TWI815044B - Lung cancer detection reagent and kit - Google Patents

Abstract

The invention belongs to the field of gene detection, and particularly relates to a lung cancer detection reagent and a kit. The reagent or kit includes a detection reagent for the methylation of a specific nucleic acid fragment and is used to detect the modified sequence of the specific nucleic acid fragment. The reagent of the present invention has been proven by experiments to be able to detect and diagnose lung cancer with high sensitivity and specificity, and has extremely high clinical application value.

Description

Lung cancer detection reagents and kits

The invention belongs to the field of gene detection, and more specifically, the invention relates to a lung cancer detection reagent and a kit.

Lung cancer is a malignant tumor of the lungs originating from bronchial mucosa, glands or alveolar epithelium. According to the pathological type, it can be divided into: 1) small cell lung cancer (SCLC): a special pathological type of lung cancer with obvious tendency of distant metastasis and poor prognosis, but most patients are sensitive to radiotherapy and chemotherapy; 2) Non-small cell lung cancer (NSCLC): Other pathological types of lung cancer other than small cell lung cancer, including squamous cell carcinoma, adenocarcinoma, large cell carcinoma, etc. There are certain differences in biological behavior and clinical course. According to the location of occurrence, it can be divided into: 1) central lung cancer (central lung cancer): lung cancer that grows at and above the opening of the segmental bronchus; 2) peripheral lung cancer (peripheral lung cancer): lung cancer that grows beyond the opening of the segmental bronchus .

In recent years, the impact of factors such as population aging, air pollution, and smoking has caused the incidence and mortality of lung cancer in China to increase year by year. According to the "2017 China Cancer Registration Annual Report" released by the National Cancer Center, about 7 people are diagnosed every minute nationwide. Suffering from cancer, lung cancer ranks first in terms of morbidity and mortality. China has become the country with the largest number of lung cancer patients in the world, and experts predict that the number of lung cancer patients in China will reach 1 million by 2025. According to epidemiological studies, smoking is an important factor causing lung cancer. About 80%-90% of lung cancer cases in the world can be attributed to smoking. Compared with non-smokers, the relative risks of lung cancer for people aged 45-64 who smoke 1-19 cigarettes a day and more than 20 cigarettes a day are 4.27 and 8.61 respectively. Compared with never-smokers, the relative risks of long-term smokers 1-19 cigarettes a day are The relative risks of dying from lung cancer for those with 10 or more blood vessels and 20 or more were respectively 6.14 and 10.73. Although the treatment technology for lung cancer is changing rapidly, the 5-year survival rate has only increased from 4% to about 12%. Existing anti-tumor drugs can still only alleviate the disease, and the progression-free survival period of patients is only extended by 3 to 5 months on average. months, but for patients with stage I lung cancer, the 5-year survival rate after surgery is as high as about 60% to 70%. Therefore, early diagnosis and early surgery of lung cancer are one of the most effective ways to improve the 5-year survival rate and reduce mortality of lung cancer.

The current clinical auxiliary diagnosis of lung cancer mainly includes the following types, but none of them can fully achieve early detection and diagnosis:

(1) Blood biochemical test: For primary lung cancer, there is currently no specific blood biochemical test. In patients with lung cancer, elevated blood alkaline phosphatase or blood calcium may indicate bone metastasis, and elevated blood alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase, or bilirubin may indicate liver metastasis.

(2) Tumor marker examination: 1) CEA: 30% to 70% of lung cancer patients have abnormally high levels of CEA in the serum, but it is mainly seen in patients with more advanced lung cancer. At present, the detection of CEA in serum is mainly used to estimate the prognosis of lung cancer and monitor the treatment process. 2) NSE: It is the preferred marker for small cell lung cancer and is used for the diagnosis and monitoring of treatment response of small cell lung cancer. The reference values vary depending on the detection method and reagents used. 3) CYFRA21-1: It is the preferred marker for non-small cell lung cancer. The sensitivity for the diagnosis of lung squamous cell carcinoma can reach 60%. The reference value varies depending on the detection method and reagents used.

(3) Imaging examination: 1) Chest X-ray examination: should include anteroposterior and lateral chest radiographs. In primary hospitals, anteroposterior and lateral chest radiographs are still the most basic and preferred imaging diagnostic method for the initial diagnosis of lung cancer. Once lung cancer is diagnosed or suspected, chest CT examination is performed. 2) CT examination: Chest CT is the most commonly used and important examination method for lung cancer. It is used for the diagnosis, differential diagnosis, staging and post-treatment follow-up of lung cancer. CT-guided lung puncture biopsy is an important diagnostic technology for lung cancer. Hospitals with qualified conditions can use it to diagnose intrapulmonary lesions that are difficult to characterize, and clinical diagnosis of lung cancer requires cytological and histological confirmation that are difficult to obtain by other methods. cases. In recent years, multi-slice spiral CT and low-dose CT (LDCT) have become effective screening tools for detecting early lung cancer and reducing mortality. The National Lung Cancer Screening Study (NLST) has shown that LDCT can reduce the cost of lung cancer by 20% compared with chest X-ray screening. Lung cancer mortality. Low-dose spiral CT is recommended as an important method for early lung cancer screening, but there are many human factors and the false positive rate is very high. 3) Ultrasound examination: It is mainly used to detect metastasis of important abdominal organs and abdominal and retroperitoneal lymph nodes. It is also used to examine cervical lymph nodes. For intrapulmonary lesions or chest wall lesions adjacent to the chest wall, the cystic and solid properties can be identified and ultrasound-guided puncture biopsy can be performed; ultrasound is also often used to extract and locate pleural effusion. 4) Bone scan: It has high sensitivity for detecting bone metastasis of lung cancer, but it has a certain false positive rate. It can be used in the following situations: preoperative examination of lung cancer; patients with local symptoms.

(4) Other examinations: 1) Sputum cytology examination: Currently, it is a simple and convenient non-invasive diagnostic method for lung cancer. Serial smear examination can increase the positive rate by about 60%. It is a routine diagnostic method for suspected lung cancer cases. 2) Fiberoptic bronchoscopy: one of the most important methods in the diagnosis of lung cancer, it plays an important role in the qualitative localization diagnosis of lung cancer and the selection of surgical plans. It is a necessary routine examination item for patients who are scheduled to undergo surgical treatment. Although transbronchial needle biopsy (TBNA) is helpful for staging before treatment, due to technical difficulty and high risks, those who need it should be transferred to a higher-level hospital for further examination. 3) Others: such as percutaneous lung biopsy, thoracoscopic biopsy, mediastinoscopic biopsy, pleural fluid cytology, etc., if there are indications, they can be used according to the existing conditions to assist diagnosis.

