WO2013077440A1 - Plant for producing spirostan-type triterpene - Google Patents

Abstract

Provided is a plant belonging to the family Solanaceae, such as potato, which can accumulate therein a triterpene glycoside that can produce a spirostan-type triterpene after being hydrolyzed. A plant belonging to the family Solanaceae, in which a gene encoding a glycoalkaloid synthetase is suppressed, and which can accumulate therein a triterpene glycoside that can produce a spirostan-type triterpene after being hydrolyzed.

Description

Plants for producing spirostan-type triterpenes

The present invention relates to a method for producing a triterpene glycoside that produces a spirostan type triterpene after hydrolysis in a solanaceous plant such as potato, a method for producing a spirostan type triterpene such as yamogenin or neotigogenin by hydrolysis of the triterpene glycoside, The present invention relates to a method for producing a novel solanaceous plant such as potato that accumulates triterpene glycosides, and to a solanaceous plant such as potato for producing spirostan-type triterpenes.

Spirostan-type triterpenes are important as starting materials in the semisynthesis of steroidal drugs represented by corticosteroids and sex hormones. Diosgenin is a representative example, and it is known that about 60% of all steroidal drugs are calculated from diosgenin (Non-patent Document 1). The wild species of Mexican yam are mainly used as a material for making diosgenin. However, commercial cultivation is also carried out due to problems of environmental destruction and resource depletion, but the unit yield of yam is generally 1.5-2t / 10a (Non-patent Document 2), and the cultivation period is 4-5 years. Therefore, the yield in terms of period is low. Potato is a crop with a large unit yield of 4t / 10a (Statistical data of Hokkaido potato in 2003, Production and Distribution Promotion Division, Ministry of Agriculture, Forestry and Fisheries) in a cultivation period of about 4 to 5 months. It is. Although tomatoes have a long cultivation period, the unit yield is high at 9t / 10a (2005 Ministry of Agriculture, Forestry and Fisheries “Vegetable Production Shipment Statistics”), so the yield in terms of period is high. Therefore, if it becomes possible to produce spirostan-type triterpenes with potatoes and tomatoes, the effect is immeasurable.

Non-patent document 3 reviews the reports that spirostan-type triterpenes were detected in potatoes (Solanum tuberosum) and tomatoes (Solanum lycopersicum). It is reported that the published literature is from before 1966 and has been detected, and since then, quantitative reports have not been made even after the development of analytical techniques. Non-Patent Document 5 reports substances detected in wild species belonging to the potato subsection forming tubers. However, the spirostan-type triterpenes detected here are diosgenin and tigogenin, and yamogenin and neotigogenin are structural isomers and different substances. Again, quantitative values have not been reported, and it is expected to be a wild species with extremely low cultivatability and unit yield.

Potatoes accumulate many glycoalkaloids with sugars such as chaconine and solanine in tuber buds (buds), flower tissues, and tubers irradiated with light. Sapogenin, which is a non-sugar part of chaconine and solanine, is solanidine, but it is known that this does not become a starting material in the semisynthesis of steroid pharmaceuticals (Non-patent Document 1). Tomatoes also accumulate glycoalkaloids composed of tomatine in immature fruits and whole plants. However, there are no reports of attempts to change the glycoalkaloids of potatoes and tomatoes to spirostane-type triterpene accumulation.

Spirostane saponin has many unclear points regarding its own health functionality. Powdered yam tubers and their extracts are commercially available as alternatives to hormone replacement therapy. Although conversion to progesterone in the body is negative, the possibility of some other mechanism has been reported (Non-patent Document 1). Moreover, it is said that it is effective in nourishing tonic, and in recent years, there are reports of an anti-fatigue effect (Non-Patent Document 6) and a fat burning promoting action (Non-Patent Document 7). There are no known solanaceous plants such as potatoes that are effective in such nourishing tonic. Spirostan-type triterpenes have also been reported to prevent colorectal cancer (Non-patent Document 8) and hair growth effect (Patent Document 1).

JP 2006-273754

The present invention relates to a method for producing a triterpene glycoside that produces a spirostan type triterpene after hydrolysis in a solanaceous plant such as potato, a method for producing a spirostan type triterpene such as yamogenin or neotigogenin by hydrolysis of the triterpene glycoside, It is an object of the present invention to provide a method for producing a novel solanaceous plant such as potato that accumulates triterpene glycosides, and to provide a solanaceous plant such as potato for producing spirostan-type triterpenes.

The present inventor has conducted extensive studies to elucidate the relationship between glycoalkaloid biosynthetic genes and spirostan-type triterpenes. As a result, it was found that by suppressing the biosynthetic gene, solanaceous plants such as potatoes accumulate triterpene glycosides that generate spirostan-type triterpenes after hydrolysis, and completed the present invention.

That is, the present invention includes the following inventions.

[1] A plant body of a solanaceous plant in which a gene encoding a glycoalkaloid biosynthetic enzyme is suppressed, and a triterpene glycoside that produces a spirostan-type triterpene after hydrolysis can be accumulated in the plant body.

[2] The solanaceous plant is potato, and the gene encoding a glycoalkaloid biosynthetic enzyme is a gene comprising any of the following DNAs (a) to (d) and / or the following (e) to (h): The plant according to [1], wherein the triterpene glycoside generates yamogenin by hydrolysis.
(a) DNA consisting of the base sequence shown in SEQ ID NO: 2;
(b) a DNA that hybridizes with a DNA comprising a base sequence complementary to the DNA comprising the base sequence shown in SEQ ID NO: 2 under stringent conditions and encodes a protein having glycoalkaloid biosynthetic enzyme activity;
(c) DNA encoding a protein comprising a base sequence having 80% or more sequence identity with the base sequence shown in SEQ ID NO: 2 and having glycoalkaloid biosynthetic enzyme activity;
(d) DNA comprising a degenerate isomer of the base sequence shown in SEQ ID NO: 2;
(e) DNA consisting of the base sequence shown in SEQ ID NO: 21;
(f) a DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the DNA consisting of the base sequence shown in SEQ ID NO: 21 and encodes a protein having glycoalkaloid biosynthetic enzyme activity;
(g) a DNA consisting of a base sequence having 80% or more sequence identity with the base sequence shown in SEQ ID NO: 21 and encoding a protein having glycoalkaloid biosynthetic enzyme activity; and (h) shown in SEQ ID NO: 21 DNA consisting of degenerate isomers of the base sequence.

[3] The solanaceous plant is a tomato, and a gene encoding a glycoalkaloid biosynthetic enzyme is a gene comprising any of the following DNAs (i) to (l) and / or the following (m) to (p): The plant according to [1], wherein the triterpene glycoside generates neotigogenin by hydrolysis.
(i) DNA consisting of the base sequence shown in SEQ ID NO: 4;
(j) DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the DNA consisting of the base sequence shown in SEQ ID NO: 4 and encodes a protein having glycoalkaloid biosynthetic enzyme activity;
(k) a DNA encoding a protein comprising a base sequence having 80% or more sequence identity with the base sequence shown in SEQ ID NO: 4 and having glycoalkaloid biosynthetic enzyme activity;
(l) DNA comprising a degenerate isomer of the base sequence shown in SEQ ID NO: 4;
(m) a DNA comprising the base sequence represented by SEQ ID NO: 23;
(n) a DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the DNA consisting of the base sequence shown in SEQ ID NO: 23 and encodes a protein having glycoalkaloid biosynthetic enzyme activity;
(o) a DNA comprising a base sequence having 80% or more sequence identity with the base sequence shown in SEQ ID NO: 23 and encoding a protein having glycoalkaloid biosynthetic enzyme activity; and (p) shown in SEQ ID NO: 23 DNA consisting of degenerate isomers of the base sequence.

[4] A method of accumulating in a plant a triterpene glycoside that produces a spirostan-type triterpene after hydrolysis by cultivating the plant of any one of [1] to [3].

[5] By cultivating the plant body according to any one of [1] to [3], a triterpene glycoside that generates a spirostan-type triterpene after hydrolysis is accumulated in the plant body,
Isolating the accumulated glycoside,
A method for producing a spirostan-type triterpene using a plant body, comprising hydrolyzing the obtained glycoside and removing a sugar chain.

[6] (i) a step of isolating a nucleic acid that is genomic DNA or RNA from a solanaceous plant,
(ii) a step of reverse transcription and synthesizing cDNA when the nucleic acid of (i) is RNA;
(iii) amplifying a gene fragment containing the base sequence shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 21 or SEQ ID NO: 23 from the DNA obtained in the step (i) or (ii);
(iv) determining the presence of mutations and / or polymorphisms in the DNA;
And a method for selecting a plant having a mutation and / or polymorphism of a gene encoding a glycoalkaloid biosynthetic enzyme in a solanaceous plant.

[7] A solanaceous plant body selected by the method of [6], having a mutation and / or polymorphism in a gene encoding a glycoalkaloid biosynthetic enzyme and suppressing the activity of the glycoalkaloid biosynthetic enzyme.

[8] The expression ability of a gene encoding a glycoalkaloid biosynthetic enzyme selected by the method of [6] is suppressed relative to an existing variety, or the activity of a glycoalkaloid biosynthetic enzyme is compared with an existing variety A solanaceous plant that is inhibited and can accumulate triterpene glycosides that generate spirostan-type triterpenes after hydrolysis in the plant.

