WO2012029914A1

WO2012029914A1 - Method for producing pentacyclic triterpene compound having hydroxymethyl group or carboxyl group at 28-position

Info

Publication number: WO2012029914A1
Application number: PCT/JP2011/069922
Authority: WO
Inventors: 俊哉村中; 光關; エリオデット福島; 直行梅基
Original assignee: キリンホールディングス株式会社
Priority date: 2010-09-01
Filing date: 2011-09-01
Publication date: 2012-03-08
Also published as: JPWO2012029914A1; JP6018915B2

Abstract

A method for enzymatically converting a methyl group at the 28-position of a pentacyclic triterpene compound of, for example, the oleanane- ursane- or lupane-type into a hydroxymethyl group or a carboxyl group, either in a cell-free system or using cells or a plant, in the presence of a protein, which has an enzymatic activity of converting a methyl group at the 28-position of an exogenous pentacyclic triterpene into a hydroxymethyl group or a carboxyl group, or under the expression of DNA encoding said protein; and a method for producing a pentacyclic triterpene compound having a hydroxymethyl group or a carboxyl group at the 28-position with the use of the aforesaid method.

Description

Method for producing pentacyclic triterpene compound wherein position 28 is a hydroxymethyl group or a carboxyl group

The present invention relates to a method for producing a pentacyclic triterpene compound in which the 28-position is a hydroxymethyl group or a carboxyl group, an enzyme that can be used in the method, and a DNA encoding the enzyme.

The present invention also relates to a cell and a transgenic plant for producing the above compound.

Triterpene is a natural product formed of six isoprene units, and more than 100 skeletons have been reported in nature (Non-patent Document 1). The most common triterpenes found in plants are oleanane type (β-amylin, taraxerol, germanicol, oleanolic acid, etc.), followed by ursan type (α-amylin, ursolic acid, etc.), lupine type (lupeol, betulinic acid, etc.), etc. There is a pentacyclic triterpene. Triterpenes are known to have physiologically active substances that exhibit anticancer and anti-inflammatory effects, and have become an important chemical structure pool for new drugs (Non-patent Document 2). It has been reported that oleanolic acid and ursonic acid, which are representative of pentacyclic triterpene compounds having a carboxyl group at the 28-position, also have physiological activity (Non-patent Documents 3 and 4). As patent documents, for pentacyclic triterpenes having a carboxyl group at the 28-position, an external skin preparation for aging (Patent Document 1), glutathione production promoting action (Patent Document 2), for improving or preventing fatigued eyes Orally administered composition (patent document 3), hyaluronidase inhibitor (patent document 4), prevention and improvement of metabolic syndrome (patent document 5), endothelin receptor antagonist (patent document 6), TGF-β inhibitor (patent document) 7), an anti-pruritic agent (Patent Document 8) and the like have been reported. Thus, while the importance of pentacyclic triterpene compounds having a carboxyl group at position 28, such as oleanolic acid, has attracted attention, such compounds are produced only in plants, and natural products (plant roots and peels). ) Is simply extracted from and used. For example, according to the information on the oleanolic acid supplier website, MP Biomedicals (USA) is ginseng (Panax ginseng), Changsha Nutramax is olive (Orea europaea), Gentianaceae (Sertia milensis plant) major), Aralia chinensis, and Cucurbitaceae (Hemsleya), all of which are said to be extracts from plants. The extraction method is reported in US Patent (Patent Document 9) and European Patent (Patent Document 10). Also, conversion by organic synthesis from β-amylin or the like is extremely difficult and has not been established as an industry, and a method for efficiently synthesizing a pentacyclic triterpene compound having a carboxyl group at the 28-position such as oleanolic acid is required. It was.

However, synthesizing enzymes for pentacyclic triterpene compounds having a carboxyl group at the 28-position, that is, enzymes capable of converting the methyl group at the 28-position of pentacyclic triterpenes such as oleanane type, ursan type or lupine type to the carboxyl group so far It was completely unknown. In addition, there was no report suggesting that the enzyme reaction was very specific and related to oleanane type, ulsan type or lupine type enzymes. In related research, an enzyme that produces β-amylin, which is a substrate for oleanolic acid synthase, and a gene for the enzyme have been identified (Non-patent Document 5). An enzyme that hydroxylates position 24 of oleanane-type triterpene, a biosynthetic enzyme of soyasapogenol B, and a gene of the enzyme (Non-patent Document 6), an enzyme that oxidizes position 11 of oleanane-type triterpene, a biosynthetic enzyme of glycyrrhizin, and An enzyme gene (Non-patent Document 7) has been identified. However, olives, beets, chixetninjin, etc., which are said to accumulate a large amount of oleanolic acid or its derivatives, have not undergone molecular biological analysis, nor have biochemical studies on the accumulation of oleanolic acid. There was no clue to analyze. Candidate genes could not be extracted even in the analysis using grapes, whose molecular biological analysis has progressed somewhat.

The present inventors have been interested in the general oxidation of secondary metabolites of Medicago truncatula and have proceeded with the analysis. Sites where oxidation reaction can occur in the oleanane type triterpene skeleton are the 11th, 16th, 23 / 24th, 28th and 30th positions. Furthermore, depending on the oxidation of the methyl group, a formyl group (—CHO) or a hydroxymethyl group ( In some cases, the oxidation proceeds to CH ₂ OH) and further to a carboxyl group (Non-patent Document 8). In the case of oxidation at the 23 / 24-position, 28-position and 30-position, it was unclear whether the conversion to the hydroxymethyl group and the subsequent conversion to the carboxyl group were one step or two steps. Furthermore, there are three possible possibilities for enzymes involved in secondary metabolism oxidation: cytochrome P450 type monooxygenase, dioxygenase, and NADPH-flavin reductase. Among them, P450 type genes are 246 types in Arabidopsis whose genome sequence has already been clarified, and 356 types in rice, and are the largest enzyme family occupying 1% of plant genome genes. Shares essential pathways not only for secondary metabolism of plants but also for biosynthesis and metabolism of plant hormones and lipids. Activity is not only hydroxylation but also epoxidation, O-demethylation, N-demethylation, sulfoxidation Although some recent studies have revealed that NO synthesis reactions are performed, the functions of most P450s remain unclear (Non-Patent Documents 9 and 10). Most of the P450 genes have been discovered only by analyzing the genome sequence with a computer, and the physiological function is often unknown (Non-patent Document 10, p. 84).

Non-Patent Document 11 reports changes in saponin content after several treatments on cultured cells of Taruma palm. In Table 1 of this document, by treatment with methyl jasmonate, hederagenin (a pentacyclic triterpene compound, which is further hydroxylated at position 23), Soyasapogenol E (a non-pentacyclic triterpene compound, positions 2 and 24) The position is hydroxylated and the 22nd position is oxidized), bayogenin (a pentacyclic triterpene compound, and the 2nd and 23rd positions are hydroxylated), medicagenic acid (pentacyclic triterpene) Compound, which is further hydroxylated at the 2-position and carboxylated at the 24-position), zanhaic acid (a pentacyclic triterpene compound, further hydroxylated at the 2-position and the 16-position, and 24 And soyasapogenol E (a non-pentacyclic triterpene compound, hydroxylated at

positions

2, 22, and 24). It has reported. However, methyl jasmonate is a hormone closely related to defense responses, and other secondary metabolites and changes in callus shape are also expected. In Non-Patent Document 12, it was reported that 184 P450s induced by these methyl jasmonates and 37 regions of the genome undecoding region were traced as probes, and about 10% of them were induced by methyl jasmonate. Furthermore, as an induction example of 10%, Mtr. 868.1. The S1 (CYP93E2) gene, CYP72 family Medtr4g032760, Medtr4g032910, Mtr. 37299.1. S1_at, Mtr. 37298.1. Four genes of S1, Mtr. 43018.1. S1 (CYP716A12) genes have been found from exhaustive analysis, but their functions are unknown. In addition, in this document, some of the 184 and 37 probe data listed in the Supplemental Data Set 4 online are not specified, but some of the biosynthesis of secondary metabolites that were altered by treatment of cultured cells. Although it is concluded that it is a candidate gene related to saponin, the relationship with saponin synthesis and pentacyclic triterpene synthesis in which position 28 is a carboxyl group such as oleanolic acid has not been clarified.

JP 2010-138154 A JP 2010-105937 A JP 2008-007417 A JP 2006-124322 A Japanese Patent Laying-Open No. 2005-097216 JP 2003-252843 A JP 2000-159793 A Japanese Patent Laid-Open No. 11-012178 US Pat. No. 6700014 European Patent No. 0894517

An object of the present invention is to provide a method for producing a pentacyclic triterpene compound in which position 28 is a hydroxymethyl group or a carboxyl group, such as plant-derived oleanolic acid, and cells and transgenic plants that produce the pentacyclic triterpene compound Is to provide.

The inventors of the present invention have intensively studied to achieve the above object. At that time, although not remarkable, attention was paid to the talum coconut which accumulates triterpene saponin-related compounds, and two kinds of genes (CYP93E2 and CYP716A12) that are expressed cooperatively when expressing the β-amylin gene that synthesizes the triterpene are expressed in I looked up at silico. By expressing the candidate gene in yeast that accumulates β-amylin as a precursor, CYP93E2 was found to be a gene that converts position 24 of oleanane-type triterpene, which is an existing reaction, to a hydroxymethyl group or a carboxyl group. However, another candidate gene CYP716A12 is an unexpected gene that encodes an enzyme having an activity to convert the 28-position of a pentacyclic triterpene to a hydroxymethyl group or a carboxyl group, which has not been found so far. I found this time. By using this gene, it has become possible to efficiently produce pentacyclic triterpenes having a carboxyl group at the 28-position, such as oleanolic acid, which could not be produced by microorganisms until now. Furthermore, a gene having the same function was obtained from a plant accumulating the pentacyclic triterpenes, and this time it was clarified that the enzyme activity in the yeast production system is equivalent or higher. In addition, producing a transgenic plant or microorganism capable of producing a pentacyclic triterpene compound in which the 28th position is a hydroxymethyl group or a carboxyl group, and comparing and analyzing the expression of the original gene to select individuals or tissues It was shown that the accumulation amount of the pentacyclic triterpene compound in which the 28-position is a hydroxymethyl group or a carboxyl group can be modified. Furthermore, surprisingly, CYP716A12 was able to convert the 28-position into a hydroxymethyl group or a carboxyl group not only for the oleanane type but also for the ursan type and lupine type pentacyclic triterpenes. Taruma palm mainly accumulates oleanane type triterpenes, and it is probable that it has an enzyme using oleanane type as a substrate. However, the structure of the E ring portion is greatly different between the oleanane type and the ulsan type or lupine type. This shows that CYP716A12, which has enzyme activity at position 28, does not recognize the difference between the E-ring part adjacent to position 28, which is a result that is significantly different from the previous analysis of the specificity of plant P450. I cannot help saying that. The present invention has been completed based on these findings.

Therefore, the present invention includes the following features.

(1) A protein having an activity of converting a methyl group at position 28 of a pentacyclic triterpene to a hydroxymethyl group or a carboxyl group.

(2) The protein according to (1) above, which is derived from a plant belonging to legumes, eggplants, vines, red crustaceans, oleaceae or red crabaceae.

(3) The protein according to (1) or (2) above, which is derived from talum palm, tomato, Miyakogusa, grape, beet, olive or coffee.

(4) The protein according to (1) above, which is selected from the group consisting of the following (a) to (c).

(A) a protein comprising the amino acid sequence shown in any of SEQ ID NOs: 2 to 8 (b) one or several amino acids are deleted, substituted, inserted or added in the amino acid sequence shown in any of SEQ ID NOs: 2 to 8 (C) a protein comprising an amino acid sequence having 70% or more sequence identity to the amino acid sequence shown in any of SEQ ID NOs: 2 to 8 (5) a pentacyclic triterpene is oleanane type, ursan type or The protein according to any one of (1) to (4) above, which is a lupine-type triterpene.

(6) The protein according to any one of (1) to (5) above, which belongs to cytochrome P450.

(7) Recombinant DNA containing DNA selected from the group consisting of (a) to (f) below.

(A) DNA encoding a protein comprising the amino acid sequence shown in any one of SEQ ID NOs: 2 to 8
(B) including an amino acid sequence in which one or several amino acids are deleted, substituted, inserted or added in the amino acid sequence shown in any of SEQ ID NOs: 2 to 8, and a methyl group at position 28 of the pentacyclic triterpene Which encodes a protein having an activity of converting acetylene into a hydroxymethyl group or a carboxyl group
(C) including an amino acid sequence having 70% or more sequence identity with the amino acid sequence shown in any of SEQ ID NOs: 2 to 8, and the methyl group at position 28 of the pentacyclic triterpene as a hydroxymethyl group or a carboxyl group DNA encoding a protein having an activity to convert
(D) DNA comprising the base sequence shown in any of SEQ ID NOs: 10 to 16
(E) hybridizing under stringent conditions with a DNA having a base sequence complementary to the base sequence shown in any of SEQ ID NOs: 10 to 16, and replacing the methyl group at position 28 of the pentacyclic triterpene with hydroxymethyl DNA encoding a protein having an activity of converting to a group or carboxyl group
(F) a base sequence having 70% or more sequence identity to the base sequence shown in any of SEQ ID NOs: 10 to 16, and the methyl group at position 28 of the pentacyclic triterpene as a hydroxymethyl group or a carboxyl group DNA encoding a protein having an activity to convert
(8) A transformant comprising the recombinant DNA according to (7) above.

(9) The transformant according to (8) above, wherein the transformant is a transformant obtained using a microorganism or a plant as a host.

(10) The transformant according to (9) above, wherein the microorganism is yeast.

(11) The transformant according to any one of (8) to (10) above, which has the ability to produce a pentacyclic triterpene having a hydroxymethyl group or a carboxyl group at position 28 or a derivative thereof.

(12) The transformant according to any of (8) to (11) above is cultured in a medium, the protein according to (4) is produced and accumulated in the culture, and the protein is collected from the culture A method for producing the protein, comprising:

(13) Using the culture of the transformant according to any one of (8) to (11) above or a processed product of the culture as an enzyme source, the enzyme source, and a pentacyclic triterpene as a substrate or its The derivative is present in an aqueous medium, and a pentacyclic triterpene having a hydroxymethyl group or a carboxyl group at position 28 or a derivative thereof is produced and accumulated in the medium, and a hydroxymethyl group or a carboxyl group is located at position 28 from the medium. A method for producing a pentacyclic triterpene or derivative thereof having a methyl group or a carboxyl group at position 28, wherein the pentacyclic triterpene or derivative thereof is collected.

(14) A processed product of the culture is a concentrate of the culture, a dried product of the culture, a cell obtained by centrifuging the culture, a dried product of the cell, a freeze-dried product of the cell, Surfactant treated product of bacterial cells, ultrasonic treated product of the bacterial cells, mechanically ground treated product of the bacterial cells, solvent treated product of the bacterial cells, enzyme treated product of the bacterial cells, protein of the bacterial cells The method according to (13) above, which is a fraction, an immobilized product of the microbial cell, or an enzyme preparation obtained by extraction from the microbial cell.