Multi-slice spiral CT and low-dose CT (LDCT) in imaging examinations are effective screening tools for detecting early lung cancer and reducing mortality. The National Lung Cancer Screening Study (NLST) has shown that LDCT can reduce the risk of lung cancer compared with chest X-ray screening. 20% lung cancer mortality rate. It has been proven in clinical practice that the success or failure of any lung cancer screening program depends on the identification of high-risk groups. The risk prediction model integrating multiple high-risk factors has been recognized worldwide as one of the methods for identifying high-risk groups for lung cancer. Risk models can further improve outcomes for lung cancer patients by assisting clinicians in improving interventions or treatments. Although the world has recognized that screening for high-risk groups can reduce the current high mortality rate from lung cancer, defining high-risk groups is still a difficult problem to solve. In order to maximize the benefit-harm ratio of lung cancer screening, the key issue is firstly how to define high-risk groups; secondly, what method to use to screen this group, including the definition of high-risk factors, overall risk Quantitative summary and selection of screening benefit margins.

With the rapid development of technology, tumor marker detection has become a new field of tumor diagnosis and treatment after imaging diagnosis and pathological diagnosis, which can have a significant impact on the diagnosis, detection, and treatment of tumors. Tumor markers can be detected in body fluids or tissues and can reflect the presence of tumors, degree of differentiation, prognosis estimation, personalized medication and treatment effects, etc. Patients with early-stage lung cancer have no obvious symptoms and are difficult to detect by doctors and patients. In addition, there are no obvious specific markers in blood or biochemical items, so it is difficult to detect and diagnose lung cancer early through conventional diagnostic methods. Early diagnosis, especially large-scale population screening, is difficult.

An increasing number of studies have shown that there are two major types of mechanisms involved in tumor formation. One is the formation of mutations through changes in the DNA nucleotide sequence, which is a genetic mechanism. Tumor as a genetic disease has been confirmed in the field of molecular biology. The other is the epigenetics mechanism, which causes changes in gene expression levels independent of DNA sequence changes. Its role in tumor formation has received increasing attention. Genetics and epigenetics are two mechanisms that intersect with each other and jointly promote the formation of tumors. Abnormal methylation of genes can appear in the early stages of tumorigenesis, and during the gradual development of tumors, the degree of abnormal methylation of genes increases. An analysis of the genomes of 98 common human primary tumors found that each tumor had at least 600 aberrantly methylated CpG islands.

Many studies have shown that abnormal promoter methylation is a frequent early event in the development of many tumors. Therefore, the methylation status of tumor-related genes is an early and sensitive indicator of tumorigenesis and is considered a promising tumor. Molecular biomarkers. More importantly, cancerous cells can release DNA into the peripheral blood. Nanogram-level cell-free DNA exists in the peripheral blood of normal people. Studies have found that abnormal methylation of the promoters of tumor-related genes present in tumor tissues can also be detected in peripheral blood plasma/serum and body fluids related to tumor-involved organs (such as saliva, sputum, etc.). These biological samples are relatively easy to obtain, and the DNA in them can be detected very sensitively after a large amount of amplification using PCR technology. Therefore, detecting the methylation status of the promoter regions of some tumor-related genes can provide early diagnosis of tumors. Diagnosis provides very valuable information. Compared with other types of tumor molecular markers, detecting abnormal promoter methylation has more advantages. In different types of tumors, the abnormally methylated region of the promoter of a certain gene is the same, so detection is more convenient; in addition, compared with markers such as allelic deletion, abnormal methylation is a positive signal and can easily be compared with Negative background differentiation in normal tissue. Esteller et al. examined the abnormal methylation status of the promoter regions of p16, DAPK, GSTP1 and MGM T genes in the tumor tissues and serum of 22 cases of non-small cell lung cancer (NSCLC) and found that 68% (15/22) of the tumor tissues There was promoter methylation of at least one gene in the cases; and among the 15 tissue-positive cases, 11 cases also had abnormal promoter methylation detected in the serum. Many other researchers have also detected promoter methylation of certain tumor-related genes in tumor tissues and serum of patients with liver cancer, head and neck cancer, esophageal cancer, and colon cancer.

Existing lung cancer detection technologies mainly have low sensitivity, high false positives, and are invasive. Moreover, current conventional detection technologies are difficult to detect early lung cancer.

Non-invasive testing for lung cancer, such as sputum testing, is even more difficult. Although some researchers have studied tumor markers in the sputum of lung cancer patients, however, compared with the detection and evaluation of tumor markers in blood samples from other cancer patients, the success rate of sputum samples is very low. This is mainly due to the following reasons: ① The composition of sputum is relatively complex, and the composition and viscosity of sputum vary greatly between different groups of people under different diseases or environments; ② Sputum contains more tracheal epithelial cells and bacteria, and oral cavity For components of non-lung cancer cells such as mucosal cells, general sample processing methods cannot effectively enrich a sufficient amount of lung cancer-derived DNA; ③ Many smoking patients do not show expectoration. A J Hubers et al.'s study of the past 10 literatures in "Molecular sputum analysis for the diagnosis of lung cancer" showed that the median methylation degree of markers in lung cancer tissue was 48%, while the median methylation degree of sputum The degree of methylation was 38%, and the results showed that the detection rate of methylation markers in tissues was significantly higher than that in sputum. At the same time, Rosalia Cirincione (Methylation profile in tumor and sputum samples of lung cancer patients detected by spiral computed tomography: A nested case–contro) reported that the detection rates of RARbeta2, P16, and RASSF1A in lung cancer tissues reached 65.5%, 41.4%, and 51.7, respectively. %, but only 44.4%, 5%, and 5% respectively in sputum.

On the one hand, the present invention provides the use of the nucleic acid fragment (hereinafter referred to as "nucleic acid fragment") as shown in SEQ ID NO: 4 in the preparation of lung cancer detection reagents or kits. The "application" includes the application of any part of the nucleic acid fragment shown in SEQ ID NO: 4, that is, any part of the nucleic acid fragment shown in SEQ ID NO: 4 (for example, a smaller fragment ) in preparing lung cancer detection reagents or kits, all fall within the protection scope of the present invention.

In some embodiments, the invention provides a nucleic acid fragment having at least 85%, or at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95% Or the use of a sequence with at least 96%, or at least 97%, or 98%, or at least 99%, or 100% identity, or its complementary sequence in the preparation of lung cancer detection reagents or kits.

On the one hand, the present invention also provides a primer, the primer is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, respectively. The sequence shown in SEQ ID NO: 9 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99 %, or 100% identity, or at least any one of its complementary sequences.

In some embodiments, the primer is selected from the group consisting of SEQ ID NO.: 1 and SEQ ID NO: 2; SEQ ID NO: 5 and SEQ ID NO: 6; and SEQ ID NO: 8 and SEQ ID NO: 9 The sequence has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identity at least one primer pair in the sequence.

In some embodiments, the primer is selected from the primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2.

On the one hand, the present invention also provides a probe, the probe is selected from the group consisting of at least 85% or at least 90% or A sequence that is at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or 98%, or at least 99%, or 100% identical, or at least one of its complements Any one.

In some embodiments, the probe is selected from the sequence set forth in SEQ ID NO: 3.

On the one hand, the present invention also provides the use of the above-mentioned primers and/or probes in preparing lung cancer detection reagents or kits.

"Detection" in the present invention is the same as diagnosis. In addition to early diagnosis of lung cancer, it also includes diagnosis of mid- and late-stage lung cancer, and also includes lung cancer screening, risk assessment, prognosis, disease identification, diagnosis of disease stages and selection of therapeutic targets.

