JP2007530431A - Compositions and methods for treating pancreatic cancer - Google Patents

Abstract

The invention features a method of inhibiting cancer cell growth by contacting a cancer cell with an siRNA composition that inhibits expression of PCDH1, CDH3, or GPR107. Methods for treating cancer are also within the scope of the present invention. The invention also features products, such as nucleic acid sequences and vectors, and compositions containing them useful in the provided methods. The invention also provides a method of inhibiting tumor cells such as, for example, pancreatic cancer cells, particularly pancreatic ductal adenocarcinoma (PDACa).

Description

TECHNICAL FIELD The present invention relates to the field of biological science, more specifically to the field of cancer research. In particular, the present invention relates to a composition comprising a nucleic acid capable of inhibiting the expression of a gene encoding PCDH1, CDH3, or GPR107. In certain embodiments, the compound is a small interfering RNA (siRNA) corresponding to a subsequence derived from these genes. This application claims the benefit of US Provisional Patent Application No. 60 / 555,809 filed on March 24, 2004, the contents of which are hereby incorporated by reference in their entirety. Is incorporated into.

BACKGROUND ART Pancreatic ductal adenocarcinoma (PDACa) is the fifth leading cause of cancer death in the western world, and has one of the highest mortality rates of any malignant tumor, with a 5 year survival rate of only 4%. In the United States, an estimated 30,700 patients are diagnosed with pancreatic cancer each year and nearly 30,000 die from these diseases. The majority of patients are diagnosed with an advanced stage of disease, at which stage the disease does not respond to current treatment and patients can only survive for months. Although only surgical resection is expected to cure, only 10-20% of PDACa patients can undergo resection with a curative cure, and 80-90% of patients will recur even after surgery. To die. Surgical results or quality of life improve somewhat in patients who have also received chemotherapy and / or radiation, including gemcitabine, but the impact on long-term survival is extremely high because of the strong tolerance to any treatment with PDACa It was slight. Currently, treatment techniques for most patients are focused on temporary relief.

  Therefore, the establishment of a novel PDACa molecular therapy and the identification of a novel molecular target for PDACa treatment are currently urgent issues for pancreatic cancer treatment.

DISCLOSURE OF THE INVENTION The present invention is based on the surprising discovery that inhibition of PCDH1, CDH3, or GPR107 expression is effective in inhibiting cell proliferation of various cancer cells, including cancer cells involved in PDACa. The invention described in this application is based in part on this discovery.

  The present invention provides a method of inhibiting cell proliferation. Among the methods provided are methods comprising contacting a cell with a composition comprising a small interfering RNA (siRNA) that inhibits expression of PCDH1, CDH3, or GPR107. The present invention also provides a method of inhibiting tumor cell growth in a subject. Such a method comprises administering to a subject a composition comprising a small interfering RNA (siRNA) that specifically hybridizes to a sequence derived from PCDH1, CDH3, or GPR107. Another aspect of the present invention provides a method of inhibiting the expression of a PCDH1 gene, a CDH3 gene, or a GPR107 gene in a cell of a biological sample. Gene expression may be inhibited by introducing a sufficient amount of a double-stranded ribonucleic acid (RNA) molecule into the cell to inhibit expression of the PCDH1 gene, CDH3 gene, or GPR107 gene. Another aspect of the present invention relates to products comprising nucleic acid sequences and vectors and compositions comprising them, for example, useful in the provided methods. Among the products provided are siRNA molecules that have the property of inhibiting the expression of the PCDH1 gene, CDH3 gene, or GPR107 gene when introduced into cells that express the PCDH1 gene, CDH3 gene, or GPR107 gene. is there. Some such molecules include a sense strand and an antisense strand, the sense strand contains a ribonucleotide sequence corresponding to a PCDH1, CDH3, or GPR107 target sequence, and the antisense strand is complementary to the sense strand. There are molecules that contain nucleotide sequences. The sense and antisense strands of the molecule hybridize to each other to form a double stranded molecule.

  As used herein, the term “organism” means any living organism that consists of at least one cell. The organism may be as simple as eukaryotic single cells, or as complex as mammals including humans.

  As used herein, the term `` biological sample '' refers to an entire organism, or a portion of a tissue, cell, or component thereof (e.g., body fluid (blood, mucus, lymph, synovial fluid, cerebrospinal fluid, saliva, Amniotic fluid, amniotic cord blood, urine, vaginal fluid, and semen)). A “biological sample” further refers to a homogenate, lysate, extract, cell culture, or tissue culture, or a fraction or one thereof, prepared from the entire organism or a subset of its cells, tissues, or components. Part. Finally, “biological sample” means a medium such as a nutrient medium or gel in which an organism has been grown, containing cellular components such as proteins or nucleic acid molecules.

  The invention features a method of inhibiting cell proliferation. Cell proliferation is inhibited by contacting the cells with a composition of PCDH1, CDH3, or GPR107 small interfering RNA (siRNA). In addition, the cells are contacted with a transfection facilitating agent. The cells are provided in vitro, in vivo, or ex vivo. The subject is a mammal, for example, a human, non-human primate, mouse, rat, dog, cat, horse, or cow. The cell is a pancreatic duct cell. Alternatively, the cell is a tumor cell (ie, a cancer cell) such as a carcinoma cell or an adenocarcinoma cell. For example, the cell is a pancreatic ductal adenocarcinoma cell. Inhibition of cell growth means that treated cells grow slower than untreated cells or that viability is reduced. Cell proliferation is measured by proliferation assays well known in the art.

  The term “siRNA” refers to a double-stranded RNA molecule that prevents translation of a target mRNA. Standard techniques for introducing siRNA into cells are used, including techniques where the template for transcription of RNA is DNA. The siRNA comprises a PCDH1 sense nucleic acid sequence, a CDH3 sense nucleic acid sequence, or a GPR107 sense nucleic acid sequence, a PCDH1 antisense nucleic acid sequence, a CDH3 antisense nucleic acid sequence, or a GPR107 antisense nucleic acid sequence, or both. siRNAs may contain two types of complementary molecules, or one transcript may be constructed to have both sense and complementary antisense sequences from the target gene, for example A hairpin, in certain embodiments, it produces microRNA (miRNA).

  The method is used, for example, to alter gene expression in cells that are upregulated in expression of PCDH1, CDH3, or GPR107 as a result of malignant transformation of the cells. Binding of siRNA and PCDH1 transcript, CDH3 transcript, or GPR107 transcript in the target cell decreases the production of PCDH1, CDH3, or GPR107 by the cell. The length of the oligonucleotide is at least about 10 nucleotides and may be as long as a naturally occurring PCDH1 transcript, CDH3 transcript, or GPR107 transcript. Preferably, the length of the oligonucleotide is about 19 to about 25 nucleotides. Most preferably, the length of the oligonucleotide is less than about 75 nucleotides, less than about 50 nucleotides, or less than about 25 nucleotides. Examples of PCDH1 siRNA, CDH3 siRNA, or GPR107 siRNA oligonucleotides that inhibit the expression of PCDH1, CDH3, or GPR107 in mammalian cells include oligos that include target sequences, eg, nucleotides of SEQ ID NOs: 22, 23, or 24, respectively Nucleotides are mentioned.

