WO2010041021A2

WO2010041021A2 - Gene regulation using rna

Info

Publication number: WO2010041021A2
Application number: PCT/GB2009/002411
Authority: WO
Inventors: Mikko P. Turunen; Seppo Ylä-Herttuala
Original assignee: Ark Therapeutics Ltd.
Priority date: 2008-10-10
Filing date: 2009-10-08
Publication date: 2010-04-15
Also published as: GB0818663D0; WO2010041021A3

Abstract

The present invention is a vector for use in therapy effected by expression of a gene product, wherein the vector comprises a nucleotide sequence that can be transcribed to give RNA that can form a double-stranded RNA hairpin construct, wherein the RNA comprises: (i) a first sequence identical or complementary to a target sequence within a promoter area of the gene which encodes the gene product; (ii) a loop sequence; (iii) a sequence complementary to the first sequence; and (iv) a termination codon. The present invention may also be a system comprising an oligonucleotide and an oligonucleotide delivery system, which can generate an RNA construct.

Description

GENE REGULATION USING RNA

Field of the Invention

This invention relates to regulation of genes, in particular VEGF, for use in therapy. Background of the Invention

It has been shown that small RNAs (siRNAs) can either up- or down- regulate mammalian transcription (Li et al., 2006). These processes have been studied in lower organisms for a long period of time, but only recently has their importance in mammals been recognized. In human cells, RNA-directed transcriptional gene silencing (TGS) can be initiated through promoter targeted siRNAs (Janowshi et al., 2006). The resulting siRNA-targeted promoter exhibits a silent-state methyl mark, containing both histone H3 lysine-9 di-methylation (H3k9me2) and histone H3 lysine-27 tri-methylation (H3K27me3). Furthermore, RNA polymerase Il may be required for siRNA-mediated TGS in human cells. However, exactly how the siRNAs modulate TGS through histone methylation, specifically at the targeted promoter, is unclear. It has been proposed that antisense strands of siRNAs have a role in writing the histone code and regulation of gene expression, by interaction with promoter-associated RNA variants that are present at these promoter sites (Han et al., 2007). Activation of gene transcription by small RNAs in human cells has also been reported. The mechanism is not fully understood, but requires Argonaute-2 and is associated with a loss of lysine-9 methylation on histone 3 at dsRNA-target sites. Further, RNA-directed DNA methylation requires dsRNAs that are cleaved into small RNAs similar to those that guide mRNA degradation in RNAi (Mette et al., 2000).

Small RNAs are valuable tools in molecular biology. They also show significant promise as therapeutic tools. Small RNAs have been used to knock down target genes by RISC-mediated mRNA cleavage, but their effects on chromatin remain unclear. Methylation of H3-K4 residue has been found as a preferred site in transcriptionally active macronuclei of Tetrahymena which also correlates with histone acetylation (Strahl et al., 1999). Reversal of the methylated status of H3K4 may have an important biological impact on normal development and human diseases (Benevolenskaya 2007). DOK1 is a multiple-site clocking protein that acts downstream of receptor and non-receptor tyrosine kinases. Although it has been proposed to contribute to the control of cell growth and migration the role of DOK1 remains largely unknown. Summary of the Invention

The present invention is based on the realisation that RNA hairpins are useful for regulating genes. Regulation of gene expression by targeting RNA hairpins to gene promoters has been found to have surprising advantages over regulation of gene expression by RNA interference.

According to a first aspect of the present invention, a therapeutic effect can be provided by a double-stranded RNA hairpin construct which regulates expression of an RNA species or a gene product, wherein the construct comprises:

(i) a first sequence identical or complementary to a target sequence within a promoter area of a gene which encodes the gene product;

(ii) a loop sequence;

(iii) a sequence complementary to the first sequence; and

(iv) a termination codon.

Such a hairpin can be produced in situ by administering a suitable vector. The therapy is effected by the expression of the RNA species or the gene product.

According to a second aspect, the present invention is a system comprising an oligonucleotide and an oligonucleotide delivery system, which can generate an RNA construct, as defined above. Brief Description of the Drawings

Figure 1 shows the results of an ELISA assay from growth medium of C166 cells transduced with different vectors using MOI 10, 7 days time point.

Figure 2 shows the results of a TaqMan RT-PCR analysis of mouse VEGF-A and β-actin mRNA levels. C166 cells transduced with different vectors using MOI 10 and analyzed at day 7.