The application of the nucleic acid fragment of the present invention makes early diagnosis of lung cancer possible. When a nucleic acid fragment that is methylated in a cancer cell is determined to be methylated in a clinically or morphologically normal-appearing cell, this indicates that the normal-appearing cell is developing cancer. In this way, lung cancer can be diagnosed at an early stage by methylation of lung cancer-specific nucleic acid fragments in normal-appearing cells.

Among them, early diagnosis refers to the possibility of detecting cancer before metastasis, optionally before morphological changes in tissues or cells can be observed.

In addition to early diagnosis of lung cancer, the reagent/kit of the present invention is also expected to be used for lung cancer screening, risk assessment, prognostic diagnosis, disease identification, diagnosis of disease stages and selection of therapeutic targets.

As an alternative embodiment of disease stage, the progression of lung cancer through different stages or periods can be diagnosed by measuring the degree of methylation of the nucleic acid fragments obtained from a sample. By comparing the degree of methylation of the nucleic acid fragments isolated from samples at each stage of lung cancer with the methylation of the nucleic acid fragments in one or more nucleic acids isolated from samples without cell proliferative abnormalities. degree, the specific stage of lung cancer in a sample can be detected.

On the other hand, the present invention provides a lung cancer detection reagent, which contains at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least the nucleic acid fragment shown in SEQ ID NO: 4. A methylation detection reagent for a sequence that is 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identical, or its complementary sequence.

"Methylation detection reagents for nucleic acid fragments" include the following: reagents for detecting the nucleic acid fragment sequence or any smaller/shorter sequence in the nucleic acid fragment. That is to say, any detection and detection reagents for any position in the nucleic acid fragment (for example, a smaller fragment) fall within the protection scope of the present invention.

The methylation detection reagent may be a methylation detection reagent in the prior art. In the existing technology, there are many methods to detect the methylation of target nucleic acids, such as methylation-specific PCR (MSP), methylation-specific quantitative PCR (qMSP), and PCR of methylated DNA-specific binding proteins. Quantitative PCR and DNA chips, methylation-sensitive restriction enzymes, bisulfite sequencing or pyrosequencing, etc. In addition, other methylation detection methods can be introduced through patent US62007687. Each detection method has its corresponding reagents, and these reagents can be used to detect methylation of nucleic acid fragments in the present invention.

In some specific embodiments of the invention, primers and/or probes detect methylation of nucleic acid fragments by quantitative Methylation-Specific PCR (qMSP).

In some embodiments, the sequence of the nucleic acid fragment is at least 85%, or at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96% identical to SEQ ID NO: 20. % or at least 97% or 98% or at least 99%, or 100% identity to the sequence, or its complementary sequence.

Methylation occurs when cytosine has an extra methyl group. After being treated with bisulfite, bisulfite, or hydrazine salt, cytosine will become uracil, because uracil and uracil are combined during PCR amplification. Thymine is similar and will be recognized as thymine. It is reflected in the PCR amplification sequence that unmethylated cytosine becomes thymine (C becomes T), while methylated cytosine (C) does not. change. The technology for PCR detection of methylated genes is usually MSP. Primers are designed for the processed methylated fragments (ie, the unchanged C in the fragments) and PCR amplification is performed. If there is amplification, it means that methylation has occurred. If there is no amplification, it means that methylation has occurred. Amplification is not methylated.

In some embodiments, the methylation detection reagent detects the sequence of the nucleic acid fragment modified by bisulfite, bisulfite, or hydrazine salt.

In some embodiments, the bisulfite-modified sequence of the nucleic acid fragment is detected.

In some embodiments, the methylation detection reagent includes primers and/or probes for methylation detection of the nucleic acid fragment shown in SEQ ID NO: 4.

In some embodiments, the upstream one of the primers has any one of the nucleotide sequences shown below:

1. Having the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:5 and SEQ ID NO:8 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94 % or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% sequence identity; and

II. The complementary sequence of the sequence shown in I.

In some embodiments, the downstream one of the primers has any one of the nucleotide sequences shown below:

III. Having the nucleotide sequence shown in SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:9 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94 % or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% sequence identity; and

IV. The complementary sequence of the sequence shown in III.

Currently, the missed detection rate of lung cancer is relatively high. Especially for adenocarcinoma, non-invasive detection of sputum is even more difficult, and the detection rate is extremely low. This is because most adenocarcinomas originate from smaller bronchi and are peripheral lung cancers. Exfoliated cells in the deep lungs are more difficult to cough up through sputum. Therefore, the current sputum detection methods for adenocarcinoma are almost zero.

Reducing the missed detection rate is particularly important in early cancer screening. If an early cancer screening product cannot screen out all or most of the patients, then those who are missed will not be able to receive adequate risk warnings, thus delaying treatment opportunities, which is a huge problem for patients. loss.

Although some lung cancer-related tumor markers have been discovered in the prior art, the sensitivity and specificity of these tumor markers cannot meet the demand due to limitations in the detection reagents or detection methods for these tumor markers. Therefore, there are still many problems in this field. Further research is needed on screening tools that can be realistically applied to lung cancer. However, although non-invasive screening has unique advantages in sampling, it also has some limitations in other aspects. For example, adenocarcinoma in lung cancer is difficult to cough up through sputum because of the exfoliated cells in the deep lungs. , generally speaking, those skilled in the art would consider that this type of lung cancer is not suitable for non-invasive screening. On the other hand, even for other types of lung cancer, currently reported non-invasive screening methods are difficult to meet the requirements for clinical use. Although relevant research has been progressing for many years, there is still no non-invasive screening method for lung cancer that can be promoted into clinical practice.

The primer is used to amplify the nucleic acid fragment. It is well known in the art that the successful design of primers is crucial for PCR. Compared with general PCR, in methylation detection, the influence of primer design is more critical. This is because the methyl sulfide reaction promotes the conversion of "C" in the DNA chain into "U", resulting in a reduction in GC content, which makes the PCR reaction The presence of long continuous "T"s in the sequence can easily cause DNA chain breaks, making it difficult to select a primer with a suitable Tm value and stability; on the other hand, in order to distinguish vulcanized DNA from non-vulcanized and incompletely treated DNA , the primer needs to have a sufficient number of "C"s, which increases the difficulty of selecting stable primers. Therefore, in DNA methylation detection, the choice of the amplified fragment targeted by the primer, such as the length and position of the amplified fragment, as well as the choice of primer, etc., all have an impact on the sensitivity and specificity of the detection. The inventor also found through experiments that different amplification target fragments and primer pairs have different detection effects. Many times, it is discovered that certain genes or nucleic acid fragments are differentially expressed in tumors and non-tumors. However, there is still a long way to go before converting them into tumor markers and applying them to clinical applications. The main reason is that due to the limitations of detection reagents, the detection sensitivity and specificity of the potential tumor markers cannot meet the detection needs, or the detection methods are complex and costly, making it difficult to apply them in large-scale clinical applications.

In some embodiments, the probe has any one of the nucleotide sequences shown below:

V. Having the nucleotide sequence shown in SEQ ID NO: 3, SEQ ID NO: 7 and SEQ ID NO: 10 has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94 % or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or a sequence that is 100% identical;

VI, the complementary sequence of the sequence shown in V.