  Methods for designing double stranded RNA having the ability to inhibit gene expression in target cells are well known. (See, eg, US Pat. No. 6,506,559, which is incorporated herein by reference in its entirety). For example, a computer program for designing siRNA can be obtained from the Ambion website (http://www.ambion.com/techlib/misc/siRNA_finder.html). This computer program, available by Ambion, selects nucleotide sequences for siRNA synthesis based on the following protocol.

siRNA target site selection
1. Scan downstream AA dinucleotide sequence starting from transcript start codon AUG. Record the occurrence of AA and 3 ′ adjacent 19 nucleotides as siRNA target candidate sites. Tuschl et al., Targeted mRNA degradation by double-stranded RNA in vitro. Genes Dev 13 (24): 3191-7 (1999), 5 'and 3' untranslated regions (UTR) and near the start codon (within 75 bases) It is recommended not to design siRNAs for these regions, as these regions may contain many regulatory protein binding sites. UTR binding proteins and / or translation initiation complexes may interfere with the binding of the siRNA endonuclease complex.

  2. Compare the target candidate site with the appropriate genomic database (human, mouse, rat, etc.) and exclude all target sequences with significant homology with other coding sequences from consideration. We propose to use BLAST found on the NCBI server at www.ncbi.nlm.nih.gov/BLAST/.

  3. Select a target sequence suitable for synthesis. It is typical to select and evaluate several target sequences depending on the length of the gene.

  An isolated nucleic acid molecule comprising a target sequence, eg, the nucleotide nucleic acid sequence of SEQ ID NO: 22, 23, and 24, or a nucleic acid molecule that is complementary to the nucleotide sequence of SEQ ID NO: 22, 23, and 24 nucleotides include. As used herein, an “isolated nucleic acid” is a nucleic acid that has been removed from its original environment (eg, the natural environment if it is naturally occurring), and thus has been artificially altered from its natural state. It is a nucleic acid. In the present invention, isolated nucleic acid includes DNA, RNA, and derivatives thereof. If the isolated nucleic acid is RNA or a derivative thereof, the base “t” in the nucleotide sequence must be replaced with “u”. As used herein, the term “complementary” refers to Watson-Crick base pairs or Hoogsteen base pairs between nucleotide units of a nucleic acid molecule, and the term “binds” refers to two nucleic acids or compounds. Or a physical or chemical interaction between related nucleic acids or compounds, or a combination thereof. Complementary nucleic acid sequences hybridize under appropriate conditions to form stable duplexes with little or no mismatch. For the purposes of the present invention, two sequences with 5 or fewer mismatches are considered complementary. Furthermore, the sense and antisense strands of the isolated nucleotides of the present invention can form double stranded nucleotides or hairpin loop structures by hybridization. In a preferred embodiment, such duplexes contain no more than 1 mismatch per 10 matches. In particularly preferred embodiments, such duplexes do not contain mismatches when the strands of the duplex are perfectly complementary. For PCDH1, CDH3, or GPR107, the nucleic acid molecule is less than 3851, 3205, or 6840 nucleotides in length, respectively. For example, the nucleic acid molecule is less than about 500 nucleotides, less than about 200 nucleotides, or less than about 75 nucleotides in length. Also encompassed by the invention are vectors containing one or more of the nucleic acids described herein and cells containing the vectors. The isolated nucleic acids of the invention are useful for siRNA or DNA encoding siRNA against PCDH1, CDH3, or GPR107. When the nucleic acid is used for siRNA or its coding DNA, the sense strand is preferably longer than about 19 nucleotides, more preferably longer than 21 nucleotides.

The present invention is based in part on the discovery that genes encoding PCDH1, CDH3, or GPR107 are overexpressed in pancreatic ductal adenocarcinoma (PDACa) compared to non-cancerous pancreatic tissue. The PCDH1 cDNA is 3851 nucleotides long, the CDH3 cDNA is 3205 nucleotides long, and the GPR107 cDNA is 6840 nucleotides long. The nucleic acid and polypeptide sequences of PCDH1, CDH3, or GPR107 are shown in SEQ ID NOs: 1 and 2, 3 and 4, or 5 and 6, respectively. Sequence data is also available via the following accession numbers.
PCDH1 (CFUPC): L11370, NM_002587
CDH3: X63629, NM_001793
GPR107: NM_032925, NM_020960, (KIAA1624: R39794) AB046844

  Transfection of siRNA containing SEQ ID NOs: 22, 23, and 24 resulted in inhibition of growth of the PDACa cell line. PCDH1 (CFUPC) belongs to the protocadherin family, the largest subgroup of the cadherin superfamily, which is a calcium-dependent intercellular adhesion molecule. Many protocadherins are highly expressed in the central nervous system and likely play a role in the regulation of neural circuit development and synaptic transmission (Sano K, Tanihara H, Heimark RL, Obata S, Davidson M, St John T, Taketani S, Suzuki S. Protocadherins: a large family of cadherin-related molecules in central nervous system.EMBO J., 12: 2249-56, 1993.Frank M, and Kemler R. Protocadherins. Curr Opin Cell Biol ., 14: 557-62, 2002). However, although PCDH1 is abundant in pancreatic cancer cells, it is not present in the central nervous system (FIG. 3A) and its function is still unknown.

  CDH3 is also a classic member of the cadherin family (Shimoyama Y, Yoshida T, Terada M, Shimosato Y, Abe O, Hirohashi S. Molecular cloning of a human Ca2 + -dependent cell-cell adhesion molecule homologous to mouse placental cadherin: its low expression in human placental tissues. J Cell Biol., 109: 1787-94. 1989), cadherin binds to catenin and cytoskeleton through its conserved intracellular domain, thereby cell polarity, differentiation, It mediates signal transduction that controls movement and cell proliferation (Christofori G. Changing neighbors, changing behavior: cell adhesion molecules-mediated signaling during tumor progression. EMBO J., 22, 2318-2323, 2003). However, unlike E-cadherin and N-cadherin, the function of CDH3 is still unknown. Its expression was observed in the mammary gland and ovary and was reported to disappear in breast and prostate cancer, but P-cadherin expression in breast cancer correlates with poor prognosis (Peralta Soler A, Knudsen KA , Salazar H, Han AC, Keshgegian AA. P-cadherin expression in breast carcinoma indicates poor survival. Cancer, 86: 1263-1272. 1999).

  GPR107 (KIAA1624) is one of seven transmembrane G protein coupled receptors (GPCR). A significant proportion of today's indicators target one or more GPCRs, and the most main therapeutic areas are met to some extent by several GPCR-based drugs. Clearly, GPCRs are in the highest position in terms of drug discovery potential. GPR107 is expressed indefinitely in normal heart, placenta, skeletal muscle, prostate, testis, ovary, spinal cord, as shown in Northern blot analysis (FIG. 3C). Expression in major essential organs is not abundant, suggesting that targeting these molecules shows little toxicity to the human body.

