WO2009009457A1 - Alzheimer's disease-specific micro-rna microarray and related methods - Google Patents

Abstract

The presently-disclosed subject matter provides methods of diagnosis and/or prognosis of Alzheimer's disease in subjects by measuring amounts of one or more micro-RNAs correlated with Alzheimer's disease present in a biological sample, including blood for example, from a subject.

Description

DESCRIPTION ALZHEIMER'S DISEASE-SPECIFIC MICRO-RNA MICROARRAY AND

RELATED METHODS

RELATED APPLICATIONS

The presently-disclosed subject matter claims the benefit of U.S. Provisional Patent Application Serial No. 60/948,354, filed July 6, 2007; the disclosure of which is incorporated herein by reference in its entirety.

GOVERNMENT INTEREST

This presently-disclosed subject matter was made with U.S. Government support under Grant No. DAAD19-01 -1 -0450 awarded by the Defense

Advanced Research Projects Agency (DARPA), Department of Defense. Thus, the U.S. Government has certain rights in the presently-disclosed subject matter.

TECHNICAL FIELD

The presently-disclosed subject matter relates to methods for diagnosis and prognosis of Alzheimer's disease and related disorders. In particular, the presently-disclosed subject matter relates to diagnostic and prognostic methods based on determining amounts of one or more micro-RNAs correlated with

Alzheimer's disease and related disorders in a biological sample from a subject.

BACKGROUND

Alzheimer's disease (AD) is a dementing illness characterized by progressive neuronal degeneration, gliosis, and the accumulation of intracellular inclusions (neurofibrillary tangles) and extracellular deposits of amyloid (senile plaques) formed around a core of aggregated amyloid β₄2 peptide in discrete regions of the basal forebrain, hippocampus, and association cortices [6, 35]. The etiology of sporadic AD is likely multifactorial, with carriage of the apolipoprotein E ε4 (APOE4) allele constituting a strong risk factor for the development of this condition [13]. AD is an impending healthcare crisis brought on in part by an aging population. This is evidenced by the fact that half of those over the age of 80 years are afflicted with AD. At present, AD is the fourth leading cause of adult deaths in the US alone, at an annual cost of approximately $100 billion. As the lifespan of the world's population increases, this disease will become an even greater problem.

To compound the difficulties of managing the ever-increasing AD healthcare crisis, the definitive diagnosis of AD ante-mortem has to date been extremely difficult. Ante-mortem presumptive diagnosis of the disease is performed primarily by exclusion of other diseases. Definitive post-mortem diagnosis of Alzheimer's disease has been based on determination of the number of neuhtic plaques and tangles in brain tissue using specialized staining techniques. However, such diagnostic methods, besides not being applicable to ante-mortem diagnosis, require extensive staining and microscopic examination of several brain sections. Moreover, the plaques and tangles are not confined to individuals having Alzheimer's disease, but also may occur in the brains of normal, elderly individuals or individuals with other diseases.

Earlier definitive diagnosis of AD, ideally prior to clinical manifestations of the disease, would facilitate earlier and potentially more effective treatment of patients afflicted with AD. Thus, there is an unmet need for a more definitive and reliable method for making a diagnosis of AD in a living subject. In particular, simple tests for AD diagnosis that can be performed on readily- accessible biological fluids are needed.

SUMMARY

This Summary lists several embodiments of the presently-disclosed subject matter, and in many cases lists variations and permutations of these embodiments. This Summary is merely exemplary of the numerous and varied embodiments. Mention of one or more representative features of a given embodiment is likewise exemplary. Such an embodiment can typically exist with or without the feature(s) mentioned; likewise, those features can be applied to other embodiments of the presently-disclosed subject matter, whether listed in this Summary or not. To avoid excessive repetition, this Summary does not list or suggest all possible combinations of such features.

In some embodiments of the presently-disclosed subject matter, a method for diagnosing Alzheimer's disease or a related disorder, or potential to develop AD, in a subject is provided. The method comprises, in some embodiments, providing a biological sample from a subject; determining an amount of one or more micro-RNAs (miRNAs) selected from Tables 1 -4 and Table D that are correlated with Alzheimer's disease in the biological sample; and, comparing the amount of the one or more miRNAs to one or more miRNA control levels, wherein the subject is diagnosed as having, or potentially developing, Alzheimer's disease or a related disorder if there is a measurable difference in the amounts of the one or more miRNAs in the sample as compared to the one or more control levels. In some embodiments, a treatment for Alzheimer's disease or a related disorder can be selected or modified based on the amount of the one or more miRNAs determined.

The presently-disclosed subject matter further provides, in some embodiments, a method for determining treatment efficacy and/or progression of Alzheimer's disease or a related disorder in a subject. In some embodiments, the method comprises providing a series of biological samples over time; analyzing the series of biological samples to determine an amount of one or more miRNAs selected from Tables 1 -4 and Table D that are correlated with Alzheimer's disease or a related disorder; and, comparing any measurable change in the amounts of the one or more miRNAs in each of the biological samples to thereby determine the treatment efficacy and/or progression of Alzheimer's disease or a related disorder in a subject. In some embodiments, the series of biological samples comprises a first biological sample collected prior to initiation of treatment for the Alzheimer's disease or related disorder and/or onset of Alzheimer's disease or related disorder and a second biological sample collected after initiation of the treatment or onset. In other embodiments of the presently-disclosed subject matter, a method for diagnosing amyloid β₄2 (Aβ) accumulation, or potentially developing Aβ accumulation, within a subject is provided. In some embodiments, the method comprises providing a biological sample from a subject; determining an amount of one or more miRNAs correlated with Aβ accumulation in the biological sample, wherein the one or more miRNAs are selected from miR-517, miR-579, and miR-181 b. The method further comprises comparing the amount of the one or more miRNAs to one or more miRNA control levels, wherein the subject is diagnosed as having, or , or potentially developing, Aβ accumulation if there is a measurable difference in the amounts of the one or more miRNAs in the sample as compared to the one or more control levels.

The presently-disclosed subject matter still further provides, in some embodiments, a method for isolating miRNA from a biological sample for use in diagnosing Alzheimer's disease or a related disorder in a subject. In some embodiments, the method comprises providing a biological sample from a subject (e.g., blood), which comprises blood mononuclear cells (BMC) and isolating the BMC from the biological sample. The method further comprises lysing the isolated BMC and extracting miRNA from the lysed BMC. The extracted miRNA is then analyzed for one or more miRNAs correlated with Alzheimer's disease, as in the methods disclosed above, to thereby diagnose Alzheimer's disease in the subject.

In some embodiments of the methods of the presently-disclosed subject matter, the one or more miRNAs are selected from the group consisting of miR- 594, miR-181 b, miR-34a, miR-155, miR-620, miR-579, miR-605, miR-517^*, miR-137, let-7f, miR-569, miR-493-3p, miR-34b, miR-581 , miR-371 , miR-489, miR-363, miR-513, miR-431 , miR-200a, miR-182, miR-520h, miR-377, and miR-653. In some embodiments of the methods disclosed herein, the amount of the one or more miRNAs can be determined by labeling the one or more miRNAs. Further, in some embodiments, determining the amount of the one or more miRNAs comprises capturing the one or more miRNAs with one or more polynucleotide probes that each selectively binds the one or more miRNAs. In some embodiments, the polynucleotide probes selectively bind mature miRNAs.