In some embodiments, the reagent contains a detection reagent including an internal reference gene.

In some embodiments, the internal reference gene is β-actin.

In some embodiments, the detection reagents for the internal reference gene are primers and probes for the internal reference gene.

In some embodiments, the detection reagent for the internal reference gene is the primer pair shown in SEQ ID NO: 11 and SEQ ID NO: 12 and the probe shown in SEQ ID NO: 13.

In some embodiments, the reagent further includes at least one of bisulfite, bisulfite or hydrazine salt to modify the nucleic acid fragment, although it may not be included.

In some embodiments, the reagent contains one or more of DNA polymerase, dNTPs, Mg2+ ions, and buffer, preferably a PCR reaction system including DNA polymerase, dNTPs, Mg2+ ions, and buffer, for Amplification of modified nucleic acid fragments.

The sample detected by the detection/diagnostic reagent of the present invention can be selected from at least one of alveolar lavage fluid, tissue, pleural effusion, sputum, blood, serum, plasma, urine, prostatic fluid or feces.

In some embodiments, the sample is selected from at least one of bronchoalveolar lavage fluid, tissue, and sputum.

In some embodiments, the sample is selected from at least one of bronchoalveolar lavage fluid or sputum.

In one aspect, the present invention also provides a kit containing the above-mentioned primer, probe, or lung cancer detection reagent.

In some embodiments, the kit includes a first container containing a primer pair for amplification and a second container containing a probe.

In some embodiments, the kit further includes instructions.

In some embodiments, the kit further includes nucleic acid extraction reagents.

In some embodiments, the kit further includes a sampling device.

In some embodiments, the present invention also provides the application of the primer, or the probe, or the reagent in preparing reagents or kits for methylation detection, or preparing reagents or kits for detecting lung cancer. Application in reagents or kits.

In some embodiments, the present invention also provides the application of the primer, or the probe, or the reagent, or the kit in methylation detection, or in the detection of lung cancer. application.

The tissue targeted by the detection reagent of the present invention is selected from lung cancer tissue and adjacent normal tissue (or benign lung disease tissue).

In some embodiments, the lung cancer is selected from small cell lung cancer and non-small cell lung cancer.

In some embodiments, the non-small cell lung cancer is selected from squamous cell carcinoma and adenocarcinoma.

On the one hand, the present invention also provides a method for detecting methylation of the nucleic acid fragment, which is characterized by comprising the following steps:

(1) Treat the sample to be tested with bisulfite, bisulfite or hydrazine salt to obtain a modified sample to be tested;

(2) Use the above-mentioned reagent or kit to detect the methylation status of the nucleic acid fragment on the modified test sample in step (1);

As a preferred embodiment, in step (2), real-time fluorescence quantitative methylation-specific polymerase chain reaction is used for detection.

On the other hand, the present invention also provides a lung cancer detection system. The system described contains:

a. Be at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% with the nucleic acid fragment shown in SEQ ID NO: 4 or a sequence that is 98%, or at least 99%, or 100% identical, or its complement, a methylation detection component, and,

b. Result judgment system.

In some embodiments, the system contains:

c. Be at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% with the nucleic acid fragment shown in SEQ ID NO: 20 or a sequence that is 98%, or at least 99%, or 100% identical, or its complement, a methylation detection component, and,

d. Result judgment system;

In some embodiments, the methylation detection component contains the above-mentioned detection reagent or kit.

In some embodiments, the result judgment component is used to have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% of the nucleic acid fragment as shown in SEQ ID NO: 4 according to the detection system. % or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identical sequence, or the methylation result of its complementary sequence, output the risk of lung cancer and /or type of lung cancer.

In some embodiments, the result judgment component is used to have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% of the nucleic acid fragment as shown in SEQ ID NO: 20 according to the detection system. % or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identical sequence, or the methylation result of its complementary sequence, output the risk of lung cancer and /or type of lung cancer.

In some embodiments, the disease risk is determined by comparing the methylation results of the test sample and the normal sample. When the methylation of the test sample and the normal sample has a significant or extremely significant difference, The results indicate that the sample to be tested has a high risk of disease.

In some embodiments, if the nucleic acid fragment is methylated positive, it indicates that the provider of the sample to be tested is a high-risk lung cancer patient or a lung cancer patient. As a preferred embodiment, the positive refers to comparing the obtained test results with the test results of normal samples. When the amplification results of the sample to be tested and the normal sample have a significant or extremely significant difference, the test result is The sample was positive for the donor.

In some embodiments, the judgment criteria of the judgment system include: judging lung cancer specimens and normal specimens based on cutoff values.

In some embodiments, the methylation level of the specimen is determined based on the Cp value and/or ΔCp value of the target gene, that is, the nucleic acid fragment (ΔCp value = Cp target gene-Cp internal reference gene).

In some embodiments, the cutoff value of the Cp value in the specimen ranges from about 35 to 39, and the cutoff value of the ΔCp value ranges from about 4 to 12.

In some embodiments, the cutoff value for ΔCp values in tissue specimens is about 5.4, the cutoff value for ΔCp values in sputum specimens is about 36.9, and the cutoff value for ΔCp values in lavage fluid specimens is about 11.2.

In some embodiments, if the ΔCp value of the tissue and lavage fluid specimen is less than the cutoff value of the ΔCp value, the specimen is determined to be a lung cancer specimen, and the ΔCp value of the tissue and lavage fluid specimen is greater than or equal to the cutoff value of the ΔCp value. value is judged as a normal specimen. If the Cp value of the sputum specimen is less than the cut-off value of the Cp value, it is determined to be a lung cancer specimen. If the Cp value of the sputum specimen is greater than or equal to the cut-off value of the Cp value, it is determined to be a normal specimen.

The invention also provides a method for diagnosing lung cancer, which method includes the following steps:

(1) The test sample derived from the subject has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% similarity with the nucleic acid fragment shown in SEQ ID NO: 4. % or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or 100% identical sequence, or its complementary sequence, or having at least 85% identity with the nucleic acid fragment shown in SEQ ID NO: 20 % or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or 98% or at least 99%, or a sequence that is 100% identical, or the methylation level of its complementary sequence;

(2) Compare the methylation levels of the nucleic acid fragments described in step (1) between the test sample and the normal control sample;

(3) Diagnose lung cancer based on the deviation of methylation levels between the test sample and the normal control sample.

In some embodiments, a method for diagnosing lung cancer is also provided, the method comprising the following steps:

(1) Contact the sample to be tested derived from the subject with the primer, or the probe, or the reagent, or the kit, and detect the methylation of the nucleic acid fragment of the sample to be tested level;

(2) Compare the methylation levels of nucleic acid fragments between the test sample and the normal control sample;

(3) Diagnose lung cancer based on the deviation of methylation levels between the test sample and the normal control sample.