Figure 3 shows the results of an ELISA from ischemic mice hind limbs. Figure 4 is a schematic representation showing a theory of how the shRNA hairpins of the invention cause regulation of a gene product's expression.

Figure 5 shows the results of an ELISA analysis of hVEGF-A expression in transfected MCF10A cells. Description of the Sequence Listing

SEQ ID NO: 1 is human VEGF-A (Accession number AF095785).

SEQ ID NO: 2 is murine VEGF-A (MMU41383).

SEQ ID NO: 3 is a fragment of human DOK1. Description of Preferred Embodiments

A vector of this invention may be a DNA or RNA viral vector, e.g. a lentivirus. Alternatively, it may be a non-viral vector. The nucleic acid may be single-stranded or double-stranded. Such vectors are well known to those of ordinary skill in the art, as are appropriate constructs, whereby RNA having the given features can be transcribed. The proposed hairpin structure will be formed in situ, in the presence of a suitable enzyme.

A second aspect of the invention relates to a system comprising an oligonucleotide and an oligonucleotide delivery system. Suitable delivery systems are well known to those skilled in the art. The system can generate an RNA construct either in the nucleus or in the cytosolic compartment.

A vector of the invention transcribes a nucleotide sequence to give RNA. The RNA may be generated without any functional cDNA or a gene expression cassette. The RNA may be mRNA or pre-mRNA with coding or non-coding sequences.

A RNA hairpin, which may be formed using a vector of the present invention is double-stranded. It contains a first oligonucleotide (oligo) and a second oligo, wherein the second oligo is complementary to the first oligo.

The first oligo (first strand) contains a sequence identical to a target sequence within a promoter area of the gene to be regulated. Preferably, the first oligo contains the 19-21-mer sense target sequence. The first oligo also contains a loop sequence. Preferably the loop sequence is CTTCCTGTCA. Further, the first oligo contains the antisense target sequence, which forms a hairpin with the sense sequence. A termination codon is included in the first oligo. Preferably, it has the sequence TTTTT. The first oligo also contains a restriction site at the 3'-end. Preferably, the restriction site is "G", for EcoRI.

The second oligo (second strand) is complementary to the first oligo. Preferably, it has an additional 5'-AATT-overhang for a EcoRI site.

Although the present invention is applicable to a number of gene products, VEGF is preferred. Preferably, the gene product is VEGF-A, VEGF-C, VEGF-receptor 1 or Nanog. Preferably, the gene product is murine or human.

In one embodiment, the gene product may be an agonist of a VEGF receptor, or it may be a VEGF protein, such as VEGF-A. A vector of the invention may therefore be useful in the regulation of angiogenesis, lymphaniogenesis, or in the prevention or treatment of retinopathy, cancer arteriogenesis, cardiovascular disease, psoriasis or arthritis.

In a preferred embodiment, the gene product is DOK1. Therefore, a vector of the present invention may be useful in inhibiting tumour metastasis and angiogenesis.

In a preferred embodiment, the sequence within the promoter area of the gene to be regulated does not contain the nucleic acid sequence TATA. Preferably, the gene's promoter can be regulated by transcription factors, such as SP1, AP1 , AP2, NfKB, Nrf2, KLF2, KLF4, HIF-1a/2a and PGC-Ia.

In a preferred embodiment, the vector is a viral vector. Preferably, the viral vector is a lentiviral vector. The vector may also be an AAD retrovirus or an adenovirus. Alternatively, the vector may be non-viral. The vector also contains a RNA promoter. Preferably, the promoter is a U6 promotor. Preferably, the plasmid is a third generation lentiviral transfer vector plasmid with a GFP marker gene and a PGK promoter.

The expression of the gene product may be upregulated or downregulated. Preferably, the expression of the gene product is upregulated.

Preferably, the RNA does a vector according to any preceding claim, wherein the RNA does not bind to the messenger RNA of the gene which encodes the gene product. Preferably the RNA is delivered directly into the nucleus of a cell, i.e. rather than into the cytoplasm. In a preferred embodiment, the target sequence is within a promoter area of human VEGF-A, and is selected from:

CCTCTTAGCTTCAGATTTG -(183);

GAGCCAGGAAATAAACATT- (472);

TTGGTTAAATTGAGGGAAA - (736);

GAAATAGCCAGGTCAGAAA - (888);

ACTGACTAACCCCGGAACC - (1424);

GCAGCGTCTTCGAGAGTGA - (1833);

CTTCAATATTCCTAGCAAA -(2006);

GTGTCTCTGGACAGAGTTT - (2101);

TTCACTGGGCGTCCGCAGA -(2204); or

TCCCGGCGGGGCGGAGCCAT -(2297), wherein the numbers in parenthesis denote the first nucleotide in the SiRNA target sequence relative to SEQ 10 NO: 1.