Methods of Inhibiting Cell Growth The present invention relates to inhibiting cell growth, ie inhibiting cancer cell growth by inhibiting the expression of PCDH1, CDH3, or GPR107. The expression of PCDH1, CDH3, or GPR107 is, for example, specifically inhibited by small interfering RNA (siRNA) that targets the PCDH1, CDH3, or GPR107 gene. PCDH1, CDH3, or GPR107 targets include, for example, the nucleotides of SEQ ID NOs: 22, 23, and 24.

  In non-mammalian cells, double-stranded RNA (dsRNA) has been shown to have a powerful and specific silencing effect on gene expression, called RNA interference (RNAi) (Sharp PA. RNAi and double-strand RNA. Genes Dev. 1999 Jan 15; 13 (2): 139-41.). dsRNA is processed into 20-30 nucleotide dsRNA called small interfering RNA (siRNA) by an enzyme containing RNaseIII motif. siRNAs specifically target complementary mRNAs with multi-component nuclease complexes (Hammond SM, Bernstein E, Beach D, Hannon GJ. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells.Nature. 2000 Mar 16; 404 (6775): 293-6; Hannon GJ. RNA interference. Nature. 2002 Jul 11; 418 (6894): 244-51.). In mammalian cells, siRNAs composed of 20 or 21-mer dsRNAs with 19 complementary nucleotides and a 3'-terminal non-complementary dimer of thymidine or uridine can alter the overall gene expression. It has been shown to have a gene-specific knockdown effect without induction (Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammal cells. Nature. 2001 May 24; 411 (6836): 494-8.). In addition, plasmids containing nuclear small RNA (snRNA) U6 or polymerase III H1-RNA promoters mobilize the type III class of RNA polymerase III to effectively produce such short RNAs, and therefore their targets mRNA can be constitutively suppressed (Miyagishi M, Taira K. U6 promoter-driven siRNAs with four uridine 3 'overhangs efficiently suppress targeted gene expression in mammalian cells.Nat Biotechnol. 2002 May; 20 (5): 497- 500 .; Brummelkamp TR, Bernards R, Agami R. A System for Stable Expression of Short Interfering RNAs in Mammalian Cells Science. 296 (5567): 550-553, April 19, 2002.).

  Cell proliferation is inhibited by contacting the cell with a composition comprising a PCDH1 siRNA, a CDH3 siRNA, or a GPR107 siRNA. The cell is further contacted with a transfection agent. Suitable transfection agents are well known in the art. Inhibition of cell growth means that the cells grow at a slower rate or have a reduced survival rate compared to cells that have not been exposed to the composition. Cell proliferation is measured by methods well known in the art (eg, MTT cell proliferation assay).

The PCDH1 siRNA, CDH3 siRNA, or GPR107 siRNA is directed to a single target PCDH1 gene sequence, target CDH3 gene sequence, or target GPR107 gene sequence. Alternatively, the siRNA is directed to multiple target PCDH1 gene sequences, target CDH3 gene sequences, or target GPR107 gene sequences. For example, the composition comprises 2, 3, 4, or 5 or more PCDH1 target sequences, CDH3 target sequences, or PCDH1 siRNA, CDH3 siRNA, or GPR107 siRNA against a GPR107 target sequence. By PCDH1, CDH3 or GPR107, the target sequence means a nucleotide sequence identical to a part of the PCDH1 gene, CDH3 gene or GPR107 gene. The target sequence may include a 5 ′ untranslated (UT) region, an open reading frame (ORF), or a 3 ′ untranslated region of the human PCDH1 gene, CDH3 gene, or GPR107 gene. Alternatively, the siRNA is a nucleic acid sequence that is complementary to an upstream or downstream modulator of expression of the PCDH1 gene, CDH3 gene, or GPR107 gene. Examples of upstream modulators or downstream modulators include PCDH1 gene promoter, CDH3 gene promoter, or transcription factor that binds to GPR107 gene promoter, PCDH1 polypeptide, CDH3 polypeptide, or kinase or phosphatase that interacts with GPR107 polypeptide, PCDH1 promoter, A CDH3 promoter, or a GPR107 promoter or enhancer. PCDH1 siRNA, CDH3 siRNA, or GPR107 siRNA that hybridizes to the target mRNA usually binds to single-stranded mRNA transcripts, thereby preventing protein translation and thus preventing expression, thereby preventing PCDH1 gene, CDH3 gene, Or reduces or inhibits the production of PCDH1 polypeptide, CDH3 polypeptide, or GPR107 polypeptide product encoded by the GPR107 gene. Thus, siRNA molecules of the invention can be defined by their ability to specifically hybridize with mRNA or cDNA derived from PCDH1, CDH3, or GPR107 genes under stringent conditions. For the purposes of the present invention, the terms “hybridize” or “specifically hybridize” are used to refer to the ability of two nucleic acid molecules to hybridize under “stringent hybridization conditions”. The phrase “stringent hybridization conditions” generally refers to conditions in a complex nucleic acid mixture where a nucleic acid molecule hybridizes to its target sequence but does not detectably hybridize to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Extensive guidelines for nucleic acid hybridization are described in Tijssen, Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). Generally, stringent conditions are selected to be about 5-10 ° C. lower than the melting point (T _m ) for the specific sequence at a defined ionic strength, pH. T _m is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probe complementary to the target hybridizes in equilibrium to the target sequence (at T _m , the target sequence When 50% is present in excess, 50% of the probe is occupied in equilibrium). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least twice background, preferably 10 times background hybridization. Exemplary stringent hybridization conditions may be as follows: 50% formamide, 5xSSC, and 1% SDS, 42 ° C incubation, or 5xSSC, 1% SDS, 65 ° C incubation, 0.2xSSC , And 0.1% SDS, 50 ° C wash.

  The siRNA of the invention is less than about 500 nucleotides, less than about 200 nucleotides, less than about 100 nucleotides, less than about 50 nucleotides, or less than about 25 nucleotides in length. Preferably, the siRNA is about 19 to about 25 nucleotides in length. Examples of nucleic acid sequences for generating PCDH1 siRNA, CDH3 siRNA, or GPR107 siRNA include the nucleotide sequences of SEQ ID NO: 22, 23, or 24, respectively, which are target sequences. Furthermore, in order to enhance the inhibitory activity of siRNA, nucleotide “u” can be added to the 3 ′ end of the antisense strand of the target sequence. The number of “u” added is at least about 2, generally from about 2 to about 10, and preferably from about 2 to about 5. The added “u” forms a single strand at the 3 ′ end of the antisense strand of the siRNA.

  The cell is any cell that expresses or overexpresses PCDH1, CDH3, or GPR107. The cell is an epithelial cell such as a pancreatic duct cell. Alternatively, the cell is a tumor cell such as a carcinoma, adenocarcinoma, blastoma, leukemia, myeloma, or sarcoma. The cell is pancreatic ductal adenocarcinoma.

  PCDH1 siRNA, CDH3 siRNA, or GPR107 siRNA is introduced directly into the cell in a form that can bind to the mRNA transcript. Alternatively, the DNA encoding PCDH1 siRNA, CDH3 siRNA, or GPR107 siRNA is in a vector.