On the one hand, the present invention also provides a method for treating lung cancer, which method includes the following steps:

(1) Contact the sample to be tested derived from the subject with the primer, or the probe, or the reagent, or the kit, and detect the methylation of the nucleic acid fragment of the sample to be tested level;

(2) Compare the methylation levels of gene nucleic acid fragments between the test sample and the normal control sample; and

(3) Diagnose lung cancer based on the deviation of methylation levels between the test sample and the normal control sample;

(4) Administer anti-lung cancer drugs to subjects diagnosed with lung cancer;

In some embodiments, methylation-specific quantitative PCR is used to detect the methylation level of a gene.

In some embodiments, the present invention provides a method for treating lung cancer, the method comprising the following steps: detecting a nucleic acid fragment as shown in SEQ ID NO: 4 in a test sample derived from a subject that has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical nucleotides The methylation level of the sequence, or its complementary sequence; the detection includes comparing the subject's test sample with the nucleic acid fragment shown in SEQ ID NO: 4, which has at least 85%, or at least 90%, or at least 91% or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical to a nucleotide sequence, or its complement The methylation level detection reagent is contacted; the test sample and the normal control sample have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% of the nucleic acid fragment shown in SEQ ID NO: 4 Or a comparison of methylation levels of nucleotide sequences that are at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical, or their complementary sequences; and based on the methylation level to be determined The test sample and the normal control sample have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% with the nucleic acid fragment shown in SEQ ID NO: 4 Or a deviation in the methylation level of a nucleotide sequence that is at least 97%, or at least 98%, or at least 99%, or 100% identical, or its complementary sequence, to diagnose lung cancer; if the subject is diagnosed as a lung cancer patient, then The subjects were given drug treatment for lung cancer.

In some embodiments, the present invention provides a method for treating lung cancer, the method comprising the following steps: detecting that the nucleic acid fragment shown in SEQ ID NO: 20 in a test sample derived from a subject has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical nucleotides The methylation level of the sequence, or its complementary sequence; the detection includes comparing the test sample of the subject with the nucleic acid fragment shown in SEQ ID NO: 20, which has at least 85%, or at least 90%, or at least 91% or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical to a nucleotide sequence, or its complement The methylation level detection reagent is contacted; the test sample and the normal control sample have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% of the nucleic acid fragment shown in SEQ ID NO: 4 Or a comparison of methylation levels of nucleotide sequences that are at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical, or their complementary sequences; and based on the methylation level to be determined The test sample and the normal control sample have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% with the nucleic acid fragment shown in SEQ ID NO: 4 Or a deviation in the methylation level of a nucleotide sequence that is at least 97%, or at least 98%, or at least 99%, or 100% identical, or its complementary sequence, to diagnose lung cancer; if the subject is diagnosed as a lung cancer patient, then The subject was given drug treatment for lung cancer.

The diagnostic method of the present invention can be used before or after treatment of lung cancer or in combination with treatment of lung cancer. It can be used after treatment such as to evaluate the success of treatment or to monitor the remission, recurrence and/or progression (including metastasis) of lung cancer after treatment.

Another aspect of the present invention provides a method for treating lung cancer, which method includes administering surgery, chemotherapy, radiotherapy, chemoradiotherapy, immunotherapy, oncolytic virus therapy, or other methods in the field to patients diagnosed with lung cancer through the above diagnostic method. Any other types of lung cancer treatments used and combinations of these treatments.

Although, in the existing technology, it has been reported that the methylation of some gene markers can be used as one of the tumor markers of lung cancer. However, there are countless reports on tumor markers for lung cancer. However, there are very few markers that can be used clinically as markers for lung cancer detection. The detection reagent for specific nucleic acid fragments of the present invention has high sensitivity and specificity for lung cancer, and is very promising as a tumor marker for clinical diagnosis of lung cancer.

In some embodiments, based on the nucleic acid fragments and detection reagents of the present invention, lung cancer can be detected in tissue specimens with a specificity of 100% and a sensitivity of 73.1%. Among them, squamous cell carcinoma can all be detected. In adenocarcinoma, which is the most difficult to detect, the specificity reached 100.0% and the sensitivity reached 78.9%.

In addition, the nucleic acid fragment of the present invention has high specificity and sensitivity for different types of lung cancer, including squamous cell carcinoma and adenocarcinoma among small cell lung cancer and non-small cell lung cancer. It has a wide range of application and can basically be used as a treatment for all lung cancers. tumor markers. Existing lung cancer markers used clinically are generally only applicable to the detection of one type of lung cancer. For example, NSE is used to diagnose and monitor treatment response of small cell lung cancer, and CYFRA21-1 is the preferred marker for non-small cell lung cancer.

The detection reagents and methods for specific nucleic acid fragments provided by the present invention can very conveniently and accurately determine patients with lung cancer and benign lung diseases. The gene detection method is expected to be converted into a gene detection kit and serve for the screening of lung cancer. Clinical testing and prognostic monitoring.

The technical solutions of the present invention will be further described below through specific examples, which do not limit the scope of protection of the present invention. Some non-essential modifications and adjustments made by others based on the concept of the present invention still belong to the protection scope of the present invention.

"Primer" or "probe" in the present invention refers to an oligonucleotide that includes a region complementary to the sequence of at least 6 consecutive nucleotides of a target molecule (eg, a target nucleic acid fragment). In some embodiments, at least a portion of the sequence of the primer or probe is not complementary to the amplified sequence. In some embodiments, the primer or probe comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 A region of sequence complementarity of contiguous nucleotides. When a primer or probe includes a region that is "complementary to at least x contiguous nucleotides of the target molecule," the primer or probe is at least 95% identical to at least x contiguous or non-contiguous chunked nucleotides of the target molecule. complementary. In some embodiments, the primer or probe is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, 96%, at least 97%, at least 98%, at least 99%, or 100% complementary.

As used herein, a "normal" sample refers to a sample of the same type isolated from an individual known to be free of the cancer or tumor in question.

In the present invention, samples for methylation detection include but are not limited to DNA, or RNA, or DNA and RNA samples containing mRNA, or DNA-RNA hybrids. The DNA or RNA can be single-stranded or double-stranded.

In the present invention, the "subject" is a mammal, such as a human.

In the present invention, "methylation level" is the same as "methylation degree" and can usually be expressed as the percentage of methylated cytosine, which is the number of methylated cytosine divided by the number of unmethylated cytosine The sum of the number of methylated cytosines; and the currently commonly used method of dividing the number of methylation target genes by the number of internal reference genes to express methylation levels; and other methods of expressing methylation levels in the existing technology.

In the present invention, "sample" is the same as "specimen".

As used herein, the term "and/or" refers to and encompasses any and all possible combinations of one or more of the associated listed items. When used in a list of two or more items, the term "and/or" means that any one of the listed items may be used alone or any combination of two or more of the listed items may be used. For example, if a composition, combination, construction, etc. is described as comprising (or containing) the components A, B, C and/or D, then the composition may comprise A alone; B alone; C alone; D alone ; A combination containing A and B; A combination containing A and C; A combination containing A and D; A combination containing B and C; A combination containing B and D; A combination containing C and D; A, B and C Combination; contains A, B and D combination; contains A, C and D combination; contains B, C and D combination; or A, B, C and D combination.