(15) The pentacyclic triterpene or derivative thereof having the hydroxymethyl group or the carboxyl group at position 28 in the medium, wherein the protein described in (1) and the substrate and the pentacyclic triterpene or derivative thereof are present in an aqueous medium. And collecting a pentacyclic triterpene having a hydroxymethyl group or a carboxyl group at position 28 or a derivative thereof from the medium, and a pentacyclic triterpene having a hydroxymethyl group or a carboxyl group at position 28 or a derivative thereof. Manufacturing method.

(16) The production method according to any one of (13) to (15) above, wherein the pentacyclic triterpene as a substrate is β-amylin, α-amylin, or lupeol.

(17) DNA selected from the group consisting of the following (a) to (f).

(A) DNA encoding a protein comprising the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 8
(B) including an amino acid sequence in which one or several amino acids are deleted, substituted, inserted or added in the amino acid sequence shown in any of SEQ ID NOs: 4 and 6 to 8, and at the 28th position of the pentacyclic triterpene DNA encoding a protein having an activity of converting a methyl group into a hydroxymethyl group or a carboxyl group
(C) an amino acid sequence having 70% or more of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 8, and the methyl group at position 28 of the pentacyclic triterpene being a hydroxymethyl group or a carboxyl DNA encoding a protein having activity of converting to a group
(D) DNA comprising the base sequence shown in any one of SEQ ID NOs: 12 and 14 to 16
(E) It hybridizes under stringent conditions with a DNA having a base sequence complementary to the base sequence shown in any of SEQ ID NOs: 12 and 14 to 16, and has a methyl group at position 28 of a pentacyclic triterpene. DNA encoding a protein having an activity of converting to a hydroxymethyl group or a carboxyl group
(F) a base sequence having 70% or more sequence identity to the base sequence shown in any of SEQ ID NOs: 12 and 14 to 16, and the methyl group at position 28 of the pentacyclic triterpene is a hydroxymethyl group or a carboxyl DNA encoding a protein having activity of converting to a group
A pentacyclic system in which the 28-position is a hydroxymethyl group or a carboxyl group, showing useful physiological activity by a protein having an enzyme activity that converts the methyl group at the 28-position of the pentacyclic triterpene of the present invention into a hydroxyl group or a carboxyl group Triterpene compounds, especially oleanolic acid, ursolic acid, betulinic acid, and substituted derivatives thereof can be produced in large quantities and at low cost. ADVANTAGE OF THE INVENTION According to this invention, the activity expression of the enzyme protein which has the activity which converts the 28th-position methyl group of a pentacyclic triterpene compound into a carboxyl group, and the DNA which codes it can be adjusted, The activity of this gene can be adjusted. Provided are methods for producing enhanced plants and microorganisms, plants with altered production of pentacyclic triterpenes having a hydroxymethyl group or a carboxyl group at position 28, such as oleanolic acid. According to the present invention, it is possible to produce plants characterized by overexpression of the above pentacyclic triterpene compounds, especially oleanolic acid, ursolic acid, betulinic acid, and substituted derivatives thereof.

Structural formulas of erythrodiol in which the 28-position methyl group of β-amylin is converted to a hydroxymethyl group and oleanolic acid in which the 28-position methyl group is converted to a carboxyl group. GC chart of yeast expressing CYP93E2. GC chart of yeast expressing CYP716A12. Mass spectrum (MS) of yeast expressing CYP716A12. GC chart of yeast expressing CYP93E2 and CYP716A12. MS of peak 1 in FIG. GC chart of grape homologous gene expression yeast. Mass spectrum (MS) of grape homologous gene expressing yeast. GC chart of yeast expressing beet homologous genes. Mass spectrum (MS) of beet homologous gene expressing yeast. GC chart of olive homologous gene expression yeast. Mass spectrum (MS) of olive homologous gene expressing yeast. GC chart of yeast expressing coffee homologous genes. Mass spectrum (MS) of coffee homologous gene expressing yeast. The electrophoretic diagram which shows the expression of the oleanolic acid synthase gene in the leaf and pericarp (CTAB) of grape cultivar "Campbell berry A". Structural formulas of betulin in which the methyl group at position 28 of lupeol is converted to a hydroxymethyl group and betulinic acid in which the methyl group at position 28 is further converted to a carboxyl group. GC chart of the expression of C. coconut palm CYP716A12 in yeast expressing lupeol. Mass spectrum (MS) of Taruma palm CYP716A12 expression in yeast expressing lupeol. GC chart of grape homologous gene expression in yeast expressing lupeol. Mass spectrum (MS) of grape homologous gene expression in yeast expressing lupeol. GC chart of beet homologous gene expression in yeast expressing lupeol. Mass spectrum (MS) of beet homologous gene expression in yeast expressing lupeol. GC chart of olive homologous gene expression in yeast expressing lupeol. Mass spectrum (MS) of olive homologous gene expression in yeast expressing lupeol. GC chart of coffee homologous gene expression in yeast expressing lupeol. Mass spectrum (MS) of coffee homologous gene expression in yeast expressing lupeol. Structural formulas of ubaol in which the methyl group at position 28 of α-amylin is converted to a hydroxymethyl group, and ursolic acid in which the methyl group at position 28 is further converted to a carboxyl group. GC chart of the expression of Caryobol CYP716A12 in yeast expressing α-amylin. Mass spectrum (MS) of Taruma palm CYP716A12 expression in yeast expressing α-amylin. GC chart of grape homologous gene expression in yeast expressing α-amylin. Mass spectrum (MS) of grape homologous gene expression in yeast expressing α-amylin. GC chart of beet homologous gene expression in yeast expressing α-amylin. Mass spectrum (MS) of beet homologous gene expression in yeast expressing α-amylin. GC chart of olive homologous gene expression in yeast expressing α-amylin. Mass spectrum (MS) of olive homologous gene expression in yeast expressing α-amylin. GC chart of coffee homologous gene expression in yeast expressing α-amylin. Mass spectrum (MS) of coffee homologous gene expression in yeast expressing α-amylin.

Hereinafter, the present invention will be described in detail.

1. Enzyme protein that converts the 28-position methyl group of a pentacyclic triterpene compound into a hydroxymethyl group or a carboxyl group ("28-position oxidase")
The enzyme protein of the present invention is a protein having an enzyme activity for converting the 28-position methyl group of a pentacyclic triterpene compound into a hydroxymethyl group or a carboxyl group, and is a pentacyclic triterpene compound such as oleanane type, ulsan type or lupine type. Is a protein having the ability to convert the 28-position methyl group into a hydroxymethyl group or a carboxyl group (FIGS. 1, 11 and 13). In this specification, such conversion ability is referred to as “position 28 oxidase activity”, and an enzyme protein having such conversion ability is referred to as “position 28 oxidase”.

Plants containing the above-mentioned enzymes include, for example, leguminous talum palm (Medicago truncatula), solanaceae tomato (Solanum lycopersicum), leguminous cypress (Lotus japonicus), oleaceae (Olea europaea), Plant species such as (Beta vulgaris), Rubiaceae coffee (Coffea Arabica), and Grapeaceae grapes (Vitis spp.) Are included. It has also been revealed for the first time that the enzyme of the present invention is a kind of membrane-bound cytochrome P450 monooxidase.

Other plants containing the above enzymes include plants that naturally produce oleanane-type, ulsan-type, or lupine-type pentacyclic triterpene compounds, such as clove, assembly, gentian, karin, ume, thyme, jujube, beetle, murine, Examples include plants that produce oleanolic acid such as sunflower, oysters, loquat, forsythia, hawthorn, chixen carrot, and sugar beet, and plants that produce betulinic acid such as clove, sweet potato, jujube, oysters, and birch.

The pentacyclic triterpene compound having a hydroxymethyl group or a carboxyl group at position 28 obtained by the enzyme of the present invention includes a triterpene synthesized by a plant or a derivative thereof, such as oleanolic acid (3β-hydroxylene-12-en- 28-oic acid), oleanic acid (3-oxoolan-12-en-28-ic acid) ursolic acid (3β-hydroxyurs-12-en-28-oic acid), betulinic acid (3β-hydroxyrup-20 (29) -En-28-oic acid), salts thereof, derivatives thereof, and the like.

Examples of the salt include alkali metal salts such as sodium salt and potassium salt, ammonium and ammonium salts with organic amines such as aliphatic amines, aromatic amines, saturated amines and unsaturated amines. The carboxylate may be formed during the production of the target triterpene compound by the method of the present invention, or may be salted by neutralization after the production of the compound.

The derivative is a cyclization reaction of the above pentacyclic triterpene compound using, for example, the biosynthetic intermediate 2,3-oxosqualene, such as the 1-position, 2-position, 11-position, 12-position, 29-position, and 30-position. And the hydrogen atom at a position that is considered to have little influence on the oxidase activity at position 28 is another substituent, such as a lower alkyl group (methyl, ethyl, propyl, butyl, etc.), halogen (fluorine, chlorine, bromine, iodine), Hydroxyl group, ester group (acetoxy, propanoyloxy, etc.), acyl group (formyl, acetyl, propionyl, etc.), alkoxy group (methoxy, ethoxy, propoxy, etc.), amino group, mono- or di-lower alkylamino group (methylamino) , Dimethylamino, ethylamino, etc.), amide group, lower alkylamide group (eg, acetamide), oxo group, cyano , A nitro group, a lower alkylthio group (methylthio, ethylthio, etc.), a compound substituted with a functional group such as a sulfonyl group (mesyl, ethylsulfonyl, etc.), (lower) alkyl esterification of the 28-position carboxyl group or (lower) alkyl- Or (lower) dialkyl-amidated compounds. Further, triterpene saponins in which a monosaccharide such as glucose or a plurality of sugars are attached to the hydroxyl group, hydroxymethyl group or carboxyl group of these sites may be used.

Preferred triterpene compounds that serve as substrates for the 28-position hydroxylase of the present invention include β-amylin (olean-12-en-3β-ol), α-amylin (urs-12-en-3β-ol), lupeol (lup- 20 (29) -en-3β-ol) and pentacyclic triterpene compounds such as derivatives thereof. The substitution position and substituent of the substituted derivative are the same as those exemplified above. By the method of the present invention, a pentacyclic triterpene compound in which the methyl group at the 28-position is converted into a hydroxymethyl group or a carboxyl group from the compound serving as a substrate by the action of the 28-position oxidase is obtained.

These substrates are synthesized from 2,3-oxide squalene by the action of β-amylin synthase, β-amylin is synthesized by the action of lupeol synthase, and α-amylin is synthesized by the action of α-amylin synthase. (P.M. Dewick, Medicinal Natural Product, 3rd ed., John Wiley & Sons, 2009). The sequence information and cloning relating to these synthases have already been known by cloning and sequencing from cDNA libraries derived from various plants such as roots and seeds. For β-amylin synthase, see H.C. Hayashi et al. , Biol. Pharma. Bull. 24 (8): 912-916 (2001), T.M. Kushiro et al. , Eur. J. Biochem. 256: 238-244 (1998), U.S. Pat. 7,186,884, WO 2003/095615, EMBL Accession No. AY095999 and AAM23264.1 (Glycine max). For lupeol synthase, see J. et al. B. Herrera et al. , Phytochemistry 49 (7): 1905-1911 (1998), T .; Kushiro et al. , J. Am. Chem. Soc. 122 (29): 6816-6824 (2000), GenBank (NCBI) Accession No. NM_179572 and No. NM_106546 (Arabidopsis thaliana). For α-amylin synthase, see M.C. Morita et al. , Eur. J. Biochem. 267: 3453-3460 (2000). These synthases may be present in plants such as barley, beans, peanuts, sugar beets, wheat, oats, potatoes, garlic, onions, asparagus, tea, rice, rye, soybeans, strawberries, sunflowers, tomatoes, etc. As known (US Patent No. 7,186,884), if necessary, the above-mentioned β-amylin synthase, α-amylin synthase and lupeol synthase can be obtained from these plants using the cloning method described in the above-mentioned literature. It is also possible to obtain a DNA encoding, and introduce the DNA into a microbial cell or plant cell using a known DNA recombination technique, PCR method or the like to express the synthetic enzyme. Transgenic plants regenerated from the transformed cells or plant cells obtained in this way are further incorporated with a DNA encoding the 28-position oxidase so that they can be expressed, whereby oleanolic acid, ursolic acid, betulinic acid, etc. It is possible to produce a pentacyclic triterpene having a carboxylate at position 28.

The 28-position oxidase that can be used in the present invention is not limited to the following, but is derived from, for example, Taruma palm, tomato, Miyakogusa, olive, beet, coffee, and grape, and each includes, for example, SEQ ID NOs: 2 to 8. Includes an enzyme comprising the amino acid sequence shown. Furthermore, the enzyme that can be used in the present invention includes a protein having an amino acid sequence partially having a mutation in the amino acid sequences shown in SEQ ID NOs: 2 to 8 and having oleanolic acid synthase activity.

Among the oleanolic acid synthases containing the specific amino acid sequence described above, an enzyme comprising any one of the amino acid sequences of SEQ ID NOs: 4 and 6-8, and a DNA encoding the enzyme, specifically SEQ ID NOs: 12 and 14 The DNA containing the base sequence shown in any one of ˜16 is novel because the full-length sequence and function have not been known so far.

Here, the “partially mutated amino acid sequence” is one or more, preferably 1 or several, for example 1 to 10, preferably 1 to 7 in the amino acid sequences shown in SEQ ID NOs: 2 to 8. , More preferably 1 to 5, more preferably 1 to 3, more preferably 1 or 2 amino acid sequences deleted, substituted, inserted and / or added, or the amino acid sequence , At least 60%, at least 70%, at least 80%, at least when calculated using known algorithms for homology searches such as BLAST, FASTA (eg, using default or default parameters) 85%, preferably at least 90%, more preferably at least 95%, particularly preferably at least 7%, and is has an amino acid sequence which has 98% or 99% sequence identity. Incidentally, the sequence identity between enzyme proteins containing the amino acid sequences shown in SEQ ID NOs: 2 to 8 is about 70 to about 80%.

As used herein, “sequence identity” means, for example, when two amino acid sequences or base (nucleotide) sequences are aligned (however, gaps may or may not be introduced, but preferably Introducing gaps) refers to the percentage of the number of identical amino acids or bases relative to the total number of amino acids or bases containing the gaps.

The 28th oxidase of the present invention includes a natural 28th oxidase isolated from a plant and a recombinant 28th oxidase produced by a genetic engineering technique.

2. DNA encoding position 28 oxidase
As used herein, the term “DNA” is intended to encompass genomic DNA, genes, cDNA and chemically modified DNA.

The DNA encoding the 28-position oxidase used in the present invention is obtained by oxidizing the methyl group at the 28-position of a specific pentacyclic triterpene compound, particularly an oleanane type, ursan type or lupine type pentacyclic triterpene compound. It is a DNA encoding an enzyme having an activity of converting to a methyl group or a carboxyl group.

The DNA encoding the 28th oxidase includes, for example, base sequences encoding the amino acid sequences shown in SEQ ID NOs: 2 to 8, and specifically, the base sequences shown in SEQ ID NOs: 10 to 16, respectively. Is included.