  The vector may be, for example, PCDH1 to the expression vector so that the operably linked regulatory sequences are flanked by PCDH1, CDH3, or GPR107 sequences so that expression of both strands (by transcription of the DNA molecule) is possible. Created by cloning a target sequence, CDH3 target sequence, or GPR107 target sequence (Lee, NS, Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A Salvaterra, P., and Rossi, J. (2002) Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nature Biotechnology 20: 500-505.). An RNA molecule that is antisense to PCDH1 mRNA, CDH3 mRNA, or GPR107 mRNA is transcribed by a first promoter (e.g., a promoter sequence that is 3 'to the cloned DNA), and PCDH1 mRNA, CDH3 mRNA, or GPR107 mRNA The RNA molecule which is the sense strand of is transcribed by a second promoter (for example, a promoter sequence on the 5 ′ side of the cloned DNA). The sense and antisense strands hybridize in vivo to yield siRNA constructs for silencing the PCDH1 gene, CDH3 gene, or GPR107 gene. Alternatively, two types of constructs are used to generate the sense and antisense strands of the siRNA construct. The cloned PCDH1, CDH3, or GPR107 may encode a construct having a secondary structure, for example, a hairpin, in which one transcript contains an antisense sequence complementary to the sense sequence from the target gene. Have both.

In order to form a hairpin loop structure, a loop sequence consisting of an arbitrary nucleotide sequence may be arranged between the sense sequence and the antisense sequence. Accordingly, the present invention also provides siRNA having the general formula 5 ′-[A]-[B]-[A ′]-3 ′, wherein [A] is derived from PCDH1, CDH3, or GPR107. A ribonucleotide sequence corresponding to a sequence that specifically hybridizes to mRNA or cDNA. In a more preferred embodiment, [A] is a ribonucleotide sequence corresponding to a sequence selected from the group consisting of the nucleotides of SEQ ID NOs: 22, 23, and 24;
[B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides, and
[A ′] is a ribonucleotide sequence consisting of the complementary sequence of [A].

  Region [A] hybridizes to [A ′], and then a loop consisting of region [B] is formed. The loop sequence may preferably be about 3 to about 23 nucleotides in length. The loop sequence can be selected, for example, from the group consisting of the following sequences (http://www.ambion.com/techlib/tb/tb_506.html). Furthermore, an active siRNA is obtained from a loop sequence consisting of 23 nucleotides (Jacque, J.-M., Triques, K., and Stevenson, M. (2002) Modulation of HIV-1 replication by RNA interference. 418: 435-438).

  CCC, CCACC, or CCACACC: Jacque, J. M., Triques, K., and Stevenson, M (2002) Modulation of HIV-1 replication by RNA interference.Nature, Vol. 418: 435-438.

  UUCG: Lee, NS, Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A., Salvaterra, P., and Rossi, J. (2002) Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells.Nature Biotechnology 20: 500-505.Fruscoloni, P., Zamboni, M., and Tocchini-Valentini, GP (2003) Exonucleolytic degradation of double-stranded RNA by an activity in Xenopus laevis germinal vesicles. Proc. Natl. Acad. Sci. USA 100 (4): 1639-1644.

  UUCAAGAGA: Dykxhoorn, D. M., Novina, C. D., and Sharp, P. A. (2002) Killing the messenger: Short RNAs that silence gene expression.Nature Reviews Molecular Cell Biology 4: 457-467.

For example, preferable siRNAs having the hairpin loop structure of the present invention are shown below. In the following structure, the loop sequence can be selected from the group consisting of CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA. A preferred loop sequence is UUCAAGAGA ("ttcaagaga" (SEQ ID NO: 35) for DNA).
GACAUCAAUGACAACACAC- [B] -GUGUGUUGUCAUUGAUGUC (for the target sequence of SEQ ID NO: 22)
GGAGACAGGCUGGUUGUUG- [B] -CAACAACCAGCCUGUCUCC (when the target sequence is SEQ ID NO: 23)
GUGGCUCUACCAGCUCCUG- [B] -CAGGAGCUGGUAGAGCCAC (when the target sequence is SEQ ID NO: 24)

  The regulatory sequences flanking the PCDH1, CDH3, or GPR107 sequence are identical, so that the expression of PCDH1, CDH3, or GPR107 can be independently regulated, or can be temporally or spatially regulated, or Different. siRNA is produced by cloning a template of the PCDH1 gene, CDH3 gene, or GPR107 gene into a vector containing, for example, an RNA polymerase III transcription unit derived from a nuclear small RNA (snRNA) U6 or a human H1 RNA promoter. It is transcribed with. A transfection facilitating agent can be used to introduce the vector into the cell. FuGENE (Roche Diagnostics), Lipofectamine 2000 (Invitrogen), Oligofectamine (Invitrogen), and Nucleofector (Wako Pure Chemical Industries) are useful as transfection promoters.

  Oligonucleotides and oligonucleotides complementary to various portions of PCDH1 mRNA, CDH3 mRNA, or GPR107 mRNA are used in tumor cells (eg, using pancreatic cell lines such as pancreatic ductal adenocarcinoma (PDACa) cell lines), PCDH1, CDH3 Or the ability to reduce the production of GPR107 was tested in vitro according to standard methods. PCDH1-specific antibodies, CDH3-specific, decrease in PCDH1 gene, CDH3 gene, or GPR107 gene product in cells contacted with the candidate siRNA composition compared to cells cultured in the absence of the candidate composition Detection is performed using antibodies, or GPR107 specific antibodies or other detection methods. Sequences that reduce the production of PCDH1, CDH3, or GPR107 in an in vitro or cell-free assay are then tested for inhibitory effects on cell proliferation. To ascertain a decrease in PCDH1, CDH3, or GPR107 production and a decrease in tumor cell proliferation in animals with malignant neoplasms, sequences that inhibit cell proliferation are tested in vivo in rats or mice in an in vitro cell assay.

How to treat malignant tumors
Patients with tumors characterized by overexpression of PCDH1, CDH3, or GPR107 are treated by administration of PCDH1 siRNA, CDH3 siRNA, or GPR107 siRNA. siRNA therapy is used, for example, to inhibit the expression of PCDH1, CDH3, or GPR107 in patients suffering from or at risk of developing pancreatic ductal adenocarcinoma (PDACa). Such patients are identified by standard methods for specific tumor types. Pancreatic ductal adenocarcinoma (PDACa) is diagnosed by, for example, CT, MRI, ERCP, MRCP, computed tomography, or ultrasound. Treatment is effective if it leads to a clinical benefit, such as decreased expression of PCDH1, CDH3, or GPR107 in the subject, or a decrease in tumor size, morbidity, or metastatic potential. “Effective” when the treatment is used for prophylactic purposes means that the treatment delays or prevents the formation of the tumor or prevents or alleviates the clinical symptoms of the tumor. Efficacy is verified in conjunction with any known method for diagnosing or treating a particular tumor type.

  siRNA therapy is performed by administering the siRNA to the patient by a gene delivery system, such as by delivering a standard vector encoding the siRNA of the invention and / or a synthetic siRNA molecule. In general, synthetic siRNA molecules are chemically stabilized to prevent nuclease degradation in vivo. Methods for preparing chemically stabilized RNA molecules are well known in the art. In general, such molecules contain a modified backbone and nucleotides to block the function of ribonucleases. Other modifications are possible, for example, cholesterol-binding siRNA has shown improved pharmacological properties (Song et al. Nature Med. 9: 347-351 (2003)). Suitable gene delivery systems can include liposomes, receptor-mediated delivery systems, or viral vectors (eg, particularly herpes viruses, retroviruses, adenoviruses, and adeno-associated viruses). The therapeutic nucleic acid composition is formulated in a pharmaceutically acceptable carrier. The therapeutic composition may comprise the gene delivery system described above. A pharmaceutically acceptable carrier is a biologically compatible vehicle (eg, saline) suitable for administration to animals. A therapeutically effective amount of the compound is determined from a medically desirable outcome (e.g., decreased production of PCDHl gene product, CDH3 gene product, or GPR107 gene product, cell growth (e.g., decreased proliferation, or tumor growth in the treated animal) This is the amount that can cause a decrease.