Once a target sequence within a gene is chosen, RNA can be constructed. The RNA transcribed by a vector of the invention is cloned into a plasmid containing only a RNA promoter (e.g. U6), just after the promoter. The promoter and the shRNA cassette is then cleaved, as one piece, and transferred into a transfer vector, preferably a lentiviral transfer vector. The resultant transfer vector plasmid is then used for virus production.

The RNA hairpins resemble naturally occurring micro RNA's. This has been found to be more effective than expressing each RNA strand separately by two promoters, as it is not certain that the two strands will anneal together. Hairpin RNAs are processed in cells in an RNA interference-related pathway, which is similar to how siRNAs are processed.

Natural mi RNAs are expressed as longer transcripts in a cell's nucleus, and cut into smaller pieces by the enzyme Drosha. The shRNAs do not need this processing as they are already the correct size. These shRNA hairpins are transported from nucleus to the cytoplasm (by exportin-5), where another enzyme, Dicer, dices the hairpin to form double-stranded RNA (at this stage the structure is the same as in siRNAs). These molecules bind to RISC (RNA- induced silencing complex). RISC contains Argonaute-2 enzyme(Ago-2), which has catalytic activity, and which is the active component in siRNA-mediated mRNA cleavage. Ago-2 has also been shown to be involved in epigenetic effects of small RNAs, and it has been shown that Ago-2 is present in the same positions where histone modifications occur. For the epigenetic effects to occur, the RNA complex has to be transported back to the nucleus. It has also been shown that lysine specific demethylase-1 (LSD-1) is the enzyme that removes the methylations at target histones. This process is represented by Figure 4.

A hairpin produced by a vector of the invention may affect the histone tails' modifications, for example acetylation or methylation, and therefore may affect the epigenetic state within, or close to, a target gene. This may affect expression of a gene product, which may produce a therapeutic effect.

The following studies illustrate the utility of the invention. Study 1

The shRNA sequences were designed by using Dharmagon siDESIGN Center algorithm

(http://www.dharmacon.com/DesignCenter/DesignCenterPage.aspx). The chosen target sequences were: CGTTCTCAGTGCCACAAAT (-856), CTGCCGCACTCAAGAATCA (-599), GACGCGTGTTTCAATGTGA (-451), and CAAGGAAGAGAGAGAGAGA (+335). The number in parenthis refers to the first nucleotide in the sequence of the shRNA relative to the TSS of mouse VEGF-A promoter (U41383). As a control, a mismatched sequence lacking any similarity to the murine sequence, and a lentivirus (LV) encoding only green fluorescent protein (GFP) without a shRNA cassette, were used. The shRNA sequences were cloned into Apal(blunted)-EcoRI-restriction sites in the pB-hU6 plasmid. For blunting T4 DNA polymerase(NEB) was used.

The shRNA-oligo design for a product designated U6 was a first oligo comprising, starting from 5^'-end:

1. 19-21-mer sense target sequence (without AA, directly as in DNA sequence)

2. loop sequence (CTTCCTGTCA)

3. antisense target sequence (forming hairpin with sense)

4. termination codon (TTTTT)

5. G for EcoRI-site. For example, the first oligo for the LV-856 under U6 promoter was CGTTCTCAGTGCCACAAATCTTCCTGTCAATTTGTGGCACTGAGAACGTTTT TG

The second oligo was complementary to the first oligo, and had additionally 5^'-AATT-overhang for EcoRI site at its 5 ^'-end. Therefore, after annealing, one site was blunt and the other site had a TTAA-overhang for EcoRI.

These oligos may be represented as:

5' 3'

3^' TTAA-5^'

After the first cloning step, the UβshRNA cassette was cleaved by Xhol- digestion and ligated into Xhol-site in the LV-1-hPGK-GFP-plasmid (3^rd generation lentiviral transfer vector plasmid with GFP marker gene). This plasmid was then used for standard LV (lentivirus) production.