The DNA encoding the 28-position oxidase that can be used in the present invention is also a DNA that hybridizes under stringent conditions with a DNA having a base sequence complementary to each base sequence shown in SEQ ID NOs: 10 to 16, or When calculated using the nucleotide sequences shown in SEQ ID NOs: 10 to 16 and a known algorithm for homology search such as BLAST, FASTA (eg, using default or default parameters), DNA having sequence identity of 60%, at least 70%, at least 80%, at least 85%, preferably at least 90%, more preferably at least 95%, particularly preferably at least 97%, 98% or 99%, or In the amino acid sequence of the protein encoded by these DNAs 1 or more, preferably 1 or several, for example 1 to 10, preferably 1 to 7, more preferably 1 to 5, more preferably 1 to 3, more preferably 1 or 2 Is a DNA encoding a protein containing an amino acid sequence in which a single amino acid is deleted, substituted, inserted and / or added, but includes a DNA encoding a protein having 28-position oxidase activity.

These DNAs are DNA homologues (analogues), analogs (analogues) or mutants containing the nucleotide sequences shown in SEQ ID NOs: 10 to 16. Such DNA can be used in plants producing oleanolic acid, ursolic acid or betulinic acid, such as clove, assembly, gentian, carin, ume, in addition to talum, tomato, cypress, olive, beet, coffee and grape. Hybridization, PCR amplification from roots, seeds, etc. of plants such as thyme, jujube, cinnamon, mouse mochi, sanshuyu, oyster, loquat, forsythia, hawthorn, chikutsujinjin, sugar beet, clove, taisou, jujube, oyster, birch family Etc. can be obtained.

The term “stringent conditions” used in the present specification is, for example, a condition of “1 × SSC, 0.1% SDS, 37 ° C.”, and more severe (medium stringent) conditions include The conditions are about “0.5 × SSC, 0.1% SDS, 42 ° C.”, and more severe (high stringency) conditions are “0.1 to 0.2 × SSC, 0.1% SDS, The condition is about “65 ° C.”. After the hybridization, for example, an operation of washing at 0.1 × SSC, 0.1% SDS, 55 to 68 ° C. may be included, and the stringency can be increased by this operation. Here, the 1 × SSC buffer is 150 mM sodium chloride, 15 mM sodium citrate, pH 7.0.

For hybridization conditions and PCR reaction procedures, see, for example, F.A. M.M. Ausbel et al. , Short Protocols in Molecular Biology, 3rd ed. , John Wiley & Sons, 1995, and the like.

Furthermore, the DNA encoding the 28-position oxidase that can be used in the present invention also includes DNA containing a sequence (degenerate sequence) based on the degeneracy of the genetic code in the base sequences shown in SEQ ID NOs: 10 to 16.

As described above, the DNA of the present invention is a protein having 28-position oxidase activity, that is, the following (a) to (c):
(A) a protein comprising the amino acid sequence shown in any one of SEQ ID NOs: 2 to 8;
(B) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted, inserted or added in the amino acid sequence shown in any of SEQ ID NOs: 2 to 8, and having 28th oxidase activity ;
(C) a protein comprising an amino acid sequence having 70% or more sequence identity with any of the amino acid sequences shown in SEQ ID NOs: 2 to 8, and having 28th position oxidase activity;
A protein selected from the group consisting of

More specifically, the DNA comprises the following (d) to (g):
(D) a DNA comprising the base sequence shown in any of SEQ ID NOs: 10 to 16;
(E) a protein that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the DNA comprising the base sequence shown in any one of SEQ ID NOs: 10 to 16 and has a 28th position oxidase activity DNA to do;
(F) a DNA comprising a base sequence having 70% or more sequence identity to the base sequence shown in any of SEQ ID NOs: 10 to 16, and encoding a protein having 28th oxidase activity;
(G) DNA containing a degenerate sequence in the base sequence shown in any of SEQ ID NOs: 10 to 16;
Is selected from the group consisting of

3. Recombinant Vector The DNA of the present invention is inserted into a suitable vector containing regulatory sequences to allow it to be expressed. The recombinant DNA thus obtained is a recombinant vector.

As the vector, any vector that can be used in prokaryotic or eukaryotic cells is intended, for example, bacteria (Escherichia, Pseudomonas, Bacillus, Rhodococcus, etc.), filamentous fungi (Aspergillus, Neurospora, Fusarium) , Trichoderma genus, Penicillium genus), basidiomycetes (white rot fungi etc.), yeasts (Saccharomyces genus, Pichia genus, Candida genus etc.) and other microorganism vectors, plant cell vectors, insect cell vectors and the like.

For example, bacterial vectors include pBR, pUC, pET, pBluescript series vectors, and yeast vectors include, but are not limited to, pDR196, pYES-DEST 52, Yip5, Yrp17, Yep24, and the like. Examples of plant cell vectors include, but are not limited to, pGWB vector, pBiEl2-GUS, pIG121-Hm, pBI121, pBiHyg-HSE, pB119, pBI101, pGV3850, pABH-Hm1, and the like. Nonlimiting examples include pBM030, pBM034, pBK283, and the like.

The vector used in the present invention incorporates components related to the expression, regulation, and secretion of genes such as a promoter, terminator, enhancer, Shine-Dalgarno sequence, ribosome binding sequence, signal sequence, etc. (For example, drug resistance gene, reporter gene).

Promoters include, but are not limited to, lac promoter, trp promoter, recA promoter, tac promoter, λPL promoter, T7 promoter, CaMV35S promoter, ADH1 promoter, GAL promoter, PHO5 promoter, PGK promoter, GAPDH promoter and the like.

Drug resistance genes include kanamycin resistance gene, ampicillin resistance gene, hygromycin resistance gene and the like. Reporter genes include lacZ gene, GFP gene, GUS gene, luciferase gene and the like. Other selectable markers include, for example, NPTII gene, dihydrofolate reductase gene and the like.

It is preferable that the components related to gene expression, regulation, and secretion are incorporated into the recombinant vector in such a manner that they can function according to their properties. Such an operation can be appropriately performed by those skilled in the art.

4). Transformant The transformant of the present invention is a transformant carrying the recombinant vector of the present invention. A transformant can be obtained by introducing a recombinant vector into which a DNA encoding position 28 oxidase is inserted into a host cell so that the target DNA can be expressed.

Host cells that are suitable for vectors may be used. Examples thereof include microbial cells such as bacteria, filamentous fungi and yeast, plant cells, insect cells (such as Sf9), and animal cells. Yeast, filamentous fungi, insect cells or plant cells are preferred.

Even if the host cell is a cell having a biosynthetic system of pentacyclic triterpene compounds such as α-amylin, β-amylin and lupeol, or a cell not having the biosynthetic system, exogenously When (or exogenously) any of cells into which DNA encoding a triterpene synthase such as α-amylin synthase, β-amylin synthase, lupeol synthase and the like is incorporated so that it can be expressed, Furthermore, since DNA encoding oleanolic acid synthase is included so that it can be expressed, ursolic acid, oleanolic acid, and betulinic acid can be produced by culturing these cells in a medium containing an appropriate substrate.

Cells that have a biosynthetic system for pentacyclic triterpene compounds such as α-amylin, β-amylin, and lupeol are originally equipped with such biosynthetic systems, such as plant cells, certain yeast cells, and filamentous fungal cells. Cells are included. Moreover, the cell which does not have said biosynthesis system includes the cell etc. which exogenously contain the genome area | region of the enzymes involved in this biosynthesis system. The exogenous genomic region is usually derived from a plant and can be inserted into a vector such as a plasmid, phagemid, BAC, PAC, YAC, virus, etc. and transferred into a host cell.

In any case, due to transformation of the above-exemplified cells, the cells overexpress oleanolic acid synthase in some cases. When the host cell is a eukaryotic cell, it is possible to secrete the enzyme outside the cell by ligating a signal sequence to the 5 'end of the DNA encoding oleanolic acid synthase.

The method for introducing a recombinant vector is not particularly limited as long as it is a method for introducing DNA into a microorganism. For example, a method using calcium ions [Cohen, S .; N. et al. : Proc. Natl. Acad. Sci. USA, 69: 2110 (1972)], electroporation method, tri-parental mating method, Agrobacterium method, protoplast or spheroplast fusion method, particle gun method and the like.

Furthermore, as a method for producing a transformed plant body (also referred to as “transgenic plant”), an Agrobacterium method using a virus vector, an Agrobacterium Ti plasmid, an Ri plasmid, or the like as a vector can be preferably used. The host plant is not particularly limited, and examples thereof include monocotyledonous plants such as rice, wheat and corn, and dicotyledonous plants such as soybean, rapeseed, tomato and potato. A transformed plant can be obtained by regenerating a plant from a plant cell transformed with a vector containing DNA encoding oleanolic acid synthase. Regeneration of the plant body from the plant cell can be performed by a known method such as callus culture.

5. Production method of the protein of the present invention The protein of the present invention is prepared by using the method described in Molecular Cloning 2nd Edition, Current Protocols in Molecular Biology, etc. The DNA encoding the protein can be produced by expressing it in a host cell. Based on the DNA encoding the protein of the present invention, if necessary, a DNA fragment of an appropriate length containing a portion encoding the protein of the present invention is prepared. Moreover, the production rate of the protein can be improved by substituting the base in the base sequence of the protein-encoding portion so as to be an optimal codon for host expression.

The recombinant DNA is prepared by inserting the DNA fragment downstream of the promoter of an appropriate expression vector. A transformant producing the protein of the present invention can be obtained by introducing the recombinant DNA into a host cell suitable for the expression vector.

Any host cell can be used as long as it can express the target gene, such as bacteria, yeast, animal cells, insect cells, and plant cells. The expression vector is capable of autonomous replication in the above host cell or can be integrated into a chromosome, and contains a promoter at a position where the DNA of the present invention or the DNA used in the production method of the present invention can be transcribed. Used.

When a prokaryotic organism such as a bacterium is used as a host cell, the recombinant DNA having the DNA of the present invention or the DNA used in the production method of the present invention is capable of autonomous replication in a prokaryotic organism, and at the same time a promoter, ribosome It is preferably a recombinant DNA composed of a binding sequence, DNA of the present invention or DNA used in the production method of the present invention, and transcription termination sequence. A gene that controls the promoter may also be included.

As expression vectors, pBTrp2, pBTac1, pBTac2 (all manufactured by Boehringer Mannheim), pHelix1 (manufactured by Roche Diagnostics), pKK233-2 (manufactured by Amersham Pharmacia Biotech), pSE280 (manufactured by Invitrogen), pGEMEX-1 (manufactured by Promega), pQE-8 (manufactured by Qiagen), pET-3 (manufactured by Novagen), pKYP10 (Japanese Patent Laid-Open No. 58-110600), pKYP200 [Agri. Biol. Chem. , 48, 669 (1984)], pLSA1 [Agric. Biol. Chem. , 53, 277 (1989)], pGEL1 [Proc. Natl. Acad. Sci. USA, 82, 4306 (1985)], pBluescript II SK (+), pBluescript II KS (-) (manufactured by Stratagene), pTrS30 [Escherichia coli JM109 / pTrS30 (FERM BP-5407)] [prepared from pTrS32] Escherichia coli JM109 / pTrS32 (FERM BP-5408)], pPAC31 (WO 98/12343), pUC19 [Gene, 33, 103 (1985)], pSTV28 (Takara Shuzo), pUC118 (Takara Shuzo), pPA1 (Japanese Patent Laid-Open No. 63-233798) can be exemplified.

Any promoter can be used as long as it functions in a host cell such as Escherichia coli. For example, promoters derived from Escherichia coli or phage, such as trp promoter (Ptrp), lac promoter (Plac), PL promoter, PR promoter, PSE promoter, SPO1 promoter, SPO2 promoter, penP promoter and the like can be mentioned. In addition, an artificially designed and modified promoter such as a promoter in which two Ptrps are connected in series, a tac promoter, a lacT7 promoter, and a let I promoter can be used.

It is preferable to use a plasmid in which the distance between the Shine-Dalgarno sequence, which is a ribosome binding sequence, and the start codon is adjusted to an appropriate distance (eg, 6 to 18 bases).

In the recombinant DNA in which the DNA of the present invention or the DNA used in the production method of the present invention is bound to an expression vector, a transcription termination sequence is not necessarily required, but a transcription termination sequence should be placed immediately below the structural gene. Is preferred.

Prokaryotes include microorganisms belonging to the genus Escherichia, Serratia, Bacillus, Brevibacterium, Corynebacterium, Microbacterium, Pseudomonas, etc. Can give.

As a method for introducing recombinant DNA, any method can be used as long as it is a method for introducing DNA into the host cell. For example, a method using calcium ions [Proc. Natl. Acad. Sci. , USA, 69, 2110 (1972)], protoplast method (Japanese Patent Laid-Open No. Sho 63-248394), electroporation method [Nucleic Acids Res. 16, 6127 (1988)].

When yeast strains are used as host cells, for example, YEp13 (ATCC37115), YEp24 (ATCC37051), YCp50 (ATCC37419), pHS19, pHS15 and the like can be used as an expression vector.

Any promoter may be used as long as it functions in yeast strains. For example, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, gal 1 promoter, gal 10 promoter, heat shock polypeptide promoter And promoters such as MFα1 promoter and CUP 1 promoter.

Host cells include the genus Saccharomyces, the genus Schizosaccharomyces, the genus Kluyveromyces, the genus Trichosporon, the genus Swaniomyces (Schwanimyces) Examples include yeast strains belonging to the genus Candida and the like, and specifically, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactyclone Lancetis ( richosporonpullulans), Shiwaniomaisesu-Arubiusu (Schwanniomycesalluvius), Pichia pastoris (Pichiapastoris), it is possible to increase the Candida utilis (Candidautilis) and the like.

As a method for introducing recombinant DNA, any method can be used as long as it is a method for introducing DNA into yeast. For example, electroporation method [Methods Enzymol. , 194, 182 (1990)], spheroplast method [Proc. Natl. Acad. Sci. USA, 81, 4889 (1984)], lithium acetate method [J. Bacteriol. , 153, 163 (1983)].

When animal cells are used as hosts, expression vectors include, for example, pcDNAI, pcDM8 (commercially available from Funakoshi), pAGE107 (JP-A-3-22979), pAS3-3 (JP-A-2-222775), pCDM8 [Nature, 329, 840 (1987)], pcDNAI / Amp (manufactured by Invitrogen), pREP4 (manufactured by Invitrogen), pAGE103 [J. Biochem, 101, 1307 (1987)], pAGE210, pAMo, pAMoA and the like can be used.

Any promoter can be used as long as it functions in animal cells. For example, cytomegalovirus (CMV) IE (immediate early) gene promoter, SV40 early promoter or metallothionein promoter, retrovirus Promoters, heat shock promoters, SRα promoters, and the like. In addition, an enhancer of human CMV IE gene may be used together with a promoter.

Host cells include mouse myeloma cells, rat myeloma cells, mouse hybridoma cells, human cells such as Namalwa cells or Namalva KJM-1 cells, human fetal kidney cells, human leukemia cells, African green monkey kidney cells CHO cells which are Chinese hamster cells, HBT5637 (Japanese Patent Laid-Open No. 63-299), and the like.

