence of WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 nucleic acid in a sample comprising at least one 15 container means having disposed therein the nucleic acid molecule of claim 4.

11. A recombinant nucleic acid molecule comprising, 5' to 3', a promoter effective to initiate transcription in a host cell and the nucleic acid molecule of claim 1.

12. A recombinant nucleic acid molecule comprising a vector and the nucleic acid molecule of claim 1. 20

13. A cell that contains the recombinant nucleic acid molecule of claim 11 or claim 12.

14. A non-human organism that contains the recombinant nucleic acid molecule of claim 11 or claim 12. 52 WO 00/06744 PCT/US98/22512

15. A purified polypeptide comprising an amino acid sequence corresponding to WIl, WI2, WI3, WI4, WIC, NYI, NY2, NY3, SWED, BOV, EQ, SLOVI, or SLOV2, wherein the polypeptide comprises the amino acid sequence set forth in SEQ ID NOS:18, 19, 20, 21, 14, 22, 23, 24, 15, 17, 16, 25, and 26, respectively. 5

16. A vaccine comprising the polypeptide of claim 15 or an immunologically reactive fragment thereof, together with a pharmaceutically acceptable diluent, carrier, or excipient, wherein said polypeptide or fragment is present in an amount effective to elicit beneficial immune responses in an animal to granulocytic Ehrlichia.

17. A method of producing an immune response which recognizes granulocytic 10 Ehrlichia in a host comprising administering to the host the vaccine of claim 16.

18. A vaccine comprising the nucleic acid molecule of claim 1 or a fragment thereof, encoding an immunologically reactive polypeptide, together with a pharmaceutically acceptable diluent, carrier, or excipient, wherein said nucleic acid molecule or fragment is present in an amount effective to elicit beneficial immune responses in an animal to 15 granulocytic Ehrlichia.

19. A method of preventing Ehrlichiosis in an animal comprising administering to said animal the vaccine of claim 16 or claim 18, wherein said vaccine is administered in an amount effective to prevent Ehrlichiosis.

20. An antibody having binding affinity to the polypeptide of claim 15. 20

21. A hybridoma which produces the antibody of claim 20.

22. A method of detecting an antibody to a WI, WI2, WI3, WI4, WIC, NY1, NY2, NY3, SWED, BOV, EQ, SLOV1, or SLOV2 polypeptide in a sample, comprising: (a) contacting said sample with a polypeptide of claim 15, under conditions such that immunocomplexes form; and 53 WO 00/06744 PCT/US98/22512 (b) detecting the presence of said polypeptide bound to said antibody.

23. A diagnostic kit comprising: (a) a first container means containing the antibody of claim 20; and (b) second container means containing a conjugate comprising a binding 5 partner of said monoclonal antibody and a label.

24. A diagnostic kit comprising: a container means containing a polypeptide of claim 15 or immunologically reactive fragments thereof.

25. A method of inhibiting Ehrlichiosis is an animal comprising administering to said animal the vaccine of claim 16 or claim 18, wherein said vaccine is administered in an 10 amount to inhibit Ehrlichiosis. 54