Example 1:

The inventors screened hundreds of gene markers and nucleic acid fragments to study the distribution of methylation sites in each gene, and designed primer probes for detection for real-time fluorescent quantitative methylation-specific polymerase chain reaction (real-time). fluorescent quantitative methylation-specific PCR, qMSP) detection. The tissue samples were screened, and the β-actin gene was used as the internal reference gene. Finally, after screening, the nucleic acid fragment shown in SEQ ID NO: 4 was obtained, which has better detection results for lung cancer. Compare the detection effects of the SEQ ID NO: 4 fragment with commonly used lung cancer detection gene markers (PCDHGA12, HOXD8). The primer probes for each gene detection are as follows:

The detection primers and probes for nucleic acid fragments are: SEQ ID NO: 1 Introduction F: TTCGTCGTTTTCGTTATCATTC SEQ ID NO: 2 Primer R: TACTAACCGCCTCGCTAC SEQ ID NO: 3 Probe P: FAM-CGGGTTTTTTGCGTCGTTATTCGTC-BQ1

The detection primers and probes of PCDHGA12 are: SEQ ID NO: 14 PCDHGA12 Introduction F: TTGGTTTTTACGGTTTTCGAC SEQ ID NO: 15 PCDHGA12 Introduction R: AAATTTCCCCGAAACGCTCG SEQ ID NO: 16 PCDHGA12 Probe P: FAM-ATTCGGTGCGTATAGGTATCGCGC-BQ1

The detection primers and probes of HOXD8 are: SEQ ID NO: 17 HOXD8 Introduction F: TTAGTTTCGGCGCGTAGC SEQ ID NO: 18 HOXD8 Introduction R: CCTAAAACCGACGCGATCTA SEQ ID NO: 19 HOXD8 Probe P: FAM-AAAACTTACGATCGTCTACCCTCCG-BQ1

The detection primers and probes for β-actin are: SEQ ID NO: 11 β-actin primer F: GGAGGTTTAGTAAGTTTTTTGGATT SEQ ID NO: 12 β-actin primer R: CAATAAAAACCTACTCCTCCCTTA SEQ ID NO: 13 β-actin probe P: FAM-TTGTGTGTTGGGTGGTGGTT-BQ1

Experimental process:

1 )extract DNA

Samples from patients with confirmed lung cancer and non-lung cancer patients were collected, including paraffin tissue samples, sputum samples, and lavage fluid samples respectively. After the sample was pretreated and cells were separated, DNA was extracted according to the instructions of the HiPure FFPE DNA Kit (D3126-03) of HiPure Biotech.

2 ) DNA Modify

Bisulfite modification was performed according to the instructions of the ZYMO RESEARCH Biotechnology Kit EZ DNA MethylationTM KIT (D5002).

3 ) Amplification and detection [Table 1] Liquid preparation system Nucleic acid fragments PCDHGA12 HOXD8 β-actin reaction components Adding amount (μl) Adding amount (μl) Adding amount (μl) Adding amount (μl) Upstream primer (100 μM) 0.125 0.125 0.05 0.125 Downstream primer (100 μM) 0.125 0.125 0.125 0.125 Probe (100 μM) 0.05 0.05 0.05 0.05 Magnesium ions (25 mM) 6 6 6 6 dNTPs(10mM) 1 1 1 1 Taq polymerase (5 unit/μl) 0.5 0.5 0.5 0.5 5X buffer 6 6 6 6 Sterilized water 11.2 11.2 11.275 11.2 Template DNA 5 5 5 5 total volume 30 30 30 30

Amplification system: See Table 2 for the amplification system. [Table 2] Amplification system for nucleic acid fragments and β-actin steps temperature and time number of loops Predenaturation 95ºC 5 minutes 1 amplify 95℃ 15 seconds 48 58ºC 30 seconds 72℃ 30 seconds cooling 40℃ 30 seconds 1 Amplification system of PCDHGA12 and HOXD8 steps temperature and time number of loops Predenaturation 95ºC 5 minutes 1 Amplification 1 95℃ 20 seconds 10 60ºC 30 seconds 70℃ 30 seconds Amplification 2 95℃ 20 seconds 45 55℃ 60 seconds 72℃ 30 seconds cooling 40℃ 30 seconds 1

4 ) Test results

Sample information: A total of 169 lung tissue samples were collected, including 91 normal tissue samples and 78 cancer tissue samples. Among the 78 cancer group samples, there were 27 squamous cell carcinomas, 38 adenocarcinomas, 3 small cell carcinomas, and 4 large cell carcinomas. There were 1 case of compound cancer and 5 cases of unclassified lung cancer, including 77 pairs of cancer and paracancerous control samples.

Calculation method:

Nucleic acid fragments: Using ACTB as the internal reference gene, the methylation level of the specimen is judged based on the ΔCp value of the targeted gene, that is, the nucleic acid fragment (ΔCp value = Cp _{nucleic acid fragment} - Cp _ACTB ). The threshold line for nucleic acid fragments is: ΔCp value = 5.4 . When the test result ΔCp value is <5.4, it can be judged as positive. If the test result ΔCp value is ≥5.4, it can be judged as negative.

PCDHGA12, HOXD8: The threshold line of PCDHGA12 is Cp value = 25.9, and the threshold line of HOXD8 is Cp value = 27.4. When the detection result of each marker is greater than or equal to the corresponding threshold line, it can be judged as negative; if the detection result of the marker is less than the corresponding The threshold line can be judged as positive.

According to this standard, the ROC curve of nucleic acid fragments detected in all tissue specimens is shown in Figure 1. The statistical results of each gene detected in tissues are shown in Table 3. [Table 3] Test results in tissues analysis group indicator Nucleic acid fragments PCDHGA12 HOXD8 Comparison between normal group and all cancer groups specificity 100% 97.8% 97.8% Sensitivity 73.1% 50.0% 53.8% Comparison between normal group and squamous cell carcinoma group specificity 100% 97.8% 97.8% Sensitivity 74.1% 44.4% 81.5% Comparison between normal group and adenocarcinoma group specificity 100% 97.8% 97.8% Sensitivity 78.9% 50.0% 50% Comparison between normal group and small cell carcinoma group specificity 100% 97.8% 97.8% Sensitivity 0% 66.7% 33.3% Comparison between normal group and large cell carcinoma group specificity 100% 97.8% 97.8% Sensitivity 50.0% 50.0% 0%

It can be seen from the above results that in tissue samples, the specificity of the nucleic acid fragment for each analysis group is as high as 100%, and when the specificity is 100%, compared with the normal group and all cancer groups, the sensitivity is 73.1 %; compared with the normal group and adenocarcinoma group, the sensitivity reached 78.9%. It shows that the nucleic acid fragment still has high sensitivity in the case of zero false positives. Other genetic markers still suffer from false positives when testing tissue samples.

As a non-invasive detection sample, sputum is more important in the diagnosis of lung cancer. For this reason, the inventor detected nucleic acid fragments in sputum.

Example 2 : Detection in sputum samples

Sample information: A total of 107 sputum samples were tested, including 51 normal control samples, 56 cancer group control samples, and 56 cancer group samples, including 20 squamous cell carcinomas, 8 small cell carcinomas, 20 adenocarcinomas, and large squamous cell carcinomas. There was 1 case of cell carcinoma, 1 case of giant cell carcinoma, and 6 cases of unclassified lung cancer.