As mouse myeloma cells, SP2 / 0, NSO, etc., as rat myeloma cells, YB2 / 0, etc., as human embryonic kidney cells, HEK293 (ATCC CRL-1573), as human leukemia cells, as BALL-1, etc., Africa Examples of green monkey kidney cells include COS-1, COS-7, and the like.

As a method for introducing recombinant DNA, any method can be used as long as it is a method for introducing DNA into animal cells. For example, electroporation method [Cytotechnology, 3, 133 (1990)], calcium phosphate method (Japanese Patent Laid-Open No. Hei. 2-227075), lipofection method [Proc. Natl. Acad. Sci. USA, 84, 7413 (1987)], Virology, 52, 456 (1973), and the like.

In the case of using insect cells as a host, for example, Baculovirus Expression Vectors, A Laboratory Manual, W., et al. H. Proteins are produced by the methods described in Freeman and Company, New York (1992), Current Protocols in Molecular Biology, Molecular Biology, A Laboratory Manual, Bio / Technology, 6, 47 (1988), etc. can do.

That is, the recombinant gene transfer vector and baculovirus are co-introduced into insect cells to obtain the recombinant virus in the insect cell culture supernatant, and then the recombinant virus is further infected into insect cells to produce proteins. it can.

Examples of the gene transfer vector used in the method include pVL1392, pVL1393, pBlueBacIII (all manufactured by Invitrogen) and the like.

As the baculovirus, for example, Autographa californica nucleopolyhydrosis virus, which is a virus that infects night-spotted insects, can be used.

As the insect cells, podocytes of Spodoptera frugiperda, ovary cells of Trichoplusiani, cultured cells derived from silkworm ovary, and the like can be used.

Spodoptera frugiperda ovary cells such as Sf9, Sf21 (Baculovirus Expression Vectors A Laboratory Manual), etc., Trichopulcia ni ovary cells High 5, BTI-TN-5B1-4 (manufactured by Invitrogen), etc. Examples of the cultured cells derived from silkworm ovary include Bombyxmori N4.

Examples of the method for co-introducing the recombinant gene introduction vector and the baculovirus into insect cells for preparing a recombinant virus include, for example, the calcium phosphate method (Japanese Patent Laid-Open No. 227075), the lipofection method [Proc. Natl. Acad. Sci. USA, 84, 7413 (1987)].

When plant cells are used as host cells, examples of expression vectors include Ti plasmids and tobacco mosaic virus vectors.

Any promoter may be used as long as it functions in plant cells, and examples thereof include cauliflower mosaic virus (CaMV) 35S promoter, rice actin 1 promoter and the like.

Examples of host cells include plant cells such as tobacco, potato, tomato, carrot, soybean, rape, alfalfa, rice, wheat and barley.

As a method for introducing a recombinant vector, any method can be used as long as it is a method for introducing DNA into plant cells. For example, a method using Agrobacterium (JP 59-140885, JP 60). -70080, WO94 / 00977), electroporation method (Japanese Patent Laid-Open No. Sho 60-251887), a method using a particle gun (gene gun) (Patent No. 2606856, Patent No. 2517813), and the like.

When expressed in yeast, animal cells, insect cells, or plant cells, a protein with a sugar or sugar chain added can be obtained.

The transformant obtained as described above is cultured in a medium, the protein of the present invention is produced and accumulated in the culture, and the protein can be produced by collecting from the culture.

Examples of the host of the transformant for producing the protein of the present invention include microbial cells such as bacteria, filamentous fungi and yeast, plant cells, insect cells (Sf9 and the like), animal cells and the like. Yeast, filamentous fungi, insect cells or plant cells are preferred.

The method of culturing the above transformant in a medium can be performed according to a usual method used for host culture.

As a medium for culturing a transformant obtained by using a prokaryote such as Escherichia coli or a eukaryote such as yeast as a host, the medium contains a carbon source, a nitrogen source, inorganic salts, etc. that can be assimilated by the organism, Either a natural medium or a synthetic medium may be used as long as the medium can efficiently culture the transformant.

The carbon source may be anything that can be assimilated by the organism, such as glucose, fructose, sucrose, molasses containing these, carbohydrates such as starch or starch hydrolysate, organic acids such as acetic acid and propionic acid, ethanol, Alcohols such as propanol can be used.

Nitrogen sources include ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium salts of organic acids such as ammonium phosphate, other nitrogen-containing compounds, peptone, meat extract, yeast extract, corn steep liquor, casein A hydrolyzate, soybean meal, soybean meal hydrolyzate, various fermented cells, digests thereof, and the like can be used.

As the inorganic salt, monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, calcium carbonate and the like can be used.

Cultivation is usually performed under aerobic conditions such as shaking culture or deep aeration stirring culture. The culture temperature is preferably 15 to 40 ° C., and the culture time is usually 5 hours to 7 days. During the culture, the pH is maintained at 3.0 to 9.0. The pH is adjusted using an inorganic or organic acid, an alkaline solution, urea, calcium carbonate, ammonia or the like.

Moreover, antibiotics such as ampicillin and tetracycline may be added to the medium as needed during the culture.

When culturing a microorganism transformed with an expression vector using an inducible promoter as a promoter, an inducer may be added to the medium as necessary. For example, isopropyl-β-D-thiogalactopyranoside is used when cultivating a microorganism transformed with an expression vector using the lac promoter, and indole acrylic is used when culturing a microorganism transformed with an expression vector using the trp promoter. An acid or the like may be added to the medium.

As a medium for culturing a transformant obtained using animal cells as a host, a generally used RPMI 1640 medium [J. Am. Med. Assoc. , 199, 519 (1967)], Eagle's MEM medium [Science, 122, 501 (1952)], DMEM medium [Virology, 8, 396 (1959)], 199 medium [Proc. Soc. Biol. Med. 73, 1 (1950)] or a medium obtained by adding fetal bovine serum or the like to these mediums.

Cultivation is usually performed for 1 to 7 days under conditions such as pH 6 to 8, 25 to 40 ° C., and the presence of 5% CO ₂ .

In addition, antibiotics such as kanamycin, penicillin, streptomycin and the like may be added to the medium as needed during culture.

As a medium for culturing a transformant obtained using insect cells as a host, commonly used TNM-FH medium (manufactured by Farmingen), Sf-900 II SFM medium (manufactured by Life Technologies), ExCell400 ExCell405 [all manufactured by JRH Biosciences], Grace's Insect Medium [Nature, 195, 788 (1962)] and the like can be used.

Cultivation is usually carried out for 1 to 5 days under conditions of pH 6-7, 25-30 ° C.

In addition, an antibiotic such as gentamicin may be added to the medium as needed during the culture.

A transformant obtained using a plant cell as a host can be cultured as a cell or differentiated into a plant cell or organ. As a medium for culturing the transformant, a commonly used Murashige and Skoog (MS) medium, White medium, or a medium in which plant hormones such as auxin and cytokinin are added to these mediums or the like is used. be able to.

Cultivation is usually carried out for 3 to 60 days under conditions of pH 5 to 9 and 20 to 40 ° C.

Moreover, you may add antibiotics, such as kanamycin and a hygromycin, to a culture medium as needed during culture | cultivation.

As described above, a transformant derived from a microorganism, insect cell, animal cell, or plant cell having a recombinant DNA in which the DNA encoding the protein of the present invention is linked to an expression vector is cultured according to a normal culture method. The protein of the present invention can be produced and accumulated, and the protein can be produced by collecting the protein from the culture.

The production method of the protein of the present invention includes a method of producing in the host cell, a method of secreting it out of the host cell, or a method of producing it on the outer membrane of the host cell. The structure can be changed.

When the protein of the present invention is produced in the host cell or on the host cell outer membrane, the method of Paulson et al. [J. Biol. Chem. , 264, 17619 (1989)], the method of Lowe et al. [Proc. Natl. Acad. Sci. USA, 86, 8227 (1989), Genes Develop. , 4, 1288 (1990)], or by applying the method described in JP-A-05-336963, WO94 / 23021, etc., the protein can be actively secreted outside the host cell.

That is, by using a gene recombination technique to produce a protein containing the active site of the protein of the present invention in the form of a signal peptide added, the protein can be actively secreted outside the host cell. it can.

Further, according to the method described in JP-A-2-227075, the production amount can be increased by using a gene amplification system using a dihydrofolate reductase gene or the like.

Furthermore, by redifferentiating the cells of the transgenic animal or plant, the animal individual (transgenic non-human animal) or plant individual (transgenic plant) into which the gene has been introduced is created, Inventive proteins can also be produced.

When the transformant producing the protein of the present invention is an animal individual or a plant individual, it is raised or cultivated according to a usual method, the protein is produced and accumulated, and the protein is collected from the animal individual or plant individual. Thus, the protein can be produced.

As a method for producing the protein of the present invention using an individual animal, for example, a known method [Am. J. et al. Clin. Nutr. 63, 639S (1996), Am. J. et al. Clin. Nutr. 63, 627S (1996), Bio / Technology, 9, 830 (1991)], a method for producing the protein of the present invention in an animal constructed by introducing a gene.

In the case of an animal individual, for example, a transgenic non-human animal into which the DNA of the present invention or the DNA used in the production method of the present invention is introduced is bred, and the protein of the present invention is produced and accumulated in the animal. The protein can be produced by collecting the protein from the inside. Examples of the place where the protein in the animal is produced and accumulated include milk of the animal (Japanese Patent Laid-Open No. 63-309192), eggs and the like. Any promoter can be used as long as it functions in animals. For example, a casein promoter, β casein promoter, β lactoglobulin promoter, whey acidity, which is a mammary cell specific promoter, can be used. A protein promoter or the like is preferably used.

As a method for producing the protein of the present invention using an individual plant, for example, a transgenic plant into which a DNA encoding the protein of the present invention has been introduced is known [tissue culture, 20 (1994), tissue culture, 21 (1995). ), Trends Biotechnol. , 15, 45 (1997)], producing and accumulating the protein in the plant, and collecting the protein from the plant to produce the protein.

As a method for isolating and purifying the protein of the present invention produced using the transformant that produces the protein of the present invention, a usual enzyme isolation and purification method can be used.

For example, when the protein of the present invention is produced in a dissolved state in cells, the cells are collected by centrifugation after culturing, suspended in an aqueous buffer, and then subjected to an ultrasonic crusher, a French press, a manton. Cells are disrupted with a Gaurin homogenizer, dynomill, etc. to obtain a cell-free extract.

From the supernatant obtained by centrifuging the cell-free extract, an ordinary enzyme isolation and purification method, that is, a solvent extraction method, a salting-out method using ammonium sulfate, a desalting method, a precipitation method using an organic solvent, diethylamino Anion exchange chromatography method using resin such as ethyl (DEAE) -Sepharose, DIAION HPA-75 (manufactured by Mitsubishi Kasei Co., Ltd.), Cation exchange chromatography method using resin such as S-Sepharose FF (manufactured by Pharmacia) Hydrophobic chromatography using resin such as butyl sepharose and phenyl sepharose, gel filtration using molecular sieve, affinity chromatography, chromatofocusing, electrophoresis methods such as isoelectric focusing etc. Alternatively, it can be used in combination to obtain a purified preparation.

In addition, when the protein is produced by forming an insoluble substance in the cell, the protein is similarly collected from the precipitate fraction obtained by crushing and centrifuging the cell, and the protein is obtained by a usual method. After recovery, the protein insoluble matter is solubilized with a protein denaturant.

The solubilized solution is diluted or dialyzed into a solution that does not contain a protein denaturant or the protein denaturant has such a concentration that the protein is not denatured. A purified sample can be obtained by the same isolation and purification method.

When the protein of the present invention or a derivative such as a sugar modification product thereof is secreted outside the cell, the protein or its derivative such as a sugar adduct can be recovered in the culture supernatant.

That is, a soluble fraction is obtained by treating the culture by a technique such as centrifugation as described above, and a purified preparation is obtained from the soluble fraction by using the same isolation and purification method as described above. be able to.

Alternatively, the protein of the present invention can be produced as a fusion protein with another protein, and purified using affinity chromatography using a substance having an affinity for the fused protein. For example, the method of Law et al. [Proc. Natl. Acad. Sci. USA, 86, 8227 (1989), Genes Develop. , 4, 1288 (1990)], JP-A-5-336963, WO94 / 23021, the protein of the present invention is produced as a fusion protein with protein A, and affinity chromatography using immunoglobulin G is used. Can be purified.

In addition, the protein of the present invention can be produced as a fusion protein with a Flag peptide and purified by affinity chromatography using an anti-Flag antibody [Proc. Natl. Acad. Sci. USA, 86, 8227 (1989), Genes Develop. , 4, 1288 (1990)]. Furthermore, it can also be purified by affinity chromatography using an antibody against the protein itself.

Based on the amino acid sequence information of the protein obtained above, the protein of the present invention is produced by a chemical synthesis method such as the Fmoc method (fluorenylmethyloxycarbonyl method) or the tBoc method (t-butyloxycarbonyl method). be able to. It can also be chemically synthesized using peptide synthesizers such as Advanced ChemTech, Perkin Elmer, Pharmacia, Protein Technology Instrument, Synthecell-Vega, PerSeptive, Shimadzu Corporation.

6). TECHNICAL FIELD The present invention relates to a method for producing a triterpene compound having a hydroxymethyl group or a carboxyl group at the 28th position, in the presence of a protein having an exogenous 28th oxidase activity or 28th position oxidation in a cell-free system or using cells or plants. Provided is a method for converting a methyl group at position 28 of a pentacyclic triterpene compound such as α-amylin, β-amylin, or lupeol into a hydroxymethyl group or a carboxyl group under the expression of DNA encoding the enzyme.

As used herein, “exogenous” means not an enzyme or its gene itself inherent in a cell or plant, but the cell or plant, or the reaction system of the above pentacyclic triterpene compound raw material. Means that the enzyme or DNA encoding the enzyme is introduced.

The present invention also provides a pentacyclic triterpene compound in which the 28-position methyl group is converted to a hydroxymethyl group or a carboxyl group by the above-described conversion method, and the compound is recovered. Provided is a method for producing a pentacyclic triterpene compound converted into a hydroxymethyl group or a carboxyl group.

In the present invention, the 28th oxidase is covalently bonded or non-covalently attached to a support such as a crude, semi-purified or purified, or a polysaccharide, a porous polymer, a porous inorganic material (eg, glass, mineral, ceramics, etc.). It may be used in the reaction system as an enzyme immobilized by binding, or the cell or the plant itself producing the enzyme may be used in the reaction system.

The 28-position oxidase that can be used in the present invention is a kind of membrane-bound cytochrome P450 monooxidase, and can be obtained by the above-described production method.

Since the protein having high enzyme activity can be expressed by the DNA recombination technique, the substrate of the 28th oxidase, such as α-amylin, is used in the culture solution of transformed microorganisms (for example, yeast, filamentous fungi) or insect cells. , Β-amylin, lupeol, or substituted derivatives thereof, can produce pentacyclic triterpene compounds in which the 28-position is hydroxymethylated or carboxylated. For example, by administering pentacyclic triterpenes such as β-amylin as a substrate to the culture solution of transformed microorganisms, a large amount of pentacyclic triterpene compounds in which the 28-position is hydroxymethylated or carboxylated can be produced efficiently. Is possible.