In some embodiments of the methods, the biological sample comprises blood. In some embodiments, the biological sample comprises blood mononuclear cells. Further, in some embodiments of the presently-disclosed subject matter, the subject is human. The presently-disclosed subject matter further provides, in some embodiments, a kit for diagnosing Alzheimer's disease, or the potential to develop AD, in a subject. In some embodiments, a kit is provided that comprises a plurality of polynucleotide probes that each selectively bind a plurality of miRNAs selected from Tables 1-4 and Table D that are correlated with Alzheimer's disease. In some embodiments, the plurality of polynucleotide probes selectively bind an miRNA selected from the group consisting of miR- 594, miR-181 b, miR-34a, miR-155, miR-620, miR-579, miR-605, miR-517^*, miR-137, let-7f, miR-569, miR-493-3p, miR-34b, miR-581 , miR-371 , miR-489, miR-363, miR-513, miR-431 , miR-200a, miR-182, miR-520h, miR-377, and miR-653. In some embodiments, the plurality of polynucleotide probes selectively bind mature miRNAs. Further, in some embodiments, the plurality of polynucleotide probes are each bound to a substrate.

In some embodiments, a kit of the presently-disclosed subject matter can further comprise instructions for using the kit. In some embodiments, the kit further comprises at least one randomly-generated sequence used as a negative control; at least one oligonucleotide sequence derived from a housekeeping gene used as a standard control for total RNA degradation; at least one randomly-generated sequence used as a positive control; and, a series of dilutions of at least one positive control sequence used as saturation controls, wherein at least one positive control sequence is positioned on the substrate to indicate orientation of the substrate.

Accordingly, it is an object of the presently-disclosed subject matter to provide methods and kits for the diagnosis and prognosis of Alzheimer's disease by determining amounts of one or more micro-RNAs correlated with Alzheimer's disease in a biological sample from a subject. This object is achieved in whole or in part by the presently-disclosed subject matter.

An object of the presently-disclosed subject matter having been stated hereinabove, and which is achieved in whole or in part by the presently- disclosed subject matter, other objects and advantages will become evident to those of ordinary skill in the art after a study of the following description of the presently-disclosed subject matter, Figures, and non-limiting Examples. BRIEF DESCRIPTION OF THE FIGURES

Figures 1A-1 F are representations of results from miRNA microarrays showing gene set enrichment analysis and hierarchical clustering of miRNA expression in Alzheimer's disease subjects' blood mononuclear cells (BMC). The significant upregulated miRNA in AD (see Table 1 ) are ranked in order of significance by GSEA software for (Figure 1A) the whole dataset or for (Figure 1 B) women and (Figure 1 C) men datasets separately. The hierarchical clustering of subjects using the same miRNA data (see Table 1 ) is shown for the (Figure 1 D) whole dataset or for (Figure 1 E) women and (Figure 1 F) men datasets separately. Both subjects (column) and miRNAs (rows) were clustered using Pearson correlation.

Figures 2A and 2B are Venn diagrams of altered miRNA expression in BMC with respect to Alzheimer disease and gender. Figure 2A shows the number of common miRNA upregulated in both AD men and women in the overlap. Figure 2B shows the number of miRNA differentially expressed in women as compared to men within NEC or AD subgroups. miRNAs are identified in Tables 1 and 3.

Figures 3A and 3B are graphs showing data from quantitative real time PCR of BMC miRNA levels relative to AD and gender. Figure 3A depicts fold differences in miRNA expression between NEC and AD for both women and men. Figure 3B depicts gender differences in miRNA levels between women and men for NEC and AD subgroups. miRNA levels were determined by the delta Ct method as described in the Examples. Figures 4A and 4B are graphs showing functional categories of predicted mi RN A targets down regulated in Alzheimer BMC. Targets of upregulated BMC miRNA for both AD women and men were compared to previous down regulated mRNA data in Alzheimer BMC [23], and summarized according to (Figure 4A) percentage of putative targets per functional category, or (Figure 4B) average number of miRNAs targeting the same mRNA. Detailed miRNA targets are presented in Supplemental Table 4.

Figure 5 is a representation of results from miRNA microarrays showing gene set enrichment analysis for the complete miRNA dataset. miRNA signatures of NEC vs. AD for both women and men together, with the significant up- and down-regulated miRNA in AD ranked from top to bottom.

Figure 6 is a diagram depicting the association of miRNAs disclosed herein and correlated with a model of their potential functional impact in amyloid β₄2 clearance and the insulin-like growth factor pathways in Alzheimer's disease.

Figure 7 is a diagram depicting the systemic dysfunctions present in AD, changes in protein expression profiles affecting the dysfunctions, and correlations to miRNAs disclosed herein that are diagnostic for AD and that modulate the proteins involved in AD systemic dysfunction. Disruption in miRNA levels can result in an increased susceptibility in a subject for AD through impairment of protective mechanisms, such as for example DNA repair, cellular stress responses, neuroprotection, neuroregeneration, and redox homeostasis and increased cellular pathologies including β-amyloid production, inflammation, apoptosis, and cytoskeletal pathology.

DETAILED DESCRIPTION

The details of one or more embodiments of the presently-disclosed subject matter are set forth in the accompanying description below. Other features, objects, and advantages of the presently-disclosed subject matter will be apparent from the specification, Figures, and Claims. All publications, patent applications, patents, and other references noted herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the presently-disclosed subject matter belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the presently-disclosed subject matter, representative methods and materials are now described.

Following long-standing patent law convention, the terms "a", "an", and "the" refer to "one or more" when used in this application, including the claims. Thus, for example, reference to "a peptide" includes a plurality of such peptides, and so forth.

Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently-disclosed subject matter. As used herein, the term "about," when referring to a value or to an amount of mass, weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1 %, in some embodiments ±0.5%, and in some embodiments ±0.1 % from the specified amount, as such variations are appropriate to perform the disclosed methods.

MicroRNAs (miRNAs) are naturally occurring, small non-coding RNAs that are about 17 to about 25 nucleotide bases (nt) in length in their biologically active form. miRNAs post-transcriptionally regulate gene expression by repressing target mRNA translation. It is thought that miRNAs function as negative regulators, i.e. greater amounts of a specific miRNAwill correlate with lower levels of target gene expression.