The third generation HIV-1 based LV-PGK-GFP-U6shRNA vectors were prepared by standard calcium phosphate transfection method in 293T cells, as described in Makinen et al., 2006. The MS1 and C166 (ATCC: CRL-2583) cells were cultured in DMEM containing fetal bovine serum (FBS, 10% for C166 and 5% for MS1), 100 unit/ml penicillin and 100 ug/ml streptomycin.

GFP fluorescence was measured by flow cytometry using CANTO Il (Becton Dickinson) and by fluorescence microscopy. Quantitative determination of VEGF in medium was determined by a specific murine VEGF enzyme-linked immunosorbent assay (Quantikine VEGF-ELISA kit; R&D Systems). The Western blot cells were lysed with cold 50 mM Tris, 150 mM NaCI, 1 mM EDTA, 1%Triton-X 100, 0.5% Na-deoxycholate, 0.1% SDS, 10% glycerol and pH 7.5 buffer. Total protein concentrations were measured with Coomassie Plus Assay Kit (Pierce). Samples were adjusted into 2.5 mg/ml concentration and 75 μg protein per sample was run into 15% SDS-PAGE gel. Recombinant VEGF-A_16S protein (200 ng) was used as a positive control. Proteins were transferred onto nitrocellulose membrane and probed with the following antibodies: mVEGF (C-1) (SantaCruz) and anti-hVEGF (R&D Systems). The following secondary antibodies were used: goat anti-mouse HRP-conjugate (Pierce) and donkey anti- goat HRP-conjugate (SantaCruz). Detection was carried out using SuperSignalWestDura (Pierce) kit into CL-Xposure Film (Pierce). For realtime TaqMan RT-PCR, total RNA of C166-GFP cells was extracted by Trizol Reagent (Gibco BRL) and treated with DNase I (Promega). RNA was reverse transcribed to cDNA by M-MuLV reverse transcriptase (MBI Fermentas). mVEGF-A mRNA levels were measured by real time PCR (ABI PRISM 7700 detection system, Applied Biosystems) using Taqman® Gene expression assay (assay ID: Mm00437304_m1 , Applied Biosystems). β-actin mRNA levels were measured by Taqman® Gene expression assay (Mouse ACTB Endogenous Control (VIC®/MGB Probe, Primer Limited, part number: 4352341 E, Applied Biosystems) and was used as an endogenous amplification control for normalization.

ChIP assays were performed as described in Vaisanen 2005. The antibodies against acetylated histone H3 (AcH3(K9), 07-352) and methylated histone H3 (MeH3(K9), 07-523 and MeH3(K4), 07-030) were from Upstate Biotechnology (Upstate Biotechnology, Lake Placid, NY, USA). IgG (sc-2027) was obtained from Santa Cruz Biotechnologies (Heidelberg, Germany). The ChIP templates were analyzed by semi-quantitative real-time PCR. For each of the 8 regions within the mVEGF promoter or coding region, specific primer pairs were designed (Table 1), optimized and controlled by running PCR with 25 ng genomic DNA (input) as a template. When running immuno-precipitated DNA (output) as a template, the following PCR profile was used: 10 min at 95°C, 34 cycles of 30 s at 95°C, 20 s at 56°C and 20 s at 72°C, and the final extension for 10 min at 72°C. The PCR products were separated by electrophoresis in 2% agarose gels. Gel images were scanned in a FLA-3000 reader (Fuji, Tokyo, Japan) and analyzed using Image Gauge software (Fuji, Tokyo, Japan).

Table 1. PCR primers used in ChIP analysis. Sequences and location relative to the TSS (+1) are shown.

Several murine cell lines were tested, by transducing them with LVs encoding shRNAs targeting different areas in mouse VEGF-A promoter. C166 (yolk sac derived mouse endothelial cells) gave a clear response to transduction, as monitored by ELISA assay (Figure 1). These cells produce more VEGF as compared to MS1 endothelial cells (derived from Langerhans islets) which did not show any differences after LV transduction. In C166 cells, LV-856, caused major decrease in VEGF production as monitored by ELISA. However, LV-451 caused a substantial increase in VEGF production. The other vectors did not show any major differences in VEGF production, except LV-599, which showed a modest increase. C166 cells were transduced using MOI 10 (7 days).