Test process:

In this example, the primer probe sequence of the nucleic acid fragment, the primer probe sequence of β-actin, and the DNA modification are the same as those in Example 1.

a. Collect sputum samples from patients diagnosed with lung cancer and non-lung cancer patients, use NaOH to thaw it, centrifuge the precipitate to separate the cells, wash it twice with PBS, and then use Magen’s DNA extraction kit (HiPure FFPE DNA Kit, D3126-03) to extract DNA.

b. The liquid preparation system is as follows: [Table 4] Liquid preparation system Nucleic acid fragments PCDHGA12 HOXD8 β-actin reaction components Adding amount (μl) Adding amount (μl) Adding amount (μl) Adding amount (μl) Upstream primer (100 μM) 0.125 0.125 0.05 0.125 Downstream primer (100 μM) 0.125 0.125 0.125 0.125 Probe (100 μM) 0.05 0.05 0.05 0.05 Magnesium ions (25 mM) 6 6 6 6 dNTPs(10mM) 1 1 1 1 Taq polymerase (5 unit/μl) 0.5 0.5 0.5 0.5 5X buffer 6 6 6 6 Sterilized water 11.2 11.2 11.275 11.2 Template DNA 5 5 5 5 total volume 30 30 30 30

c. The amplification system is as follows: [Table 5] Amplification system of nucleic acid fragments and β-actin steps temperature and time number of loops Predenaturation 95ºC 5 minutes 1 amplify 95℃ 15 seconds 48 58ºC 30 seconds 72℃ 30 seconds cooling 40℃ 30 seconds 1 [Table 6] Amplification system of PCDHGA12 and HOXD8 steps temperature and time number of loops Predenaturation 95ºC 5 minutes 1 Amplification 1 95℃ 20 seconds 10 60ºC 30 seconds 70℃ 30 seconds Amplification 2 95℃ 20 seconds 45 55℃ 60 seconds 72℃ 30 seconds cooling 40℃ 30 seconds 1

d. The test results are as follows:

Nucleic acid fragments: ACTB is used as the internal reference gene, and the methylation level of the specimen is judged based on the Cp value of the target gene, that is, the nucleic acid fragment. The threshold line of the nucleic acid fragment is: Cp value = 36.9. When the Cp value of the test result is <36.9, it can be judged as positive. If the Cp value of the test result is ≥36.9, it can be judged as negative.

PCDHGA12, HOXD8: The threshold line of PCDHGA12 is Cp value = 23.48, and the threshold line of HOXD8 is Cp value = 26.4. When the detection result of each marker is greater than or equal to the corresponding threshold line, it can be judged as negative; if the detection result of the marker is less than the corresponding The threshold line can be judged as positive. [Table 7] Test results in sputum analysis group indicator Nucleic acid fragments PCDHGA12 HOXD8 Comparison between normal group and all cancer groups specificity 96.1% 96.1% 96.1% Sensitivity 64.3% 16.1% 23.2% Comparison between normal group and all squamous cell carcinoma groups specificity 96.1% 96.1% 96.1% Sensitivity 80.0% 25.0% 50.0% Comparison between normal group and all adenocarcinoma groups specificity 96.1% 96.1% 96.1% Sensitivity 50.0% 10.0% 5.0% Comparison between normal group and all small cell carcinoma groups specificity 96.1% 96.1% 96.1% Sensitivity 50.0% 12.5% 12.5%

The ROC curve of nucleic acid fragments detected in sputum samples is shown in Figure 2, and the statistical results are shown in Table 7. From the above results, it can be seen that in sputum samples, with a specificity as high as 96.1%, the nucleic acid fragments are effective for all The detection rate of lung cancer is 64.3%, and the detection rate of all squamous cell carcinomas can reach 80.0%.

Example 3 : Detection in lavage fluid

Sample information: A total of 176 alveolar lavage fluid samples were tested, including 94 normal control samples, 82 cancer group control samples, and 82 cancer group samples, including 20 squamous cell carcinomas, 40 adenocarcinomas, and 9 small cell carcinomas. , 13 cases of unspecified lung cancer type. The primers and probes for each gene detection are as follows:

The detection primers and probes for nucleic acid fragments are: SEQ ID NO: 1 Introduction F: TTCGTCGTTTTCGTTATCATTC SEQ ID NO: 2 Introduction R: TACTAACCGCCTCGCTAC SEQ ID NO: 3 Probe P: FAM-CGGGTTTTTTGCGTCGTTATTCGTC-BQ1

The detection primers and probes for β-actin are: SEQ ID NO: 11 β-actin primer F: GGAGGTTTAGTAAGTTTTTTGGATT SEQ ID NO: 12 β-actin primer R: CAATAAAAACCTACTCCTCCCTTA SEQ ID NO: 13 β-actin Probe P: Texas Red- TTGTGTGTTGGGTGGTGGTT-BQ2

Test process:

a. Collect bronchoalveolar lavage fluid samples from patients diagnosed with lung cancer and non-lung cancer patients, centrifuge to separate the cells, and then use HiPure FFPE DNA Kit (D3126-03) to extract DNA.

b. Use the DNA transformation kit (EZ DNA Methylation Kit, D5002) from ZYMO RESEARCH Biotechnology Company to perform bisulfite modification of DNA.

c. The amplification detection system is as follows: [Table 8] Amplification system reaction components Adding amount (μl) F1 (100 μM) 0.125 R1 (100 μM) 0.125 P1 (100 μM) 0.05 β-actin-F1 (100 μM) 0.125 β-actin-R1 (100 μM) 0.125 β-actin-P2 (100 μM) 0.05 Magnesium ions (25 mM) 6 dNTPs(10mM) 1 Taq polymerase (5 unit/μl) 0.5 5X buffer 6 Sterilized water 10.9 Template DNA 5 total volume 30

d. The detection system is as follows: [Table 9] Amplification system steps temperature and time number of loops Predenaturation 95ºC 5 minutes 1 amplify 95℃ 15 seconds 48 58ºC 30 seconds 72℃ 30 seconds cooling 40℃ 30 seconds 1

e. The test results are as follows:

Using ACTB as the internal reference gene, the methylation level of the specimen is judged based on the ΔCp value of the targeted gene, that is, the nucleic acid fragment (ΔCp value = Cp _{nucleic acid fragment} - Cp _ACTB ). The threshold line for the nucleic acid fragment is: ΔCp value = 11.2. When the test result ΔCp value is <11.2, it can be judged as positive. If the test result ΔCp value is ≥11.2, it can be judged as negative. The test results of 176 lavage fluid samples are as follows: [Table 10] Test results analysis group indicator Nucleic acid fragments Comparison between normal group and all cancer groups specificity 97.9% Sensitivity 69.5% Comparison between normal group and all squamous cell carcinoma groups specificity 97.9% Sensitivity 65.0% Comparison between normal group and all adenocarcinoma groups specificity 97.9% Sensitivity 80.0% Comparison between normal group and all small cell carcinoma groups specificity 97.9% Sensitivity 44.4%

The ROC curve of nucleic acid fragments detected in lavage fluid samples is shown in Figure 3, the amplification curve is shown in Figure 4, and the statistical results are shown in Table 10. It can be seen from the above results that the nucleic acid fragments were detected with a high specificity of 97.9%, and the sensitivity of the entire lung cancer group reached 69.5%; a comparative analysis according to the subtypes of lung cancer, the detection rate of nucleic acid fragments in the squamous cell carcinoma group was 65.0 %. Especially for the detection of adenocarcinoma, the detection sensitivity of nucleic acid fragments is as high as 80.0%. This breakthrough is of great significance for the detection of adenocarcinoma. Because adenocarcinoma is generally of the peripheral type, and due to the tree-like physiological structure of the bronchi, alveolar lavage fluid cannot easily contact the alveoli or cancer tissue deep in the lungs.