There are three forms of miRNAs existing in vivo, primary miRNAs (pri- miRNAs), premature miRNAs (pre-miRNAs), and mature miRNAs. Primary miRNAs (ph-miRNAs) are expressed as stem-loop structured transcripts of about a few hundred bases to over 1 kb. The pri-miRNA transcripts are cleaved in the nucleus by an RNase Il endonuclease called Drosha that cleaves both strands of the stem near the base of the stem loop. Drosha cleaves the RNA duplex with staggered cuts, leaving a 5'phosphate and 2 nt overhang at the 3' end. The cleavage product, the premature miRNA (pre-miRNA) is about 60 to about 110 nt long with a hairpin structure formed in a fold-back manner. Pre- miRNA is transported from the nucleus to the cytoplasm by Ran-GTP and Exportin-5. Pre-miRNAs are processed further in the cytoplasm by another RNase Il endonuclease called Dicer. Dicer recognizes the 5' phosphate and 3' overhang, and cleaves the loop off at the stem-loop junction to form miRNA duplexes. The miRNA duplex binds to the RNA-induced silencing complex (RISC), where the antisense strand is preferentially degraded and the sense strand mature miRNA directs RISC to its target site. It is the mature miRNA that is the biologically active form of the miRNA and is about 17 to about 25 nt in length.

MicroRNAs function by engaging in base pairing (perfect or imperfect) with specific sequences in their target genes' messages (mRNA). The miRNA degrades or represses translation of the mRNA, causing the target genes' expression to be post-transcriptionally down-regulated, repressed, or silenced. In animals, miRNAs do not necessarily have perfect homologies to their target sites and partial homologies lead to translational repression, whereas, in plants miRNAs tend to show complete homologies to the target sites and degradation of the message (mRNA) prevails. Micro-RNAs are widely distributed in the genome, dominate gene regulation, and actively participate in many physiological and pathological processes. For example, the regulatory modality of certain miRNAs is found to control cell proliferation, differentiation, and apoptosis; and, abnormal miRNA profiles are associated with oncogenesis. Additionally, it is suggested that viral infection causes an increase in miRNAs targeted to silence "pro-cell survival" genes, and a decrease in miRNAs repressing genes associated with apoptosis (programmed cell death), thus tilting the balance towards gaining apoptosis signaling.

Thousands of messenger RNA (mRNA) are under this selection pressure by hundreds of miRNA species identified so far; this selection process is instrumental in dampening specific groups of gene expressions which, for example, may no longer be needed, to allow cells to channel their physiological program direction to a new pathway of gene expression. The miRNA- dependent dampening of target groups of gene expression is a robust and rapid regulation to allow cells to depart from an old, and transition to a new, program. A typical example of this is demonstrated during embryonic development, when a particular group of cells is directed to become unique specialized cell types such as neurons, cardiomyocytes, muscle, etc. It is thought that expression levels of roughly a third of human genes are regulated by miRNAs, and that the miRNA regulation of unique gene expressions is linked to the particular signaling pathway for each specific cell type. For example, the apoptosis signaling pathway may be dictated by a group of miRNAs targeted to destabilize pro-survival gene messages, allowing alternative pro-apoptosis genes to gain dominance and thus activate the death program. Another example is the control of cancer growth; a recent discovery has shown that miRNAs may also be essential in preventing cells from becoming neoplastic. For example, two oncogenes, cMyc and cRas, are found to share control by one miRNA species, whose expression is down-regulated in cancer. In other words, lack of this miRNA allows the unchecked expression of cMyc and cRas, thus permitting these two genes to become abundantly present in cancer cells, allowing them to acquire uncontrolled cell proliferating ability, and set the stage for neoplastic growth. Additionally, it has been reported that a miRNA mutation is responsible for a phenotype of muscularity in sheep of Belgian origin, suggesting that mutations associated with genetic disorders could be found in miRNAs, where no evidence of mutations have been found in promoter regions, coding areas, and slicing sites.

It is possible that a coordinated orchestration of multiple pathways serves to control a particular cellular state, wherein certain molecular "hubs" may be involved, which are functionally manipulated by hierarchical orders and redundancy of molecular control. Indeed, dozens of miRNAs may operate to ensure that these "hubs" can exert either major or minor functions in cells, by simply repressing the expression of either themselves or their functional opponents. Thus, one gene product may function as a major "hub" for one signaling pathway in one type of cell, and in another cell type, it may be a minor "hub", or may not be used at all. MicroRNA control of "hub" gene expressions may then be an expedient mechanism to provide such versatility for various molecules to serve as either major or minor "hubs', or not at all, for different types of cellular operational modalities.

Given the role of miRNAs in gene regulation, and in many physiological and pathological processes, information about their interactive modes and their expression patterns is desirable to obtain. Systems and methods of quantitating and identifying which groups of putative miRNAs are in operation in a particular cell type, or in association with a particular process or condition of interest, can provide information useful for understanding how each cellular state evolves and is maintained, and how dysfunctional maintenance is abetted by improper decreases or increases of unique sets of miRNAs to regulate the expression of key genes. Such understanding can prove useful in the diagnosis and characterization of a number of disorders, including Alzheimer's disease.

Gene expression studies in AD have shown downregulation of various mRNA species in brain [31], peripheral blood mononuclear cells (BMC) [23] and lymphocytes [23, 34] relative to non-demented control values. Furthermore, investigations have implicated impairment of protein synthesis in AD tissues [14] and diminished concentrations of specific proteins in the cerebrospinal fluid (CSF) of these patients [32].

Disclosed herein are novel data demonstrating that miRNA expression levels differing from a norm can effect a change in the amounts of specific mRNA species both in AD brain and peripheral tissues. As disclosed herein in the Examples, a large number of exemplary human miRNAs {e.g., from the let- 7 family to miR-663) were screened in blood mononuclear cells (BMC) derived from well-characterized cases of mild sporadic AD and age-matched normal elderly control subjects and, based on predicted miRNA targets, it was ascertained that measured variations in miRNA levels can be correlated with particular patterns of mRNA expression demonstrated in AD [23].

In addition, the present correlations of miRNA expression levels to AD have also been correlated to changes in expression patterns of proteins (and are responsible, at least in part, to the changes in protein expression). In particular, the up-regulation of several miRNAs has further been correlated to the AD-associated down-regulation of certain signaling proteins described in Ray, et al. (Nat. Med. (2007) 13, 1359 - 1362, which is incorporated herein by reference). Briefly, Ray, et al. describe 18 signaling proteins in blood plasma that can be used to classify AD and control subjects with 90% accuracy. Included in the proteins identified by Ray, et al. are CCL7, M-CSF, G-CSF, EGF, IL-1 a, CCL5, IL-3, TNF-α, PDGF-BB, GDNF, and CCL15. In accordance with the presently-disclosed subject matter, the down-regulation of these proteins was correlated to an increase in the levels of the miRNAs which target the gene products responsible for producing these proteins. These miRNAs included has-let-7f, hsa-miR-181 a, hsa-miR-181 b, hsa-miR-200a, hsa-miR-34a, hsa-miR-371 , hsa-miR-520h, and hsa-miR-579. As such, the up-regulation of these miRNAs and their correlation with the down-regulation of proteins previously-identified as proteins useful for diagnosing AD subjects, further independently validates the presently-disclosed subject matter as a method for diagnosing AD.