  Parenteral administration, such as intravenous, subcutaneous, intramuscular, and intraperitoneal delivery routes, can be used to deliver PCDH1 siRNA, CDH3 siRNA, or GPR107 siRNA compositions. For the treatment of pancreatic tumors, direct injection into the celiac, splenic, or common hepatic artery is useful.

Dosage to any patient is such as patient size, body surface area, age, specific nucleic acid to be administered, sex, administration time and route, overall health, and other drugs being administered at the same time It depends on many factors. When the nucleic acid is administered intravenously, the dose is about 10 ⁶ to 10 ²² copies of the nucleic acid molecule.

  Polynucleotides are administered by standard methods (eg, injection into gaps in tissues such as muscle or skin, introduction into the circulation or body cavities, or inhalation or insufflation). The polynucleotide is injected into the animal together with a pharmaceutically acceptable liquid carrier (eg, a water-soluble or partially water-soluble liquid carrier) or otherwise delivered. The polynucleotide is associated with a liposome (eg, a cationic liposome or an anionic liposome). The polynucleotide contains genetic information (eg, a promoter) necessary for expression by the target cell.

  Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are hereby incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

BEST MODE FOR CARRYING OUT THE INVENTION The present invention is further described in the following examples. The following examples do not limit the scope of the invention described in the claims.

[Example 1] General method
Cell Lines and Tissue Samples Human pancreatic cell lines PK45P, KLM1, and MIA-PaCa2 (ATCC number: CRL-1420) were obtained from Tohoku University Institute of Aging Medicine, Attached Medical Cell Resource Center. All of these cells are publicly available.

Isolation of overexpressed genes in PDACa cells using cDNA microarray
Production of cDNA microarray slides has already been reported (Ono K, Tanaka T, Tsunoda T, Kitahara O, Kihara C, Okamoto A, Ochiai K, Takagi T, and Nakamura Y. Cancer Res., 60: 5007-5011, 2000). For each expression profile analysis, two sets of cDNA microarray slides containing about 23,040 DNA spots were prepared to reduce experimental variability. Briefly, total RNA was purified from PDACa cells and normal pancreatic ductal epithelium microdissected from 18 pancreatic cancer tissues. T7-based RNA amplification was performed to obtain sufficient RNA for microarray experiments. Amplified RNA aliquots from PDACa cells and normal ductal epithelium were labeled with Cy5-dCTP and Cy3-dCTP, respectively, by reverse transcription (Amersham Biosciences). Hybridization, washing, and detection were performed as previously described (Ono K, Tanaka T, Tsunoda T, Kitahara O, Kihara C, Okamoto A, Ochiai K, Takagi T, and Nakamura Y. Cancer Res., 60: 5007-5011, 2000). Next, among the up-regulated genes, we focused on three genes, PCDH1, CDH3, and GPR107, which had an expression ratio of more than 5.0 in more than 50% of the reference cancers, 29 This is because, according to our previous gene expression data in normal human tissues, their expression levels in major normal essential organs were relatively low. (Saito-Hisaminato A, Katagiri T, Kakiuchi S, Nakamura T, Tsunoda T, Nakamura Y. Genome-wide profiling of gene expression in 29 normal human tissues with a cDNA microarray.DNA Res., 9: 35-45, 2002) .

Semi-quantitative RT-PCR of PCDH1 and CDH3
RNA from microdissected PDACa cells and normal pancreatic ductal epithelial cells was subjected to two rounds of amplification by T7-based in vitro transcription (Epicentre Technologies) and synthesized into single stranded cDNA. For subsequent PCR amplification, appropriate dilutions of each single stranded cDNA were prepared by monitoring β-actin (ACTB) as a quantitative control. The primer sequences used by the inventors are:
For PCDH1,
5'-AGAAGGAGACCAAGGACCTGTAT-3 '(SEQ ID NO: 7) and
5'-AGAACTTTATTGTCAGGGTCAAGG-3 '(SEQ ID NO: 8)
For CDH3,
5'-CTGAAGGCGGCTAACACAGAC-3 '(SEQ ID NO: 9) and
5'-TACACGATTGTCCTCACCCTTC-3 '(SEQ ID NO: 10)
About ACTB
5'-CATCCACGAAACTACCTTCAACT-3 '(SEQ ID NO: 11) and
5'-TCTCCTTAGAGAGAAGTGGGGTG-3 '(SEQ ID NO: 12)
It was used. All reactions include initial denaturation at 94 ° C for 2 minutes followed by 21 cycles at 94 ° C for 30 seconds, 58 ° C for 30 seconds, and 72 ° C for 1 minute (for ACTB) or 28-32 cycles (for PCDH1 and CDH3) ) Was performed on a GeneAmp PCR system 9700 (PE Applied Biosystems).

Immunohistochemistry PDACa sections fixed in formalin and embedded in paraffin were immunostained using a mouse anti-CDH3 monoclonal antibody (BD Transduction Laboratories) for CDH3 expression. For antigen recovery, deparaffinized tissue sections were placed in 10 mM citrate buffer, pH 6.0 and heated to 108 ° C. for 15 minutes in an autoclave. Sections were incubated with a 1:10 or 1: 100 dilution of the primary antibody for CDH3 for 1 hour at room temperature in a humidified chamber, using peroxidase-labeled dextran polymer, then diaminobenzidine (DAKO Envision Plus System Developed by DAKO Corporation, Carpinteria, CA). Sections were counterstained with hematoxylin. For negative controls, primary antibody was omitted.

Northern blot analysis [α ³² P] dCTP-labeled PCR product amplified with the above primers was hybridized with Human multiple-tissue Northern blots (Clontech). Prehybridization, hybridization, and washing were performed according to the manufacturer's recommendations. Blots were autoradiographed at −80 ° C. for 5 days using an intensifying screen.

Construction of psiU6BX plasmid
A DNA fragment encoding siRNA was inserted into the gap of nucleotides 485 to 490 indicated by (−) in the following plasmid sequence (SEQ ID NO: 26).

GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGGAT
CCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGGCTTGGGGATCAGCGTTTGAGTAAGA
GCCCGCGTCTGAACCCTCCGCGCCGCCCCGGCCCCAGTGGAAAGACGCGCAGGCAAAACG
CACCACGTGACGGAGCGTGACCGCGCGCCGAGCGCGCGCCAAGGTCGGGCAGGAAGAGGG
CCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAAT
TAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTA
ATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCT
TACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAA
CACC ------ TTTTTACATCAGGTTGTTTTTCTGTTTGGTTTTTTTTTTACACCACGTTT
ATACGCCGGTGCACGGTTTACCACTGAAAACACCTTTCATCTACAGGTGATATCTTTTAA
CACAAATAAAATGTAGTAGTCCTAGGAGACGGAATAGAAGGAGGTGGGGCCTAAAGCCGA
ATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGTGAGGCGGAAAGAACCAGCTGGG
GCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGG
TTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCT
TCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCC
CTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTG
ATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGT
CCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGG
TCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGC
TGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGG
AAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGC
AACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCT
CAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCC
CAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGA
GGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGG
CTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGG
ATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTG
GGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGC
CGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGG
TGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGT
TCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGG
CGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCAT
CATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCA
CCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCA
GGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAA
GGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAA
TATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGC
GGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGA
ATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGC
CTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGAC
CAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
TTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTC
ATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAA
AGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGT
TTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGC
TTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCA
CACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAA
CTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAG
CTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCC
GCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCT
CACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATG
TGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTC
CATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGA
AACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCT
CCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTG
GCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAG
CTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTAT
CGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAAC
AGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAAC
TACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTC
GGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTTTTTTT
GTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTT
TCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGA
TTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATC
TAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCT
ATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATA
ACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCA
CGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGA
AGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGA
GTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTG
GTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCCAAGGCGA
GTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTT
GTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCT
CTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCA
TTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAAT
ACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGA
AAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCC
AACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGG
CAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTC
CTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTT
GAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCA
CCTGACGTC

The snRNA U6 gene has been reported to be transcribed by RNA polymerase III, resulting in a short transcript with a uridine at the 3 'end. A set of primers comprising a genomic fragment of the snRNA U6 gene containing the promoter region:
5'-GGGGATCAGCGTTTGAGTAA-3 '(SEQ ID NO: 27), and
5'-TAGGCCCCACCTCCTTCTAT-3 '(SEQ ID NO: 28)
PCR amplification was also performed using human placental DNA as a template. The product was purified and cloned into a pCR plasmid vector using a TA cloning kit according to the supplier's (Invitrogen) protocol. A set of primers:
5'-TGCGGATCCAGAGCAGATTGTACTGAGAGT-3 '(SEQ ID NO: 29) and
5'-CTCTATCTCGAGTGAGGCGGAAAGAACCA-3 '(SEQ ID NO: 30)
A BamHI, XhoI fragment containing the snRNA U6 gene amplified by PCR was purified and cloned into a fragment from nucleotide positions 1257 to 56 of pcDNA3.1 (+) plasmid. Ligated DNA, primer:
5'-TTTAAGCTTGAAGACTATTTTTACATCAGGTTGTTTTTCT-3 '(SEQ ID NO: 31) and
5'-TTTAAGCTTGAAGACACGGTGTTTCGTCCTTTCCACA-3 '(SEQ ID NO: 32)
Was used as a template for PCR. The product was digested with HindIII and then self-ligated to generate the psiU6BX vector plasmid. As a control,
5'-CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTC-3 '(SEQ ID NO: 33) and
5'-AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCTGCTTC-3 '(SEQ ID NO: 34)
The psiU6BX-EGFP was prepared by cloning the double stranded oligonucleotide consisting of into the BbsI site of the psiU6BX vector.

siRNA expression constructs
The nucleotide sequence of siRNA was designed using the siRNA design computer program available from the Ambion website (http://www.ambion.com/techlib/misc/siRNA_finder.html). Briefly, the nucleotide sequence for siRNA synthesis is selected using the following protocol.

siRNA target site selection:
1. Scan downstream AA dinucleotide sequences starting from the start codon AUG of each gene transcript. Record the occurrence of AA and 3 ′ adjacent 19 nucleotides as siRNA target candidate sites. Tuschl et al. Do not design siRNAs for the 5 'and 3' untranslated regions (UTR) and the region near the start codon (within 75 bases), which may contain many regulatory protein binding sites. Not recommended for. UTR binding proteins and / or translation initiation complexes may interfere with the binding of the siRNA endonuclease complex.

  2. Compare target candidate sites with appropriate genomic databases (human, mouse, rat, etc.) and remove target sequences that have significant homology with other coding sequences.

  3. Select a target sequence suitable for synthesis. Depending on the length of the gene, several target sequences are selected for evaluation. The oligonucleotides used for PCDH1 siRNA, CDH3 siRNA, or GPR107 siRNA are shown below. Each oligonucleotide is a combination of a sense nucleotide sequence and an antisense nucleotide sequence of this target sequence. The nucleotide sequences of the hairpin loop structure and the target sequence are shown in SEQ ID NO: 19 to SEQ ID NO: 21, and SEQ ID NO: 22 to SEQ ID NO: 24, respectively (excluding the endonuclease recognition site from each hairpin loop structure sequence. )

Insertion sequence of siRNA expression vector for PCDH1
410si:
5'-CACCGACATCAATGACAACACACTTCAAGAGAGTGTGTTGTCATTGATGTC-3 '(SEQ ID NO: 13) and
5'-AAAAGACATCAATGACAACACACTCTCTTGAAGTGTGTTGTCATTGATGTC-3 '(SEQ ID NO: 14)
Insertion sequence of siRNA expression vector for CDH3
si24:
5'-CACCGGAGACAGGCTGGTTGTTGTTCAAGAGACAACAACCAGCCTGTCTCC-3 '(SEQ ID NO: 15) and
5'-AAAAGGAGACAGGCTGGTTGTTGTCTCTTGAACAACAACCAGCCTGTCTCC-3 '(SEQ ID NO: 16)
Insertion sequence of siRNA expression vector for GPR107
1003si:
5'-CACCGTGGCTCTACCAGCTCCTGTTCAAGAGACAGGAGCTGGTAGAGCCAC-3 '(SEQ ID NO: 17) and
5'-AAAAGTGGCTCTACCAGCTCCTGTCTCTTGAACAGGAGCTGGTAGAGCCAC-3 '(SEQ ID NO: 18)
Insertion sequence of control siRNA expression vector
EGFPsi: (control)
5'- CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTC -3 '(SEQ ID NO: 33) and
5'-AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCTGCTTC-3 '(SEQ ID NO: 34)

The SEQ ID NOs of each sequence are listed in Table 1.

Colony formation / MTT assay Human PDACa cell lines PK45P, KLM1, and MIA-PaCa2 are plated into 10cm dishes (5X10 ⁵ cells / dish), using Lipofectamine 2000 (Invitrogen) or FuGENE6 (Roche), manufacturer's instructions And psiU6BX containing the EGFP target sequence (EGFP) and psiU6BX containing the target sequence. Cells were selected with 500 mg / ml geneticin for 1 week and spare cells were harvested 48 hours after transfection and analyzed by RT-PCR to confirm knockdown effects on PCDH1, CDH3, and GPR107. RT-PCR primers were the same as described above. Each of these cells was also stained with Giemsa solution to assess colony formation, and an MTT assay was performed to assess cell number.