[9] A method of accumulating in a plant a triterpene glycoside that produces a spirostan-type triterpene after hydrolysis by breeding the plant according to [8].

[10] By breeding the plant according to [8], a triterpene glycoside that generates a spirostan-type triterpene after hydrolysis is accumulated in the plant.
We isolated the accumulated glycosides of spirostan type triterpene,
A method for producing a spirostan-type triterpene using a plant body, comprising hydrolyzing a glycoside of the obtained spirostan-type triterpene and removing a sugar chain.

This specification includes the contents described in the specification and / or drawings of Japanese Patent Application No. 2011-258288, which is the basis of the priority of the present application.

According to the present invention, in a solanaceous plant such as potato, a triterpene glycoside that produces a spirostan-type triterpene after hydrolysis can be accumulated, and a solanaceous plant such as potato in which the triterpene glycoside is accumulated is provided. . According to the present invention, it is possible to produce a solanaceous plant such as a potato characterized by containing the triterpene glycoside. Spirostan-type triterpenes can be obtained by hydrolyzing the triterpene glycosides produced by these plants and removing the sugars. Spirostan-type triterpenes can be used as a raw material for producing steroid compounds. By using the solanaceous plant such as potato of the present invention, steroid compounds exhibiting various useful physiological activities can be produced in large quantities and at low cost.

It is a figure which shows the result of having analyzed the homology of the biosynthesis gene E of a potato and a tomato with DNA analysis software GENETYX (Genetics company). Overall, very high homology is observed. FIG. 2 shows the results of analyzing the homology of potato and tomato biosynthetic gene E using DNA analysis software GENETYX (Genetics) (continuation of FIG. 1-1). It is a figure which shows the result of having analyzed the homology of the biosynthetic gene E of a potato and a tomato with DNA analysis software GENETYX (Genetics company) (continuation of FIG. 1-2). The structure of the gene E suppression vector is shown. FIG. 2 is a diagram showing the structure inside the right border (RB) and left border (LB) of the T-DNA of the gene part to be introduced, and the restriction enzyme site. It is a figure which shows the glycoalkaloid content of the in-vitro stem of a potato transformant. Error bars indicate standard deviation. It is a figure which shows the result of RT-PCR with respect to mRNA extracted from the invitro stem of a potato transformant. The glycoalkaloid content of the tuber epidermis of a potato transformant is shown. Error bars indicate standard deviation. It is a figure which shows the glycoalkaloid content of the young leaf of a tomato transformant. Error bars indicate standard deviation. It is a figure which shows the result of having analyzed the homology of the biosynthesis gene Y of a potato and a tomato with DNA analysis software GENETYX (Genetics company). Overall, very high homology is observed. FIG. 7 shows the results of analyzing the homology of potato and tomato biosynthetic gene Y with DNA analysis software GENETYX (Genetics) (continuation of FIG. 7-1). FIG. 7 shows the results of analyzing the homology of potato and tomato biosynthetic gene Y with DNA analysis software GENETYX (Genetics) (continuation of FIG. 7-2). The structure of the gene Y suppression vector is shown. FIG. 8 is a diagram showing the structure inside the right border (RB) and left border (LB) of the T-DNA of the gene portion to be introduced, and the restriction enzyme site. It is a figure which shows the glycoalkaloid content of the in-vitro stem of a potato transformant. It is a figure which shows the result of RT-PCR with respect to mRNA extracted from the invitro stem of a potato transformant. It is a figure which shows the glycoalkaloid content of the epidermis of the tuber of a potato transformant. Error bars indicate standard deviation. It is a figure which shows the glycoalkaloid content of the young leaf of a tomato transformant. Error bars indicate standard deviation. It is a figure which shows the GC chart of the triterpene saponin extracted from the in-vitro stem of the potato transformant. It is a figure which shows the enlarged view of GC chart of the triterpene saponin extracted from the in-vitro stem of the potato transformant. It is a figure which shows the mass spectrum of the peak of the triterpene saponin extracted from the in-vitro stem of the potato transformant. a to d correspond to a to d in FIG. It is a figure which shows the GC chart of a hydrolysis process of the triterpene saponin extracted from the in-vitro stem of the potato transformant, and un-processed. It is a figure which shows GC chart of the triterpene saponin extracted from the potato tuber and germination. It is a figure which shows the GC chart of the triterpene saponin extracted from the young leaf of the tomato transformant.

Hereinafter, the present invention will be described in detail.

The solanaceous plant such as potato producing the glycoside of the spirostan-type triterpene of the present invention (triterpene saponin) is a glycoalkaloid biosynthetic enzyme gene E (hereinafter referred to as gene E) and / or glycoalkaloid biosynthesizing a glycoalkaloid biosynthetic enzyme. Synthetic enzyme gene Y (hereinafter referred to as gene Y), preferably gene E, is suppressed, and a glycolucaloid biosynthetic enzyme encoded by gene E and / or a glycolucaloid biosynthetic enzyme encoded by gene Y is expressed. Rather, these enzymes are deleted. Here, eggplants such as potato include potato (Solanum tuberosum), tomato (Solanum lycopersicum), eggplant (Solanum melongena), capsicum (Capsium annum) and the like.

Here, the expression that gene E and / or gene Y is suppressed means that gene E and / or gene Y is not expressed, expression is decreased, or expression protein is expressed as gene E or gene. It means that the normal function of the expression product of Y is not maintained, that is, the enzyme activity is reduced or lost. The suppression of the gene can be caused by the complete deletion, partial deletion of the gene, deletion of the base of the base sequence of the gene, substitution, addition, insertion or the like. It can also occur due to suppression by RNA interference with siRNA or the like. The mutants in which the gene E and / or the gene Y of the present invention are suppressed include those in which these genes are artificially suppressed and those in which the gene is suppressed by a naturally occurring mutation in nature.

A triterpene glycoside that generates a spirostane-type triterpene after hydrolysis is a spirostan-type triterpene that is sugar-modified at position 3 in potato, a furostane-type triterpene that is sugar-modified at position 3, 26, or both, 16 It is characterized by the presence of a sugar chain which is a cholestane type triterpene in which the position, the 22nd position, the 26th position are oxidized, and the 3rd position, including the 3rd position, or a plurality thereof is sugar modified.

Hydrolysis of a triterpene glycoside that generates a spirostan-type triterpene after hydrolysis with an acid or the like removes the sugar chain by hydrolysis, thereby obtaining a non-sugar part (aglycone). The non-sugar part, spirostan type triterpene, can be used as a raw material for steroid pharmaceuticals.

Spirostan-type triterpenes (sapogenins), which are non-sugar parts (aglycones) of the glycosides of spirostan-type triterpenes that can accumulate in solanaceous plants, include yamogenin (yamagenin), tigogenin (tigogenin), neotigogenin (neotigogenin), solaspigenin (solaspigenin) And neosolaspigenin. Yamogenin accumulates in potatoes, neotigogenin accumulates in tomatoes, tigogenin accumulates in Cestrum diurnum, and solaspigenin and neosorapigenin accumulates in Solanum hispidum.

1. Glycoalkaloid biosynthetic enzymes encoded by glycoalkaloid biosynthetic enzymes E and Y The glycoalkaloid biosynthetic enzymes encoded by genes E and Y of the present invention are glycoalkaloid biosynthetic enzymes contained in solanaceae plants such as potatoes (Solanaceae). It is. The solanaceous family such as potato includes potato (Solanum tuberosum), tomato (Solanum lycopersicum), eggplant (Solanum melongena), capsicum (Capsium annum) and the like. The enzymes are membrane-bound cytochrome P450 monooxidase (gene E) and aminotransferase (gene Y). The glycoalkaloid obtained by the enzyme includes glycoalkaloids synthesized in solanaceous plants such as potato, and examples include glycoalkaloids such as potato chaconine and solanine, and glycoalkaloids such as tomato tomatine.

Preferred steroid compounds that serve as substrates for the glycoalkaloid biosynthetic enzymes include cholesterols that are C-26-OH or C-26-oxo. Examples of cholesterols include cholesterol, sitosterol, campesterol, stigmasterol, and brassicasterol. The glycoalkaloid biosynthetic enzyme is a hydroxylase that transfers a hydroxyl group thereto.

The full-length amino acid sequence of the enzyme encoded by gene E is shown in SEQ ID NO: 1 or 3. SEQ ID NO: 1 shows the amino acid sequence of an enzyme derived from potato (Solanum tuberosum), and SEQ ID NO: 3 shows the amino acid sequence of an enzyme derived from tomato (Solanum lycopersicum). The full-length amino acid sequence of the enzyme encoded by gene Y is shown in SEQ ID NO: 20 or 22. SEQ ID NO: 20 shows the amino acid sequence of an enzyme derived from potato (Solanum tuberosum), and SEQ ID NO: 22 shows the amino acid sequence of an enzyme derived from tomato (Solanum lycopersicum). Further, the enzyme includes an amino acid sequence represented by SEQ ID NO: 1, an amino acid sequence represented by SEQ ID NO: 3, an amino acid sequence represented by SEQ ID NO: 20, or an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 22. And an enzyme composed of a protein having glycoalkaloid biosynthetic enzyme activity. Here, as the substantially identical amino acid sequence, one or several (1 to 10, preferably 1 to 7, more preferably 1 to 5, more preferably 1 to 3) of the amino acid sequence. , More preferably 1 or 2 amino acid sequences deleted, substituted, inserted and / or added, or the amino acid sequence and BLAST (Basic Local Alignment Search Tool at the National Center for Biological Information ( US National Biological Information Center Basic Local Alignment Search Tool))) etc. (for example, default or default parameters), calculated at least 85%, preferably 90% or more, more preferably 95% or more Particularly preferred is an amino acid sequence having a sequence identity of 97% or more.