In particular, yeast has a pathway for biosynthesis of DMAPP (dimethylallyl pyrophosphate) in the cytosol (mevalonate pathway), introduction of the mevalonate pathway into E. coli, squalene epoxidase, and oxide squalene cyclase It has been reported that it was possible to produce and enhance precursors and substrates [Harada and Misawa 2009, Appl Microbiol Biotechnol 84: 1021-31, Nakano et al. 2007 Biosci. Biotech. Biochem. 71: 2543-2550]. For example, the GIL77 strain of Saccharomyces cerevisiae (T. Kushiro et al., Eur. J. Biochem. 256: 238-244 (1998)) or a mutant strain thereof is a plasmid that can express DNA encoding β-amylin synthase. It is known to produce β-amylin when transformed (H. Hayashi et al., Biol. Pharm. Bull. 24: 912-916 (2001)). A pentacyclic triterpene compound in which position 28 is hydroxymethylated or carboxylated by simultaneously expressing other genes (for example, substrate biosynthetic enzyme genes) and DNA encoding position 28 oxidase using these methods Can be produced. As an example of expressing a metabolite by expressing a similar membrane-bound cytochrome P450 monooxidase, Chang et al. [2007 Nat. Chem. Biol. 3: 274-277]. Moreover, since there is a report of Seki et al. [2008 PNAS 105: 14204-14209] in yeast, it is possible to produce the target pentacyclic triterpene compound by combining such methods. In addition, the target pentacyclic triterpene compound can be produced by overexpressing the 28-position oxidase in the transgenic plant and recovered from roots, seeds, and the like.

(1) Enzymatic production method In a cell-free system, a cell-free extract containing the 28-position oxidase is prepared from the culture medium of the transformant, and a part thereof is α-amylin, β-amylin, lupeol, or the like. A pentacyclic triterpene compound in which the 28-position is hydroxymethylated or carboxylated can be produced by carrying out a conversion reaction in addition to a buffer containing a pentacyclic triterpene compound such as a substituted derivative of.

The harvested cell suspension or the transformed plant in an appropriate amount of buffer is crushed by a homogenizer, an ultrasonic crusher or a French press, and then centrifuged to obtain a cell-free extract. In order to prevent inactivation of the polypeptide, an antioxidant, an enzyme stabilizer, a polyphenol adsorbent, a metal ligand and the like can be added to the buffer. In order to further increase the specific activity, it is effective to purify the polypeptide, such as centrifugation using an ultracentrifuge, salting out using ammonium sulfate, gel filtration, ion exchange chromatography, affinity chromatography, electrophoresis. Methods such as the method can be used alone or in combination. The above pentacyclic triterpene and coenzyme as substrates are added to the buffer containing the obtained polypeptide and incubated. As a coenzyme, NADH or NADPH can be used, and an NADPH reconstitution system using glucose-6-phosphate and glucose-6-phosphate dehydrogenase can be used in combination. It is also possible to perform an oxidation reaction by adding NADPH-P450 reductase other than NADPH-P450 reductase produced by the transformant from the outside.

In the above production method, the protein of the present invention is added in an amount of 0.01 to 100 mg, preferably 0.1 to 10 mg per mg of triterpene used as a substrate.

In the above production method, the pentacyclic triterpene used as a substrate is added to the reaction aqueous medium at the beginning or in the middle of the reaction so as to have a concentration of 0.1 to 500 g / L, preferably 0.2 to 200 g / L. The aqueous medium used in the above production method may be an aqueous medium of any component and composition as long as it does not inhibit the formation reaction of a pentacyclic triterpene having a hydroxymethyl group or a carboxyl group at the 28-position. And buffers such as phosphate, carbonate, acetate, borate, citrate, and tris. Further, it may contain alcohols such as methanol and ethanol, esters such as ethyl acetate, ketones such as acetone, and amides such as acetamide.

The formation reaction of a pentacyclic triterpene having a hydroxymethyl group or a carboxyl group at the 28-position is 2 to 150 in an aqueous medium under conditions of pH 5 to 11, preferably pH 6 to 10, 20 to 50 ° C., preferably 25 to 45 ° C. The time is preferably 6 to 120 hours.

(2) Production method using transformant or microorganism culture or treatment of culture as enzyme source Transformant or microorganism culture or treatment of culture as enzyme source As a method for producing a pentacyclic triterpene having a carboxyl group, a culture of a transformant having the ability to produce the protein of the present invention or a processed product of the culture is used as an enzyme source, the enzyme source, and the pentacyclic system A triterpene having a 28-position hydroxymethyl group or a carboxyl group is produced by accumulating a triterpene in an aqueous medium to form and accumulate a pentacyclic triterpene having a 28-position hydroxymethyl group or a carboxyl group in the medium. The manufacturing method which collects can be mention | raise | lifted.

As the transformant used in the above production method, 4. And 5. A transformant producing the protein of the present invention, which can be produced by the above method, can be mentioned. Furthermore, NADPH-P450 reductase other than NADPH-P450 reductase produced by the host can be added from the outside.

As a processed product of the culture, a concentrate of the culture, a dried product of the culture, a cell obtained by centrifuging the culture, a dried product of the cell, a freeze-dried product of the cell, the cell Treated product of surfactant, sonicated product of cell, mechanically ground product of cell, solvent-treated product of cell, enzyme-treated product of cell, protein fraction of cell Products, immobilized products of the cells, enzyme preparations obtained by extraction from the cells, and the like.

In the above production method, the kind of pentacyclic triterpene used as a substrate, the concentration and timing of addition, and the produced pentacyclic triterpene having a hydroxymethyl group or a carboxyl group at position 28 are produced by the enzymatic production of (1) above. Same as the law.

In addition to the aqueous medium used in the enzymatic production method of (1) above, the aqueous medium used in the production method using the culture of microorganisms or the treated product of the culture as an enzyme source was used as an enzyme source. A transformant or a culture solution of microorganisms can also be used as an aqueous medium.

If necessary, a surfactant or an organic solvent may be added to the aqueous medium. Examples of the surfactant include nonionic surfactants such as polyoxyethylene / octadecylamine (for example, Nimine S-215, manufactured by NOF Corporation), cetyltrimethylammonium / bromide and alkyldimethyl / benzylammonium chloride (for example, cation F2-40E). Catalytic surfactants such as Nippon Oil & Fats Co., Ltd., anionic surfactants such as lauroyl and sarcosinate, and tertiary amines such as alkyldimethylamine (eg, tertiary amine FB, manufactured by Nippon Oil & Fats Co., Ltd.) Any one may be used as long as it promotes the generation of the triterpene, and one kind or a mixture of several kinds can be used. As the surfactant, the surfactant is usually used at a concentration of 0.1 to 50 g / l. Examples of the organic solvent include xylene, toluene, aliphatic alcohol, acetone, ethyl acetate and the like, and are usually used at a concentration of 0.1 to 50 ml / l.

When a culture or a processed product of the culture is used as an enzyme source, the amount of the enzyme source varies depending on the specific activity of the enzyme source, etc., for example, as wet cell weight per 1 mg of pentacyclic triterpene used as a substrate Add 5 to 1000 mg, preferably 10 to 400 mg.

In the production method of (1) or (2) above, the triterpene having a 28-position hydroxymethyl group or carboxyl group generated and accumulated in an aqueous medium is collected by a normal method using activated carbon, an ion exchange resin or the like, or organic Extraction with a solvent, crystallization, thin layer chromatography, high performance liquid chromatography and the like can be performed.

7. Selection of 28th Oxidase Gene Mutation, Polymorphism or Gene Expression Mutation According to the method for producing a pentacyclic triterpene compound in which the 28th position is a hydroxymethyl group or a carboxyl group according to the present invention, the 28th position oxidase gene is suddenly changed in plants. The presence of a mutation, a polymorphism such as a single nucleotide polymorphism (SNP), or a gene expression mutation is detected, and the 28-position oxidase activity is high and the 28-position is hydroxy from the gene having such a mutation or polymorphism. Mutant genes that enhance the productivity of pentacyclic triterpene compounds that are methyl or carboxyl groups can be selected. Such mutation may be caused by artificial mutation treatment such as chemical treatment such as radiation, UV irradiation, mutagen, or the like in a plant having the oxidase gene at position 28 and capable of producing a pentacyclic triterpene compound. Can be induced by mutation.

The above-mentioned method for selecting a mutant oleanolic acid synthase gene includes isolating genomic DNA and mRNA from mutant individuals, plants of various varieties and breeding individuals, and in the case of mRNA, synthesizing cDNA by reverse transcription. Amplifying a gene fragment containing an oleanolic acid synthase gene from genomic DNA or cDNA by using DNA amplification techniques and determining the presence of a mutation in the DNA. A commercially available kit (for example, DNeasy or RNeasy (Qiagen)) can be used for the method of extracting DNA or RNA. As a method for synthesizing cDNA, a commercially available kit (for example, Superscript First Strand System (Invitrogen)) can be used.

As a method of amplifying a gene fragment by using DNA amplification technology, a technique such as a so-called PCR method or LAMP method can be used. These are a group of techniques based on the use of polymerases to achieve specific DNA sequence amplification (ie, increasing copy number) by a continuous polymerase reaction. This reaction can be used instead of cloning, but all that is needed is information about the nucleic acid sequence. In order to amplify DNA, a primer complementary to the DNA sequence to be amplified is designed. Next, the primer is prepared by automatic DNA synthesis. DNA amplification methods are well known in the art and can be readily performed by one of ordinary skill in the art based on the teachings and instructions provided herein. Some PCR methods (as well as related techniques) are described, for example, in U.S. Pat. Nos. 4,683,195, 4,683,202, 4,800,159, 4,965,188. , And edited by Innis et al., PCR Protocols: A guide to Method and Applications.

In the step of determining the presence of mutations or polymorphisms in the DNA, the base sequence (Applied Biosystems) or the TILLING method (Till method) for detecting a mutant using an enzyme that cleaves one side of a mismatched pair is used. et al., 2003, Genome Res 13: 524-530), and the like. These can be performed by comparing the sequence data obtained from this technique with the base sequence of the gene encoding the 28th position oxidase relating to the gene portion, for example, the base sequences as shown in SEQ ID NOs: 10 to 16.

In the step of determining the difference in the amount of mRNA, a real-time PCR method (Roche Diagnostics, Inc.) using a primer prepared based on the base sequence of the gene encoding the 28-position oxidase whose sequence is known is used for the cDNA. Quantitative PCR such as a light cycler manufactured by the company may be employed. Thereafter, for example, the difference in the amount of mRNA can be determined by comparing with the amount of cDNA obtained from the grape variety “Campbell Berry A”.

In a particularly preferred embodiment, the method for determining the presence of the 28th position oxidase gene mutation as described above is applied to a material obtained from olive (Olea europea).

By the method for determining the mutation and / or polymorphism described above, the mutation or polymorphism of the gene encoding the 28th oxidase can be identified at the base level, and the gene encoding the 28th oxidase is suddenly changed. A plant having a mutation and / or polymorphism can be selected to obtain a gene encoding a mutant 28-position oxidase.

In addition, it is possible to select plants in which the expression ability of the 28-position oxidase-encoding gene or the activity of the 28-position oxidase is changed by determining the mutation, polymorphism, or determining the amount of mRNA. . Here, the expression capacity of the gene encoding the 28th oxidase or the change in the activity of the 28th oxidase refers to the alteration of the gene expression capacity or the activity of the 28th oxidase by mutation such as an artificial mutation. It means that the gene expression ability or the 28-position oxidase activity differs depending on the type.

Modification by mutation of the 28th position oxidase activity of a plant refers to modification of an existing variety contained in the plant species, and the existing variety includes a wild type. The existing varieties refer to all varieties for obtaining plants in which the gene encoding the 28th oxidase is modified, and include varieties created by artificial manipulation such as mating and genetic manipulation. In addition, in the activity modification, the activity does not have to be changed for all existing varieties. If the activity is modified for a specific existing variety, “plants with modified activity of the 28th oxidase” "include. “Plant in which the activity of the 28th oxidase is modified” includes a plant whose activity is modified by mutation in a natural state without being subjected to artificial manipulation, and a plant whose activity has been changed in the natural state by the above selection method. Can be selected and can be established as a new variety. In addition, when a mutagenesis treatment is performed on an existing variety and a plant with modified 28-position oxidase activity is produced, the comparison target may be an existing variety that has undergone mutagenesis treatment, or other existing variety But you can. In addition, by mating a plant whose activity has been selected in a natural state or a plant whose activity has been changed by mutagenesis treatment, it can be obtained as a new variety in which the mutation of the gene encoding the 28th oxidase is fixed. .

For example, when the plant is olive (Olea europea), the existing varieties include “Nevady Robronco”, “Manzanillo”, “Mission”, “Lecchino” and the like. Here, the expression ability of the gene encoding the 28th oxidase or the plant in which the activity of the 28th oxidase is modified with respect to the existing variety refers to the expression ability of the gene encoding the 28th oxidase with respect to the existing variety. Includes plants in which the activity of the 28th position oxidase is increased or decreased relative to existing varieties. The present invention also includes a plant in which the expression ability of the gene encoding such a 28-position oxidase or the activity of the 28-position oxidase is modified with respect to an existing variety.

The plant having a mutation or polymorphism in the gene encoding the 28-position oxidase thus obtained is produced by the method of the present invention to produce a pentacyclic triterpene compound in which the 28-position is a hydroxymethyl group or a carboxyl group. Can be used for.

(Example)
EXAMPLES Hereinafter, although an Example is shown and this invention is demonstrated in detail, the scope of the present invention is not limited to these.

Selection of candidate P450 for triterpene saponin biosynthesis using co-expression analysis Gene co-expression analysis database of Taruma palm (http://bioinfo.noble.org/gene-atlas/v2/correlation_search_form.php, Version: V2 (July 2009 ) # of Experiments: 64, # of GeneChips: 156), a gene sequence probe 221 having a β-amylin synthase gene (probe ID = Mtr.32384.1.S1_s_at) and a co-expression coefficient of 0.8 or more was found. As a result of searching for homology among the probe sequences, CYP93E2 (probe ID = Mtr.8618.1.S1_at, co-expression coefficient 0.791) and CYP716A12 (probe ID = Mtr. 43018.1.S1_at, co-expression coefficient 0.8566) was found as a P450 gene possibly co-expressed with β-amylin synthase gene, and the following analysis was advanced. However, the probe ID = Mtr.37298.1.S1_at (co-expression coefficient 0.9441) having a higher co-expression count belongs to the CYP72 clan and was not analyzed.

Isolation of CYP93E2 gene of Taruma palm Palm tree and Ecotype R108-1 were grown in an artificial meteorograph (23 ° C, 16 hours long), and total RNA from the leaves, stems and roots of the plant 4 weeks after germination. Was prepared. First-strand cDNA synthesis was performed using 1 μg of the total RNA obtained and SMART RACE cDNA amplification kit (Clontech) according to the attached protocol.