The same samples were analysed by Western blot to confirm the results at the protein level. Again, LV-856 showed a clear decrease.

To analyze whether alterations in VEGF production correlated with mRNA levels, C166 cells were analysed by TaqMan RT-PCR, which showed the same profile of VEGF production as ELISA analyses (Figure 2). Morphological changes were also observed in C166 cells, especially if MOI higher than 10 was used. C166 gradually lost adherence and ability to grow when transduced with LV-362

To analyse the expected changes in histone code caused by these vectors, ChIP experiments were conducted using antibodies against different histone modifications. It was noted that MS1 and C166 cells have different profiles of histone modifications in the VEGF promoter region, which may be linked to their different ability to produce VEGF. In MS1 cells, TSS with region - 905 to -657 is free from any histone modifications, and shRNAs may not make any alterations to histone code. Other regions are heavily acetylated. In the region -905 to -657 in C166 cells, LV-856 causes a total loss of both acetylation and methylation. This may mean that this area is a negative regulator of VEGF promoter, since when exposed, it results in a loss of VEGF expression. LV-451 , which upregulates VEGF expression, does not have a direct effect on its target region (-534 to -311). Instead, it affects TSS region (-24 to 398) by causing a strong MeH3(K4) methylation.

In this study, it has been demonstrated that shRNA LV-856 can efficiently remove H3K4 methylation at specific areas of murine VEGF-A promoter, resulting in a transcriptional shutdown of the gene. Further, activating shRNA LV-451 increases H3K4 methylation at the proximity of TSS. Recently described JARID1 and LSD1 proteins may be important demethylases, specific for H3K4. They may repress transcription via an epigenetic mechanism, by demethylation of H3K4 at the promoter region or by potentiating transcription via interactions with transcription activators. This study has found that particular shRNAs regulate VEGF and additionally shows an important link between shRNAs targeted to VEGF promoter region and transcriptional repression/activation, which are associated with changes in H3K4 methylation. Study 2

In this study, 23 c57Black6/Harlan female mice (8 weeks old) were used. Unilateral hindlimb ischemia was induced by ligating the left femoral artery proximal to the bifurcation of the saphenous and poplital arteries. Lentiviral vector encoding PGK-GFP marker gene and in -856 and -451 samples also U6 driven shRNA against VEGF-A promoter region were introduced to muscles by 10 intramuscular injections in total 30 ul volume. The animals were killed 5 days after the operation. Muscle samples were collected for ELISA, ChIP and histological analysis. For ELISA, proteins were extracted and total protein amount was determined by BCA kit. ELISA was done according to instructions (Quantikine, R&D systems). The statistical analysis was made using one-way ANOWA (GraphPad Prism). All animal experiments were approved by Experimental Animal Committee of Kuopio University. The results of the ELISA show that LV-856 caused a decrease in VEGF-A production, whereas LV-451 caused an increase.

To analyse whether shRNA mediated epigenetic modulation of the VEGF-A promoter was present also in vivo, qChlP analysis was performed using skeletal muscle tissues from transduced mice with antibodies against H3K4me2, H3K9me2, H3K9ac2, H3CT, Ago2, LSD1 and JaridiB. LV-856 and LV-451 showed similar epigenetic profiles in vivo as was observed in C166 cells (Study 1). LV-856 caused enrichment of H3K9me2 and nucleosome density, and simultaneously decreased H3K4me2 and H3K9ac2 both at the targeted promoter region and TSS of VEGF-A. The effects of LV-451 were opposite to those of LV-856, as it enriched H3K4me2 and decreased H3K9me9 both at the targeted promoter region and TSS. However, no clear effects on H3K9ac2 and nucleosome density were observed.

When recruitment of transcription factors to VEGF-A promoter was examined, the results suggested that both LV-451 and LV-856 increased the recruitment of Ago2 to the respective promoter regions and TSS. These results suggest that Ago2 has an important role also in vivo in the shRNA mediated transcriptional regulation. As in C166 cells, Jaridi B seemed not to have a role in LV-856 and LV-451 mediated transcriptional regulation.

LV-856 increased the recruitment of LSD1 to the targeted promoter region, but no enrichment at TSS was observed. LV-856 also caused the recruitment of RNA polymerase Il to the VEGF-A promoter and TSS. LV-451 did not have any effects on LSD1 or RNA polymerase Il recruitments. Thus, in vivo qChlP results are in a good agreement with those obtained in C166 cells.