Thus, the presently-disclosed subject matter provides for the correlation of miRNA expression levels (see, e.g., Table E) with mRNA levels and proteins expressed therefrom and AD. As such, the presently-disclosed subject matter provides, for the first time, methods for diagnosis of Alzheimer's disease (AD) and related disorders through determination of amounts of one or more miRNAs present in a biological sample, such as for example, a peripheral blood sample.

In some embodiments of the presently-disclosed subject matter, a method for diagnosing Alzheimer's disease or a related disorder, or the potential to develop AD, in a subject is provided. In some embodiments, the method comprises providing a biological sample from a subject, determining an amount of one or more miRNAs correlated with AD or a related disorder in the biological sample, and comparing the amount of the one or more miRNAs to one or more miRNA control levels. The subject can then be diagnosed as having, or potentially developing, Alzheimer's disease or a related disorder if there is a measurable difference in the amounts of the one or more miRNAs in the sample as compared to the one or more control levels. In some embodiments, the one or more miRNAs correlated with AD are, for example, miRNAs selected from Tables 1 -4 and Table D. In some embodiments, the one or more miRNAs correlated with AD are, for example, miR-594, miR-181 b, miR- 34a, miR-155, miR-620, miR-579, miR-605, miR-517^*, miR-137, let-7f, mi R- 569, miR-493-3p, miR-34b, miR-581 , miR-371 , miR-489, miR-363, miR-513, miR-431 , miR-200a, miR-182, miR-520h, miR-377, miR-653, and combinations thereof. As disclosed herein above, AD is characterized by the deposition of senile plaques in particular regions of the brain. These characteristic plaques are composed of an aggregation of the amyloid β₄2 peptide (Aβ), which is a 42 amino acid carboxy-terminal fragment of the amyloid precursor protein (APP). Aβ is directly neurotoxic and can stimulate an inflammatory response. Aβ also spontaneously aggregates in fibrils, which accumulate in senile plaques (Figure 6). Aβ accumulation in plaques can result from increased production or decreased clearance of Aβ. Increased production can be a result of a number of factors including, for example, overproduction of APP (e.g., as occurs in Trisomy 21 ), mutations in APP resulting in aberrant proteolytic processing (e.g., as occurs in Familial AD (FAD)), or excessive proteolytic processing by v- secretase, which generates Aβ.

As shown in Figure 6, Aβ is normally converted from the toxic to the nontoxic form via a degradation process by the heat shock factor 1/heat shock factor 2 (HSF1/HSF2) complex; this generally prevents accumulation of toxic Aβ by degrading Aβ into a non-toxic aggregate form. However, in AD the efficacy of the HSF1/HSF2 complex can be reduced, resulting in decreased clearance of Aβ. HSF1/HSF2 complex activity can be down regulated by insulin growth factor 1 receptor (IGF1 -R), which in turn is upregulated in response to reduced levels of its natural ligand, insulin growth factor 1 (IGF1 ) (Figure 6). The present inventors have now discovered that this aberrant pathway for decreased Aβ clearance is in turn regulated by several miRNAs, including miR-181 b, miR-517^*, and miR-579. Without wishing to be bound by any particular theory of operation, both miR-517* and 579 target IGF1 , resulting in decreased IGF1 expression and thereby increased IGF1 -R expression, which in turn can downregulate HSF/HSF2 complex activity, ultimately resulting in aberrant Aβ clearance. Further, the present inventors have determined that miR-181 b also reduces the expression of the HSF2 complex directly, and thus further leads to an increase in toxic oligomers and protofibrils of Aβ (Figure 6). As such, an increased expression of one or more of miRNAs 181 b, miR-517^*, or miR-579 can result in increased Aβ accumulation, or an increased risk thereof, in a subject. Therefore, in some embodiments of the presently- disclosed subject matter, a method of diagnosing amyloid β₄2 accumulation (e.g., in the brain of the subject), or a risk thereof, within a subject is provided. The method comprises providing a biological sample and determining an amount in the sample of one or more of the miRNAs miR-517^*, miR-579, and miR-181 b, which are correlated with Aβ accumulation. The amount of the one or more miRNAs is compared to one or more miRNA control levels. The subject is diagnosed as having, or at an increased risk of developing, Aβ accumulation if there is a measurable difference in the amounts of the one or more miRNAs in the sample as compared to the one or more control levels. In particular embodiments, the subject is diagnosed as having, or at an increased risk of developing, Aβ accumulation if the amount of the one or more measured miRNAs is increased in the sample as compared to the control.

The term "biological sample" as used herein refers to a sample that comprises a biomolecule and/or is derived from a subject. Representative biomolecules include, but are not limited to, total DNA, RNA, miRNA, mRNA, and polypeptides. The biological sample can be utilized for the detection of the presence and/or the expression level of a miRNA of interest. As such, a biological sample can comprise a cell, a group of cells, fragments of cells, or cell products. Any cell, group of cells, cell fragment, or cell product can be used with the methods of the presently-disclosed subject matter, although cell-types and organs that would be predicted to show differential miRNA expression in subjects with Alzheimer's disease versus normal subjects are best suited. In some embodiments, the biological sample is a relatively easily obtained biological sample, such as for example blood. In some embodiments, the biological sample comprises one or more of the constituent cell types that make up blood, including but not limited to blood mononuclear cells (BMC), such as for example T cells, B cells, monocytes, APCs and NK/NKT cells. Also encompassed within the phrase "biological sample" are biomolecules that are derived from a cell or group of cells that permit miRNA levels to be determined. As such, in some embodiments, the biological sample can be a blood sample or sub-fractions thereof, including BMCs; an epithelial cell (e.g., as obtained with a buccal swab); and a tissue biopsy [e.g., as obtained from a biopsy of skin, muscle, fat, connective tissue, organ, etc.). The terms "diagnosing" and "diagnosis" as used herein refer to methods by which the skilled artisan can estimate and even determine whether or not a subject is suffering from a given disease or condition. The skilled artisan often makes a diagnosis on the basis of one or more diagnostic indicators, such as for example a biomarker, the amount (including presence or absence) of which is indicative of the presence, severity, or absence of the condition.

Along with diagnosis, clinical disease prognosis is also an area of great concern and interest. It is important to know the stage and rapidity of advancement of the AD in order to plan the most effective therapy. If a more accurate prognosis can be made, appropriate therapy, and in some instances less severe therapy for the patient can be chosen. Measurement of miRNA levels disclosed herein can be useful in order to categorize subjects according to advancement of AD who will benefit from particular therapies and differentiate from other subjects where alternative or additional therapies can be more appropriate.