Using 2 μl of each of the three first-strand cDNAs as templates, oligo DNA at the position corresponding to the N-terminus and C-terminus of the polypeptide (514 amino acids) of CYP93E2 (GenBank accession number, ABC59085), that is, SEQ ID NO: 17 (caccATGCTTGAAATCCAAGGCTACGTAGTATT) Using SEQ ID NO: 18 (TTAGGCAGAAGAGAATGGAACAAAATGTGGAAC) as a primer, PCR was performed at an annealing temperature of 58 ° C. (30 cycles, using KOD plus ver. 2 polymerase manufactured by TOYOBO). Since it is necessary for cloning into pENTR ^™ / D-TOPO (registered trademark) entry vector (Invitrogen), the primer of SEQ ID NO: 17 has an artificially 4 base (cacc) at the 5 ′ end. Has been added. As a result of PCR, an approximately 1.5 kb DNA fragment was amplified to the same extent when any first-strand cDNA was used as a template. A DNA fragment amplified from the stem-derived first strand cDNA was cloned into a pENTR ^™ / D-TOPO entry vector (production of entry clones), and the polynucleotide sequences of the three independent clones obtained were determined. The sequence thus obtained is SEQ ID NO: 9, and the polypeptide sequence deduced therefrom (SEQ ID NO: 1) has 99% identity to the amino acid sequence of ABC59085 registered in GenBank. It was.

Isolation of CYP716A12 gene of Taruma corpuscord corresponding to N-terminal and C-terminal of polypeptide (479 amino acids) of CYP716A12 (GenBank accession number, ABC59076) using 2 μl each of the three first-strand cDNAs prepared in Example 2 as templates PCR was carried out at an annealing temperature of 58 ° C. (30 cycles, using KOD plus ver.2 polymerase manufactured by TOYOBO) using the oligo DNA at the position, that is, SEQ ID NO: 19 (caccATGGAGCCTAATTTCTATCTCTCCCT) and SEQ ID NO: 20 (TTAAGCTTTGTGTGGATAAAGGCGA) as primers. . Since it is necessary for cloning into the pENTR ^™ / D-TOPO (registered trademark) entry vector (Invitrogen), the primer of SEQ ID NO: 19 has an artificial 4 base (cacc) at the 5 'end. Has been added. As a result of PCR, an approximately 1.5 kb DNA fragment was amplified to the same extent when any first-strand cDNA was used as a template. A DNA fragment amplified from stem-derived first strand cDNA was cloned into a pENTR ^™ / D-TOPO entry vector, and the polynucleotide sequences of the three independent clones obtained were determined. The sequence thus obtained is SEQ ID NO: 10, and the polypeptide sequence deduced therefrom (SEQ ID NO: 2) has 99% identity to the amino acid sequence of ABC59076 registered in GenBank. It was.

Construction of yeast expression vector pYES3-ADH-OSC1 of the Lotus japonicus β-amylin synthase (OSC1) gene cDNA Using Lotus japonicus, which is an advanced model plant of legumes, β-amylin synthase A yeast expression vector for the (OSC1) gene was constructed. Miyakogusa OSC1 gene cDNA introduction plasmid (Sawai et al. (2006) Plant Sci 170: 247-257) was digested with KpnI and XbaI to excise the OSC1 cDNA region. Similarly, pAUR123 (TaKaRa) was digested with KpnI and XbaI and ligated with DNA ligation Kit Ver. 2.1 (TaKaRa) to obtain pAUR123-OSC1. The PADH1 to TADH1 region of pAUR123-OSC1 was treated with KOD-Plus-DNA polymerase (TOYOBO) at 94 ° C for 2 minutes after treatment with both primers of SEQ ID NO: 21 (GGATGATCCACTAGTGGATCCTCTAGCTCCCTAACATGTAGGTGG) and SEQ ID NO: 22 (TAATGCAGGGCCGCAGGATCCGTGTGGAAGAACGATTACAACAGG) PCR consisting of 20 cycles of 94 ° C. for 20 seconds → 55 ° C. for 40 seconds → 68 ° C. for 90 seconds) × 20 cycles. Then, it kept warm at 68 degreeC for 2 minutes. In addition, the region except pYES3 / CT (Invitrogen) from 1st to 960th bases (PGAL1 to CYC1TT) is KOD-Plus-DNA polymerase using both SEQ ID NO: 23 (TGCGGCCCTGCATTAATGAATCGGCCAACG) and SEQ ID NO: 24 (ACTAGTGGATCATCCCCACGCGCCCTGTAG). (TOYOBO) performed PCR as described above. Both PCR products were ligated using In-Fusion Dry-Down PCR Cloning Kit (clontech) to obtain Miyakogusa OSC1 yeast expression vector pYES3-ADH-OSC1.

Construction of the yeast expression vector pELC-MCS2-GW containing Miyakogusa cytochrome P450 reductase Searching the Miyakogusa EST database (Kazusa DNA Research Institute) for nucleic acid sequences having at least 70% homology with Arabidopsis cytochrome P450 reductase at the amino acid level Selected. An EST clone (accession no. AV778635) that appears to contain the full-length coding region was obtained from Kazusa DNA Research Laboratories, and the DNA sequence was determined (hereinafter referred to as LjCPR1). Using LjCPR1-introduced plasmid (pBluescript SK (-)) as a template, using both primers of SEQ ID NO: 25 (GGGCGGCCGCACTAGTATCGATGGAAGAATCAAGCTCCATGAAG) and SEQ ID NO: 26 (TTAATTAATCACCATACATCACGCAAATAC) for 2 minutes at 94 ° C with KOD-Plus-DNA polymerase (TOYOBO) After the treatment, PCR consisting of 15 cycles (94 ° C. 20 seconds → 60 ° C. 40 seconds → 68 ° C. 120 seconds) was performed. Then, it kept warm at 68 degreeC for 2 minutes. The PCR product was ligated with pT7Blue T-vector (Novagen) using TAget Clone -Plus- (TOYOBO). After confirming the base sequence, it was digested with NotI and PacI, and the yeast expression vector pESC-LEU (Stratagene) was similarly digested with NotI and PacI. Then, both were ligated using DNA ligation Kit Ver. 2.1 (TaKaRa), and the yeast expression vector pESC-LjCPR1 of LjCPR1 was obtained. Next, the pAM-PAT-GW vector (a gift from Dr. Bekir Ulker and Imre E. Somssich of Max Planck Institute) was double digested with restriction enzymes XhoI and SpeI, and a DNA fragment containing the Gateway conversion cassette (Invitrogen) was obtained. Cut out. PELC-MCS2-GW was constructed by ligating the obtained DNA fragment with a larger fragment of two fragments obtained by double digestion of SalI and NheI with pESC-LjCPR1. For construction of pELC-MCS2-GW, E. coli DB3.1 strain (Invitrogen) was used.

Construction of yeast simultaneous expression vector pELC-CYP93E2 of LjCPR1 and CYP93E2 The plasmid (entry clone) having the polynucleotide shown in SEQ ID NO: 9 prepared in Example 2 and pELC-MCS2-GW were mixed, and Gateway LR Clonase II Enzyme By transferring the DNA fragment shown in SEQ ID NO: 9 to pELC-MCS2-GW by a base sequence-specific recombination reaction (attL x attR reaction) using Mix (Invitrogen), the gene shown in LjCPR1 and SEQ ID NO: 9 A co-expression vector pELC-CYP93E2 was obtained.

Construction of yeast simultaneous expression vector pELC-CYP716A12 of LjCPR1 and CYP716A12 The plasmid (entry clone) having the polynucleotide shown in SEQ ID NO: 10 prepared in Example 3 and pELC-MCS2-GW were mixed, and Gateway LR Clonase II Enzyme By transferring the DNA fragment shown in SEQ ID NO: 10 to pELC-MCS2-GW by base sequence-specific recombination reaction (attL x attR reaction) using Mix (Invitrogen), the gene shown in LjCPR1 and SEQ ID NO: 10 A co-expression vector pELC-CYP716A12 was obtained.

Preparation of transformed yeast expressing both OSC1 and CYP93E2 INVSc1 strain (Invitrogen) (MATa his3D1 leu2 trp1-289 ura3-52 MATAlpha his3D1 leu2 trp1-289 ura3-52) was transformed into Frozen-EZ Yeast Transformation II ( Zymo Research). First, the yeast INVSc1 strain was transformed with pYES3-ADH-OSC1, and then the resulting transformed yeast was transformed with pELC-CYP93E2 or pESC-LjCPR1 as a control.

Preparation of transformed yeast co-expressing OSC1 and CYP716A12 As in Example 8, the yeast INVSc1 strain was transformed with pYES3-ADH-OSC1, and then the resulting transformed yeast was transformed with pELC-CYP716A12 .

Confirmation of product in transformed yeast (pYES3-ADH-OSC1, pELC-CYP93E2) Yeast holding two vectors pYES3-ADH-OSC1 and pELC-CYP93E2 was added to 5 ml of SC-Trp / Leu medium at 30 ° C., 135 rpm, Cultured for 1 day. The cultured yeast was collected by centrifugation at 3000 g for 10 minutes, suspended in 10 ml SC-Trp / Leu-glucose medium supplemented with galactose (20 mg / ml) and hemin chloride (13 μg / ml), 30 ° C. Cultured at 135 rpm for 2 days. After 5 ml of ethyl acetate was added to the yeast culture and mixed, the ethyl acetate extract was recovered. This operation was repeated three times. The ethyl acetate extract was concentrated under reduced pressure. In the same manner, yeast carrying two vectors pYES3-ADH-OSC1 and pESC-LjCPR1 was cultured and extracted. In the ethyl acetate section, after removing the solvent by drying, N-methyl-N-trimethylsilyltrifluoroacetamide was added, and the mixture was heated at 80 ° C. for 30 minutes to be derivatized into a trimethylsilyl ether and used as a sample for GC-MS analysis. The identity of the transformant was determined by comparing the retention time of GC with the MS spectrum.

In addition to β-amylin (dotted arrow), the yeast extract containing two vectors pYES3-ADH-OSC1 and pELC-CYP93E2 (Figure 2, GC chart shown as OSC1 / LjCPR1 / CYP93E2) is unique. Two typical peaks (peak 1 and peak 2) were detected. Among them, the mass spectrum of peak 1 agreed very well with the mass spectrum of 24-hydroxy β-amylin (24-OH-β-amyrin). From the mass spectrum pattern, peak 2 was 24 acid (β-amyrin-24-oic acid), which was a further oxidized compound. On the other hand, β-amylin (dotted arrow) was detected from the yeast extract carrying the two vectors pYES3-ADH-OSC1 and pESC-LjCPR1 (Fig. 2, GC chart shown as OSC1 / LjCPR1) but peaked. Compounds corresponding to 1 and peak 2 were not detected. From the above results, CYP93E2 hydroxylates and further oxidizes the 24-position of β-amylin produced in yeast expressing β-amylin synthase (OSC1), and 24-OH-β-amyrin and β-amyrin-24- It was revealed that oic acid can be generated.

Confirmation of Product in Transformed Yeast (pYES3-ADH-OSC1, pELC-CYP716A12) Yeast having the two vectors pYES3-ADH-OSC1 and pELC-CYP716A12 was cultured, extracted, and extracted by the method described in Example 10. The extract was analyzed. From the yeast extract (Fig. 3, GC chart shown as OSC1 / LjCPR1 / CYP716A12) carrying two vectors, pYES3-ADH-OSC1 and pELC-CYP716A12, in addition to β-amylin (dotted arrow), it is unique Two typical peaks (peak 1 and peak 2) were detected. Among them, the mass spectrum of peak 2 agreed very well with the mass spectrum of the oleanolic acid preparation. Thus, it was found that peak 2 corresponds to oleanolic acid. Peak 1 was erythridiol in which the 28-position of β-amylin was hydroxylated from the mass spectrum pattern.

On the other hand, β-amylin (arrow) was detected from the yeast extract (Fig. 3, GC chart shown as OSC1 / LjCPR1) containing two vectors pYES3-ADH-OSC1 and pESC-LjCPR1, but peak 1 And no compound corresponding to peak 2 was detected. From the above results, it was clarified that CYP716A12 can generate oleanolic acid by converting the 28-position methyl group of β-amylin produced in yeast expressing β-amylin synthase (OSC1) into a carboxyl group.

This is surprising from the following. So far, in the process of triterpene oxidation, activity has been confirmed only in the CYP93, CYP88, and CYP72 families, and not in the CYP716 family. Furthermore, according to the June 22, 2010 update of Dr. Nelson's HP (http://drnelson.uthsc.edu/cytochromeP450.html), which names P450, there are three sequences in the CYP716 family that have been estimated and identified. (CYP716A14 Artemisia annua putative taxadiene 5-alpha-hydroxylase, CYP716D4 Stevia rebaudiana ent-kaurenoic acid 13-hydroxylase, CYP716D6 Artemisia annua putative taxane 13-alpha-hydroxylase). Both code for enzymes that perform hydroxylation on the skeleton of diterpenes, not triterpenes. When homologous search of CYP716A12 is performed with NCBI blastP, the top 100 sequences whose enzyme activity is specified are Q8W4T9.1 Taxane 13-alpha-hydroxylase (E value = 97% in the 97% region). 2e-104 and the same), AAU93341.1 taxadiene 5-alpha hydroxylase (94% 3e-101), AAN52360.1 5-alpha-taxadienol-10-beta-hydroxylase (94% 2e-97), AAO66199.1 taxane 14b -hydroxylase (95% 3e-95), AAS89065.2 taxoid 2-alpha-hydroxylase (93% 1e-92), Q9AXM6.1 5-alpha-taxadienol-10-beta-hydroxylase (94% 4e-92), AAT47183 .1 taxoid 10-beta hydroxylase (94% 1e-91), AAV54171.1 taxoid 2-alpha-hydroxylase (97% 3e-91), and so on. In both cases, they code for enzymes that oxidize diterpenes, not triterpenes. From these information, it was not considered that the genes of CYP716 family have triterpene oxidation ability.

Production of transformed yeast co-expressing OSC1, CYP93E2 and CYP716A12 The plasmid (entry clone) having the polynucleotide shown in SEQ ID NO: 10 and the destination vector pYES-DESTTM52 (Invitrogen) produced in Example 3 were mixed, By using Gateway LR Clonase II Enzyme Mix (Invitrogen), the DNA fragment represented by SEQ ID NO: 10 is transferred to pYES-DESTTM52 by base sequence-specific recombination reaction (GATEWAYTM attL x attR reaction). The yeast expression vector pDEST52-CYP716A12 of the gene was obtained. Next, the yeast carrying the two vectors pYES3-ADH-OSC1 and pELC-CYP93E2 prepared in Example 10 was transformed with pDEST52-CYP716A12 or pYES2 (Invitrogen) corresponding to the empty vector.

Confirmation of product in transformed yeast (pYES3-ADH-OSC1, pELC-CYP93E2, pDEST52-CYP716A12) 5 ml of SC-Trp containing 3 vectors of pYES3-ADH-OSC1, pELC-CYP93E2, and pDEST52-CYP716A12 / Leu / Ura medium was cultured at 30 ° C., 135 rpm for 1 day. The cultured yeast was collected by centrifugation at 3000 g for 10 minutes, suspended in 10 ml of SC-Trp / Leu / Ura-glucose medium supplemented with galactose (20 mg / ml) and hemin chloride (13 μg / ml), 30 The cells were cultured at 135 ° C. for 2 days. After 5 ml of ethyl acetate was added to the yeast culture and mixed, the ethyl acetate extract was recovered. This operation was repeated three times. The ethyl acetate extract was concentrated under reduced pressure. In the same manner, culture and extraction were performed for the control yeast carrying the three vectors pYES3-ADH-OSC1, pELC-CYP93E2, and pYES2. In the ethyl acetate section, after removing the solvent by drying, N-methyl-N-trimethylsilyltrifluoroacetamide was added, and the mixture was heated at 80 ° C. for 30 minutes to be derivatized into a trimethylsilyl ether and used as a sample for GC-MS analysis.

