WO2021243905A1 - Lung cancer detection reagent and kit - Google Patents

Abstract

The present invention relates to the field of genetic testing. Disclosed are a lung cancer detection reagent and a kit. The reagent or kit comprises a detection reagent for the methylation of a specific nucleic acid fragment and is used to detect a modified sequence of the specific nucleic acid fragment.

Description

Lung cancer detection reagent and kit Technical field

The present disclosure belongs to the field of genetic testing. More specifically, the present disclosure relates to a lung cancer detection reagent and kit.

Background technique

Lung cancer is a malignant tumor of the lung that originates from the bronchial mucosa, glands, or alveolar epithelium. According to the type of pathology, it can be divided into: 1) Small cell lung cancer (SCLC): a special pathological type of lung cancer, which has a clear tendency to metastasize to a distance and a poor prognosis, but most patients are sensitive to radiotherapy and chemotherapy; 2) Non-small cell lung cancer (NSCLC): In addition to small cell lung cancer, other pathological types of lung cancer, including squamous cell carcinoma, adenocarcinoma, large cell carcinoma, etc. There are certain differences in biological behavior and clinical course. According to the location of occurrence, it can be divided into: 1) central lung cancer: lung cancer that grows at or above the bronchial opening of the lung; 2) peripheral lung cancer: lung cancer that grows beyond the bronchial opening of the lung. Lung cancer.

In recent years, the aging population, air pollution and smoking have caused the incidence and mortality of lung cancer in China to increase year by year. According to the "2017 China Cancer Registry Annual Report" issued by the National Cancer Center, about 7 people are diagnosed every minute in the country. Suffering from cancer, the incidence and mortality of lung cancer are both the first. China has become the country with the largest number of lung cancers in the world. Experts predict that the number of lung cancers in China will reach 1 million by 2025. According to epidemiological studies, smoking is an important factor in causing lung cancer. About 80%-90% of lung cancers in the world can be attributed to smoking. Compared with non-smokers, the relative risk of lung cancer for people aged 45-64 who smoked 1-19 cigarettes a day and 20 or more cigarettes a day was 4.27 and 8.61, respectively. Compared with never-smokers, long-term daily smoking was 1-19 The relative risk of dying from lung cancer for those with more than 20 branches and those with more than 20 branches was 6.14 and 10.73, respectively. Although the treatment technology of lung cancer is changing with each passing day, the 5-year survival rate has only increased from 4% to about 12%. Existing anti-tumor drugs can only relieve the disease, and the progression-free survival of patients is only extended by an average of 3 months to 5 months. Months, but for patients with stage I lung cancer, the 5-year survival rate after surgery is as high as about 60% to 70%. Therefore, early diagnosis and early surgery of lung cancer is one of the most effective methods to improve the 5-year survival rate of lung cancer and reduce the mortality rate.

The current clinical auxiliary diagnosis of lung cancer mainly includes the following types, but none of them can fully achieve early detection and early diagnosis:

(1) Blood biochemical test: For primary lung cancer, there is currently no specific blood biochemical test. For lung cancer patients, elevated blood alkaline phosphatase or blood calcium may consider the possibility of bone metastasis, and elevated blood alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase or bilirubin may consider the possibility of liver metastasis.

(2) Tumor marker examination: 1) CEA: 30% to 70% of lung cancer patients have abnormally high levels of CEA in the serum, but they are mainly seen in patients with advanced lung cancer. At present, the examination of CEA in serum is mainly used to estimate the prognosis of lung cancer and monitor the treatment process. 2) NSE: It is the first choice marker for small cell lung cancer. It is used for the diagnosis and monitoring of treatment response of small cell lung cancer. The reference value is different according to the different detection methods and reagents used. 3) CYFRA21-1: It is the first choice marker for non-small cell lung cancer, with a sensitivity of up to 60% in the diagnosis of lung squamous cell carcinoma. The reference value is different depending on the detection method and reagents used.

(3) Imaging examination: 1) Chest X-ray examination: It should include frontal and lateral chest radiographs. In primary hospitals, chest radiographs are still the most basic and preferred imaging diagnosis method for lung cancer at the initial diagnosis. Once lung cancer is diagnosed or suspected, a CT scan of the chest is performed. 2) CT examination: Chest CT is the most commonly used and most important examination method for lung cancer. It is used for the diagnosis and differential diagnosis, staging and follow-up after treatment of lung cancer. CT-guided lung biopsy is an important diagnostic technique for lung cancer. Hospitals with conditions can use it for the diagnosis of lung lesions that are difficult to characterize. The clinical diagnosis of lung cancer needs to be confirmed by cytology and histology, and other methods are difficult to obtain. Case. In recent years, multi-slice spiral CT and low-dose CT (LDCT) are effective screening tools for detecting early lung cancer and reducing mortality. The National Lung Cancer Screening Study (NLST) has shown that LDCT can reduce 20% compared with chest X-ray screening. % Mortality from lung cancer. Low-dose spiral CT is recommended as an important method for early lung cancer screening, but there are many man-made factors and the false positive rate is very high. 3) Ultrasound examination: It is mainly used to find out whether there are metastases in vital organs of the abdomen, abdominal cavity and retroperitoneal lymph nodes. It is also used to check the lymph nodes in the neck. For lung lesions or chest wall lesions that are adjacent to the chest wall, the cysts and solids can be identified and ultrasound-guided needle biopsy can be performed; ultrasound is also often used for pleural fluid extraction and positioning. 4) Bone scan: It is highly sensitive to detecting bone metastases from lung cancer, but has a certain false positive rate. It can be used in the following situations: preoperative examination of lung cancer; patients with local symptoms.

(4) Other examinations: 1) Sputum cytology examination: The current simple and convenient non-invasive diagnosis method for lung cancer, continuous smear examination can increase the positive rate by about 60%, and it is a routine diagnosis method for suspected lung cancer cases. 2) Fiberoptic bronchoscopy: one of the most important methods in the diagnosis of lung cancer, which plays an important role in the qualitative diagnosis of lung cancer and the selection of surgical options. Routine examination items are necessary for patients who are to be treated by surgery. The bronchoscopy needle biopsy (TBNA) is good for pre-treatment staging, but due to technical difficulties and risks, those in need should be transferred to a higher-level hospital for further examination. 3) Others: such as percutaneous lung biopsy, thoracoscopic biopsy, mediastinoscopy biopsy, pleural effusion cytology, etc., if there are indications, they can be used according to existing conditions to assist in diagnosis.

Multi-slice spiral CT and low-dose CT (LDCT) in imaging examinations are effective screening tools for detecting early lung cancer and reducing mortality. The National Lung Cancer Screening Study (NLST) has shown that LDCT is more effective than chest X-ray screening. Reduce the death rate of lung cancer by 20%. In clinical practice, it has been proved that the success or failure of any lung cancer screening project depends on the identification of high-risk groups. The risk prediction model integrating multiple high-risk factors has been recognized worldwide as one of the methods for identifying high-risk groups of lung cancer. The risk model can further improve the efficacy of lung cancer patients by assisting clinicians to improve interventions or treatment methods. Although the world has recognized that screening for high-risk groups can reduce the current high mortality rate of lung cancer, the definition of high-risk groups is still a difficult problem to solve. In order to maximize the benefit-harm ratio of lung cancer screening, the key question is how to define the population at high risk of disease; the second is what method is used to screen the population, including the definition of high-risk factors and overall risk Quantitative summary and selection of screening benefit cutoffs.