The glycoalkaloid biosynthetic enzyme of the present invention includes a natural glycoalkaloid biosynthetic enzyme isolated from a plant and a recombinant glycoalkaloid biosynthetic enzyme produced by genetic engineering techniques.

2. Genes E and Y encoding glycoalkaloid biosynthetic enzymes
Genes E and Y encoding a glycoalkaloid biosynthetic enzyme are genes encoding a glycoalkaloid biosynthetic enzyme having an activity of binding a hydroxyl group to a steroid compound (gene E) or an activity of transferring an amino group (gene Y). .

The base sequence of the DNA of glycoalkaloid biosynthetic enzyme gene E is shown in SEQ ID NO: 2 or 4. The base sequence of the DNA of glycoalkaloid biosynthetic enzyme gene Y is shown in SEQ ID NO: 21 or 23. Fig.1-1 to Fig.1-3 show the results of analyzing the homology of gene E between potato and tomato with DNA analysis software GENETYX (Genetics), and Fig.7-1 to Fig.7-3 show the result of potato and tomato. The result of analyzing the homology of gene Y with DNA analysis software GENETYX (Genetics) is shown. Furthermore, DNA that hybridizes under stringent conditions with DNA having a base sequence complementary to the base sequence shown in SEQ ID NO: 2, 4, 21, or 23, base shown in SEQ ID NO: 2, 4, 21, or 23 Calculated using sequences and BLAST (Basic Local Alignment Search Tool Tool atat the National National Center for Biological Information) (eg, using default or default parameters) DNA having a sequence identity of at least 85% or more, preferably 90% or more, more preferably 95% or more, particularly preferably 97% or more, or the amino acid sequence of a protein encoded by the DNA Or 1 to several (1 to 10, preferably 1 to 7, more preferably 1 to 5, more preferably DNA encoding a protein comprising an amino acid sequence in which 1 to 3, more preferably 1 or 2 amino acids are deleted, substituted, inserted and / or added, and has glycoalkaloid biosynthetic enzyme activity It includes DNA encoding a protein having a protein. Here, “stringent conditions” are, for example, “1XSSC, 0.1% SDS, 37 ° C.” conditions, and more severe conditions are “0.5 XSSC, 0.1% SDS, 42 ° C.” conditions. There are more severe conditions such as “0.2XSSC, 0.1% SDS, 65 ° C.”. Furthermore, the gene of the present invention includes DNA consisting of a degenerate isomer of the base sequence shown in SEQ ID NO: 2, 4, 21 or 23.

3. Suppression of glycoalkaloid biosynthetic enzyme gene E and / or glycoalkaloid biosynthetic enzyme gene Y Glycoalkaloid biosynthetic enzyme gene E and / or glycoalkaloid biosynthetic enzyme gene Y in solanaceous plants is artificially produced using various methods. Can be suppressed. For example, gene expression can be suppressed by using RNAi. RNAi can be performed by expressing an RNA fragment complementary to a gene whose expression is to be suppressed in the plant. For example, a recombinant vector capable of expressing an RNA fragment may be introduced into a plant body. The length of RNA used for RNAi is not limited. The length of the oligo RNA of the present invention is, for example, 10 to 100 bases, preferably 15 to 25 bases, and more preferably 19 to 23 bases.

Alternatively, the gene may be deleted by a known homologous recombination method. The homologous recombination method is a method in which only a target gene is arbitrarily modified by homologous gene recombination between a gene on a chromosome and foreign DNA, and for the purpose of dividing the sequence encoding the protein, Insert another DNA sequence into the exon. A targeting vector may be designed and produced based on gene sequence information, and the gene to be suppressed may be homologously recombined using the targeting vector.

The vector incorporates a component related to expression or suppression of a gene such as a promoter, terminator, enhancer and the like, and contains a selection marker (for example, drug resistance gene, antibiotic resistance gene, reporter gene) as necessary. Constituent elements relating to gene expression and suppression are preferably incorporated into a recombinant vector in such a manner that they can function according to their properties. Such an operation can be appropriately performed by those skilled in the art.

In addition, the gene can be suppressed by an antisense method, a ribozyme method, a method using a retrovirus, a method using a transposon, or the like. By introducing a recombinant vector used for suppressing the above gene into a plant, a plant body in which the gene is suppressed can be obtained. The method for introducing the recombinant vector is not particularly limited as long as it is a method for introducing DNA into a microorganism. For example, methods using calcium ions (Cohen et al., Proc. Natl. Acad. Sci., USA, 69: 2110 (1972)), electroporation method, tri-parental mate mating method and the like can be mentioned. In addition, examples of a method for producing a transformed plant include a method using a virus, an Agrobacterium Ti plasmid, an Ri plasmid, etc. The transformed plant is a plant cell transformed with the gene of the present invention. The plant body can be regenerated from the plant cell by a known method.

Triterpene glycosides that produce spirostane-type triterpenes after hydrolysis can be produced by cultivating the plant obtained by the above method.

4. Selection of gene mutation, polymorphic individual, and gene expression mutation The present invention relates to mutation, single nucleotide polymorphism (SNP) of glycoalkaloid biosynthesis enzyme gene E and / or glycoalkaloid biosynthesis enzyme gene Y in plants. Provided is a method for detecting the presence of a polymorphism or gene expression mutation and selecting an individual in which glycoalkaloid biosynthetic enzyme gene E and / or glycoalkaloid biosynthetic enzyme gene Y is suppressed. Mutant individuals may be those caused by radiation, chemical treatment, UV irradiation, or spontaneous mutation.

In this method, genomic DNA and RNA are isolated from mutant individuals and plants of various varieties and breeding individuals, the latter being reverse transcribed to synthesize cDNA, and using DNA amplification technology, the glycoalkaloid biosynthetic enzyme gene Amplifying a gene fragment containing E and / or glycoalkaloid biosynthetic enzyme gene Y, and determining the presence of a mutation in the DNA. Commercially available kits (such as DNeasy and RNeasy (Qiagen)) can be used for extracting DNA and RNA. As a method for synthesizing cDNA, a commercially available kit (for example, Superscript First Strand System (Invitrogen)) can be used. Techniques such as so-called PCR and LAMP can be used as methods for amplifying gene fragments by using DNA amplification techniques. These represent a group of techniques based on the use of polymerases to achieve specific DNA sequence amplification (ie, increasing copy number) by a continuous polymerase reaction. This reaction can be used instead of cloning, but all that is needed is information about the nucleic acid sequence. In order to amplify DNA, a primer complementary to the DNA sequence to be amplified is designed. The primer is then created by automated DNA synthesis. DNA amplification methods are well known in the art and can be readily performed by one of ordinary skill in the art based on the teachings and instructions provided herein. Several PCR methods (and related techniques) are described, for example, in US Pat. Nos. 4,683,195, 4,683,202, 4,800,159, 4,965,188, and edited by Innis et al., PCR® Protocols: Aguide-to-method-and-applications. It is stated.

In the process of determining the presence of mutations and polymorphisms in DNA, the TILLING method (Till et al., 2003) detects the mutants by determining the nucleotide sequence (Applied Biosystems) and using an enzyme that cleaves one side of the mismatched pair. , Genome Res 13: 524-530) and the like, and a method of detecting using the homology between the mutant gene and the normal gene may be used. These can be performed by comparing the sequence data obtained from this technique with the nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 21 or SEQ ID NO: 23 relating to the gene portion.

In the step of determining the difference in mRNA amount, real-time PCR (Roche) is performed on the above cDNA using a primer prepared based on the nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 21 or SEQ ID NO: 23. -Quantitative PCR such as Diagnostic Light Cycler) may be employed. Thereafter, for example, the difference in the amount of mRNA can be determined by comparing with the amount of cDNA obtained from the variety “Sassy”.

In a particularly preferred embodiment, a method for determining the presence of a mutation in the glycoalkaloid biosynthetic enzyme gene E and / or glycoalkaloid biosynthetic enzyme gene Y as defined above is referred to as Solanaceae potato (Solanum tuberosum) or tomato Applies to materials obtained from (Solanum lycopersicum).

By the above-described method for determining mutation and / or polymorphism, mutation or polymorphism of a gene encoding glycoalkaloid biosynthetic enzyme can be identified at the base level, and glycoalkaloid biosynthetic enzyme gene E and / or Alternatively, a plant having a mutation and / or polymorphism in the glycoalkaloid biosynthetic enzyme gene Y can be selected. The present invention includes a plant having a mutation or polymorphism in the glycoalkaloid biosynthesis enzyme gene E and / or glycoalkaloid biosynthesis enzyme gene Y thus obtained.

In addition, glycoalkaloid biosynthetic enzyme gene E and / or glycoalkaloids are determined by determining mutations and polymorphisms, determining mRNA levels, and analyzing glycoalkaloid content and glycoside content of spirostan-type triterpenes, which will be described later. It is possible to select plants in which the ability to express biosynthetic enzyme gene Y or the activity of glycoalkaloid biosynthetic enzymes encoded by these genes is suppressed.