In addition to β-amylin, the yeast extract (Fig. 4: GC chart shown as bAS / CPR / CYP93E2 / CYP716A12) containing three vectors pYES3-ADH-OSC1, pESC-CYP93E2, and pDEST52-CYP716A12 In addition to the 24-OH-β-amyrin, β-amyrin-24-oicoacid, erythridiol, and oleanolic acid peaks shown in (Example 10) and (Example 11), four specific peaks Was detected. Among them, the mass spectrum of peak 1 (FIG. 5) agreed very well with the mass spectrum of the standard hederagenin.

On the other hand, from the yeast extract containing the three vectors pYES3-ADH-OSC1, pESC-CYP93E2, and pYES2 (Fig. 4: GC chart shown as OSC1 / CPR / CYP93E2) that was used as a control experiment, No oxidation or further acidification was detected. From the above results, it is clear that oleanolic acid and related triterpenoids with β-amylin as the basic skeleton can be produced by co-expressing CYP93E2 and CYP716A12 in yeast expressing β-amylin synthase (OSC1). became.

Sequence Extraction from Public Database of CYP716A12 Homologous Genes In order to verify that the enzyme having the activity to oxidize the methyl group at position 28 of the oleanane-type triterpene of the present invention is not limited to Taruma palm by homology search, A polynucleotide sequence having high base sequence identity with the full-length coding region of CYP716A12 was searched from among the base sequences registered in the public EST database of plants.

LEFL3159E12 was found from the full-length tomato cDNA database (http://www.pgb.kazusa.or.jp/kaftom/blast.html). The full length coding region deduced from LEFL3159E12 is SEQ ID NO: 11, and the polypeptide sequence deduced therefrom is SEQ ID NO: 3. SEQ ID NO: 3 had 74.2% identity to the amino acid sequence of CYP716A12.

From the public EST database of Miyakogusa (http://est.kazusa.or.jp/en/plant/lotus/EST/blast.html), AV768711 corresponding to a partial sequence of Miyakogusa cDNA fragment was found. A cDNA clone (MWL008g03) containing the sequence of AV768711 was obtained from National BioResource Project Miyakogusa soybean, and the full-length sequence of Miyakogusa-derived cDNA contained in MWL008g03 was determined. The full-length coding region deduced from MWL008g03 is SEQ ID NO: 12, and the polypeptide sequence deduced therefrom is SEQ ID NO: 4. SEQ ID NO: 4 had 79.5% identity to the amino acid sequence of CYP716A12.

The Blast search site (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi?) Of NCBI (The National Center for Biotechnology, Information, advances, science, and health) has been published. The gene sequence accession no. XM_002268434.1 (Vitis vinifera hypothetical protein LOC100251813) predicted from the genome sequence was found. This sequence could be expected to encode the full length.

The Gene Index Project site (http://compbio.dfci.harvard.edu/tgi/tgipage.html) of the DFCI (Dana-Farber Cancer Institute, Harvard School of Public Public Health) Using the information of Beet Release 2.0 (May 19, 2008), we found one gene fragment, TC8082. Meanwhile, accession no. FG344256.1 (SF_01-a06 Bv_T1 Beta vulgaris subsp. Vulgaris cDNA clone SF_01-a06 reverse, mRNA sequence. ) Was found. Although both sequences do not contain the full-length gene, TC8082 could be expected to contain an N-terminal sequence and FG344256.1 would contain a C-terminal sequence from homology analysis.

From the published EST data information of olives to the NCBI Blast search site, the accession no. GO244188.1 (OEAA-070810_Plate3p13.b1 cDNA library from Olive leaves and fruits Olea europaea cDNA, mRNA sequence) was found. Although this sequence does not contain the full-length gene, it could be expected to contain a C-terminal sequence from homology analysis.

From the published data information of olives on the NCBI Blast search site, accession no. GT020247.1 (TransId-279278 CarCatBudEnri2 Coffea arabica cDNA clone CarCatBudEnri2_59-D09- PAL17d similar to Cytochrome P450 monooxygenase CYP716A12-Medicago truncatula (Barrel medic), mRNA sequence.) Was found. Although this sequence does not contain the full-length gene, it could be expected to contain a C-terminal sequence from homology analysis.

Acquisition of full-length sequence of CYP716A12 homologous gene Among the sequences obtained in Example 14, grapes that are reported to contain oleanolic acid (Casado and Heredia1, J. Exp. Bot., 50, 175-182, 1999), Beets (Connolly, Phytochemistry, 37, 1994, 1667-1670), olives (Bianchi et al., Phytochemistry, 32, 1992, 49-52) and coffee known to accumulate ursolic acid (Jager et al., Molecules 2009) , 14, 2016-2031).

For grapes, the peel of grapes (variety red glove) sold for raw consumption purchased at a grocery store was crushed with liquid nitrogen. Total RNA was extracted using the CTAB (Cetyltrimethylammonium bromide) method (Chang et al., 1993. Plan Mol Biol Rep 11: 113-116). Total cDNA synthesis was performed using the Superscript First Strand System (Invitrogen). Using this cDNA as a template, PCR was performed at a primer sequence number 27 (U910: caccATGGAGGTGTTCTTCCTCTC) and sequence number 28 (U911: CTATGGTTTGCGAGGATGGA) at an annealing temperature of 55 ° C. corresponding to the N-terminus and C-terminus of (Example 14). The gene was amplified by 30 cycles (using PrimeSTAR HS DNA Polymerase manufactured by Takara Bio Inc.). This was cloned into a pENTR ^™ / D-TOPO entry vector (Invitrogen). Polynucleotide sequences were determined for the 8 independent clones obtained. The sequence thus obtained is SEQ ID NO: 13, and the polypeptide sequence (SEQ ID NO: 5) deduced therefrom has 100% identity to the amino acid sequence of XM_002268434.1 registered in GenBank. Was. The amino acid sequence of CYP716A12 had 75.3% identity. This vector was designated as pTOPO-PSGrape.

For beets, seeds of Detroit Dark Red (Takii Seed & Seed Co., Ltd.) were sown on commercially available culture soil, and the whole plant one week later was crushed with liquid nitrogen. RNA was extracted with RNeasy (Qiagen), and total cDNA was synthesized using Superscript First Strand System (Invitrogen). The portion corresponding to the N-terminus and C-terminus of (Example 14) is primer SEQ ID NO: 29 (U908: caccATGGAGCTCTTCTTCCTTT) and SEQ ID NO: 30 (U909: TTAAGCAGCAACAATTTGAGGAT), PCR at an annealing temperature of 55 ° C. The gene was amplified by using PrimeSTAR HS DNA Polymerase. This was cloned into a pENTR ^™ / D-TOPO entry vector (Invitrogen). Polynucleotide sequences were determined for the 8 independent clones obtained. The sequence obtained thereby was SEQ ID NO: 14, and the polypeptide sequence deduced therefrom (SEQ ID NO: 6) had 71.2% identity to the amino acid sequence of CYP716A12. This vector was designated as pTOPO-PSBeet.

For olives, the leaves of the cultivar Nevadiro bronco were crushed with liquid nitrogen. RNA was extracted with RNeasy (Qiagen), and total cDNA was synthesized using GeneRacer ^™ kit (Invitrogen). The N-terminal sequence was determined from a partial sequence of (Example 14) using a primer (SEQ ID NO: 31 U912: ATTCCCCAGGAGCTTTTGAT) and a 5'race primer attached to the GeneRacer ^TM kit. Place the primer corresponding to N-terminal and C-terminal with primer SEQ ID NO: 32 (U916: caccATGGAGTTCTTCTATGTCTCTCTTC) and SEQ ID NO: 33 (U907: TTAAGCATTAAGGGGATAAAGAC), PCR at 30 ° C annealing temperature (30 cycles, PrimeSTAR HS DNA Polymerase manufactured by Takara Bio Inc.) Use) to amplify the gene. This was cloned into a pENTR ^™ / D-TOPO entry vector (Invitrogen). Polynucleotide sequences were determined for the 8 independent clones obtained. The sequence obtained thereby was SEQ ID NO: 15, and the polypeptide sequence deduced therefrom (SEQ ID NO: 7) had 78.0% identity to the amino acid sequence of CYP716A12. This vector was designated as pTOPO-PSOlive.

For coffee, the leaves of cultivar Blue Mountain were crushed with liquid nitrogen. RNA was extracted with RNeasy (Qiagen), and total cDNA was synthesized using GeneRacer ^™ kit (Invitrogen). The N-terminal sequence was determined from a partial sequence of (Example 14) using a primer (SEQ ID NO: 34 U914: CGCTCACAAACAATCTGGAA) and a 5'race primer attached to the GeneRacer ^TM kit. PCR corresponding to primer sequence number 35 (U917: caccATGGAGTTTTTCTATGTCTCTTTG) and sequence number 36 (U906: TTAGGCCTTGTGTGGAAAAA) at the annealing temperature of 55 ° C (30 cycles, using PrimeSTAR HS DNA Polymerase manufactured by Takara Bio Inc.) ) Amplified the gene. This was cloned into a pENTR ^™ / D-TOPO entry vector (Invitrogen). Polynucleotide sequences were determined for the 8 independent clones obtained. The sequence obtained thereby was SEQ ID NO: 16, and the polypeptide sequence deduced therefrom (SEQ ID NO: 8) had 71.3% identity to the amino acid sequence of CYP716A12. This vector was designated as pTOPO-PSCoffee.

Preparation of transformed yeast co-expressing OSC1 and CYP716A12 homologous genes Each of the four plasmids (pTOPO-PSGrape, pTOPO-PSBeet, pTOPO-PSOlive, pTOPO-PSCoffee) and pELC-MCS2-GW prepared in Example 15 By mixing each, and transferring each to pELC-MCS2-GW by base sequence specific recombination reaction (attL x attR reaction) using Gateway LR Clonase II Enzyme Mix (Invitrogen), LjCPR1 and each gene The coexpression vectors pELC-Grape, pELCBeet, pELC-Olive, and pELC-Coffee were obtained. As in Example 8, the yeast INVSc1 strain was transformed with pYES3-ADH-OSC1, and then the resulting transformed yeast was transformed with pELC-Grape, pELCBeet, pELC-Olive, or pELC-Coffee.

Confirmation of products in transformed yeast (pYES3-ADH-OSC1 and pELC-Grape, pYES3-ADH-OSC1 and pELC-Beet, pYES3-ADH-OSC1 and pELC-Olive, pYES3-ADH-OSC1 and pELC-Coffee) pYES3 -Yeast holding two vectors of -ADH-OSC1 and pELC-CYP716A12 were cultured, extracted and analyzed by the method described in Example 10. Four types of pYES3-ADH-OSC1 and pELC-Grape, pYES3-ADH-OSC1 and pELC-Beet, pYES3-ADH-OSC1 and pELC-Olive, and pYES3-ADH-OSC1 and pELC-Coffee. From the yeast extract (Figures 6 to 9, OSC1 / LjCPR1 / Grape, OSC1 / LjCPR1 / Beet, OSC1 / LjCPR1 / Olive, GC chart shown as OSC1 / LjCPR1 / Coffee), β-amylin (dotted arrow) In addition, two specific peaks (peak 1 and peak 2) were detected. Among them, the mass spectrum of peak 2 agreed very well with the mass spectrum of the oleanolic acid preparation, and peak 2 was found to correspond to oleanolic acid. Peak 1 was erythridiol in which the 28-position of β-amylin was hydroxylated from the mass spectrum pattern.

From the above results, the CYP716A12 homologous gene product obtained from grape, beet, and olive that accumulates oleanolic acid has a methyl group at the 28th position of β-amylin produced in yeast expressing β-amylin synthase (OSC1). It was revealed that it can be converted to a carboxyl group to produce oleanolic acid. It could also be shown that its activity is much higher than the gene of Taruma palm. On the other hand, it was clarified that coffee that accumulates ursolic acid, which is a pentacyclic triterpene compound, can convert the methyl group at the 28-position of β-amylin to a carboxyl group to produce oleanolic acid.

Gene expression analysis in grape tissue Total RNA was extracted using leaves and pericarp (CTAB) of grape cultivar "Campbell berry A". cDNA was synthesized by SuperScript III first strand synthesis system (Invitrogen). Primers (CACTTTCTGGCTAGCTTGCCG (SEQ ID NO: 37): U919 and CATGAATATCTCATCTTTTG (SEQ ID NO: 38): U920) were prepared based on the oleanolic acid synthase gene SEQ ID NO. 95 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. for 3 minutes) were performed 25 times, 72 ° C. for 5 minutes). It is known that the content of oleanolic acid in grapes is less than 1/10 of that in the leaves (GRNCAREVIC and RADLER (1971) A review of the surface lipids of grapes and their importance in the drying process. J. Enol. Vitic. 22: 80-86.). As shown in FIG. 10, it was found that the expression of the oleanolic acid synthase gene was high in the pericarp on the leaves. In this way, identification of tissues with high oleanolic acid content is possible by gene expression analysis, and by analyzing the correlation between oleanolic acid compounds and composition, genes such as variety evaluation and QTL are not only increased Analysis has become possible, and it has been shown that gene expression markers can be produced.

Construction of the yeast expression vector pYES-ADH-GuLUS for the Uralcanus-derived lupeol synthase (GuLUS) gene cDNA First, pYES3 / CT (AUR) -Gateway-1 used to introduce the Uralcanus-derived lupeol synthase (GuLUS1) gene The vector was produced by the method shown below.

pAUR123 (TaKaRa) from 5968 to 6959 bases (PADH1 to TADH1 region) with SEQ ID NO: 39 (GGATGATCCACTAGTGGATCCTCTAGCTCCCTAACATGTAGGTGG) and SEQ ID NO: 40 (TAATGCAGGGCCGCAGGATCCGTGTGGAAGAACGATTACAACAGG) using both primers (DNA) by KODTO PlusBO After treatment at 94 ° C. for 2 minutes, PCR consisting of 20 cycles of (94 ° C. for 20 seconds → 55 ° C. for 40 seconds → 68 ° C. for 90 seconds) was performed. Then, it kept warm at 68 degreeC for 2 minutes. In addition, the region except pYES3 / CT (Invitrogen) from 1st to 960th bases (PGAL1 to CYC1TT) is KOD-Plus- DNA polymerase using both SEQ ID NO: 41 (TGCGGCCCTGCATTAATGAATCGGCCACG) and SEQ ID NO: 42 (ACTAGTGGATCATCCCCACGCGCCCTGTAG). (TOYOBO) performed PCR as described above. Both PCR products were ligated using In-Fusion Dry-Down PCR Cloning Kit (clontech) to obtain a pYES3 / CT (AUR) vector. The obtained pYES3 / CT (AUR) vector was cleaved with a restriction enzyme SmaI and ligated with Gateway-Vector-Conversion-System-Reading-frame-B (Invitrogen) to construct a pYES3 / CT (AUR) -Gateway-1 vector.