With the rapid development of technology, tumor marker detection has become a new field of tumor diagnosis and treatment following imaging diagnosis and pathological diagnosis, which can have a significant impact on tumor diagnosis, detection, and treatment. Tumor markers can be detected in body fluids or tissues, and can reflect the existence of tumors, the degree of differentiation, prognostic estimation, personalized medication and treatment effects, etc. Early-stage lung cancer patients have no obvious symptoms and are difficult to be detected by doctors and patients. In addition, they have no obvious specific markers in blood or biochemical items. Therefore, it is difficult to carry out early detection and early diagnosis through conventional diagnostic methods. Therefore, lung cancer Early diagnosis, especially in large-scale population screening, is more difficult.

More and more studies have shown that there are two major types of mechanisms involved in the formation of tumors. One is the formation of mutations through changes in the DNA nucleotide sequence, which is a genetic mechanism. Tumor as a genetic disease has been confirmed in the field of molecular biology. The other is the mechanism of epigenetics, which does not rely on changes in DNA sequence to cause changes in gene expression levels, and its role in the process of tumor formation is getting more and more attention. The two mechanisms of genetics and epigenetics intersect each other and jointly promote the formation of tumors. The abnormal methylation of genes can appear in the early stage of tumor, and the degree of abnormal methylation of genes increases during the gradual development of the tumor. Analysis of the genomes of 98 common human primary tumors revealed that each tumor has at least 600 abnormally methylated CpG islands.

Many studies have shown that abnormal promoter methylation is a frequent early event in the development of many tumors. Therefore, the methylation status of tumor-related genes is an early sensitive indicator of tumorigenesis and is considered to be a promising Tumor molecular biomarker (biomarker). More importantly, cancerous cells can release DNA into peripheral blood. There are nanogram-level free DNA in the peripheral blood of normal people. Studies have found that peripheral blood plasma/serum, tumor-related organ-related body fluids (such as saliva, sputum, etc.) can also detect abnormal methylation of the promoters of tumor-related genes in tumor tissues. These biological samples are relatively easy to obtain, and the DNA in them can be detected sensitively after a large amount of DNA amplification by PCR technology. Therefore, the detection of the methylation status of the promoter regions of some tumor-related genes can be used for the early stage of tumors. Diagnosis provides very valuable information. Compared with other types of tumor molecular markers, detecting abnormal promoter methylation has more advantages. In different types of tumors, the abnormally methylated region of the promoter of a certain gene is the same, which is more convenient to detect. In addition, compared with markers such as allelic deletion, abnormal methylation is a positive signal, which is easy Distinguish from the negative background in normal tissues. Esteller et al. examined the abnormal methylation status of the promoter regions of genes such as p16, DAPK, GSTP1 and MGM T in 22 cases of non-small cell lung cancer (NSCLC) tumor tissues and serum, and found that 68% (15/22) of the tumor tissues The promoter methylation of at least one gene was present in at least one gene; and among the 15 tissue-positive cases, 11 cases also detected abnormal promoter methylation in the serum. Many other researchers have also detected the promoter methylation of certain tumor-related genes in the tumor tissues and serum of patients with liver cancer, head and neck cancer, esophageal cancer, and colon cancer.

Existing lung cancer detection techniques mainly have low sensitivity, high false positives, and are invasive, and it is difficult to detect early lung cancer with conventional detection techniques.

However, non-invasive detection of lung cancer, such as sputum detection, is more difficult. Although some researchers have studied tumor markers in the sputum of patients with lung cancer, the success rate of sputum samples is very low compared with the detection and evaluation of tumor markers in blood samples of other tumor patients. This is mainly due to the following reasons: ①The composition of sputum is more complicated, and the composition and viscosity of sputum in different people under different diseases or environments are quite different; ②The sputum contains more tracheal epithelial cells and bacteria, and the oral cavity Mucosal cells and other non-lung cancer cell components, general sample processing methods cannot effectively enrich a sufficient number of lung cancer-derived DNA; ③There are many smokers who do not show sputum expectoration. AJ Hubers et al. in "Molecular sputum analysis for the diagnosis of lung cancer" in the past 10 literature studies showed that the median methylation degree of markers in lung cancer tissue is 48%, and the median of sputum The degree of methylation is 38%, and the results show that the detection rate of methylation markers in tissues is significantly higher than that of sputum. At the same time, Rosalia Cirincione (Methylation

in tumor and sputum samples of lung cancer patients detected by spiral computed tomography: A nested case–contro) reported that the detection rates of RARbeta2, P16, and RASSF1A in lung cancer tissues reached 65.5%, 41.4%, 51.7%, and in sputum They are only 44.4%, 5%, and 5% respectively.

Summary of the invention

In one aspect, the present disclosure provides the application of the nucleic acid fragment shown in SEQ ID NO: 4 (hereinafter referred to as "nucleic acid fragment") in the preparation of lung cancer detection reagents or kits. This "application" includes the application of any part of the nucleic acid fragment shown in SEQ ID NO: 4, that is, any part of the nucleic acid fragment shown in SEQ ID NO: 4 (for example, a smaller fragment The application of) in the preparation of lung cancer detection reagents or kits all fall within the protection scope of the present disclosure.

In some embodiments, the present disclosure provides that the nucleic acid fragment as shown in SEQ ID NO: 20 has at least 85%, or at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%. Or at least 96%, or at least 97%, or 98%, or at least 99%, or 100% identical sequence, or the application of its complementary sequence in the preparation of lung cancer detection reagents or kits.

On the one hand, the present disclosure also provides a primer, the primer is selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8 , SEQ ID NO: 9 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identity, or at least any one of its complementary sequences.

In some embodiments, the primer is selected from SEQ ID NO.: 1 and SEQ ID NO: 2; SEQ ID NO: 5 and SEQ ID NO: 6; and SEQ ID NO: 8 and SEQ ID NO: 9 The sequence has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identity At least one primer pair in the sequence.

In some embodiments, the primer is selected from the primer pair shown in SEQ ID NO:1 and SEQ ID NO:2.

In one aspect, the present disclosure also provides a probe which is selected from the group consisting of at least 85% or at least 90% of the sequence shown in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 10 Or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identical sequence, or its complementary sequence At least any one.

In some embodiments, the probe is selected from the sequence shown in SEQ ID NO: 3.

In one aspect, the present disclosure also provides the application of the above-mentioned primers and/or probes in the preparation of lung cancer detection reagents or kits.

"Detection" in the present disclosure is the same as diagnosis, in addition to the early diagnosis of lung cancer, it also includes the diagnosis of middle and late stages of lung cancer, and also includes lung cancer screening, risk assessment, prognosis, disease identification, diagnosis of disease stages, and selection of therapeutic targets.

The application of the nucleic acid fragments of the present disclosure makes the early diagnosis of lung cancer possible. When it is determined that a nucleic acid fragment methylated in a cancer cell is methylated in a clinically or morphologically normal cell, this indicates that the normal cell is developing into cancer. In this way, lung cancer can be diagnosed at an early stage by methylation of lung cancer-specific nucleic acid fragments in normal-appearing cells.