[Example 2]
Reduced expression of PCDH1, CDH3, or GPR107 gene and suppression of cancer cell growth by siRNA In previous studies, the accuracy of PDACa was determined by combining laser microdissection with a genome-wide cDNA microarray spotted with 27,000 genes. An expression profile was created. The present inventors identified more than 200 genes as up-regulated genes in PDACa cells as compared to the expression pattern of normal pancreatic duct epithelium thought to be the origin of PDACa (Nakamura T, Furukawa Y, Nakagawa H, Tsunoda T, Ohigashi H, Murata K, Ishikawa O, Ohgaki, Kashimura N, Miyamoto M, Hirano S, Kondo S, Katoh H, Nakamura Y, and Katagiri T. Genome-wide cDNA microarray analysis of gene-expression profiles in pancreatic cancers using populations of tumor cells and normal ductal epithelium cells selected for purity by laser microdissection. Oncogene, 2004 Feb 9, Epub ahead of print). Based on these PDACa cell expression profiles, we selected three overexpressed genes, RT-PCR using cDNA from microdissectioned PDACa cells (Figure 1A, B) or immune tissue Chemistry (Figure 2) confirmed that PCDH1 and CDH3 were overexpressed in PDACa.

(1) PCDH1 (protocadherin 1) (GenBank accession number NM_002587; SEQ ID NOs: 1 and 2)
In order to investigate the proliferation or survival effect of PCDH1 on PDACa cells, we specifically investigated endogenous expression of PCDH1 in PDACa cell lines by mammalian vector-based RNA interference (RNAi) method. Knocked down. PCDH1 is expressed indefinitely in normal heart, placenta, and prostate as shown in Northern blot analysis (FIG. 3A). Expression in the major essential organs is not abundant, suggesting that targeting these molecules shows little toxicity to the human body.

  Transfection of the siRNA production vector clearly reduced the endogenous expression in the siRNA designed for PCDH1, 410si (FIG. 4A). This knock-down effect on PCDH1 mRNA by siRNA resulted in significant growth inhibition in colony formation assay (FIG. 4B) and MTT assay (FIG. 4C). These findings strongly suggested that overexpression of PCDH1 in PDACa cells is associated with cancer cell viability. PCDH1 and other protocadherins have homophilic interactions on the cell surface through their cadherin domains and regulate intercellular signaling for cytoskeletal conformation, cell motility, or cell proliferation (Sano K, Tanihara H, Heimark RL, Obata S, Davidson M, St John T, Taketani S, Suzuki S. Protocadherins: a large family of cadherin-related molecules in central nervous system.EMBO J., 12: 2249-56, 1993, Frank M, and Kemler R. Protocadherins. Curr Opin Cell Biol., 14: 557-62, 2002.). According to our data, PCDH1 is likely to regulate the positive signal of pancreatic cancer cell growth through its allophilic interaction in cell-cell adhesion.

(2) CDH3 (P-cadherin) (GenBank accession number NM_001793; SEQ ID NOs: 3, 4)
We confirmed CDH3 overexpression in PDACa cells by RT-PCR (Figure 1B) and immunohistochemistry (Figure 2), and according to microarray data and RT-PCR (Figure 1B), CDH3 overexpression. Expression was one of the most prevalent patterns among over 200 up-regulated genes in our PDACa profile. CDH3 is expressed indefinitely in normal thymus, prostate, ovary, and trachea, as shown by Northern blot analysis (FIG. 3B). This is not rich in expression in major essential organs, suggesting that targeting these molecules is not expected to lead to toxicity in the human body.

  In order to investigate the proliferative or survival effect of CDH3 on PDACa cells, we specifically investigated the endogenous expression of CDH3 in PDACa cell lines by a mammalian vector-based RNA interference (RNAi) method. Knocked down. Transfection of the siRNA production vector clearly reduced endogenous expression in the siRNA designed for CDH3, si24 (FIG. 5A). This knockdown effect on CDH3 mRNA by siRNA resulted in significant growth inhibition in colony formation assay (FIG. 5B) and MTT assay (FIG. 5C). These findings indicate that CDH3 overexpression in PDACa cells is associated with cancer cell viability and cell-cell interactions, and this molecule is strongly likely to be involved in signal transduction from cell-cell interactions. It was suggested. PDACa is extremely malignant, and high expression of CDH3 in PDACa may be related to its malignancy and metastatic potential.

(3) GPR107 (G protein coupled receptor 107) (GenBank accession number AB046844; SEQ ID NOs: 5 and 6)
The inventors have identified this orphan GPCR with unknown function and ligand as a target for pancreatic cancer. GPR107 is expressed indefinitely in normal heart, placenta, skeletal muscle, testis, ovary, spinal cord, as shown in Northern blot analysis (FIG. 3C). In order to examine the proliferative or survival effects of GPR107 on PDACa cells, we specifically knocked down endogenous expression of GPR107 in PDACa cell lines by siRNA. Transfection of the siRNA production vector clearly reduced endogenous expression in the siRNA designed for GPR107, 1003si (FIG. 6A). This knockdown effect on GPR107 mRNA by siRNA resulted in growth inhibition in colony formation assay (FIG. 6B) and MTT assay (FIG. 6C). These findings strongly suggested that overexpression of GPR107 in PDACa cells is associated with cancer cell viability.

  In conclusion, we have identified three membrane-type molecules that are overexpressed in PDACa cells, all of which are likely to be associated with cancer cell growth, which means that these membranes This suggests that the type molecule is an ideal target molecule for the treatment of fatal pancreatic cancer.

Industrial Applicability The present inventors have shown that cell proliferation is suppressed by small interfering RNA (siRNA) that specifically targets the PCDH1 gene, CDH3 gene, or GPR107 gene. Therefore, this novel siRNA is a useful target for developing anticancer agents. For example, agents that block expression of PCDH1, CDH3, or GPR107 or block their activity are therapeutically useful as anticancer agents, for example, anticancer agents, particularly for treating pancreatic cancer such as pancreatic ductal adenocarcinoma (PDACa) Sex can be found.

  Although the invention has been described in detail and with reference to certain embodiments of the invention, it will be appreciated by those skilled in the art that various changes and modifications can be made to the invention without departing from the spirit and scope of the invention. It will be obvious.