As such, "making a diagnosis" or "diagnosing", as used herein, is further inclusive of making a prognosis, which can provide for predicting a clinical outcome (with or without medical treatment), selecting an appropriate treatment (or whether treatment would be effective), or monitoring a current treatment and potentially changing the treatment, based on the measure of diagnostic miRNA levels. Further, in some embodiments of the presently-disclosed subject matter, multiple determinations of amounts of one or more miRNAs over time can be made to facilitate diagnosis and/or prognosis. A temporal change in one or more miRNA levels (i.e., miRNA amounts in a biological sample) can be used to predict a clinical outcome, monitor the progression of the AD, and/or efficacy of administered AD therapies. In such an embodiment for example, one could observe a decrease in the amount of particular miRNAs (as disclosed in greater detail in the Examples) in a biological sample over time during the course of a therapy, thereby indicating effectiveness of treatment. In some embodiments, a first time point can be selected prior to initiation of a prophylaxis or treatment and a second time point can be selected at some time after initiation of the prophylaxis or treatment. miRNA levels can be measured in each of the samples taken from different time points and qualitative and/or quantitative differences noted. A change in the amounts of one or more of the measured miRNA levels from the first and second samples can be correlated with prognosis, used to determine treatment efficacy, and/or used to determine progression of the disease in the subject. The terms "correlated" and "correlating," as used herein in reference to the use of diagnostic and prognostic miRNA levels associated with AD or related disorders, refers to comparing the presence or quantity of the miRNA levels in a subject to its presence or quantity in subjects known to suffer from, or known to be at risk of AD (e.g., due to advanced age or other known risk factors); or in subjects known to be free of a given condition, i.e. "normal subjects" or "control subjects". For example, a level of one or more miRNAs in a biological sample can be compared to a miRNA level for each of the specific miRNAs tested and determined to be correlated with AD. The sample's one or more miRNA levels is said to have been correlated with a diagnosis; that is, the skilled artisan can use the miRNA level(s) to determine whether the subject suffers from AD, or may potentially develop AD, and respond accordingly. Alternatively, the sample's miRNA level(s) can be compared to control miRNA level(s) known to be associated with a good outcome {e.g., the absence of AD), such as an average level found in a population of normal subjects. In certain embodiments, a diagnostic or prognostic miRNA level is correlated to AD by merely its presence or absence. In other embodiments, a threshold level of a diagnostic or prognostic miRNA level can be established, and the level of the miRNA in a subject sample can simply be compared to the threshold level. As noted, in some embodiments, multiple determinations of one or more diagnostic or prognostic miRNA levels can be made, and a temporal change in the levels can be used to determine a diagnosis or prognosis. For example, specific miRNA level(s) can be determined at an initial time, and again at a second time. In such embodiments, an increase in the miRNA level(s) from the initial time to the second time can be diagnostic of AD, or a given prognosis. Likewise, a decrease in the miRNA level(s) from the initial time to the second time can be indicative of AD, or a given prognosis. Furthermore, the degree of change of one or more miRNA level(s) can be related to the severity of the AD and/or timeline of disease progression and future adverse events.

The skilled artisan will understand that, while in certain embodiments comparative measurements can be made of the same miRNA level(s) at multiple time points, one can also measure given miRNA level(s) at one time point, and second miRNA level(s) at a second time point, and a comparison of these levels can provide diagnostic information.

The phrase "determining the prognosis" as used herein refers to methods by which the skilled artisan can predict the course or outcome of a condition in a subject. The term "prognosis" does not refer to the ability to predict the course or outcome of a condition with 100% accuracy, or even that a given course or outcome is predictably more or less likely to occur based on the presence, absence or levels of a biomarker. Instead, the skilled artisan will understand that the term "prognosis" refers to an increased probability that a certain course or outcome will occur; that is, that a course or outcome is more likely to occur in a subject exhibiting a given condition, when compared to those individuals not exhibiting the condition. For example, in individuals not exhibiting the condition {e.g., not expressing the miRNA level(s) or expressing miRNA level(s) at a reduced level), the chance of a given outcome (e.g., suffering from AD) may be very low (e.g., <1 %), or even absent. In contrast, in individuals exhibiting the condition (e.g., expressing the miRNA level(s) or expressing miRNA level(s) at a level greatly increased over a control level), the chance of a given outcome (e.g., suffering from AD) may be high. In certain embodiments, a prognosis is about a 5% chance of a given expected outcome, about a 7% chance, about a 10% chance, about a 12% chance, about a 15% chance, about a 20% chance, about a 25% chance, about a 30% chance, about a 40% chance, about a 50% chance, about a 60% chance, about a 75% chance, about a 90% chance, or about a 95% chance.

The skilled artisan will understand that associating a prognostic indicator with a predisposition to an adverse outcome is a statistical analysis. For example, miRNA level(s) (e.g., quantity of one or more miRNAs in a sample) of greater than a control level in some embodiments can signal that a subject is more likely to suffer from AD than subjects with a level less than or equal to the control level, as determined by a level of statistical significance. Additionally, a change in miRNA level(s) from baseline levels can be reflective of subject prognosis, and the degree of change in marker level can be related to the severity of adverse events. Statistical significance is often determined by comparing two or more populations, and determining a confidence interval and/or a p value. See, e.g., Dowdy and Wearden, Statistics for Research, John

Wiley & Sons, New York, 1983, incorporated herein by reference in its entirety.

Exemplary confidence intervals of the present subject matter are 90%, 95%,

97.5%, 98%, 99%, 99.5%, 99.9% and 99.99%, while exemplary p values are 0.1 , 0.05, 0.025, 0.02, 0.01 , 0.005, 0.001 , and 0.0001 .

In other embodiments, a threshold degree of change in the level of a prognostic or diagnostic miRNA level(s) can be established, and the degree of change in the level of the indicator in a biological sample can simply be compared to the threshold degree of change in the level. A preferred threshold change in the level for miRNA level(s) of the presently-disclosed subject matter is about 5%, about 10% (i.e., a 1.1 fold change), about 15%, about 20%, about 25%, about 30%, about 50% (i.e., a 1.5 fold change), about 60%, about 75%, about 100% (i.e., a 2 fold change), and about 150%. In yet other embodiments, a "nomogram" can be established, by which a level of a prognostic or diagnostic indicator can be directly related to an associated disposition towards a given outcome. The skilled artisan is acquainted with the use of such nomograms to relate two numeric values with the understanding that the uncertainty in this measurement is the same as the uncertainty in the marker concentration because individual sample measurements are referenced, not population averages.

The "amount" of one or more miRNAs determined refers to a qualitative (e.g., present or not in the measured sample) and/or quantitative (e.g., how much is present) measurement of the one or more miRNAs. The "control level" is an amount (including the qualitative presence or absence) or range of amounts of one or more miRNAs found in a comparable biological sample in subjects not suffering from AD. As one non-limiting example of calculating the control level, the amount of one or more miRNAs of interest present in a normal biological sample {e.g., blood) can be calculated and extrapolated for whole subjects.