Among them, early diagnosis refers to the possibility of detecting cancer before metastasis, optionally before observing the morphological changes of tissues or cells.

In addition to the early diagnosis of lung cancer, the reagents/kits of the present disclosure are also promising for lung cancer screening, risk assessment, prognostic diagnosis, disease identification, diagnosis of disease stages, and selection of therapeutic targets.

As an alternative embodiment of the stage of the disease, the diagnosis can be made by measuring the degree of methylation of the nucleic acid fragment obtained from the sample through the progress of lung cancer in different stages or periods. By comparing the degree of methylation of the nucleic acid fragments isolated from samples of each stage of lung cancer with the methylation of the nucleic acid fragments in one or more nucleic acids isolated from samples with no abnormal cell proliferation The degree can detect the specific stage of lung cancer in the sample.

In another aspect, the present disclosure provides a lung cancer detection reagent, which contains at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or the nucleic acid fragment shown in SEQ ID NO: 4 A methylation detection reagent for a sequence that is at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identical, or its complementary sequence.

"Methylation detection reagents for nucleic acid fragments" include the following: reagents for detecting the sequence of the nucleic acid fragment or any smaller/shorter sequence in the nucleic acid fragment. That is to say, any detection and detection reagents performed on any site in the nucleic acid fragment (for example, a smaller fragment) fall within the protection scope of the present disclosure.

The methylation detection reagent can be a methylation detection reagent in the prior art. In the prior art, there are a variety of methods to detect the methylation of target nucleic acid, such as methylation-specific PCR (MSP), methylation-specific quantitative PCR (qMSP), methylation-specific DNA binding protein PCR, quantitative PCR and DNA chips, methylation-sensitive restriction endonucleases, bisulfite sequencing or pyrosequencing, etc. In addition, other methylation detection methods can be introduced through patent US62007687. Each detection method has its corresponding reagents, and these reagents can be used in the present disclosure to detect the methylation of nucleic acid fragments.

In some specific embodiments of the present disclosure, the primers and/or probes detect the methylation of nucleic acid fragments by quantitative Methylation-Specific PCR (qMSP).

In some embodiments, the sequence of the nucleic acid fragment is at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96 % Or at least 97% or 98% or at least 99%, or 100% identical to the sequence, or its complementary sequence.

Methylation occurs when a methyl group is added to cytosine. After being treated with bisulfite or bisulfite or hydrazine salt, cytosine will become uracil, because uracil is used for PCR amplification. Similar to thymine, it will be recognized as thymine. It is reflected in the PCR amplified sequence that cytosine that has not been methylated becomes thymine (C becomes T), and methylated cytosine (C) is Will not change. The technology for detecting methylated genes by PCR is usually MSP. Primers are designed for the treated methylated fragments (that is, the unchanged C in the fragments), and PCR amplification is carried out. If there is amplification, it means that methylation has occurred. There is no methylation for amplification.

In some embodiments, the methylation detection reagent detects the sequence of the nucleic acid fragment modified by bisulfite, bisulfite, or hydrazine.

In some embodiments, the sequence detected is the sequence of the nucleic acid fragment modified with bisulfite.

In some embodiments, the methylation detection reagent includes primers and/or probes for methylation detection of the nucleic acid fragment shown in SEQ ID NO: 4.

In some embodiments, the upstream primer in the primer has any one of the nucleotide sequences shown below:

I. The nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 5 and SEQ ID NO: 8 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94 % Or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or a sequence of 100% identity; and

II. The complementary sequence of the sequence shown in I.

In some embodiments, the downstream primer in the primer has any one of the nucleotide sequences shown below:

III. The nucleotide sequence shown in SEQ ID NO: 2, SEQ ID NO: 6 and SEQ ID NO: 9 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94 % Or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or a sequence of 100% identity; and

IV. The complementary sequence of the sequence shown in III.

Currently, the missed detection rate of lung cancer is relatively high. Especially, for this type of adenocarcinoma, non-invasive detection of sputum is even more difficult, and the detection rate is extremely low. This is because most adenocarcinomas originate from smaller bronchial tubes, which are peripheral lung cancers. The exfoliated cells in the deep lungs are more difficult to expectorate through sputum. Therefore, the current sputum detection methods for adenocarcinoma are almost zero.

Reducing the missed detection rate is especially important in the early screening of tumors. If an early tumor screening product fails to screen all or most of the patients, those who missed the test will not be able to get enough risk prompts, which will delay the timing of treatment, which is a huge for patients. loss.

Although some lung cancer-related tumor markers have been discovered in the prior art, the detection reagents or detection methods for these tumor markers are limited, resulting in that the sensitivity and specificity of these tumor markers cannot meet the demand. Therefore, the current There is still a need for further research in the field of screening methods that can be practically applied to lung cancer. However, although non-invasive screening has unique advantages in sampling, it also has some limitations in other aspects. For example, the type of adenocarcinoma in lung cancer is difficult to cough up through sputum due to the exfoliated cells in the deep lung. Generally speaking, those skilled in the art would think that this type of lung cancer is not suitable for non-invasive screening. On the other hand, even for other types of lung cancer, the currently reported non-invasive screening methods are difficult to meet the requirements of clinical use. Although related research has been progressing for many years, there is still no noninvasive screening method for lung cancer that can be promoted to the clinic.

The primers are used to amplify the nucleic acid fragments. It is well known in the art that the successful design of primers is essential for PCR. Compared with general PCR, in methylation detection, the influence of primer design is more critical. This is because the methylsulfurization reaction promotes the conversion of "C" in the DNA chain to "U", resulting in a decrease in GC content, which makes the PCR reaction Long continuous "T" in the sequence can easily cause DNA strand breaks, making it difficult to select suitable Tm and stable primers; on the other hand, in order to distinguish between sulfurized and non-sulfurized and incompletely processed DNA , It is necessary to have a sufficient number of "C" in the primers, all of which increase the difficulty of selecting stable primers. Therefore, in DNA methylation detection, the selection of the amplified fragments targeted by the primers, such as the length and position of the amplified fragments, and the selection of primers, all have an impact on the sensitivity and specificity of the detection. The inventor also found through experiments that different amplification target fragments and primers have different detection effects. In many cases, some genes or nucleic acid fragments are found to have differences in expression between tumors and non-tumor. However, their distances are transformed into tumor markers, and there is still a long way to be applied to the clinic. The main reason is that the detection sensitivity and specificity of the potential tumor markers are difficult to meet the detection requirements due to the limitation of detection reagents, or the detection methods are complicated and costly, and it is difficult to apply them in clinics on a large scale.

In some embodiments, the probe has any one of the nucleotide sequences shown below:

V. The nucleotide sequence shown in SEQ ID NO: 3, SEQ ID NO: 7 and SEQ ID NO: 10 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94 % Or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or a sequence of 100% identity;

VI. The complementary sequence of the sequence shown in V.

In some embodiments, the reagent includes a detection reagent including an internal reference gene.

In some embodiments, the internal reference gene is β-actin.

In some embodiments, the detection reagents for the internal reference gene are primers and probes for the internal reference gene.