Here, the expression ability of glycoalkaloid biosynthetic enzyme gene E and / or glycoalkaloid biosynthetic enzyme gene Y or suppression of the activity of glycoalkaloid biosynthetic enzyme encoding these genes is a mutation such as an artificial mutation. Inhibition of gene expression ability or glycoalkaloid biosynthetic enzyme activity due to polymorphism and suppression of gene expression ability or glycoalkaloid biosynthetic enzyme activity due to polymorphism.

Suppression by mutation of glycoalkaloid biosynthetic enzyme activity of a plant refers to suppression of existing varieties contained in the plant species, and existing varieties include wild type but are wild species that appear in the natural state. However, it is not included in existing varieties unless it is already in industrial use. Existing varieties refer to all varieties existing when a plant with suppressed glycoalkaloid biosynthetic enzyme activity is obtained, including varieties created by artificial manipulations such as mating and genetic manipulation. Moreover, in the suppression of activity, it is not necessary that the activity is suppressed for all existing varieties. If the activity is suppressed for a specific existing variety, “the activity of glycoalkaloid biosynthetic enzyme is suppressed. Included in “plant”. “Plant in which the activity of the glycoalkaloid biosynthetic enzyme is suppressed” includes a plant in which the activity is suppressed by mutation in the natural state without being subjected to artificial manipulation, and the activity in the natural state is suppressed by the method of the present invention. Plants can be selected and can be established as new varieties. In addition, when a mutagenesis treatment is performed on an existing variety to produce a plant in which the activity of glycoalkaloid biosynthetic enzyme is suppressed, the comparison target may be the same existing variety as the mutagenesis treatment, Other existing varieties may be used. Mutation of a gene encoding a glycoalkaloid biosynthetic enzyme by crossing a plant having a mutation or polymorphism with a gene encoding a glycoalkaloid biosynthetic enzyme created by selection or mutagenesis from the natural world Can be obtained as a new plant variety in which the expression of glycoalkaloid biosynthetic enzyme gene or glycoalkaloid biosynthetic enzyme activity is suppressed.

For example, when the plant is potato (Solanum tuberosum), existing varieties include “Cynthia”, “Sassy”, “Sherry”, “Baron”, “Mae Queen”, “Sayaka (Agricultural Forestry Registration Number: Agriculture Forestry No.36)”, etc. There is. Here, the expression capacity of glycoalkaloid biosynthetic enzyme gene E and / or glycoalkaloid biosynthetic enzyme gene Y or the plant in which the activity of glycoalkaloid biosynthetic enzyme encoded by these genes is suppressed with respect to existing varieties is: It includes plants in which the expression ability of glycoalkaloid biosynthetic enzyme gene E and / or glycoalkaloid biosynthetic enzyme gene Y is reduced or lost relative to existing varieties.

Such a plant body has a low synthesis amount of glycoalkaloid biosynthetic enzyme or is unable to synthesize, and the content of glycoalkaloid biosynthetic enzyme in the plant body is low, or glycoalkaloid synthase is not present, or Glycoalkaloid synthase activity is low or lost. As a result, glycoalkaloids are not produced in the plant body, and triterpene glycosides that produce spirostane-type triterpenes after hydrolysis accumulate. If the solanaceous plant is potato, the glycoside that becomes hydrolyzed when it is hydrolyzed accumulates in the plant containing the potato tubers, and if it is hydrolyzed, the glycoside that becomes hydrolyzed and becomes neotigogenin accumulates in the plant that contains the fruit. To do. Therefore, by breeding and cultivating such a plant, it is possible to produce a triterpene glycoside that produces a spirostan-type triterpene after hydrolysis. Triterpene glycosides that produce spirostane-type triterpenes after hydrolysis accumulated in the plant can be isolated by known methods. That is, it can be extracted and isolated using an organic solvent. By hydrolyzing the triterpene glycoside that produces a spirostan-type triterpene after hydrolysis obtained from a plant body with an acid or the like, the sugar chain is cleaved to obtain a spirostan-type triterpene that is a non-sugar part. The spirostan-type triterpene can be used as a raw material for producing a steroid compound, and can produce a steroid drug or the like.

In a plant of a solanaceous plant in which the gene encoding the glycoalkaloid biosynthetic enzyme of the present invention is suppressed, a plant capable of accumulating in the plant a triterpene glycoside that generates a spirostan-type triterpene after hydrolysis. For example, when the plant is a potato, the amount of yamogenin obtained when the obtained triterpene glycoside is hydrolyzed is 5 μg / 100 μmg dry weight or more, preferably 10 μg / 100 μmg dry weight or more, more preferably It is more than 20 μg / 100 mg mg dry weight, more preferably more than 30 μg / 100 mg mg dry weight, particularly preferably more than 40 μg / 100 mg mg dry weight. In the germination, the concentration is 10 μg / 100 μmg dry weight or more, preferably 20 μg / 100 μmg dry weight or more, more preferably 30 μg / 100 μmg dry weight or more, particularly preferably 40 μg / 100 μmg dry weight or more. Further, when the plant is a tomato, the amount of neotigogenin obtained when the obtained triterpene glycoside is hydrolyzed is a yamogenin equivalent, and is more than 8 μg / 100 mg mg dry weight, preferably more than 10 μg / 100 mg mg dry weight, more preferably Is more than 15 μg / 100 mg mg dry weight, particularly preferably more than 20 μg / 100 mg mg dry weight.

In addition, when a plant is bred and cultivated, by irradiating light, the plant body can accumulate a larger amount of triterpene glycosides that generate spirostan-type triterpenes after hydrolysis, resulting in a large amount of spirostane-type triterpenes. I can expect that.

Hereinafter, the present invention will be described in more detail with reference to examples, but the present invention is not limited thereto.

(Example 1) Acquisition of full-length sequence of glycoalkaloid biosynthesis candidate gene E mRNA was extracted from sprouting of potato (Solanum tuberosum) cultivar "Sassy" with RNeasy (Qiagen). Total cDNA synthesis was performed using the Superscript First Strand System (Invitrogen). It is said that the glycoalkaloid aglycone is made from cholesterol, but there is no confirmation (Non-patent Document 1). However, several hydroxylation processes are required even assuming they are made from closely related compounds. There are at least three possibilities for the hydroxylation process: cytochrome P450 type monooxygenase, dioxygenase, and NADPH-flavin reductase. Of these, the P450 type is considered as a target, and the potato-expressed gene has been sprouting from the published DFCI Potato Gene Index (http://compbio.dfci.harvard.edu/tgi/plant.html) Release 11.0. We focused on the gene TC155233 from which many EST clones have been isolated.

Based on this sequence, PCR was performed using primers [U890: GAGGCTAAGAAAAAGAGAGAGAGA (SEQ ID NO: 6), U889: CGTTCTACAAAAACATCCAATTT (SEQ ID NO: 7)] (conditions: 95 ° C. for 5 minutes, (95 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C.). 3 minutes) was performed 30 times at 72 ° C. for 10 minutes. The amplified product was cloned using TOPOTA cloning kit sequencing (Invitrogen). Furthermore, the base sequence was determined using ABI310 (Applied Biosystems). The part containing ORF is shown in SEQ ID NO: 2, and the amino acid sequence of the enzyme encoded from the cDNA sequence is shown in SEQ ID NO: 1.

The homologous gene of tomato corresponds to SGN-U583521 of the solanaceous genome network (http://solgenomics.net/index.pl). The part containing ORF is shown in SEQ ID NO: 4, and the amino acid sequence of the enzyme encoded from the cDNA sequence is shown in SEQ ID NO: 3. When the nucleotide sequences of these genes were compared, the homology was 95%. The genome sequence of this tomato homologous gene is also reported as SL1.00sc03540 of the solanaceous genome network, and it is reported that it contains seven introns. However, there is no report on any functions on the website (Figs. 1-1 to 1-3).

(Example 2) Isolation of genomic gene of glycoalkaloid biosynthesis candidate gene E Genomic DNA was extracted from "Sassy" with RNeasy (Qiagen). Using the same primer as in Example 1 (U904: TGATAAGGAAATCCTGGGAGA (SEQ ID NO: 8), U901: AGAGAAGCCATGAAGGATGG (SEQ ID NO: 9)), the second intron was the enzyme PrimeSTAR HS DNA Polymerase (Takara Bio) and the primer (U898 : PCR was performed using GAAATACGCTACTACGGAAGAACC (SEQ ID NO: 10) and U899: CGTCATTTGCCTAATCTCATC (SEQ ID NO: 11)), and the base sequence of the full-length genomic DNA was determined (SEQ ID NO: 5). It was revealed that there are seven introns.

(Example 3) Vector construction for producing a transformant of glycoalkaloid biosynthesis candidate gene E In order to suppress a gene by transformation, a reverse complementary strand gene having a structure driven by a strong promoter Fragment expression (commonly called RNAi method in plants) [Chuang and Meyerowitz Proc Natl Acad Sci US A., 97, 4985-90 (2000), Wesley et al. Plant J., 27, 581-90 ( 2001)]. For the full-length cDNA obtained in Example 1, PCR was performed using primers [U675: GAGCTCTAGAGGTTTGGGACAGGAGGAAT (SEQ ID NO: 12), U676: GGATCCATATGCAAGCCTGTGCATCTTAT (SEQ ID NO: 13)] (conditions: 95 ° C for 5 minutes, (95 ° C for 30 seconds, 55 ° C). 30 seconds at 72 ° C. and 30 seconds at 72 ° C.) and 10 minutes at 72 ° C. to obtain gene fragments. Based on binary vector pKT11 (Japanese Patent Laid-Open No. 2001-161373), the 35S RNA promoter of calflower mosaic virus, the gene fragment is forward, the third intron of Arabidopsis phytoene desaturase gene (AT4g14210), the gene fragment is reversed A plant transformation vector pKT230 was prepared by ligating in the order of the direction and terminator of the nopaline synthase gene (FIG. 2).