Further with respect to the diagnostic methods of the presently-disclosed subject matter, the present methods are applicable to other disorders related to AD as well. For example, other neurodegenerative disorders, in humans and animals, which share overlapping dysfunctional metabolic pathways with AD can be diagnosed using the presently-disclosed miRNAs. In addition, related disorders can include disorders that are not necessarily considered neurodegenerative, but nonetheless are related to AD via overlapping dysfunctional metabolic pathways. For example, Figure 7 depicts the various systemic cellular dysfunctions that can occur, which over time lead to the development of AD. Systemic etiopathogenetic mechanisms in late-onset AD point to a defective hub of transcriptional networks that coordinate antioxidant defense with DNA repair mechanisms (Figure 7). The consequences of aberrant gene expression in the Alzheimer CNS are complex, and may be related in part to progressive breakdown of cytoskeletal and mitochondrial functions. As demonstrated in Figure 7, the importance of miRNA deregulation in neurological diseases such as AD is evident. However, oxidative and other stresses drive other disorders as well and certain of these disorders are related to AD in that metabolic dysfunctional pathways of these related disorders are shared with AD. In particular, disorders related to AD that can be diagnosed using one or more of the miRNAs disclosed herein include metabolic disorders such as diabetes and vascular dementia (e.g., co-morbidity of AD with cardiovascular disease and hypertension). To illustrate, as disclosed herein, miR-181 b, miR-34a, let-7f, miR-579, miR-51 T, and miR-200a, have each been correlated with AD. In addition, each of these miRNAs have been correlated with related neurological disorders and/or metabolic disorders. For example, miR-181 b, miR-34a, let-7f, and miR-517^*, have been correlated with diabetes as well as AD and other neurological disorders. Further, miR-579 has been correlated with lymphocyte apoptosis and brain atrophy and miR-200a has been correlated with inflammation, amyloid fibrils, and demyelination. As such, the presently-disclosed diagnostic miRNAs can be utilized for diagnosis of Alzheimer's disease as well as related disorders, including other neurological disorders and metabolic syndrome disorders, which share overlapping dysfunctional metabolic pathways with AD.

A preferred subject is a vertebrate subject. A preferred vertebrate is warm-blooded; a preferred warm-blooded vertebrate is a mammal. A preferred mammal is most preferably a human. As used herein, the term "subject" includes both human and animal subjects. Thus, veterinary therapeutic uses are provided in accordance with the presently-disclosed subject matter.

As noted hereinabove, the presently-disclosed subject matter provides for the determination of the amount of one or more miRNAs correlated with AD within biological fluids of a subject, and in particular, from serological samples from a subject, such as for example blood. This provides the advantage of allowing for the use of biological samples for testing that are easily acquired from the subject. The amount of one or more miRNAs of interest in the biological sample can then be determined utilizing any of a number of methodologies generally known in the art.

An exemplary methodology for measuring miRNA levels in a biological sample is microarray technique, which is a powerful tool applied in gene expression studies. The technique provides many polynucleotides with known sequence information as probes to find and hybridize with the complementary strands in a sample (e.g., a sample extracted from cells, tissues, or another nucleotide-containing sample of interest) to thereby capture the complementary strands by selective binding.

The term "selective binding" as used herein refers to a measure of the capacity of a probe to hybridize to a target polynucleotide with specificity. Thus, the probe comprises a polynucleotide sequence that is complementary, or essentially complementary, to at least a portion of the target polynucleotide sequence. Nucleic acid sequences which are "complementary" are those which are base-pairing according to the standard Watson-Crick complementarity rules. As used herein, the term "complementary sequences" means nucleic acid sequences which are substantially complementary, as can be assessed by the same nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment in question under relatively stringent conditions such as those described herein. A particular example of a contemplated complementary nucleic acid segment is an antisense oligonucleotide. With regard to probes disclosed herein having binding affinity to miRNAs, the probe can be 100% complementary with the target polynucleotide sequence at the polymorphic base. However, the probe need not necessarily be completely complementary to the target polynucleotide along the entire length of the target polynucleotide so long as the probe can bind the target polynucleotide with specificity and capture it from the sample.

Nucleic acid hybridization will be affected by such conditions as salt concentration, temperature, or organic solvents, in addition to the base composition, length of the complementary strands, and the number of nucleotide base mismatches between the hybridizing nucleic acids, as will be readily appreciated by the skilled artisan. Stringent temperature conditions will generally include temperatures in excess of 30⁰C, typically in excess of 37°C, and preferably in excess of 45°C. Stringent salt conditions will ordinarily be less than 1 ,000 mM, typically less than 500 mM, and preferably less than 200 mM. However, the combination of parameters is much more important than the measure of any single parameter. Determining appropriate hybridization conditions to identify and/or isolate sequences containing high levels of homology is well known in the art. For the purposes of specifying conditions of high stringency, preferred conditions are a salt concentration of about 200 mM and a temperature of about 37°C or about 45°C.

Data mining work is completed by bioinformatics, including scanning chips, signal acquisition, image processing, normalization, statistic treatment and data comparison as well as pathway analysis. As such, a microarray can profile hundreds and thousands of polynucleotides simultaneously with high through-put performance. Microarray profiling analysis of mRNA expression has successfully provided valuable data for gene expression studies in basic research. And the technique has been further put into practice in the pharmaceutical industry and in clinical diagnosis. With increasing amounts of miRNA data becoming available, and with accumulating evidence of the importance of miRNA in gene regulation, microarray becomes a useful technique for high throughput miRNA studies. The analysis of miRNA correlated with AD can be carried out separately or simultaneously with multiple polynucleotide probes within one test sample. For example, several probes can be combined into one test for efficient processing of a multiple of samples and for potentially providing greater diagnostic and/or prognostic accuracy. In addition, one skilled in the art would recognize the value of testing multiple samples (for example, at successive time points) from the same subject. Such testing of serial samples can allow the identification of changes in miRNA levels over time. Increases or decreases in miRNA levels, as well as the absence of change in levels, can provide useful information about the disease status, such as for example the progression of the disease from pre-clinical AD into moderate or advanced stages of AD.

In some embodiments, a panel consisting of polynucleotide probes that selectively bind miRNAs correlated with AD can be constructed to provide relevant information related to the diagnosis or prognosis of AD and management of subjects with AD. Such a panel can be constructed, for example, using 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 75, 100, 150, 200, 250, 300, 400, 500, or 1 ,000 individual polynucleotide probes. The analysis of a single probe or subsets of probes comprising a larger panel of probes could be carried out by one skilled in the art to optimize clinical sensitivity or specificity in various clinical settings. These include, but are not limited to ambulatory, urgent care, critical care, intensive care, monitoring unit, in-patient, out-patient, physician office, medical clinic, and health screening settings. Furthermore, one skilled in the art can use a single probe or a subset of additional probes comprising a larger panel of probes in combination with an adjustment of the diagnostic threshold in each of the aforementioned settings to optimize clinical sensitivity and specificity. The clinical sensitivity of an assay is defined as the percentage of those with the disease that the assay correctly predicts, and the specificity of an assay is defined as the percentage of those without the disease that the assay correctly predicts. In some embodiments, determining the amount of the one or more miRNAs comprises labeling the one or more miRNAs. The labeled miRNAs can then be captured with one or more polynucleotide probes that each selectively binds the one or more miRNAs. As used herein, the terms "label" and "labeled" refer to the attachment of a moiety, capable of detection by spectroscopic, radiologic, or other methods, to a probe molecule. Thus, the terms "label" or "labeled" refer to incorporation or attachment, optionally covalently or non-covalently, of a detectable marker into/onto a molecule, such as a polynucleotide. Various methods of labeling polypeptides are known in the art and can be used. Examples of labels for polynucleotides include, but are not limited to, the following: radioisotopes, fluorescent labels, heavy atoms, enzymatic labels or reporter genes, chemiluminescent groups, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for antibodies, metal binding domains, epitope tags, etc.). In some embodiments, labels are attached by spacer arms of various lengths to reduce potential steric hindrance.