In some embodiments, the detection reagent for the internal reference gene is a primer pair shown in SEQ ID NO: 11 and SEQ ID NO: 12 and a probe shown in SEQ ID NO: 13.

In some embodiments, the reagent further includes at least one of bisulfite, bisulfite, or hydrazine salt to modify the nucleic acid fragment, which of course may not be included.

In some embodiments, the PCR reagent containing DNA polymerase including, dNTPs, Mg ²⁺ ions, buffer one or more, preferably comprising a DNA polymerase, dNTPs, Mg ²⁺ ions and buffer The reaction system is used for the amplification of modified nucleic acid fragments.

The sample detected by the detection/diagnostic reagent of the present disclosure may be selected from at least one of alveolar lavage fluid, tissue, pleural fluid, sputum, blood, serum, plasma, urine, prostate fluid, or feces.

In some embodiments, the sample is selected from at least one of alveolar lavage fluid, tissue, and sputum.

In some embodiments, the sample is selected from at least one of alveolar lavage fluid or sputum.

In one aspect, the present disclosure also provides a kit containing the aforementioned primers, or probes, or lung cancer detection reagents.

In some embodiments, the kit includes: a first container that contains a primer pair for amplification; and a second container that contains a probe.

In some embodiments, the kit further includes instructions.

In some embodiments, the kit further includes nucleic acid extraction reagents.

In some embodiments, the kit further includes a sampling device.

In some embodiments, the present disclosure also provides the primers, or the probes, or the application of the reagents in the preparation of methylation detection reagents or kits, or the preparation of the detection of lung cancer Application in reagents or kits.

In some embodiments, the present disclosure also provides the primer, or the probe, or the reagent, or the kit, for use in methylation detection, or in the detection of lung cancer Applications.

The tissues targeted by the detection reagents of the present disclosure are selected from lung cancer tissues and adjacent normal tissues (or benign lung disease tissues).

In some embodiments, the lung cancer is selected from small cell lung cancer and non-small cell lung cancer.

In some embodiments, the non-small cell lung cancer is selected from squamous cell carcinoma and adenocarcinoma.

In one aspect, the present disclosure also provides a method for detecting the methylation of the nucleic acid fragment, which is characterized in that it comprises the following steps:

(1) Treat the sample to be tested with bisulfite or bisulfite or hydrazine salt to obtain a modified sample to be tested;

(2) Using the above reagents or kits to detect the methylation status of the nucleic acid fragments on the modified sample to be tested in step (1);

As a preferred embodiment, in step (2), real-time fluorescence quantitative methylation-specific polymerase chain reaction is used for detection.

On the other hand, the present disclosure also provides a lung cancer detection system. The described system contains:

a. The nucleic acid fragment as shown in SEQ ID NO: 4 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% Or 98% or at least 99%, or 100% identical sequence, or its complementary sequence methylation detection component, and,

b. Results judgment system.

In some embodiments, the system contains:

c. The nucleic acid fragment as shown in SEQ ID NO: 20 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93%

Or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identical sequence, or its complement

Sequence methylation detection component, and,

d. Results judgment system;

In some embodiments, the methylation detection component contains the aforementioned detection reagent or kit.

In some embodiments, the result judgment component is used to have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% of the nucleic acid fragment as shown in SEQ ID NO: 4 detected by the detection system. % Or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identical sequence, or the methylation result of its complementary sequence, output the risk of lung cancer and / Or type of lung cancer.

In some embodiments, the result judging component is used to have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% of the nucleic acid fragment as shown in SEQ ID NO: 20 detected by the detection system. % Or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identical sequence, or the methylation result of its complementary sequence, output the risk of lung cancer and / Or type of lung cancer.

In some embodiments, the disease risk is based on the result of comparing the methylation results of the test sample and the normal sample. When the methylation of the test sample and the normal sample is significantly different or extremely significant, As a result, it is judged that the sample to be tested has a high risk of disease.

In some embodiments, if the nucleic acid fragment is positive for methylation, it indicates that the provider of the sample to be tested is a high-risk lung cancer patient or a lung cancer patient. As a preferred embodiment, the “positive” refers to comparing the obtained detection result with the detection result of a normal sample. When the amplification result of the sample to be tested and the normal sample has a significant or extremely significant difference, the waiting The donor of the test sample was positive.

In some embodiments, the judgment standard of the judgment system includes: judging lung cancer specimens and normal specimens according to the cut-off value.

In some embodiments, the methylation level of the specimen is determined based on the Cp value and/or ΔCp value of the target gene, that is, the nucleic acid fragment ( _{ΔCp value=Cp target gene- Cp internal reference gene).}

In some embodiments, the critical value of the Cp value in the specimen ranges from about 35 to 39, and the critical value of the ΔCp value ranges from about 4 to 12.

In some embodiments, the cutoff value of the ΔCp value in the tissue specimen is about 5.4, the cutoff value of the Cp value in the sputum specimen is about 36.9, and the cutoff value of the ΔCp value in the lavage fluid specimen is about 11.2.

In some embodiments, the ΔCp value of the tissue and lavage fluid specimen is less than the threshold value of the ΔCp value, and it is determined as a lung cancer specimen, and the ΔCp value of the tissue and lavage fluid specimen is greater than or equal to the ΔCp value. The boundary value of Cp value is judged to be a normal specimen. If the Cp value of the sputum specimen is less than the threshold value of the Cp value, it is judged as a lung cancer specimen, and the sputum specimen is judged to be a normal specimen if the Cp value of the sputum specimen is greater than or equal to the threshold value of the Cp value.

The present disclosure also provides a method for diagnosing lung cancer, which includes the following steps:

(1) The test sample derived from the subject has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94 % Or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or a sequence of 100% identity, or its complementary sequence, or a nucleic acid fragment shown in SEQ ID NO: 20 that has at least 85 % Or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99% or a sequence of 100% identity, or The methylation level of its complementary sequence;

(2) Compare the methylation level of the nucleic acid fragment described in step (1) of the test sample and the normal control sample;

(3) Diagnose lung cancer based on the deviation of the methylation level of the test sample and the normal control sample.

In some embodiments, a method for diagnosing lung cancer is also provided, and the method includes the following steps:

(1) Contact the test sample derived from the subject with the primer, or the probe, or the reagent, or the kit to detect the methylation of the nucleic acid fragment of the test sample level;

(2) Compare the methylation level of nucleic acid fragments of the sample to be tested and the normal control sample;

(3) Diagnose lung cancer based on the deviation of the methylation level of the test sample and the normal control sample.

In one aspect, the present disclosure also provides a method for treating lung cancer, which includes the following steps:

(1) Contact the test sample derived from the subject with the primer, or the probe, or the reagent, or the kit to detect the methylation of the nucleic acid fragment of the test sample level;

(2) Compare the methylation level of gene nucleic acid fragments of the sample to be tested and the normal control sample; and

(3) Diagnose lung cancer based on the deviation of the methylation level of the test sample and the normal control sample;

(4) Administer anti-lung cancer drugs to subjects diagnosed with lung cancer;

In some embodiments, methylation-specific quantitative PCR is used to detect the methylation level of genes.