(Example 4) Production of potato-transformed plant body The vector prepared in Example 3 was electroporated (Gelvin and Schilperoor, Plant Molecular Biology Manual, C2, 1-32 (1994), Kluwer Academic Publishers) It was introduced into Agrobacterium tumefaciens strain GV3110. Agrobacterium tumefaciens strain GV3110 containing the vector was added to a YEB liquid medium containing 5 ppm of kanamycin [5 g / l beef extract, 1 g / l yeast extract, 5 g / l peptone, 5 g / l sucrose, 2 mM magnesium sulfate ( pH 7.2)], and cultured with shaking at 28 ° C. for 12 hours. 1.5 ml of the culture solution was centrifuged at 10,000 rpm for 3 minutes, collected, and washed with 1 ml of LB medium to remove kanamycin. After further centrifugation at 10,000 rpm for 3 minutes, the cells were collected and resuspended in MS medium [Murashige & Skoog, Physiol. Plant., 15, 473-497 (1962)] containing 1.5 ml of 3% sucrose. It was.

Potato transformation was carried out according to [Monma (1990) plant tissue culture 7: 57-63]. A microtuber obtained from the potato variety “Sassy” (Kirin Agribio) was sliced into 2 to 3 mm and used as a material for Agrobacterium infection. This was immersed in the above Agrobacterium solution and placed on a sterilized filter paper to remove excess Agrobacterium. Place on MS medium in petri dish (Zeatin 1ppm, IAA 0.1ppm, acetosyringone 100μM and agar 0.8%) and culture for 3 days at 25 ° C for 16 hours (photon flux density 32μE / m ² s) / The test was conducted under no illumination for 8 hours. Subsequently, it was cultured for 1 week in a medium containing 250 ppm of carbenicillin instead of acetosyringone. Thereafter, the cells were further transferred onto a medium containing 50 ppm kanamycin and subcultured every 2 weeks. Adventitious buds formed during this period, resulting in shoots. The stretched shoots were placed in MS medium containing carbenicin 250 ppm and kanamycin 100 ppm and no plant growth regulator. Individuals containing a kanamycin resistance gene as an exogenous gene from a plant having grown rooted shoots in kanamycin resistance were subjected to PCR (conditions: 95 ° C. for 5 minutes, (95 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. 1 Min) was performed 30 times at 72 ° C. for 10 minutes, and the redifferentiated plant body was confirmed to be a transformed plant body. Here, TAAAGCACGAGGAAGCGGT (SEQ ID NO: 14) and GCACAACAGACAATCGGCT (SEQ ID NO: 15) were used as primers for specifically amplifying the kanamycin resistance gene sequence. From the above, 30 potato transformed plants into which vector pKT230 was introduced were obtained.

(Example 5) Glycoalkaloid content of transformed plant and expression analysis of candidate gene E Glycoalkaline by the following method (Patent Publication 2011-27429) using liquid chromatography using an alkali-resistant reverse phase chromatography column The alkaloid content was measured.

Thirty in vitro stems obtained in Example 4 were stretched for one month after passage, and 2-4 pieces were combined to make about 100 mg, 0.1% formic acid in 80% MeOH aq. 990 μL and brush as internal standard Noride (Brassino) 10 μg / 10 μL was added and crushed with a mixer mill (1/25 sec, 10 min, 4 ° C.). The obtained crushed material was subjected to centrifugation (10,000 rpm, 5 min, 4 ° C.) for alcohol precipitation. Collect 25 μL of supernatant, add 475 μL with 0.1% formic acid, filter with Multiscreen Solbinate (Millipore), and LC-MS (Shimadzu Corporation, LCMS-2010EV, or Waters, Alliance e2795 Q-micro ) And analyzed. LC conditions were a column (XBridge ^TM Shield RP18-5 (φ2.1 × 150 mm, Waters)) and mobile phase (A: 10 mM ammonium hydrogen carbonate aqueous solution (pH 10): B: acetonitrile = 40: 60) They were separated and analyzed with a cratic (column oven: 40 ° C.). Quantification was performed using a standard product (chaconine, solanine (both from Sigma-Aldrich)).

In 5 strains (# 8, # 17, # 22, # 27, # 29) out of 30 individuals, the accumulation of glycoalkaloids was low with good reproducibility. Two non-control individuals were also crushed in vitro with liquid nitrogen, half was measured for glycoalkaloid content, half was extracted with RNeasy (Qiagen), and total cDNA synthesis was Superscript Fast. The strand system (Invitrogen) was used. These individuals have extremely low glycoalkaloid accumulation compared to non-transformants (2 individuals) (Fig. 3), and primers [U887: TAAGGGACTCAAGGCTCGAA (SEQ ID NO: 16), U886: TTCCTCTTTGGCTTTCTCCA (SEQ ID NO: 17)]. RT-PCR used (conditions: 95 ° C for 5 minutes, (95 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 3 minutes) 25 times, 72 ° C for 5 minutes) It was not possible to observe whether there were few (FIG. 4). This reveals that the accumulation of glycoalkaloid is extremely reduced by suppressing the expression of the gene of candidate gene E, and it becomes clear that candidate gene E is a gene encoding a glycoalkaloid biosynthetic enzyme. It was. Along with the non-transformants, these five strains of in vitro plants were grown, and each of the three individuals was acclimated to a commercially available vegetable culture soil and cultivated in a biohazard greenhouse according to a standard method to harvest tubers. Each of these five strains (# 8, # 17, # 22, # 27, # 29) showed the same growth as the non-transformant and was able to harvest the same tuber (Table 1).

Further, the three epidermis of each of the harvested tubers were peeled at about 1 mm, and the glycoalkaloid content was similarly analyzed. As a result, surprisingly, the glycoalkaloids in the tubers were extremely low, and it was confirmed that it was less than that of “Sayaka”, which is known as a low variety of glycoalkaloids, measured by the same method. (Fig. 5).

(Example 6) Production of tomato transformed plant body Tomato transformation was performed according to [Sun et al. (2006) Plant Cell Physiol. 47: 426-431.]. The Agrobacterium tumefaciens AGL0 strain containing the vector pKT230 prepared in Example 3 was cultured to obtain a bacterial solution for infection. A section of 5 mm or less of the cotyledon of a sterile seed plant of the tomato (Solanum lycopersicum) experimental strain "Microtom" is immersed in the above Agrobacterium suspension, infected for 10 minutes, and then the leaf is placed on a sterilized filter paper. The excess Agrobacterium was removed. Place leaves on Petri dish MS medium (containing zeatin 1.5mg / l, acetosyringone 40μM and gellite 0.3%) [Murashige & Skoog, Physiol. Plant., 15, 473-497 (1962)] Was cultured at 25 ° C. for 3 days in the dark. Sections were selected MS medium 1 (containing zeatin 1.5 mg / l, kanamycin 100 mg / l, augmentin 375 mg / l and gellite 0.3%) at 25 ° C. for 16 hours (photon flux density 32 μE / m ² s) / 8 hours without It was passaged every 2 weeks under lighting conditions. Adventitious buds formed during this period, resulting in shoots. Further, in order to extend the shoots, the cells were transplanted to selective MS medium 2 (containing zeatin 1.0 mg / l, kanamycin 100 mg / l, augmentin 375 mg / l, and gellite 0.3%), and the extended shoots were selected to a selective 1/2 concentration MS medium ( Rooted with kanamycin 100 mg / l, augmentin 375 mg / l and gellite 0.3%). A plant containing a kanamycin resistance gene as an exogenous gene from a plant that has developed a kanamycin resistance shoot is subjected to PCR (conditions: 95 ° C for 5 minutes, (95 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 1 minute). This was detected 30 times at 72 ° C. for 10 minutes, and it was confirmed that the redifferentiated plant was a transformed plant. Here, TAAAGCACGAGGAAGCGGT (SEQ ID NO: 18) and GCACAACAGACAATCGGCT (SEQ ID NO: 19) were used as primers for specifically amplifying the kanamycin resistance gene sequence. From the above, 13 transgenic plant lines of tomato introduced with the vector pKT230 were obtained. The resulting 13 individuals were acclimated to a greenhouse and cultivated for about 1 month, weighed about 100 mg each from three newly developed young leaves, and liquid chromatography using an alkali-resistant column for reversed-phase chromatography similar to potato The glycoalkaloid content was measured by the method of Example 5 using However, the analysis conditions are: mobile phase A: 10 mM ammonium hydrogen carbonate aqueous solution (pH 10) and mobile phase B: MeCN for the mobile phase, isocratic ratio of A: B = 60: 40 for the above sample solvent. Conditions were used. Of the 13 lines, 4 lines had a remarkably low tomatine content of 280 μg or less per 100 mg of fresh weight, which was 1/5 of the control (FIG. 6).