The analysis of miRNA levels utilizing polynucleotide probes can be carried out in a variety of physical formats as well. For example, the use of microtiter plates or automation can be used to facilitate the processing of large numbers of test samples. Alternatively, single sample formats could be developed to facilitate immediate treatment and diagnosis in a timely fashion.

In some embodiments, a kit for the diagnosis of AD, or potential to develop AD, in a subject is provided that comprises a plurality of polynucleotide probes that each selectively bind a plurality of miRNAs correlated with AD. For example, in some embodiments, the plurality of miRNAs is selected from Tables 1 -4 and Table D. In some embodiments, the plurality of polynucleotide probes each selectively bind an miRNA selected from the group consisting of miR-594, miR-181 b, miR-34a, miR-155, miR-620, miR-579, miR-605, miR- 517*, miR-137, let-7f, miR-569, miR-493-3p, miR-34b, miR-581 , miR-371 , miR- 489, miR-363, miR-513, miR-431 , miR-200a, miR-182, miR-520h, miR-377, and miR-653. In some embodiments, the polynucleotide probes selectively bind mature miRNAs. In some embodiments, the plurality of polynucleotide probes are each bound to a substrate. In some embodiments, the substrate comprises a plurality of addresses. Each address can be associated with at least one of the polynucleotide probes of the array. An array is "addressable" when it has multiple regions of different moieties {e.g., different polynucleotide sequences) such that a region (i.e., a "feature" or "spot" of the array) at a particular predetermined location (i.e., an "address") on the array will detect a particular target or class of targets (although a feature may incidentally detect non-targets of that feature). Array features are typically, but need not be, separated by intervening spaces. In the case of an array, the "target" miRNA can be referenced as a moiety in a mobile phase (typically fluid), to be detected by probes ("target probes") which are bound to the substrate at the various regions. Biopolymer arrays (e.g., polynucleotide microarrays) can be fabricated by depositing previously obtained biopolymers (such as from synthesis or natural sources) onto a substrate, or by in situ synthesis methods. Methods of depositing obtained biopolymers include, but are not limited to, loading then touching a pin or capillary to a surface, such as described in U.S. Pat. No. 5,807,522 or deposition by firing from a pulse jet such as an inkjet head, such as described in PCT publications WO 95/25116 and WO 98/41531 , and elsewhere. The in situ fabrication methods include those described in U.S. Pat. No. 5,449,754 for synthesizing peptide arrays, and in U.S. Pat. No. 6,180,351 and WO 98/41531 and the references cited therein for polynucleotides, and may also use pulse jets for depositing reagents. Further details of fabricating biopolymer arrays by depositing either previously obtained biopolymers or by the in situ method are disclosed in U.S. Pat. Nos. 6,242,266, 6,232,072, 6,180,351 , and 6,171 ,797. In fabricating arrays by depositing previously obtained biopolymers or by in situ methods, typically each region on the substrate surface on which an array will be or has been formed ("array regions") is completely exposed to one or more reagents. For example, in either method the array regions will often be exposed to one or more reagents to form a suitable layer on the surface that binds to both the substrate and biopolymer or biomonomer. In in situ fabrication the array regions will also typically be exposed to the oxidizing, deblocking, and optional capping reagents. Similarly, particularly in fabrication by depositing previously obtained biopolymers, it can be desirable to expose the array regions to a suitable blocking reagent to block locations on the surface at which there are no features from non-specifically binding to target.

In some embodiments, the kit can comprise devices and reagents for the analysis of at least one test sample. The kit can further comprise instructions for using the kit and conducting the analysis. Optionally the kits can contain one or more reagents or devices for converting a determined miRNA level to a diagnosis or prognosis of the subject.

In some particular embodiments of the presently-disclosed subject matter, a miRNA microarray or "MMChip", as disclosed in International PCT application No. PCT/US07/62233 and herein incorporated by reference in its entirety, is utilized to determine amount of one or more miRNAs correlated with

AD present in a biological sample. MMChips can include an organized assortment of oligonucleotide probes immobilized onto an appropriate platform.

The oligonucleotide probes are each about 15 to about 28 nucleotide bases (nt) in length. Each probe selectively binds a miRNA of interest. In certain embodiments, each probe of the MMChip selectively binds a biologically active mature miRNA in a sample.

Exemplary MMChips made in accordance with the present subject matter can include: probes for at least about 1 to about 20 different miRNAs; probes for at least to about 100 to about 200 different miRNAs; probes for at least about 100 to about 150 different miRNAs; probes for at least about 150 to about 250 different miRNAs; probes for at least about 250 to about 350 different miRNAs; probes for at least about 260 to about 350 different miRNAs; probes for at least about 350 to about 450 different miRNAs; probes for at least about 450 to about 800 different miRNAs; or probes for at least about 800 to about

1200 different miRNAs.

An MM Chip made in accordance with the present subject matter can include any number or combination of probes that selectively bind miRNAs, without departing from the spirit and scope of the presently-disclosed subject matter. Examples of such probes and the miRNAs which they specifically bind are set forth in Figures 1 -4 of International PCT application No.

PCT/US07/62233. The probes can be selected from those set forth in Figures 1 -4 of International PCT application No. PCT/US07/62233, or may be otherwise selected based on their ability to selectively bind miRNAs correlated with AD.

As a refinement, an MM Chip can also include one or more positive, negative, or standardized controls. For example, oligonucleotides with randomized sequences can be used as positive controls, indicating orientation of the MMChip based on where they are placed on the MMChip, and providing controls for the detection time of the MMChip when it is used for detecting miRNAs in a sample. For another example, an oligonucleotide that is complementary to a short RNA sequence that is randomly generated can be used as a negative control. For another example, an oligonucleotide representing housekeeping genes, such as GAPDH, β-actin, and 18S rRNA, can be used as standardized controls for total RNA degradation. Any number of positive, negative, or standardized can be included on an MM Chip as desired. Embodiments of the MMChip utilized with the presently-disclosed methods and kits can be made in the following manner. The oligonucleotide probes to be included in the MMChip are selected and obtained. The probes can be selected, for example, based on a particular subset of miRNAs of interest. The probes can be synthesized using methods and materials known to those skilled in the art, or they can be synthesized by and obtained from a commercial source, such as Alpha DNA Company (Montreal, Quebec, Canada).