In these studies, it has been shown that lentivirus-mediated delivery of shRNA molecules, targeted to specific loci in mouse VEGF-A promoter, either represses or induces VEGF-A expression. This may significantly expand the therapeutic use of small RNAs, and suggests new possibilities for the activation of gene expression in vitro and in vivo. The shRNAs may be useful in gene therapy, and are likely to cause fewer side-effects than traditional delivery of potent transgenes. Down-regulation of VEGF expression is favorable in the treatment of many cancers, whereas VEGF up-regulation has been used for the treatment of muscle ischemia and cardiovascular diseases. Thus, epigenetic control of gene expression via delivery of promoter-targeted shRNAs may be an important new therapeutic approach for the treatment of various diseases. Study 3

All siRNAs used in this study were manufactured by Applied biosystems (www.ambion.com). 10 different siRNA construct were used to target different regions of human VEGF-A promoter. The chosen target sequences of siRNA constructs were CCTCTTAGCTTCAG ATTTG -(183),

GAGCCAGGAAATAAACATT- (472), TTGGTTAAATTGAGGGAAA - (736), GAAATAGCCAGGTCAGAAA - (888), ACTGACTAACCCCGGAACC - (1424), GCAGCGTCTTCGAGAGTGA - (1833), CTTCAATATTCCTAGCAAA -(2006), GTGTCTCTGGACAGAGTTT - (2101), TTCACTGGGCGTCCGCAGA -(2204), TCCCGGCGGGGCGGAGCCAT -(2297). The numbers indicates first nucleotide in siRNA target sequence relative to gene promoter (accession number AF095785).

Transfection was optimized by varying RNAi duplex (annealed siRNA) and Lipofectamine™ RNAiMAX concentration. Reverse transfection was used to introduce siRNA into MCF10A cells by Lipofectamine™ RNAiMAX. The optimized condition for siRNA transfections was siRNA=50nM/Lipofectamine™ RNAiMAX=7.5μl. Transfection efficiency was monitored by FACS.

Human MCF-10A cells were cultured in MEBM supplemented with (BPE 13 mg/ml, 2 ml; hydrocortisone 0.5 mg/ml, 0.5 ml; hEGF 10 ug/ml, 0.5 ml; insulin 5 mg/ml, 0.5 ml); 100 ng/ml cholera toxin. MCF 10A cells were transfected in triplicates by each siRNA (2x10⁵cells/well, 5OnM siRNA and Lipofectamine™ RNAiMAX.). Transfection was done in 700 μl of MEBM without adding any supplement, after 8 hours MEBM along with its supplement were added to cells making final volume of 1.7 ml. The cells were grown in a humidified 95 % air / 5 % CO2 incubator at 37°C.

Medium samples were collected at day 7 and hVEGF-A protein expression was measured using human VEGF-A immunoassay kit (Quantikine, R & D systems, catalog number SVEOO). Results Results are shown in Figure 5. The results are expressed as mean of triplicate samples and error bars represent standard deviation. Figure 5 shows that siRNAs 472 and 888 mediate downregulation of hVEGF-A expression and that siRNAs 183 and 736 mediate upregulation of hVEGF-A expression. Study 4

The Human DOK1 promoter was identified by searching the literature and using bioinformatics programs including the USC genome browser (http://genome.ucsc.edu/) and the TFSEARCH database

(http://www.cbrc.jp/research/db/TFSEARCH.html). The DOK1 promoter was analysed and 12 sequences were selected for screening. siRNA corresponding to the 12 candidate sequences, as well as a control scrambled and control DOK1 siRNA were individually transfected into U87MG cells and DOK1 expression levels were determined by western blot analysis. As shown in table 2, a single siRNA (#11) corresponding to sequence (GGCCAGGGGAGACTGGACC) (SEQ ID NO: 3), showed approximately a 50% level of knockdown compared to the control scramble siRNA.

Table 2: Effect of DOK1 promoter specific siRNAs on DOK1 protein Expression

Treatment of U87MG cells with siRNA to DOK1 resulted in a significant reduction in cell migration in response to Hepatocyte Growth Factor (HGF) and Platelet Derived Growth Factor (PDGF). In addition treatment of Human Umbilical Vein Endothelial cells (HUVECs) with siRNA to DOK1 resulted in a significant reduction in cell migration in response to VEGF-A. Due to the reduction in both tumour cell and endothelial cell migration, DOK1 could be a possible therapeutic target for use in inhibiting tumour metastasis and angiogenesis. Reference List

Li LC et al., Proc Natl Acad Sci U S A 2006; 103: 17337-17342.