In some embodiments, the present disclosure provides a method for treating lung cancer, the method includes the following steps: detecting a nucleic acid fragment shown in SEQ ID NO: 4 in a test sample derived from a subject that has at least 85 % Or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or 100% identical nucleosides The methylation level of the acid sequence or its complementary sequence; the detection includes combining the test sample of the subject and the detection with the nucleic acid fragment shown in SEQ ID NO: 4 that has at least 85% or at least 90% or at least 91 % Or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical nucleotide sequence, or its complement Contact with the detection reagent for methylation level of the test sample; the nucleic acid fragment shown in SEQ ID NO: 4 in the test sample and the normal control sample has at least 85% or at least 90% or at least 91% or at least 92% or at least 93 %, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical nucleotide sequence, or comparison of the methylation level of its complementary sequence; and The nucleic acid fragment shown in SEQ ID NO: 4 in the test sample and the normal control sample has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96 % Or at least 97% or at least 98% or at least 99%, or 100% identical nucleotide sequence, or deviation of the methylation level of its complementary sequence, to diagnose lung cancer; if the subject is diagnosed as a lung cancer patient, Then, the subject is given lung cancer drug treatment.

In some embodiments, the present disclosure provides a method for the treatment of lung cancer, the method comprising the following steps: detecting that a nucleic acid fragment shown in SEQ ID NO: 20 in a test sample derived from a subject has at least 85 % Or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or 100% identical nucleosides The methylation level of the acid sequence or its complementary sequence; the detection includes combining the test sample of the subject and the detection with the nucleic acid fragment shown in SEQ ID NO: 20 that has at least 85% or at least 90% or at least 91 % Or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical nucleotide sequence, or its complement Contact with the detection reagent of methylation level of the test sample and the normal control sample; the nucleic acid fragment shown in SEQ ID NO: 4 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93 %, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical nucleotide sequences, or comparison of the methylation levels of their complementary sequences; and The nucleic acid fragment shown in SEQ ID NO: 4 in the test sample and the normal control sample has at least 85%, or at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96 % Or at least 97% or at least 98% or at least 99%, or 100% identical nucleotide sequence, or deviation of the methylation level of its complementary sequence, to diagnose lung cancer; if the subject is diagnosed as a lung cancer patient, Then, the subject is given lung cancer drug treatment.

The diagnostic method of the present disclosure can be used before and after treatment of lung cancer or in combination with treatment of lung cancer, after treatment, such as evaluating the success of the treatment or monitoring the remission, recurrence and/or progress (including metastasis) of lung cancer after treatment.

Another aspect of the present disclosure provides a method for the treatment of lung cancer, the method comprising administering surgery, chemotherapy, radiotherapy, radiotherapy and chemotherapy, immunotherapy, oncolytic virus therapy, or other medicines to a patient diagnosed with lung cancer by the above-mentioned diagnostic method. Any other types of lung cancer treatment methods used in the field and combinations of these treatment methods.

Although, in the prior art, it has been reported that the methylation of some gene markers can be used as one of the tumor markers of lung cancer. However, there are countless reports about tumor markers of lung cancer, and there are very few that can be used in clinical practice as markers for lung cancer detection. The detection reagent for specific nucleic acid fragments of the present disclosure has high sensitivity and specificity for lung cancer, and is very promising as a tumor marker for clinical diagnosis of lung cancer.

In some embodiments, based on the nucleic acid fragments and detection reagents of the present disclosure, lung cancer can be detected in tissue samples with a specificity of 100% and a sensitivity of 73.1%. Among them, squamous cell carcinoma can all be detected. Among the most difficult to detect adenocarcinoma, its specificity reached 100.0% and its sensitivity reached 78.9%.

In addition, the nucleic acid fragments of the present disclosure have high specificity and sensitivity for different types of lung cancer, including squamous cell carcinoma and adenocarcinoma in small cell lung cancer and non-small cell lung cancer. They have a wide range of applications and can basically be used for all lung cancers. Tumor markers. The existing lung cancer markers for clinical use are generally only applicable to the detection of one type of lung cancer. For example, NSE is used for the diagnosis of small cell lung cancer and monitoring treatment response, while CYFRA21-1 is the first choice for non-small cell lung cancer. .

The detection reagents and methods for specific nucleic acid fragments provided in the present disclosure can easily and accurately determine patients with lung cancer and benign lung diseases. The gene detection method is expected to be transformed into a gene detection kit and serve for the screening of lung cancer. Clinical testing and prognostic monitoring.

Description of the drawings

Figure 1 is the ROC curve of nucleic acid fragments detected in tissue samples in Example 1;

Figure 2 shows the ROC curve of nucleic acid fragments detected in sputum samples in Example 2;

Figure 3 is the ROC curve detected in the nucleic acid fragment lavage fluid sample in Example 3;

FIG. 4 is the amplification curve of the nucleic acid fragment in Example 3. FIG.

detailed description

The technical solutions of the present disclosure are further described by specific examples below, and the specific examples do not represent a limitation on the protection scope of the present disclosure. Some non-essential modifications and adjustments made by others based on the concept of this disclosure still belong to the protection scope of this disclosure.

The "primer" or "probe" in the present disclosure refers to an oligonucleotide that includes a region complementary to a sequence of at least 6 consecutive nucleotides of a target molecule (for example, a target nucleic acid fragment). In some embodiments, at least a portion of the sequence of the primer or probe is not complementary to the amplified sequence. In some embodiments, the primer or probe contains at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 relative to the target molecule. A region where the sequence of consecutive nucleotides is complementary. When a primer or probe contains a region "complementary to at least x consecutive nucleotides of the target molecule", the primer or probe is at least 95% of at least x consecutive or discontinuous block nucleotides of the target molecule Complementary. In some embodiments, the primer or probe is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, 96%, at least 97%, at least 98%, at least 99%, or 100% complementary.

In the present disclosure, "normal" samples refer to samples of the same type isolated from individuals who are known to be free of the cancer or tumor.

The samples for methylation detection in the present disclosure include but are not limited to DNA, or RNA, or DNA and RNA samples containing mRNA, or DNA-RNA hybrids. The DNA or RNA can be single-stranded or double-stranded.

In the present disclosure, the "subject" is a mammal, such as a human.

In the present disclosure, "methylation level" and "methylation degree" can usually be expressed as the percentage of methylated cytosine, which is the number of methylated cytosine divided by the number of methylated cytosine and the amount of unmethylated cytosine. The sum of the number of methylated cytosines; and the method of dividing the number of methylation target genes by the number of internal reference genes is generally used to express the methylation level; and other methods of expressing the methylation level in the prior art.

In this disclosure, "sample" is the same as "specimen".

The term "and/or" as used in this disclosure refers to and encompasses any and all possible combinations of one or more of the associated listed items. When used in a list of two or more items, the term "and/or" means that any of the listed items can be used alone, or any combination of two or more of the listed items can be used . For example, if a composition, combination, structure, etc. are described as including (or including) components A, B, C and/or D, then the composition may include A alone; B alone; C alone; D alone Contains the combination of A and B; Contains the combination of A and C; Contains the combination of A and D; Contains the combination of B and C; Contains the combination of B and D; Contains the combination of C and D; Contains the combination of A, B and C Combination; including A, B and D combination; including A, C and D combination; including B, C and D combination; or A, B, C and D in combination.