Example 4 The impact of primer probes on detection results

Primers and probes also have a great impact on the detection effect of tumor markers. During the research process, the inventors designed multiple pairs of primers and their corresponding probes to find probes and probes that improve detection sensitivity and specificity as much as possible. Introduction, so that the detection reagent of the present invention can be practically applied to clinical detection. Some primers and probes are shown in Table 11 below, and the detection results are shown in Table 11. [Table 11] Primers and probes Name Serial number sequence effect F1 SEQ ID NO: 1 TTCGTCGTTTTCGTTATCATTC Nucleic acid fragment upstream primer R1 SEQ ID NO: 2 TACTAACCGCCTCGCTAC Nucleic acid fragment downstream primer P1 SEQ ID NO: 3 FAM-CGGGTTTTTGCGTCGTTATTCGTC-BQ1 Nucleic acid fragment detection probe F2 SEQ ID NO: 5 ATTCGTTCGGGTATTACGTC Nucleic acid fragment upstream primer R2 SEQ ID NO: 6 CCAAAATCCCGACAAACCG Nucleic acid fragment downstream primer P2 SEQ ID NO: 7 FAM-CGGTTAGAGGCGAGAGAGTAGTTT-BQ1 Nucleic acid fragment detection probe F3 SEQ ID NO: 8 CG GGTTT CG GG CG G CGCG C Nucleic acid fragment upstream primer R3 SEQ ID NO: 9 CG AA CG ATAA CG AAAA CG A CG Nucleic acid fragment downstream primer P3 SEQ ID NO: 10 FAM- CG TGTAT CG TGTAG CG TTA CGCG G-BQ1 Nucleic acid fragment detection probe A3-TqMF SEQ ID NO: 11 GGAGGTTTAGTAAGTTTTTTGGATT β-actin gene upstream primer A3-TqMR SEQ ID NO: 12 CAATAAAAACCTACTCCTCCCTTA β-actin gene downstream primer A3-TqP SEQ ID NO: 13 FAM-TTGTGTGTTGGGTGGTGGTT-BQ1 β-actin gene detection probe

The liquid preparation systems are the same, and the liquid preparation systems are the same as Table 4; the amplification procedures are all the same, and the amplification procedures are the same as Table 5.

Different primer probe combinations were tested on 40 sputum samples, including 15 normal control samples and 25 cancer control samples. The primer probe detection results of each group are as follows: [Table 11] Detection in sputum samples Results (normal group vs. all cancer groups) Group specificity sensitivity F1, R1, P1 93.3% 72.0% F2, R2, P2 93.3% 44.0% F3, R3, P3 93.3% 68.0%

The results show that different primer pairs targeting the same region will have an impact on the detection results. In the case of consistent specificity, the primer and probe combinations of F1, R1, and P1 have higher sensitivity.

without.

Figure 1 is an ROC curve for detection of nucleic acid fragments in tissue specimens in Example 1; Figure 2 is an ROC curve for detection of nucleic acid fragments in sputum samples in Example 2; Figure 3 is the ROC curve detected in the nucleic acid fragment lavage fluid sample in Example 3; Figure 4 is an amplification curve of the nucleic acid fragment in Example 3.

Claims (12)

Application of a methylation detection reagent with the nucleic acid fragment shown in SEQ ID NO: 4 in preparing a non-small cell lung cancer detection reagent or kit, the methylation detection reagent contains a primer pair selected from SEQ The primer pair shown in ID NO: 1 and SEQ ID NO: 2; the methylation detection reagent contains sputum DNA extraction reagent and/or alveolar lavage fluid DNA extraction reagent; the non-small cell lung cancer is selected from squamous cell carcinoma or Adenocarcinoma. For the application described in claim 1, the methylation detection reagent further contains a probe, and the probe is selected from the sequence shown in SEQ ID NO: 3 or its complementary sequence. A non-small cell lung cancer detection reagent, containing a methylation detection reagent with the nucleic acid fragment shown in SEQ ID NO: 4, the methylation detection reagent contains a primer pair, the primer pair is selected from SEQ ID NO: 1 and SEQ The primer pair shown in ID NO: 2; the methylation detection reagent contains sputum DNA extraction reagent and/or alveolar lavage fluid DNA extraction reagent; the non-small cell lung cancer is selected from squamous cell carcinoma or adenocarcinoma. The lung cancer detection reagent according to claim 3, wherein the methylation detection reagent also includes a probe for methylation detection of the nucleic acid fragment shown in SEQ ID NO: 4; the probe has a core as shown below Any one of the nucleotide sequences: has the nucleotide sequence shown in SEQ ID NO: 3; or its complementary sequence. A kit containing the non-small cell lung cancer detection reagent described in any one of claims 3-4. The kit according to claim 5, wherein the kit includes: a first container containing a primer pair for amplification; and a second container containing a probe. The application of a non-small cell lung cancer detection reagent as described in any one of claims 3-4 in preparing a reagent or kit for methylation detection, or in preparing a reagent or kit for detecting non-small cell lung cancer. A reagent as described in any one of claims 3 to 4, or a kit as described in claim 5, used in methylation detection, or in the detection of non-small cell lung cancer. A detection system for non-small cell lung cancer, including: a. a methylation detection component with the nucleic acid fragment shown in SEQ ID NO: 4; and b. a result judgment system; the methylation detection component contains request item 3- The detection reagent described in any one of 4 or the kit described in claim 5. As for the non-small cell lung cancer detection system described in claim 9, the result judgment component is used to output the non-small cell lung cancer based on the methylation result detected by the detection system and the nucleic acid fragment shown in SEQ ID NO: 4. Risk and/or type of non-small cell lung cancer. For the non-small cell lung cancer detection system described in claim 10, the risk is based on comparing the methylation results of the sample to be tested and the normal sample. When the methylation of the sample to be tested is significantly different from that of the normal sample, Or when there is a very significant difference, the result is that the sample to be tested has a high risk of disease. A method for diagnosing non-small cell lung cancer, the method comprising the following steps: (1) combining a test sample derived from a subject with the reagent described in any one of claims 3-4, or the reagent described in claim 5 Contact the box to detect the methylation level of the nucleic acid fragment of the sample to be tested; (2) Compare the methylation level of the nucleic acid fragment of the sample to be tested and the normal control sample; (3) Based on the methylation level of the sample to be tested and the normal control sample Deviation from the level is used to diagnose non-small cell lung cancer.