Janowski BA etai., Nat Chem Biol 2007;3: 166-173.

Janowski BA etai, NatChem Biol 2005; 1:210-215.

Morris KV etai., Sc/eπce 27-8-2004;305: 1289- 1292.

Janowski BA etai., Nat Struct MoI Biol 2006; 13:787-792.

Han J et al., Proc Natl Acad Sci U SA 24-7-2007; 104: 12422-12427.

Mette MF etai., EMBO J 2000; 19:5194-5201.

Yla-Herttuala S etai., Nat Med 2003;9:694-701.

Makinen Pl et al., J Gene Med2006;8:433-441.

Vaisanen S et al., J MoI Biol 1 -7-2005;350:65-77.

Strahl BD etai., Proc Natl Acad Sci U S A 1999;96:14967-14972.

Benevolenskaya EV, Biochem Cell Biol 2007;85:435-443.

Claims

1. A vector for use in therapy effected by expression of a gene product, wherein the vector comprises a nucleotide sequence that can be transcribed to give RNA that can form a double-stranded RNA hairpin construct, wherein the RNA comprises:

(i) a first sequence identical or complementary to a target sequence within a promoter area of the gene which encodes the gene product;

(ii) a loop sequence;

(iii) a sequence complementary to the first sequence; and

(iv) a termination codon.

2. A vector according to claim 1 , wherein the loop sequence comprises all or part of CTTCCTGTCA.

3. A vector according to claim 1 or claim 2, wherein the sequence within the promoter area of the gene does not contain the nucleic acid sequence TATA.

4. A vector according to any preceding claim, wherein the expression of the gene product can be regulated by a transcription factor selected from SP1 , AP1 , AP2, NfKB, Nrf2, KLF2, KLF4, HIF-1a/2a and PGC-Ia.

5. A vector according to any preceding claim, wherein the gene product is an agonist or antagonist of a VEGF receptor or VEGF binding site.

6. A vector according to claim 5, wherein the gene product is a member of the VEGF family, e.g. VEGF-A.

7. A vector according to any of claims 1 to 4, wherein the gene product is DOK1.

8. A vector according to any preceding claim, which is a viral vector.

9. A vector according to claim 8, which is a lentiviral vector, an AAD retroviral vector or an adenoviral vector.

10. A vector according to any of claims 1 to 7, which is a non-viral vector.

11. A vector according to any preceding claim, wherein the expression of a gene product is upregulated.

12. A vector according to any preceding claim, wherein the RNA does not bind to the messenger RNA of the gene which encodes the gene product.

13. A vector according to any preceding claim, wherein the RNA is delivered directly into the nucleus of a cell.

14. A vector according to any preceding claim, wherein the target sequence is within a promoter area of human VEGF-A, and is selected from: CCTCTTAGCTTCAGATTTG -(183); GAGCCAGGAAATAAACATT- (472);

TTGGTTAAATTGAGGGAAA - (736); GAAATAGCCAGGTCAGAAA - (888); ACTGACTAACCCCGGAACC - (1424); GCAGCGTCTTCGAGAGTGA - (1833); CTTCAATATTCCTAGCAAA -(2006); GTGTCTCTGGACAGAGTTT - (2101); TTCACTGGGCGTCCGCAGA -(2204); or TCCCGGCGGGGCGGAGCCAT -(2297), wherein the numbers in parenthesis denote the first nucleotide in the siRNA target sequence relative to SEQ ID NO:1.

15. A system comprising an oligonucleotide and an oligonucleotide delivery system, which can generate an RNA construct, as defined in any preceding claim.

16. A system according to claim 15, for use in therapy effected by expression of a gene product.

17. A vector or a system according to any preceding claim, wherein the therapy is the regulation of arteriogenesis, angiogenesis or lymphangiogenesis.

18. A vector or a system according to any preceding claim, wherein the therapy is of retinopathy, cancer, cardiovascular disease, psoriasis or arthritis.

19. A vector or a system according to any preceding claim, wherein the therapy is inhibiting tumour metastasis.