Example 1:

The inventor screened hundreds of gene markers and nucleic acid fragments, studied the distribution of methylation sites of each gene, and designed and detected primers and probes for real-time fluorescence quantitative methylation-specific polymerase chain reaction (real-time fluorescent quantitative methylation-specific PCR, qMSP) detection. Screening in tissue samples, using the β-actin gene as the internal reference gene, and finally screening to obtain the nucleic acid fragment shown in SEQ ID NO: 4 has a better detection result for lung cancer. Comparing the detection effect of the SEQ ID NO: 4 fragment with the commonly used lung cancer detection gene markers (PCDHGA12, HOXD8), the primer probes for each gene detection are as follows:

The detection primers and probes for nucleic acid fragments are:

SEQ ID NO: 1 Primer F: TTCGTCGTTTTCGTTATCATTC

SEQ ID NO: 2 Primer R: TACTAACCGCCTCGCTAC

SEQ ID NO: 3 Probe P: FAM-CGGGTTTTTGCGTCGTTATTCGTC-BQ1

The detection primers and probes of PCDHGA12 are:

SEQ ID NO: 14 PCDHGA12 Primer F: TTGGTTTTTACGGTTTTCGAC

SEQ ID NO: 15 PCDHGA12 Primer R: AAATTCTCCGAAACGCTCG

SEQ ID NO: 16 PCDHGA12 Probe P: FAM-ATTCGGTGCGTATAGGTATCGCGC-BQ1

The detection primers and probes of HOXD8 are:

SEQ ID NO: 17 HOXD8 Primer F: TTAGTTTCGGCGCGTAGC

SEQ ID NO: 18 HOXD8 primer R: CCTAAAACCGACGCGATCTA

SEQ ID NO: 19 HOXD8 Probe P: FAM-AAAACTTACGATCGTCTACCCTCCG-BQ1

The detection primers and probes for β-actin are:

SEQ ID NO: 11 β-actin primer F: GGAGGTTTAGTAAGTTTTTTGGATT

SEQ ID NO: 12 β-actin primer R: CAATAAAACCTACTCCTCCCTTA

SEQ ID NO: 13 β-actin probe P: FAM-TTGTGTGTTGGGTGGTGGTT-BQ1

experiment procedure:

1) Extract DNA

Collect specimens of confirmed lung cancer patients and non-lung cancer patients, including paraffin tissue specimens, sputum specimens, and lavage fluid specimens. After the sample is pretreated and separated from the cells, DNA extraction is performed according to the HiPure FFPE DNA Kit (D3126-03) instructions of Meji Biotech.

2) DNA modification

Follow the instructions of ZYMO RESEARCH Biotech Kit EZ DNA Methylation ^TM KIT (D5002) for bisulfite modification.

3) Amplification and detection

Table 1 Liquid dispensing system

To	Nucleic acid fragment	PCDHGA12	HOXD8	β-actin
Reaction component	Addition amount (μl)	Addition amount (μl)	Addition amount (μl)	Addition amount (μl)
Upstream primer (100μM)	0.125	0.125	0.05	0.125
Downstream primer (100μM)	0.125	0.125	0.125	0.125
Probe (100μM)	0.05	0.05	0.05	0.05
Magnesium ion (25mM)	6	6	6	6
dNTPs (10mM)	1	1	1	1
Taq polymerase (5unit/μl)	0.5	0.5	0.5	0.5
5X buffer	6	6	6	6
Sterilized water	11.2	11.2	11.275	11.2
Template DNA	5	5	5	5
total capacity	30	30	30	30

Amplification system: see Table 2 for the amplification system.

Table 2 Amplification system of nucleic acid fragments and β-actin

Table 2 (Continued) PCDHGA12 and HOXD8 amplification system

4) Test results

Sample information: There are a total of 169 lung tissue samples, including 91 normal tissue samples, 78 cancer tissue samples, and 78 cancer group samples including 27 cases of squamous cell carcinoma, 38 cases of adenocarcinoma, 3 cases of small cell carcinoma, and 4 cases of large cell carcinoma. Among them, there were 1 case of compound cancer and 5 cases of lung cancer that were not clearly classified. Among them, 77 pairs of cancer and para-cancer control samples were included.

Calculation method:

Nucleic acid fragment: ACTB is used as the internal reference gene, and the methylation level of the specimen is judged according to the △Cp value of the target gene, that is, the nucleic acid fragment (△Cp value = Cp _{nucleic acid fragment-} Cp _ACTB ). The threshold line of nucleic acid fragment is: △Cp Value=5.4. When the test result △Cp value<5.4, it can be judged as positive, if the test result △Cp value≥5.4, it can be judged as negative.

PCDHGA12, HOXD8: The threshold line of PCDHGA12 is Cp value = 25.9, and the threshold line of HOXD8 is Cp value = 27.4. When the detection result of each marker is greater than or equal to the corresponding threshold line, it can be judged as negative; if the detection result of the marker is less than The corresponding threshold line can be judged as positive.

According to this standard, the ROC curve of nucleic acid fragments detected in all tissue samples is shown in Figure 1. The statistical results of the detection of each gene in the tissue are shown in Table 3.

Table 3 Test results in the organization

It can be seen from the above results that in the tissue samples, the specificity of the nucleic acid fragments for each analysis group is as high as 100%, and when the specificity is 100%, the sensitivity of the normal group and all cancer groups is 73.1. %; Comparing the normal group and the adenocarcinoma group, the sensitivity reached 78.9%. It shows that the nucleic acid fragment still has high sensitivity under the condition of zero false positive. However, other genetic markers still have the problem of false positives in the detection of tissue samples.

As a noninvasive test sample, sputum is more important in the diagnosis of lung cancer. For this reason, the inventors detected nucleic acid fragments in sputum.

Example 2: Detection in sputum samples

Sample information: A total of 107 sputum samples were tested, including 51 normal control samples, 56 cancer control samples, and 56 cancer group samples including 20 squamous cell carcinomas, 8 small cell carcinomas, and 20 adenocarcinomas. 1 case was cell carcinoma, 1 case was giant cell carcinoma, and 6 cases were unclearly classified lung cancer.

Experimental procedure:

In this example, the primer probe sequence of the nucleic acid fragment, the primer probe sequence of β-actin, and the DNA modification are the same as those in Example 1.

a. Collect sputum specimens from lung cancer patients and non-lung cancer patients. After dethickening with NaOH, centrifuge to remove the precipitate to separate the cells, wash them twice with PBS, and then use the DNA extraction kit (HiPure) from Magen. FFPE DNA Kit, D3126-03) extract DNA.

b. The liquid dosing system is as follows:

Table 4 Liquid dispensing system

To	Nucleic acid fragment	PCDHGA12	HOXD8	β-actin
Reaction component	Addition amount (μl)	Addition amount (μl)	Addition amount (μl)	Addition amount (μl)
Upstream primer (100μM)	0.125	0.125	0.05	0.125
Downstream primer (100μM)	0.125	0.125	0.125	0.125
Probe (100μM)	0.05	0.05	0.05	0.05

Magnesium ion (25mM)	6	6	6	6
dNTPs (10mM)	1	1	1	1
Taq polymerase (5unit/μl)	0.5	0.5	0.5	0.5
5X buffer	6	6	6	6
Sterilized water	11.2	11.2	11.275	11.2
Template DNA	5	5	5	5
total capacity	30	30	30	30

c. The amplification system is as follows:

Table 5 Amplification system of nucleic acid fragments and β-actin

Table 6 PCDHGA12 and HOXD8 amplification system

d. The test results are as follows:

Nucleic acid fragment: ACTB is used as the internal reference gene, and the methylation level of the specimen is judged according to the Cp value of the target gene, that is, the nucleic acid fragment. The threshold line of the nucleic acid fragment is: Cp value = 36.9. When the test result Cp value is less than 36.9, it can be judged as positive, and if the test result is Cp value ≥ 36.9, it can be judged as negative.