It is the photograph which showed the confirmation result of overexpression of PCDH1 (A) and CDH3 (B) in the PDACa cell by RT-PCR. Normal pancreatic duct epithelial cells (normal) and essential organs (lung, heart, liver, kidney, and bone marrow) microdissectioned from the same individuals were compared by semi-quantitative RT-PCR. It is the photograph which showed the result of the immunohistochemistry in PDACa tissue. Overexpression of CDH3 protein was observed in pancreatic ductal adenocarcinoma but not in normal pancreatic duct. It is the photograph of the Northern blot analysis which showed the expression pattern of each pancreatic cancer target gene in a normal adult tissue. (A) PCDH1, (B) CDH3, and (C) GPR107. It is the photograph which showed the knockdown effect of endogenous PCDH1 in PDACa cell PK-45P by siRNA. FIG. 4 (A) shows the RT-PCR results. PCDH1 mRNA knockdown effect was confirmed by transfection of siRNA expression vector 410si, but not by EGFPsi. 410si was designed specifically for the PCDH1 mRNA sequence and EGFP was designed for the EGFP mRNA sequence. RNA was collected and analyzed 48 hours after transfection. ACTB was used to normalize the administered cDNA. FIG. 4 (B) is a photograph showing the results of the colony formation assay. One week after transfection with 410si, which was confirmed to effectively knock down PCDH1 by RT-PCR, it was shown that the number of colonies of cells was significantly reduced. FIG. 4 (C) is a bar graph showing the results of the MTT assay. This also showed that the number of proliferating cells transfected with 410si was significantly reduced, but not with EGFPsi. It is the photograph which showed the knockdown effect of endogenous CDH3 in PDACa cell KLM-1 by siRNA. FIG. 5 (A) shows the RT-PCR results. CDH3 mRNA knockdown effect was confirmed by transfection of siRNA expression vector si24, but not by EGFPsi. si24 was designed specifically for the CDH3 mRNA sequence and EGFPsi was designed for the EGFP mRNA sequence. RNA was collected and analyzed 48 hours after transfection. ACTB was used to normalize the administered cDNA. FIG. 5 (B) is a photograph showing the results of the colony formation assay. One week after transfection with si24, which was confirmed to effectively knock down CDH3 by RT-PCR, it was shown that the number of colonies of cells was significantly reduced. FIG. 5 (C) is a bar graph showing the results of the MTT assay. This also showed that the number of proliferating cells transfected with si24 was significantly reduced, but not with EGFPsi. It is the photograph which showed the knockdown effect of endogenous GPR107 in PDACa cell KLM-1 by siRNA. FIG. 6 (A) shows the RT-PCR results. GPR107 mRNA knockdown effect was confirmed by transfection of siRNA expression vector 1003si, but not by EGFPsi. 1003si was designed specifically for the GPR107 mRNA sequence and EGFPsi was designed for the EGFP mRNA sequence. RNA was collected and analyzed 48 hours after transfection. ACTB was used to normalize the administered cDNA. FIG. 6 (B) is a photograph showing the results of the colony formation assay. One week after transfection with 1003si, which was confirmed to effectively knock down GPR107 by RT-PCR, it was shown that the number of cell colonies decreased. FIG. 6 (C) is a bar graph showing the results of the MTT assay. This also showed that the number of proliferating cells transfected with 1003si was reduced, but not with EGFPsi.

Claims (23)

  A method for treating or preventing pancreatic cancer in a subject, comprising administering to the subject a composition comprising a small interfering RNA (siRNA) that inhibits expression of PCDH1, CDH3, or GPR107.   2. The method of claim 1, wherein the siRNA comprises a sense nucleic acid sequence and an antisense nucleic acid sequence that specifically hybridize to a sequence derived from PCDH1, CDH3, or GPR107.   2. The method of claim 1, wherein the pancreatic cancer is pancreatic ductal adenocarcinoma (PDACa).   3. The method of claim 2, wherein the siRNA comprises a ribonucleotide sequence corresponding to a sequence selected from the group consisting of SEQ ID NO: 22, 23, and 24 as a target sequence.   siRNA has the general formula 5 ′-[A]-[B]-[A ′]-3 ′, wherein [A] is selected from the group consisting of the nucleotides of SEQ ID NOs: 22, 23, and 24 [B] is a ribonucleotide loop sequence consisting of 3 to 23 nucleotides, and [A ′] is a ribonucleotide sequence consisting of a complementary sequence of [A]. 5. The method of claim 4, wherein   2. The method of claim 1, wherein the composition comprises a transfection facilitating agent.   A double-stranded molecule comprising a sense strand and an antisense strand, wherein the sense strand comprises a ribonucleotide sequence corresponding to a target sequence selected from the group consisting of SEQ ID NOs: 22, 23, and 24; Comprises a ribonucleotide sequence complementary to the sense strand, the sense strand and the antisense strand hybridize to each other to form the double-stranded molecule, and the double-stranded molecule comprises the PCDH1 gene, CDH3 A double-stranded molecule that, when introduced into a cell expressing a gene or GPR107 gene, inhibits the expression of the gene.   8. The double-stranded molecule of claim 7, wherein the target sequence comprises at least about 10 consecutive nucleotides derived from a nucleotide sequence selected from the group of SEQ ID NO: 1, 3, and 5.   9. The double-stranded molecule of claim 8, wherein the target sequence comprises from about 19 to about 25 contiguous nucleotides derived from a nucleotide sequence selected from the group of SEQ ID NOs: 1, 3, and 5.   10. The double-stranded molecule according to claim 9, which is a single ribonucleotide transcript consisting of a sense strand and an antisense strand linked via a single-stranded ribonucleotide sequence.   9. The double-stranded molecule of claim 8, which is an oligonucleotide less than about 100 nucleotides in length.   12. The double stranded molecule of claim 11, which is an oligonucleotide of less than about 75 nucleotides in length.   13. The double-stranded molecule of claim 12, which is an oligonucleotide less than about 50 nucleotides in length.   14. The double-stranded molecule of claim 13, which is an oligonucleotide less than about 25 nucleotides in length.   15. The double-stranded polynucleotide of claim 14, which is an oligonucleotide of about 19 to about 25 nucleotides in length.   A vector encoding the double-stranded molecule according to claim 8.   17. The vector according to claim 16, which encodes a transcript having a secondary structure and comprises a sense strand and an antisense strand.   18. The vector of claim 17, wherein the transcript further comprises a single stranded ribonucleotide sequence linking the sense and antisense strands.   A vector comprising a polynucleotide comprising a combination of a sense strand nucleic acid and an antisense strand nucleic acid, the sense strand nucleic acid comprising the nucleotide sequences of SEQ ID NOs: 22, 23, and 24, wherein the antisense strand nucleic acid A vector consisting of complementary sequences. Polynucleotide is general formula
5 '-[A]-[B]-[A']-3 '
Wherein [A] is the nucleotide sequence of SEQ ID NOs: 22, 23, and 24, [B] is a nucleotide sequence consisting of 3 to 23 nucleotides, and [A ′] is 20. The vector according to claim 19, which is a nucleotide sequence complementary to [A].   To treat or prevent pancreatic cancer comprising, as active ingredients, a pharmaceutically effective amount of a small interfering RNA (siRNA) that inhibits the expression of PCDH1, CDH3, or GPR107 and a pharmaceutically acceptable carrier Pharmaceutical composition.   23. The pharmaceutical composition of claim 21, wherein the siRNA comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 22, 23, and 24 as a target sequence. siRNA is a general formula
5 '-[A]-[B]-[A']-3 '
Wherein [A] is a ribonucleotide sequence corresponding to the nucleotide sequences of SEQ ID NOs: 22, 23, and 24, and [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides. 23. The composition of claim 22, wherein [A '] is a ribonucleotide sequence complementary to [A].

Images