(Example 7) Screening of glycoalkaloid biosynthesis candidate gene E mutant plant In vitro of potato passaged in MS medium [Murashige & Skoog, Physiol. Plant., 15, 473-497 (1962)] containing 3% sucrose Plant irradiation with quantum beam irradiation (NIRS-HIMAC irradiation device, argon ion beam 500MeV / nucleon 0.1 to 3Gy, neon ion beam 400Mev / nucleon 0.2 to 3Gy, or carbon ion beam 290MeV / nucleon 0.5Gy to 5Gy) Mutation processing is performed. After the mutation treatment, leaves are collected from the grown plants and genomic DNA is collected by a conventional method. Primers [U890: GAGGCTAAGAAAAAGAGAGAGAGA (SEQ ID NO: 6), U889: CGTTCTACAAAAACATCCAATTT (SEQ ID NO: 7), U904: TGATAAGGAAATCCTGGGAGA (SEQ ID NO: 8), U901: AGAGAAGCCATGAAGGATGG (SEQ ID NO: 9), and the second intron Using the enzyme, PrimeSTAR HS DNA Polymerase (Takara Bio Inc.) and primers (U898: GAAATACGCTACTACGGAAGAACC (SEQ ID NO: 10) and U899: CGTCATTTGCCTAATCTCATC (SEQ ID NO: 11)), PCR was performed, and the region containing the E gene was determined. Furthermore, it is cloned using a gene cloning kit, etc. The nucleotide sequence of the cloned region can be determined, and individuals with mutations in the E gene can be selected.

(Example 8) Acquisition of full length sequence of glycoalkaloid biosynthesis candidate gene Y mRNA was extracted from sprouting of potato (Solanum tuberosum) cultivar "Sassy" with RNeasy (Qiagen). Total cDNA synthesis was performed using the Superscript First Strand System (Invitrogen). In recent years, Oyama et al. Have shown that the introduction of the amino group of glycoalkaloids via the 26th aldehyde (Abstracts of the 28th Annual Meeting of the Japanese Society for Plant Cell Biology (Sendai) (2010) p.165) . This amino group transfer reaction to aldehyde is expected to be mediated by aminotransferase, but no similar reaction is known at all. Therefore, we decided to refer to the gene pAMT that encodes an enzyme that catalyzes vanillylamine from vanillin, which is a completely different structure, in the same solanaceous pepper (Lang et al. Plant J. (2009) 59: 953-961). When unigene registered in the solanaceous genome network (http://solgenomics.net/index.pl) was searched by NCBI Blast method, E value, which is an index of homology, was extremely low, and the amino acid of the aligned amino acid Six gene fragments having an identity of 80% or more could be found (SGN-U268561, SGN-U268558, SGN-U277939, SGN-U268560, SGN-U268559, SGN-U274756). We focused on the gene SGN-U268561, from which many EST clones have been isolated.

Based on this sequence, a primer [U1008: caccATGGCCAAGACTACTAATGGATTT (SEQ ID NO: 24, 4 bases (cacc) is artificially added to the 5 ′ end to clone the gene into this primer), U1007: Using CCATCAAGTTTTTGTCCATGAG (SEQ ID NO: 25)], the gene was amplified by PCR (30 cycles, using Takara Bio Inc. PrimeSTAR HS DNAasePolymerase) at an annealing temperature of 55 ° C. This was cloned into a pENTRTM / D-TOPO entry vector (Invitrogen). The base sequences of the 8 independent clones obtained were determined using ABI310 (Applied Biosystems). The sequence thus obtained is SEQ ID NO: 20, and the amino acid sequence deduced therefrom is SEQ ID NO: 21. The amino acid sequence of pepper pAMT having different enzyme activities had 82.4% identity over the entire length.

Note that the tomato homologous gene corresponds to SGN-U570903 of the solanaceous genome network (http://solgenomics.net/index.pl). The part containing ORF is shown in SEQ ID NO: 23, and the amino acid sequence of the enzyme encoded from the cDNA sequence is shown in SEQ ID NO: 22. When the nucleotide sequences of the tomato and potato genes were compared, the homology was 96.0%. Surprisingly, this gene is the amino acid sequence of the gene reported as gamma-aminobutyrateytransaminase subunit precursor isozyme 2 (GABA-T2) in tomato (Clark et al. J. Exp. Bot. (2009) 60: 3255-3267, Akihiro Plant Physiol. (2009) 60: 3255-3267) (Table 2), but it is not known that GABA-T2 is involved in glycoalkaloid biosynthesis.

(Example 9) Identification of genome gene of glycoalkaloid biosynthesis candidate gene Y The genome sequence of the potato gene was recently reported (Xu et al. Nature (2011) 475: 189-197). The genome sequence is published on the website of Potato Genome Sequencing Consortium Data Release (http://potatogenomics.plantbiology.msu.edu/index.html). It is possible to determine the Y genomic gene based on this sequence.

The genome sequence of the tomato gene is reported as SL1.00sc03540, SL2.31ch12, and SL2.40ch12 of the eggplant genome network, and it has been reported that it contains 16 introns. However, there are no reports on the website.

(Example 10) Construction of a vector for producing a suppression transformant of glycoalkaloid biosynthesis candidate gene Y As a method for suppressing a gene by transformation, a reverse complementary strand gene having a structure driven by a strong promoter Fragment expression (commonly called RNAi method in plants) [Chuang and Meyerowitz Proc Natl Acad Sci US A., 97, 4985-90 (2000), Wesley et al. Plant J., 27, 581-90 ( 2001)]. PCR (30 cycles, Takara Bio Inc. ExTaq DNA Polymerase) was performed on the full-length cDNA obtained in Example 8 using primers [U895: GAGCTCTAGATATTTGATTTGCCACCTCCAT (SEQ ID NO: 26), U896: GGATCCATATGCTTACAAGCACAGCACCAA (SEQ ID NO: 27)] at an annealing temperature of 55 ° C. The gene was amplified by This was cloned into a pCR4-TOPO vector (Invitrogen) to obtain a gene fragment. Based on binary vector pKT11 (Japanese Patent Laid-Open No. 2001-161373), the 35S RNA promoter of calflower mosaic virus, the gene fragment is forward, the third intron of Arabidopsis phytoene desaturase gene (AT4g14210), the gene fragment is reversed Ligation was performed in the order of the 35S RNA terminator of the calf mosaic mosaic virus to prepare a plant transformation vector pKT250 (FIG. 8).

(Example 11) Production of potato-transformed plant body The vector prepared in Example 10 was subjected to electroporation (Edited by Gelvin and Schilperoor, Plant Molecular Biology Manual, C2, 1-32 (1994), Kluwer Academic Publishers). It was introduced into Agrobacterium tumefaciens strain GV3110. Agrobacterium tumefaciens strain GV3110 containing the vector was added to a YEB liquid medium containing 5 ppm of kanamycin [5 g / l beef extract, 1 g / l yeast extract, 5 g / l peptone, 5 g / l sucrose, 2 mM magnesium sulfate ( pH 7.2)], and cultured with shaking at 28 ° C. for 12 hours. 1.5 ml of the culture solution was centrifuged at 10,000 rpm for 3 minutes, collected, and washed with 1 ml of LB medium to remove kanamycin. After further centrifugation at 10,000 rpm for 3 minutes, the cells were collected and resuspended in MS medium [Murashige & Skoog, Physiol. Plant., 15, 473-497 (1962)] containing 1.5 ml of 3% sucrose. It was.

Potato transformation was carried out according to [Monma (1990) plant tissue culture 7: 57-63]. Microtubers obtained from the potato variety “Sassy” (Japan Agribio Inc.) were sliced into 2 to 3 mm and used as materials for Agrobacterium infection. This was immersed in the above Agrobacterium solution and placed on a sterilized filter paper to remove excess Agrobacterium. Place on MS medium in petri dish (Zeatin 1ppm, IAA 0.1ppm, acetosyringone 100μM and agar 0.8%) and culture for 3 days at 25 ° C for 16 hours (photon flux density 32μE / m ² s) / The test was conducted under no illumination for 8 hours. Subsequently, it was cultured for 1 week in a medium containing 250 ppm of carbenicillin instead of acetosyringone. Thereafter, the cells were further transferred onto a medium containing 50 ppm kanamycin and subcultured every 2 weeks. Adventitious buds formed during this period, resulting in shoots. The stretched shoots were placed in MS medium containing carbenicin 250 ppm and kanamycin 100 ppm and no plant growth regulator. Individuals containing a kanamycin resistance gene as an exogenous gene from a plant having grown rooted shoots in kanamycin resistance were subjected to PCR (conditions: 95 ° C. for 5 minutes, (95 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. 1 Min) was performed 30 times at 72 ° C. for 10 minutes, and the redifferentiated plant body was confirmed to be a transformed plant body. Here, TAAAGCACGAGGAAGCGGT (SEQ ID NO: 28) and GCACAACAGACAATCGGCT (SEQ ID NO: 29) were used as primers for specifically amplifying the kanamycin resistance gene sequence. From the above, 25 potato transformed plants into which the vector pKT250 was introduced were obtained.

(Example 12) Glycoalkaloid content of transformed plant and expression analysis of candidate gene Y 30 in vitro stems obtained in Example 11 were elongated for one month after passage, and 2 to 4 parts thereof were put together. The glycoalkaloid content was measured by the following method (Patent Publication 2011-27429) using liquid chromatography using an alkali-resistant column for reverse phase chromatography.