PCDHGA12, HOXD8: The threshold line of PCDHGA12 is Cp value = 23.48, and the threshold line of HOXD8 is Cp value = 26.4. When the detection result of each marker is greater than or equal to the corresponding threshold line, it can be judged as negative; if the detection result of the marker is less than The corresponding threshold line can be judged as positive.

Table 7 Test results in sputum

The ROC curve of nucleic acid fragments detected in sputum samples is shown in Figure 2, and the statistical results are shown in Table 7. From the above results, it can be seen that in sputum samples, the specificity of nucleic acid fragments is as high as 96.1%. The detection rate of lung cancer is 64.3%, and the detection rate of all squamous cell carcinomas can reach 80.0%.

Example 3: Detection in lavage fluid

Sample information: A total of 176 samples of alveolar lavage fluid were tested, including 94 samples from the normal control group, 82 samples from the cancer group, and 20 samples from the cancer group, including 20 cases of squamous cell carcinoma, 40 cases of adenocarcinoma, and 9 cases of small cell carcinoma. , 13 cases of lung cancer type were not clear. The primer probes for each gene detection are as follows:

The detection primers and probes for nucleic acid fragments are:

SEQ ID NO: 1 Primer F: TTCGTCGTTTTCGTTATCATTC

SEQ ID NO: 2 Primer R: TACTAACCGCCTCGCTAC

SEQ ID NO: 3 Probe P: FAM-CGGGTTTTTGCGTCGTTATTCGTC-BQ1

The detection primers and probes for β-actin are:

SEQ ID NO: 11 β-actin primer F: GGAGGTTTAGTAAGTTTTTTGGATT

SEQ ID NO: 12 β-actin primer R: CAATAAAACCTACTCCTCCCTTA

SEQ ID NO: 13 β-actin probe P: Texas Red-TTGTGTGTTGGGTGGTGGTT-BQ2

Experimental procedure:

a. Collect the alveolar lavage fluid specimens of patients diagnosed with lung cancer and non-lung cancer patients, centrifuge to separate the cells, and then use the DNA extraction kit (HiPure FFPE DNA Kit, D3126-03) of Meji Biotech to extract DNA.

b. Use ZYMO Research's DNA Conversion Kit (EZ DNA Methylation Kit, D5002) to modify the DNA with bisulfite.

c. The amplification detection system is as follows:

Table 8 Amplification system

d. The detection system is as follows:

Table 9 Amplification system

e. The test results are as follows:

ACTB is used as an internal reference gene, and the methylation level of the specimen is judged according to the △Cp value (△Cp value=Cp _{nucleic acid fragment-} Cp _ACTB ) of the target gene, that is, the nucleic acid fragment. The threshold line of the nucleic acid fragment is: △Cp value=11.2 . When the test result △Cp value <11.2, it can be judged as positive, if the test result △ Cp value ≥ 11.2, it can be judged as negative. The test results of 176 lavage fluid samples are as follows:

Table 10 Test results

The ROC curve of nucleic acid fragments detected in the lavage fluid sample is shown in Figure 3, the amplification curve is shown in Figure 4, and the statistical results are shown in Table 10. It can be seen from the above results that the sensitivity of nucleic acid fragments in the detection of 97.9% high specificity for all lung cancer groups reaches 69.5%; according to the comparison and analysis of the subtypes of lung cancer, the detection rate of nucleic acid fragments in the squamous cell carcinoma group is 65.0 %. Especially for the detection effect of adenocarcinoma, the detection sensitivity of nucleic acid fragments is as high as 80.0%. This breakthrough is of great significance for the detection of adenocarcinoma. Because adenocarcinoma is generally peripheral, due to the tree-like physiological structure of the bronchi, the alveolar lavage fluid is not easy to contact the deep lung alveoli or cancer tissue.

Example 4 The influence of primer probe on detection effect

Primers and probes also have a great impact on the detection effect of tumor markers. In the process of research, the inventor designed many pairs of primers and their corresponding probes to find a probe that can improve the detection sensitivity and specificity as much as possible. Needle and primers, so that the detection reagent of the present invention can be practically applied to clinical detection. Some primers and probes are shown in Table 11 below, and the detection results are shown in Table 11.

Table 11 Primers and probes

name	Serial number	sequence	effect
F1	SEQ ID NO: 1	TTCGTCGTTTTCGTTATCATTC	Nucleic acid fragment upstream primer
R1	SEQ ID NO: 2	TACTAACCGCCTCGCTAC	Downstream primers for nucleic acid fragments
P1	SEQ ID NO: 3	FAM-CGGGTTTTTGCGTCGTTATTCGTC-BQ1	Nucleic acid fragment detection probe
F2	SEQ ID NO: 5	ATTCGTTCGGGTATTACGTC	Nucleic acid fragment upstream primer
R2	SEQ ID NO: 6	CCAAAATCCCGACAAACCG	Downstream primers for nucleic acid fragments

P2	SEQ ID NO: 7	FAM-CGGTTAGAGGCGAGAGAGTAGTTT-BQ1	Nucleic acid fragment detection probe
F3	SEQ ID NO: 8	CGGGTTTCGGGCGGCGCGC	Nucleic acid fragment upstream primer
R3	SEQ ID NO: 9	CGAACGATAACGAAAACGACG	Downstream primers for nucleic acid fragments
P3	SEQ ID NO: 10	FAM-CGTGTATCGTGTAGCGTTACGCGG-BQ1	Nucleic acid fragment detection probe
A3-TqMF	SEQ ID NO: 11	GGAGGTTTAGTAAGTTTTTTGGATT	β-actin gene upstream primer
A3-TqMR	SEQ ID NO: 12	CAATAAAACCTACTCCTCCCTTA	β-actin gene downstream primer
A3-TqP	SEQ ID NO: 13	FAM-TTGTGTGTTGGGTGGTGGTT-BQ1	β-actin gene detection probe

All the liquid preparation systems are the same, and the liquid preparation systems are the same as Table 4; all the amplification procedures are the same, and the amplification procedures are the same as Table 5.

Different primer probe combinations were tested in 40 sputum samples, including 15 normal control samples and 25 cancer control samples. The primer probe detection results of each group are as follows:

Table 11 Test results in sputum samples (normal group vs. all cancer groups)

Group	Specificity	Sensitivity
F1, R1, P1	93.3%	72.0%
F2, R2, P2	93.3%	44.0%
F3, R3, P3	93.3%	68.0%

The results show that different primer pairs for the same region will have an impact on the detection results. In the case of the same specificity, the primer and probe combination of F1, R1, P1 has higher sensitivity.