Next, total RNA was prepared from a stron of G. uralensis. First-strand cDNA synthesis was performed using 1 μg of the total RNA obtained and SMART RACE cDNA amplification kit (Clontech) according to the attached protocol. Using 2 μl each of the obtained first strand cDNA as a template, the 5 ′ non-specific sequence of the rupeol synthase gene mRNA sequence (AB116228, Hayashi et al. 2004 Biol. Pharm. Bull. 27: 1086-1092) isolated from Spanish licorice Using PCR primers SEQ ID NO: 43 (5 'side = CACCGTACTACTAGGCGAGGCAATTAAAGCG) and SEQ ID NO: 44 (3' side = TGGTCAATAACTGTGAGCACACAAGACT) designed at locations including the translation region and translation stop codon, PCR was performed at an annealing temperature of 53 ° C (30 cycles, TOYOBO KOD plus ver.2 polymerase manufactured by the company was used). Since it is necessary for cloning into the pENTR ^™ / D-TOPO entry vector (Invitrogen), 4 bases (cacc) are artificially added to the 5 ′ end of the primer with SEQ ID NO: 1. ing. A DNA fragment of about 2.3 kb amplified as a result of PCR was cloned into a pENTR ^™ / D-TOPO entry vector (production of entry clones), and the polynucleotide sequences of the three independent clones obtained were determined. The sequence thus obtained was SEQ ID NO: 45, and the polypeptide sequence deduced therefrom (SEQ ID NO: 46) had 99% identity to the amino acid sequence of Spanish licorice lupeol synthase. .

A plasmid (entry clone) having a lupeol synthase (GuLUS) gene from Ural licorice mixed with pYES3 / CT (AUR) -Gateway-1 vector, and base sequence specific using GatewayGateLR Clonase II Enzyme Mix (Invitrogen) The recombination reaction (attL x attR reaction) to transfer the DNA fragment shown in SEQ ID NO: 3 to pYES3 / CT (AUR) -Gateway-1 to obtain the Ural licorice GuLUS gene yeast expression vector pYES3-ADH-LUS It was.

Construction of transgenic yeast that co-expresses CYP716A12 homologous genes obtained from GuLUS and CYP716A12, GuLUS and grape, beet, olive and coffee, and transformed yeast (pYES3-ADH-LUS and pELC-CYP716A12, pELC-Grape, pELC -Beet, pELC-Olive, pELC-Coffee) Confirmation of product In the same manner as in Example 8, the yeast INVSc1 strain was transformed with pYES3-ADH-LUS, and then the resulting transformed yeast was transformed into pELC-CYP716A12. , pELC-Grape, pELC-Beet, pELC-Olive, pELC-Coffee, and transformed yeast that co-expresses CYP716A12 homologous genes obtained from GuLUS and CYP716A12, GuLUS and grape, beet, olive, and coffee. Obtained. About the yeast which hold | maintains these two vectors, it culture | cultivated by the method shown in Example 10, extraction, and the analysis of the extract were performed. From the yeast extract carrying the two vectors pYES3-ADH-LUS and pELC-CYP716A12 (Figure 12, GC chart indicated as LUS / CPR / CYP716A12), in addition to lupeol (dotted arrow), specific Two peaks (peak 1 and peak 2) were detected. Among them, the mass spectrum of peak 1 agreed very well with the mass spectrum of the betulin preparation. This revealed that peak 1 corresponds to betulin. The mass spectrum of peak 2 agreed very well with the mass spectrum of the betulinic acid preparation. This revealed that peak 2 corresponds to betulinic acid.

On the other hand, lupeol (dotted arrow) was detected from the yeast extract carrying the two vectors pYES3-ADH-LUS and pESC-LjCPR1 (FIG. 12, GC chart indicated as LUS / CPR), but peak 1 No compound corresponding to peak 2 was detected. Similarly, betulin (peak 1) and betulinic acid (peak 1) and betulinic acid (peak 1) and homologous genes of CYP716A12 obtained from grape (Fig. 13), beet (Fig. 14), olive (Fig. 15) and coffee (Fig. 16) instead of CYP716A12 Peak 2) was obtained. From the above results, it was revealed that CYP716A12 and homologous genes can convert betulinic acid by converting the 28-position methyl group of lupeol produced in yeast expressing lupeol synthase (LUS) to a carboxyl group.

Construction of yeast expression vector pYES-ADH-OeOEA of olive-derived α-amylin synthase (OeOEA) gene cDNA No gene that produces only α-amylin is known. However, from the report of Saimaru et al. (Chem. Pharm. Bull. 55: 784-788 (2007)), we read that the gene mainly produces α-amylin and decided to use this gene. Using the obtained first-strand cDNA obtained in (Example 15) as a template, the positions corresponding to the N-terminal and C-terminal from the same paper are the primer SEQ ID NO: 47 (U921: caccATGTGGAAGCTTAAGATTGCTG) and SEQ ID NO: 48 (U922: TTACAGGCTTTGAGATGACCA) The gene was amplified by PCR at an annealing temperature of 55 ° C. (30 cycles, using PrimeSTAR HS DNA Polymerase manufactured by Takara Bio Inc.). This was cloned into a pENTR ^™ / D-TOPO entry vector (Invitrogen). Polynucleotide sequences were determined for the 8 independent clones obtained. The sequence obtained thereby was SEQ ID NO: 49, and the polypeptide sequence deduced therefrom (SEQ ID NO: 50) had 99.7% identity to the amino acid sequence of the paper.

A plasmid (entry clone) containing the α-amylin synthase (OeOEA) gene derived from olive and pYES3 / CT (AUR) -Gateway-1 vector are mixed, and base sequence specific using GatewayGateLR Clonase II Enzyme Mix (Invitrogen) By recombination reaction (attL x attR reaction), the DNA fragment shown in SEQ ID NO: 3 was transferred to pYES3 / CT (AUR) -Gateway-1 to obtain olive OeOEA gene yeast expression vector pYES3-ADH-OEA .

OeOEA and CYP716A12, GuLUS and CYP716A12 homologous genes obtained from grapes, beets, olives and coffee, and the generation of transformed yeasts (pYES3-ADH-OEA and pELC-CYP716A12, pELC-Grape, pELCBeet , pELC-Olive, pELC-Coffee) In the same manner as in Example 8, the yeast INVSc1 strain was transformed with pYES3-ADH-OEA, pELC-Grape, pELC-Beet, pELC-Olive, pELC-Coffee. Subsequently, the obtained transformed yeast was transformed with pELC-CYP716A12 to obtain a transformed yeast co-expressing CYP716A12 homologous genes obtained from OeOEA and CYP716A12, GuLUS and grape, beet, olive and coffee. . About the yeast which hold | maintains these two vectors, it culture | cultivated by the method shown in Example 10, extraction, and the analysis of the extract were performed. In addition to α-amylin (dotted arrow), the yeast extract carrying two vectors, pYES-ADH-OeOEA and pELC-CYP716A12 (FIG. 18, GC chart indicated as CPR / aAS / CYP716A12) is specific. Two peaks (peak 1 and peak 2) were detected. Among them, the mass spectrum of peak 1 agreed very well with the mass spectrum of Ubaol. Thus, it was found that peak 1 corresponds to ubaol. The mass spectrum of peak 2 agreed very well with the mass spectrum of the ursolic acid preparation. Thus, it was found that peak 2 corresponds to ursolic acid.

On the other hand, α-amylin (dotted arrow) was detected from the yeast extract (Fig. 12, GC chart indicated as CPR / aAS) containing two vectors pYES-ADH-OeOEA and pESC-LjCPR1, but peak 1 No compound corresponding to peak 2 was detected. Similarly, CYP716A12 homologous genes obtained from grapes (Fig. 19), beets (Fig. 20), olives (Fig. 21), and coffee (Fig. 22) instead of CYP716A12 of tarumago palm also have ubaol (peak 1) and ursolic acid ( Peak 2) was obtained. From the above results, it is clear that CYP716A12 and homologous genes can convert ursolic acid by converting the methyl group at position 28 of α-amylin generated in yeast expressing α-amylin synthase (aAS) to a carboxyl group. It was.

Comparative Example 1

Identification of oleanolic acid synthesis gene candidates from grapes As in Example 18, grapes are rich in oleanolic acid in the skin. The DCFI (Release 7.0 (April 17, 2010)) mentioned above as the EST database for the pericarp contains Green Grape Skin Triplex2 Library (326 EST), Ripe Grape Skin Triplex2 Library (588 EST), Green Grape Berry Skins Lambda Triplex2 Library (226 EST ), Ripe Grape Berry Skins Lambda Triplex2 Library (79 EST) is registered. Among them, a gene fragment considered as P450 and further a gene homologous to CYP716A16 could not be found.

The method for producing a pharmacologically active pentacyclic triterpene compound using the 28-position oxidase and the gene encoding the same of the present invention is useful because it enables mass production as compared with a natural extraction method.

Sequence number 17-44, 47, 48: Primer

Claims

A protein having the activity of converting the methyl group at position 28 of a pentacyclic triterpene to a hydroxymethyl group or a carboxyl group.
2. The protein according to claim 1, which is derived from a plant belonging to legumes, eggplants, vines, red crustaceae, oleaceae or rhesaceae.
The protein according to claim 1 or 2, which is derived from Taruma palm, tomato, Miyakogusa, grape, beet, olive or coffee.
The protein according to claim 1, which is selected from the group consisting of the following (a) to (c).
(A) a protein comprising the amino acid sequence shown in any of SEQ ID NOs: 2 to 8 (b) one or several amino acids are deleted, substituted, inserted or added in the amino acid sequence shown in any of SEQ ID NOs: 2 to 8 (C) a protein comprising an amino acid sequence having 70% or more sequence identity with the amino acid sequence shown in any of SEQ ID NOs: 2 to 8
The protein according to any one of claims 1 to 4, wherein the pentacyclic triterpene is oleanane type, ursan type, or lupine type triterpene.
The protein according to any one of claims 1 to 5, which belongs to cytochrome P450.
Recombinant DNA containing DNA selected from the group consisting of the following (a) to (f).
(A) DNA encoding a protein comprising the amino acid sequence shown in any one of SEQ ID NOs: 2 to 8
(B) including an amino acid sequence in which one or several amino acids are deleted, substituted, inserted or added in the amino acid sequence shown in any of SEQ ID NOs: 2 to 8, and a methyl group at position 28 of the pentacyclic triterpene Which encodes a protein having an activity of converting acetylene into a hydroxymethyl group or a carboxyl group
(C) including an amino acid sequence having 70% or more sequence identity with the amino acid sequence shown in any of SEQ ID NOs: 2 to 8, and the methyl group at position 28 of the pentacyclic triterpene as a hydroxymethyl group or a carboxyl group DNA encoding a protein having an activity to convert
(D) DNA comprising the base sequence shown in any of SEQ ID NOs: 10 to 16
(E) hybridizing under stringent conditions with a DNA having a base sequence complementary to the base sequence shown in any of SEQ ID NOs: 10 to 16, and replacing the methyl group at position 28 of the pentacyclic triterpene with hydroxymethyl DNA encoding a protein having an activity of converting to a group or carboxyl group
(F) a base sequence having 70% or more sequence identity to the base sequence shown in any of SEQ ID NOs: 10 to 16, and the methyl group at position 28 of the pentacyclic triterpene as a hydroxymethyl group or a carboxyl group DNA encoding a protein having an activity to convert
A transformant comprising the recombinant DNA according to claim 7.
The transformant according to claim 8, wherein the transformant is a transformant obtained using a microorganism or a plant as a host.
The transformant according to claim 9, wherein the microorganism is yeast.
The transformant according to any one of claims 8 to 10, which has the ability to produce a pentacyclic triterpene having a hydroxymethyl group or a carboxyl group at position 28 or a derivative thereof.
Culturing the transformant according to any one of claims 8 to 11 in a medium, producing and accumulating the protein according to claim 4 in the culture, and collecting the protein from the culture The method for producing the protein.
A transformant culture according to any one of claims 8 to 11 or a processed product of the culture is used as an enzyme source, and the enzyme source and a pentacyclic triterpene or derivative thereof as a substrate are used as an aqueous medium. A pentacyclic triterpene or a derivative thereof having a hydroxymethyl group or a carboxyl group at the 28-position in the medium, and accumulating in the medium, and a pentacyclic system having a hydroxymethyl group or a carboxyl group at the 28-position from the medium A method for producing a pentacyclic triterpene or a derivative thereof having a methyl group or a carboxyl group at the 28-position by collecting the triterpene or a derivative thereof.
A processed product of the culture is a concentrate of the culture, a dried product of the culture, a cell obtained by centrifuging the culture, a dried product of the cell, a freeze-dried product of the cell, Surfactant treated product, ultrasonic treated product of the bacterial cell, mechanically ground treated product of the bacterial cell, solvent treated product of the bacterial cell, enzyme treated product of the bacterial cell, protein fraction of the bacterial cell The production method according to claim 13, which is an immobilized product of the microbial cell or an enzyme preparation obtained by extraction from the microbial cell.
The protein according to claim 1 and the pentacyclic triterpene or derivative thereof as a substrate are present in an aqueous medium to produce a pentacyclic triterpene or derivative thereof having a hydroxymethyl group or a carboxyl group at position 28 in the medium. A process for producing a pentacyclic triterpene having a hydroxymethyl group or a carboxyl group at position 28, or a derivative thereof having the hydroxymethyl group or carboxyl group at the 28th position, which is accumulated, and collecting the medium.
The production method according to any one of claims 13 to 15, wherein the pentacyclic triterpene as a substrate is β-amylin, α-amylin or lupeol.
DNA selected from the group consisting of the following (a) to (f).
(A) DNA encoding a protein comprising the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 8
(B) including an amino acid sequence in which one or several amino acids are deleted, substituted, inserted or added in the amino acid sequence shown in any of SEQ ID NOs: 4 and 6 to 8, and at the 28th position of the pentacyclic triterpene DNA encoding a protein having an activity of converting a methyl group into a hydroxymethyl group or a carboxyl group
(C) an amino acid sequence having 70% or more of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 8, and the methyl group at position 28 of the pentacyclic triterpene being a hydroxymethyl group or a carboxyl DNA encoding a protein having activity of converting to a group
(D) DNA comprising the base sequence shown in any one of SEQ ID NOs: 12 and 14 to 16
(E) It hybridizes under stringent conditions with a DNA having a base sequence complementary to the base sequence shown in any of SEQ ID NOs: 12 and 14 to 16, and has a methyl group at position 28 of a pentacyclic triterpene. DNA encoding a protein having an activity of converting to a hydroxymethyl group or a carboxyl group
(F) a base sequence having 70% or more sequence identity to the base sequence shown in any of SEQ ID NOs: 12 and 14 to 16, and the methyl group at position 28 of the pentacyclic triterpene is a hydroxymethyl group or a carboxyl DNA encoding a protein having activity of converting to a group