Twenty-five in vitro stems obtained in Example 11 were stretched for one month after passage, and 2 to 4 portions thereof were combined to make about 100 mg, 0.1% formic acid in 80% MeOH aq. 990 μL and a brush as an internal standard Noride (Brassino) 10 μg / 10 μL was added and crushed with a mixer mill (1/25 sec, 10 min, 4 ° C.). The obtained crushed material was subjected to centrifugation (10,000 rpm, 5 min, 4 ° C.) for alcohol precipitation. Collect 25 μL of supernatant, add 475 μL with 0.1% formic acid, filter with Multiscreen Solbinate (Millipore), and LC-MS (Shimadzu Corporation, LCMS-2010EV, or Waters, Alliance e2795 Q-micro ) And analyzed. LC conditions were a column (XBridge ^TM Shield RP18-5 (φ2.1 × 150 mm, Waters)) and mobile phase (A: 10 mM ammonium hydrogen carbonate aqueous solution (pH 10): B: acetonitrile = 40: 60) They were separated and analyzed with a cratic (column oven: 40 ° C.). Quantification was performed using a standard product (chaconine, solanine (both from Sigma-Aldrich)).

By repeating the analysis twice from the obtained 25 in vitro stems, the accumulation of glycoalkaloids in 5 lines (# 1, # 9, # 11, # 15, # 22) is low with good reproducibility. confirmed. About 5 mg of these low glycoalkaloids, 2 that were not low (# 8, # 25), and about 200 mg of invitro stalk from one control individual that had not been transfected with the gene, ground with liquid nitrogen, and half of the glycoalkaloid The content was measured, and half was measured for mRNA. It was reconfirmed that 5 low glycoalkaloid strains had extremely low glycoalkaloid accumulation compared to non-transformant (1 individual) and 2 strains that did not decrease (FIG. 9). From each line, total RNA was extracted with RNeasy (Qiagen), and total cDNA was synthesized with Superscript® First Strand® system (Invitrogen). RT-PCR using primers [U935: 分 TGGGGTGTTGGTACATATTTTG (SEQ ID NO: 30), U1007: TTCCTCTTTGGCTTTCTCCA (SEQ ID NO: 31)] (conditions: 95 ° C for 5 minutes, (95 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 3 minutes) As a result of 25 times at 72 ° C. for 5 minutes, the expression of mRNA of the Y gene was very small or could not be observed in the five low glycoalkaloid strains (FIG. 10). From this, it became clear that accumulation of glycoalkaloid is extremely reduced by suppressing the expression of the gene of candidate gene Y, and it became clear that candidate gene Y is a gene encoding glycoalkaloid biosynthetic enzyme. It was.

(Example 13) Preparation of tubers from transformed plants of low-glycoalkaloid strains Three non-transformed plants and three in vitro plants of these five low-glycoalkaloid strains are proliferated, and three individuals are commercially available. The tuber was harvested by acclimatizing to the vegetable culture soil and cultivating it in a biohazard greenhouse according to a standard method. Each of these three strains (# 9, # 11, # 22) showed the same growth as the non-transformant and was able to harvest the same tuber (Table 2).

Further, the three epidermis of each of the harvested tubers were peeled at about 1 mm, and the glycoalkaloid content was similarly analyzed. As a result, it was surprisingly confirmed that the glycoalkaloid in the tuber was extremely low (FIG. 11).

(Example 14) Production of tomato transformed plant body Tomato transformation was performed according to [Sun et al. (2006) Plant Cell Physiol. 47: 426-431.]. The Agrobacterium tumefaciens AGL0 strain containing the vector pKT230 prepared in Example 10 was cultured to obtain a bacterial solution for infection. A 5 mm or less section of a cotyledon of a sterile seed plant of the tomato (Solanum lycopersicum) experimental strain “Microtom” is immersed in the above Agrobacterium suspension and infected for 10 minutes, and then the leaf is placed on a sterilized filter paper. The excess Agrobacterium was removed. Place leaves on Petri dish MS medium (containing zeatin 1.5mg / l, acetosyringone 40μM and gellite 0.3%) [Murashige & Skoog, Physiol. Plant., 15, 473-497 (1962)] Was cultured at 25 ° C. for 3 days in the dark. Sections were selected MS medium 1 (containing zeatin 1.5 mg / l, kanamycin 100 mg / l, augmentin 375 mg / l and gellite 0.3%) at 25 ° C. for 16 hours (photon flux density 32 μE / m ² s) / 8 hours without It was passaged every 2 weeks under lighting conditions. Adventitious buds formed during this period, resulting in shoots. Further, in order to extend the shoots, the cells were transplanted to selective MS medium 2 (containing zeatin 1.0 mg / l, kanamycin 100 mg / l, augmentin 375 mg / l, and gellite 0.3%), and the extended shoots were selected to a selective 1/2 concentration MS medium ( Rooted with kanamycin 100 mg / l, augmentin 375 mg / l and gellite 0.3%). An individual containing a kanamycin resistance gene as a foreign gene is detected by performing PCR using a primer that specifically amplifies the sequence of the kanamycin resistance gene from the plant body in which the shoot is grown. It was confirmed that the plant body was a transformed plant body. Thirty tomato transgenic plants into which vector pKT250 was introduced were obtained. The obtained 30 lines were acclimated to a greenhouse and cultivated for about 1 month, weighed about 100 mg each from three newly developed young leaves, and the glycoalkaloid content (α-tomatine content, standard amount) by the method of Example 5 in the same manner as potatoes. The product α-tomatine was measured by Sigma-Aldrich. However, the ratio of mobile phase A: mobile phase B = 60: 40 was used as analysis conditions. Of the 30 lines, 14 lines had significantly lower tomatine content, less than 1/5 (<53 μg) of 266 μg per 100 mg of fresh weight, which is the average of the control (FIG. 12).

(Example 15) Screening of glycoalkaloid biosynthesis candidate gene Y mutant plant In vitro of potato passaged in MS medium [Murashige & Skoog, Physiol. Plant., 15, 473-497 (1962)] containing 3% sucrose Plant irradiation with quantum beam irradiation (NIRS-HIMAC irradiation device, argon ion beam 500MeV / nucleon 0.1 to 3Gy, neon ion beam 400Mev / nucleon 0.2 to 3Gy, or carbon ion beam 290MeV / nucleon 0.5Gy to 5Gy) Mutation processing is performed. After the mutation treatment, leaves are collected from the grown plants and genomic DNA is collected by a conventional method. Using the genomic DNA as a template, PCR is performed using the above primers [U1008: caccATGGCCAAGACTACTAATGGATTT (SEQ ID NO: 24), U1007: CCATCAAGTTTTTGTCCATGAG (SEQ ID NO: 25)] to obtain a region containing the Y gene, and a gene cloning kit Cloning using etc. The base sequence of the cloned region can be determined, and individuals with mutations in the Y gene can be selected.

(Example 16) Production of spirostan-type triterpenes from potato gene-suppressed transformants Samples of 1 g of in vitro stems of potatoes (non-transformants, pKT230 # 8 and pKT250 # 9, # 22) obtained in the above example The following processing was extracted and analyzed. pKT230 # 8 is the inhibitory transformant of glycoalkaloid biosynthetic enzyme E obtained in Example 4, and pKT250 # 9, # 22 is the inhibitory transformant of glycoalkaloid biosynthetic enzyme Y obtained in Example 11. It is.

10 mg of lyophilized plant sample was extracted 3 times with 2 mL of CHCl ₃ -MeOH solution (1: 1). Nitrogen gas was blown into the residue, and 1 mL of MeOH and 1 mL of 4 M HCl were added to the residue, and the mixture was reacted at 80 ° C. for 1 hour for hydrolysis. The reaction mixture was extracted three times with 2 mL of hexane-Ethyl acetate solution (1: 2), and the resulting organic layer was blown with nitrogen gas to remove the solvent. A solution obtained by adding N-methyl-N-trimethylsilyltrifluoroacetamide (MSTFA, SIGMA) to the obtained residue and treating at 80 ° C. for 30 minutes was used as a sample for GC-MS analysis.

The conditions for GC-MS analysis are shown below. EI (70eV), ion source temperature 250 ° C, column is DB-1 (30 m × 0.25 mm, 0.25-μm; J & W Scientific), sample introduction part temperature 250 ° C, column heating program: 80 ° C, hold for 1 minute, The temperature was raised to 300 ° C. in 11 minutes and maintained for 23 minutes, the interface temperature at 280 ° C., the carrier gas was He は (1.0 mL / min (DB-1)), and the sample was introduced in a splitless manner. Accumulation product identification was determined by comparing GC retention time and MS spectra. Gyeogenin was quantified using a sample purchased from Phyto Rabo.

Fig. 13 shows a GC-MS total ion chromatogram of the transformant potato extract. A peak (solid arrow) not found in the non-transformant was observed. FIG. 14 shows a combination of this part as a preparation of diosgenin and yamogenin. The newly appearing peak d has the same retention time and mass spectrum as the peak b (retention time 17 minutes 50 seconds) of the yamogenin preparation. The peak a mixed in the yamogenin preparation was 22βO-spirostanol type (retention time 17 minutes 34 seconds) with the spiroketal ring of the yamogenin re-wound, and was different from the peak b (retention time 17 minutes 37 seconds) of the diosgenin preparation. . Peak c mixed with the yamogenin preparation was predicted to be neotigogenin reduced in the 5th position from the mass spectrum (retention time 18 minutes 02 seconds). As a result of quantification, it was revealed that 68.8 μg / 100 mg dry weight, 55.5 μg / 100 mg dry weight, 30.4 μg / 100 mg dry weight of pest 230 # 8, pKT250 # 9, # 22 . On the other hand, even in the non-transformant, there was a trace amount of yamogenin of 6.3 μg / 100 mg dry weight. This quantitative value is not cultivated under different conditions for the accumulation of spirostan-type triterpenes, and thus shows the potential for substance accumulation, and is not limited in any way.