Claims (15)

1. The nucleic acid fragment shown in SEQ ID NO: 4 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or 98 % Or at least 99%, or 100% identity sequence, or its complementary sequence in the preparation of lung cancer detection reagents or kits.
2. A primer, characterized in that the primer is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO : The sequence shown in 9 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identity, or at least any one of its complementary sequences;

   Optionally, the primer is selected from SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 5 and SEQ ID NO: 6; and SEQ ID NO: 8 and SEQ ID NO: 9 have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99% or 100% in a sequence of identity At least one pair of primer pairs;

   Optionally, the primer is selected from the primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2.
3. A probe, characterized in that the probe is selected from the group consisting of sequences shown in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 10 having at least 85% or at least 90% or at least 91% Or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or a sequence of 100% identity, or at least any one of its complementary sequences;

   Optionally, the probe is selected from the sequence shown in SEQ ID NO: 3.
4. The use of the primers and/or probes of claim 2 or 3 in the preparation of lung cancer detection reagents or kits.
5. A lung cancer detection reagent, characterized in that the reagent contains at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% of the nucleic acid fragment shown in SEQ ID NO: 4 % Or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identity sequence, or its complementary sequence methylation detection reagent.
6. The application of claim 1 or the lung cancer detection reagent of claim 5, wherein the sequence of the nucleic acid fragment is at least 85% or at least 90% or at least 91% or at least as shown in SEQ ID NO: 20. 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identical sequence, or its complementary sequence.
7. The lung cancer detection reagent according to claim 5 or 6, wherein the methylation detection reagent comprises primers and/or probes for the methylation detection of the nucleic acid fragment shown in SEQ ID NO: 4 ；

   Preferably, the methylation detection reagent includes primers and/or probes for methylation detection of the nucleic acid fragment shown in SEQ ID NO: 20;

   Preferably, the upstream primer in the primer has any one of the nucleotide sequences shown below:

   I. The nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 5 and SEQ ID NO: 8 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94 % Or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or a sequence of 100% identity; and

   II. The complementary sequence of the sequence shown in I;

   Optionally, the downstream primer in the primer has any one of the nucleotide sequences shown below:

   III. The nucleotide sequence shown in SEQ ID NO: 2, SEQ ID NO: 6 and SEQ ID NO: 9 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94 % Or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or a sequence of 100% identity; and

   IV. The complementary sequence of the sequence shown in III;

   Optionally, the primer is selected from SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 5 and SEQ ID NO: 6; and at least one of SEQ ID NO: 8 and SEQ ID NO: 9 Pair of primers

   Optionally, the probe has any one of the nucleotide sequences shown below:

   V. The nucleotide sequence shown in SEQ ID NO: 3, SEQ ID NO: 7 and SEQ ID NO: 10 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94 % Or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or a sequence of 100% identity;

   VI. The complementary sequence of the sequence shown in V;

   Optionally, the probe is selected from the sequence shown in SEQ ID NO: 3.
8. The lung cancer detection reagent according to claim 5, wherein the detection sample of the reagent is selected from alveolar lavage fluid, tissue, pleural fluid, sputum, blood, serum, plasma, urine, prostate fluid, or stool. At least one of

   Optionally, the sample is selected from at least one of alveolar lavage fluid, sputum, and tissue;

   Optionally, the sample is selected from at least one of alveolar lavage fluid or sputum.
9. A kit comprising the primer of claim 2, or the probe of claim 3, or the lung cancer detection reagent of any one of claims 4-7;

   Optionally, the kit includes: a first container, which contains a primer pair for amplification; and a second container, which contains a probe.
10. The primer according to claim 2, or the probe according to claim 3, or the application of the reagent according to claim 5 in preparing a reagent or kit for methylation detection, or preparing a reagent or reagent for detecting lung cancer Application in the box.
11. The primer of claim 2, or the probe of claim 3, or the reagent of claim 5, or the kit of claim 9, for use in methylation detection, or in detection Application in lung cancer.
12. The application or lung cancer detection reagent or kit according to any one of claims 1, 5, 9, wherein the lung cancer is selected from the group consisting of small cell lung cancer and non-small cell lung cancer;

    Optionally, the non-small cell lung cancer is selected from squamous cell carcinoma and adenocarcinoma.
13. A lung cancer detection system, characterized in that the system contains:

    a. The nucleic acid fragment shown in SEQ ID NO: 4 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% Or a sequence of 98% or at least 99%, or 100% identity, or a methylation detection component of its complementary sequence, and,

    b. Results judgment system;

    Optionally, the system includes:

    c. The nucleic acid fragment as shown in SEQ ID NO: 20 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% Or 98% or at least 99%, or 100% identical sequence, or its complementary sequence methylation detection component, and,

    d. Results judgment system;

    Optionally, the methylation detection component contains the detection reagent according to any one of claims 4-7 or the kit according to claim 9;

    Optionally, the result judgment component is used to detect the nucleic acid fragment as shown in SEQ ID NO: 4 having at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or At least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identical sequence, or the methylation result of its complementary sequence, export the risk of lung cancer and/or Type of lung cancer;

    Optionally, the result judgment component is used to detect the nucleic acid fragment as shown in SEQ ID NO: 20 having at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or At least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identical sequence, or its complementary sequence methylation result, export the risk of lung cancer and/or lung cancer type;

    Optionally, the risk of disease is based on the result of comparing the methylation results of the test sample and the normal sample. When the methylation of the test sample and the normal sample is significantly different or extremely significant, the result is judged to be The test sample has a high risk of illness.
14. A method for diagnosing lung cancer, the method includes the following steps:

    (1) Combine the test sample derived from the subject with the primer according to claim 2, or the probe according to claim 3, or the reagent according to claim 5, or the kit according to claim 9 Contact to detect the methylation level of nucleic acid fragments of the sample to be tested;

    (2) Compare the methylation level of nucleic acid fragments of the sample to be tested and the normal control sample;

    (3) Diagnose lung cancer based on the deviation of the methylation level of the test sample and the normal control sample.
15. A method for treating lung cancer, the method includes the following steps:

    (1) Combine the test sample derived from the subject with the primer according to claim 2, or the probe according to claim 3, or the reagent according to claim 5, or the kit according to claim 9 Contact to detect the methylation level of nucleic acid fragments of the sample to be tested;

    (2) Compare the methylation level of nucleic acid fragments of the sample to be tested and the normal control sample; and

    (3) Diagnose lung cancer based on the deviation of the methylation level of the test sample and the normal control sample;

    (4) Administer anti-lung cancer drugs to subjects diagnosed with lung cancer;

    Optionally, methylation-specific quantitative PCR is used to detect the methylation level of genes;

    Optionally, the sample to be tested is selected from at least one of alveolar lavage fluid, tissue, pleural fluid, sputum, blood, serum, plasma, urine, prostate fluid or feces;

    Optionally, the sample is selected from at least one of alveolar lavage fluid, sputum, and tissue;

    Optionally, the sample is selected from at least one of alveolar lavage fluid or sputum;

    Optionally, the lung cancer is selected from small cell lung cancer and non-small cell lung cancer;

    Preferably, the non-small cell lung cancer is selected from squamous cell carcinoma and adenocarcinoma.

Images