The same extraction and analysis were performed using potato and tomato (Japanese Patent Application No. 2010-108445), a transformant that suppressed glycoalkaloid biosynthesis genes C and D, but no spirostan-type triterpene was detected. . This indicates that accumulation does not occur when genes are suppressed in all glycoalkaloid biosynthetic genes, but accumulation occurs specifically by suppressing E and Y genes.

(Example 17) Prediction of accumulated product of potato tissue It was found that yamogenin can be obtained by hydrolysis from potato in which the expression of E gene or Y gene is suppressed, but the substance in potato is unknown. . Therefore, analysis was performed without hydrolysis. As a result, it was found that almost no yamogenin was obtained when hydrolysis was not performed (FIG. 15). Among potatoes, yamogenin that is sugar-modified at position 3, furosene-type triterpenes that are sugar-modified at position 3 or 26, or both, positions 16, 22, and 26 are oxidized, including position 3, A cholestane type triterpene in which one or a plurality of sugars are modified can be estimated.

(Example 18) Production of spirostan-type triterpenes from different potato tissues In the above-described tuber of potato (pKT230 # 8, # 17, # 29) with suppressed E gene prepared in the above example, and germination The amount of yamogenin obtained by hydrolyzing the accumulated glycoside was quantified. As a result, the tuber peel was 49.7, 48.1, 24.6 μg / 100 mg dry weight, and the germination was 95.6, 70.2, 102.5 μg / 100 mg dry weight (FIG. 16). On the other hand, even in the non-transformant, trace amounts of yamogenin of 2.8 μg / 100 mg dry weight in the tuber peel and 7.9 μg / 100 mg dry weight in the germination were present (FIG. 16). Since this quantitative value was not cultivated under different conditions for the accumulation of spirostan-type triterpenes, it shows the potential for substance accumulation and is not limited in any way. Generally, it is known that the amount of glycoalkaloid increases when irradiated with light. From this, it is expected that a larger amount of spirostan type triterpene can be obtained when irradiated with light.

(Example 19) Production of spirostan-type triterpenes from tomato gene-suppressed transformants Tomatoes (non-transformants, pKT230 # 13, pKT250 # 75) were cultivated in a greenhouse for about 1 month and newly developed young leaves 1 g was used as a sample, and it was carried out according to Example 16. pKT230 # 13 is the inhibitory transformant of glycoalkaloid biosynthetic enzyme E obtained in Example 6, and pKT250 # 9, # 22 is the inhibitory transformant of glycoalkaloid biosynthetic enzyme Y obtained in Example 14. It is. Neotigogenin obtained by hydrolyzing the accumulated glycoside was quantified as a yamogenin equivalent. As a result, it was revealed that neotigogenin can obtain 86.8 μg / 100 mg dry weight and 93.2 μg / 100 mg dry weight from pKT230 # 13 and pKT250 # 75 (FIG. 17). On the other hand, the non-transformant contained a trace amount of neotigogenin of 5.7 μg / 100 mg dry weight (FIG. 17). This quantitative value shows the potential for substance accumulation because it was not cultivated under different conditions for accumulation of spirostan-type triterpenes.

The solanaceous plants such as potatoes in which triterpene glycosides that produce spirostane-type triterpenes after hydrolysis according to the present invention are accumulated can supply spirostane-type triterpenes as raw materials for steroid pharmaceuticals. Glycoalkaloid biosynthetic enzyme gene E and / or glycoalkaloid biosynthetic enzyme gene Y can be used to accumulate triterpene glycosides that produce spirostan-type triterpenes after hydrolysis that can be used as functional foods. Can be used for selection.

SEQ ID NOs: 5-19 and 24-31 Primers All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety.

Claims (10)

1. A plant body of a solanaceous plant in which a gene encoding a glycoalkaloid biosynthetic enzyme is suppressed, and a triterpene glycoside that generates a spirostan-type triterpene after hydrolysis can be accumulated in the plant body.
2. The solanaceous plant is potato, and the gene encoding the glycoalkaloid biosynthetic enzyme is a gene comprising any of the following DNAs (a) to (d) and / or any of the following (e) to (h) The plant body according to claim 1, wherein the triterpene glycoside generates yamogenin by hydrolysis:
   (a) DNA consisting of the base sequence shown in SEQ ID NO: 2;
   (b) a DNA that hybridizes with a DNA comprising a base sequence complementary to the DNA comprising the base sequence shown in SEQ ID NO: 2 under stringent conditions and encodes a protein having glycoalkaloid biosynthetic enzyme activity;
   (c) DNA encoding a protein comprising a base sequence having 80% or more sequence identity with the base sequence shown in SEQ ID NO: 2 and having glycoalkaloid biosynthetic enzyme activity;
   (d) DNA comprising a degenerate isomer of the base sequence shown in SEQ ID NO: 2;
   (e) DNA consisting of the base sequence shown in SEQ ID NO: 21;
   (f) a DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the DNA consisting of the base sequence shown in SEQ ID NO: 21 and encodes a protein having glycoalkaloid biosynthetic enzyme activity;
   (g) a DNA consisting of a base sequence having 80% or more sequence identity with the base sequence shown in SEQ ID NO: 21 and encoding a protein having glycoalkaloid biosynthetic enzyme activity; and (h) shown in SEQ ID NO: 21 DNA consisting of degenerate isomers of the base sequence.
3. The solanaceous plant is a tomato, and the gene encoding a glycoalkaloid biosynthetic enzyme is a gene comprising any of the following DNAs (i) to (l) and / or any of the following (m) to (p) The plant according to claim 1, wherein the triterpene glycoside produces neotigogenin by hydrolysis.
   (i) DNA consisting of the base sequence shown in SEQ ID NO: 4;
   (j) DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the DNA consisting of the base sequence shown in SEQ ID NO: 4 and encodes a protein having glycoalkaloid biosynthetic enzyme activity;
   (k) a DNA encoding a protein comprising a base sequence having 80% or more sequence identity with the base sequence shown in SEQ ID NO: 4 and having glycoalkaloid biosynthetic enzyme activity;
   (l) DNA comprising a degenerate isomer of the base sequence shown in SEQ ID NO: 4;
   (m) a DNA comprising the base sequence represented by SEQ ID NO: 23;
   (n) a DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the DNA consisting of the base sequence shown in SEQ ID NO: 23 and encodes a protein having glycoalkaloid biosynthetic enzyme activity;
   (o) a DNA comprising a base sequence having 80% or more sequence identity with the base sequence shown in SEQ ID NO: 23 and encoding a protein having glycoalkaloid biosynthetic enzyme activity; and (p) shown in SEQ ID NO: 23 DNA consisting of degenerate isomers of the base sequence.
4. A method for accumulating in a plant a triterpene glycoside that produces a spirostan-type triterpene after hydrolysis by cultivating the plant according to any one of claims 1 to 3.
5. By cultivating the plant according to any one of claims 1 to 3, a triterpene glycoside that produces a spirostan-type triterpene after hydrolysis is accumulated in the plant,
   Isolating the accumulated glycoside,
   A method for producing a spirostan-type triterpene using a plant body, comprising hydrolyzing the obtained glycoside and removing a sugar chain.
6. (i) isolating a nucleic acid that is genomic DNA or RNA from a solanaceous plant;
   (ii) a step of reverse transcription and synthesizing cDNA when the nucleic acid of (i) is RNA;
   (iii) amplifying a gene fragment containing the base sequence shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 21 or SEQ ID NO: 23 from the DNA obtained in the step (i) or (ii);
   (iv) determining the presence of mutations and / or polymorphisms in the DNA;
   And a method for selecting a plant having a mutation and / or polymorphism of a gene encoding a glycoalkaloid biosynthetic enzyme in a solanaceous plant.
7. A solanaceous plant body selected by the method according to claim 6, having a mutation and / or polymorphism in a gene encoding a glycoalkaloid biosynthetic enzyme and suppressing the activity of the glycoalkaloid biosynthetic enzyme.
8. The expression ability of a gene encoding a glycoalkaloid biosynthetic enzyme selected by the method according to claim 6 is suppressed for an existing variety, or the activity of a glycoalkaloid biosynthetic enzyme is suppressed for an existing variety A solanaceous plant that can accumulate triterpene glycosides that generate spirostane-type triterpenes after hydrolysis in the plant.
9. A method for accumulating in a plant a triterpene glycoside that produces a spirostan-type triterpene after hydrolysis by breeding the plant according to claim 8.
10. By breeding the plant body according to claim 8, a triterpene glycoside that produces a spirostane-type triterpene after hydrolysis is accumulated in the plant body,
    We isolated the accumulated glycosides of spirostan type triterpene,
    A method for producing a spirostan-type triterpene using a plant body, comprising hydrolyzing a glycoside of the obtained spirostan-type triterpene and removing a sugar chain.

Images