Each discrete probe is then attached to an appropriate platform in a discrete location, to provide an organized array of probes. Appropriate platforms include membranes and glass slides. Appropriate membranes include nylon membranes and nitrocellulose membranes. The probes are attached to the platform using methods and materials known to those skilled in the art. Briefly, the probes can be attached to the platform by synthesizing the probes directly on the platform, or probe-spotting using a contact or non-contact printing system. Probe-spotting can be accomplished using any of several commercially available systems, such as the GeneMachines™ OmniGrid (San Carlos, CA). Additional information related to making an array of oligonucleotide probes can be found in U.S. Patent Application Serial No. 11/553,513, filed October 27, 2006, entitled "Thematic microarrays having enhanced specificity to screen genes, and related methods," which is incorporated herein by this reference.

Micro-RNA can be isolated from a biological sample in the following exemplary manner. A biological sample (e.g., blood) of interest is provided. The procedure for isolating the blood mononuclear cells (BMC) was described in "Blood-sample processing for the study of age-dependent gene expression in peripheral blood mononuclear cells." J Gerontol A Biol Sci Med Sci 2002;57(7):B285-7, which is incorporated herein by reference. In brief, whole blood was collected by phlebotomy in EDTA vacutainers (6 ml_ K2EDTA, Becton Dickinson, USA) and processed within two hours of procurement. On average, 32 ml_ of blood were processed at room temperature (RT) according to the procedure of Lacelle et al. [30]. Briefly, blood was centrifuged at 500*g for 10 minutes, and the upper layer of plasma removed without disturbing the surface buffy coat. The remaining blood cells were immediately diluted two-fold with phosphate-buffered saline (PBS 1 *) and layered on Ficoll-Paque Plus (Amersham Biosciences, Canada) in 15 ml_ conical tubes. After centrifugation (400*g; 4°C; x 30 min), the interphase layer containing BMC was carefully removed, washed in PBS (1 *) followed by centrifugation (500*g; x 10 min). The cell pellet was lysed in TRIZOL (Invitrogen, Canada) and immediately stored at 80⁰C until further processing. For every 30 ml_ whole blood processed, 4 ml_ TRIZOL were added to the cell pellets.

Total RNA extracted from the blood sample using, e.g., TRIZOL (Invitrogen Corporation, Carlsbad, CA) as described above, as well as from the manufacturers. Briefly, TRIZOL is added to the samples. BMC-cell pellet samples are homogenized in the TRIZOL. The TRIZOL-sample mixtures are divided into aliquots, and placed in tubes. Chloroform is added to the TRIZOL- sample mixtures, and the tubes are incubated at room temperature before being centrifuged. Three phases appear after centrifugation, and the upper- most aqueous phase is transferred to a new tube, lsopropyl alcohol and TRIZOL are added to precipitate the RNA. The sample is centrifuged to create a total RNA pellet. For an exemplary method, the desired sample size for total RNA is about 1.2 μg to about 2 μg. The total RNA sample is diluted in RNase- free water. Sodium Chloride (5M) and PEG 8000 are added, and the sample is mixed and incubated at about 4°C. NaC₂H₃O₂ (3M) and ethanol (95%) are added. The sample is centhfuged and incubated at -20⁰C. The sample is treated to a series of centhfugations and washes to isolate the miRNA. The concentration of the miRNA sample can be measured using a spectrophotometer. Additional information about miRNA isolation can be found in Thomson, et al. Nat. Meth 1 , 47-53 (2004), which is incorporated herein by reference.

The miRNA sample is amplified and labeled as is appropriate or desired. If amplification is desired, methods known to those skilled in the art can be applied. The miRNA samples can be labeled using various methods known to those skilled in the art. In certain embodiments, the miRNA samples are labeled with digoxigenin using a Digoxigenin (DIG) Nucleotide Tailing Kit (Roche Diagnostics Corporation, Indianapolis, IN) in a GENEAMP^® PCR System 9700 (Applied Biosystems, Foster City, CA). Additional information about DIG labeling can be found in Semov, et al. Analytical Biochemistry 302, 38-51 (2002).

The labeled miRNA sample is incubated with an MM Chip, allowing the miRNAs in the sample to hybridize with a probe specific for the miRNAs in the sample. In certain embodiments, the labeled miRNA sample is added to a DIG Easy Hyb Solution or Hybrid Easy Buffer (Roche Diagnostics Corporation, Indianapolis, IN) that has been preheated to hybridization temperature. The miRNA sample is then incubated with the MMChip in the solution, for example, for about 4 hours to about 24 hours. The miRNAs in the sample can be detected, identified, and quantitated in the following exemplary manner. After the miRNA sample has been incubated with the MMChip for an appropriate time period, the MMChip is washed with a series of washing buffers, and then incubated with a blocking buffer. When digoxigenin (DIG) labeling of the miRNA samples has been used, the MMChip is then incubated with an Anti-DIG-AP antibody (e.g., Roche Diagnostics Corporation, Indianapolis, IN). The MMChip is then washed with washing buffer and incubated with detection buffer, for example, for about 5 minutes. NBT/BCIP dye (5-Bromo-4-Chloro-3'-lndolyphosphate p-Toluidine Salt and NBT Nitro-Blue Tetrazolium Chloride) diluted with detection buffer is added to the MMChip, which is allowed to develop in the dark, for example, for about 1 hour to about 2 days under humid conditions.

The MMChips are scanned, for example, using an Epson Expression 1680 Scanner (Seiko Epson Corporation, Long Beach, CA) at a resolution of about 1500 dpi and 16-bit grayscale. The MMChip images are analyzed using Array-Pro Analyzer (Media Cybernetics, Inc., Silver Spring, MD) software. Because the identity of the miRNA probes on the MMChip are known, the sample can be identified as including particular miRNAs when spots of hybridized miRNAs-and-probes are visualized. Additionally, the density of the spots can be obtained and used to quantitate the identified miRNAs in the sample.

The identity and relative quantity of miRNAs in a sample can be used to provide miRNA profiles for a particular sample. An miRNA profile for a sample includes information about the identities of miRNAs contained in the sample, quantitative levels of miRNAs contained in the sample, and/or changes in quantitative levels of miRNAs relative to another sample. For example, an miRNA profile for a sample includes information about the identities, quantitative levels, and/or changes in quantitative levels of miRNAs associated with a particular cellular type, process, condition of interest, or other cellular state.

The practice of the presently-disclosed subject matter can employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Molecular Cloning A Laboratory Manual (1989), 2nd Ed., ed. by Sambrook, Fritsch and Maniatis, eds., Cold Spring Harbor Laboratory Press, Chapters 16 and 17; U.S. Pat. No.4,683,195; DNA Cloning, Volumes I and II, Glover, ed., 1985; Oligonucleotide Synthesis, M. J. Gait, ed., 1984; Nucleic Acid Hybridization, D. Hames & S. J. Higgins, eds., 1984; Transcription and Translation, B. D. Hames & S. J. Higgins, eds., 1984; Culture Of Animal Cells, R. I. Freshney, Alan R. Liss, Inc., 1987; Immobilized Cells And Enzymes, IRL Press, 1986; Perbal (1984), A Practical Guide To Molecular Cloning; See Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian CeIIs₁ J. H. Miller and M. P. Calos, eds., Cold Spring Harbor Laboratory, 1987; Methods In Enzymology, VoIs. 154 and 155, Wu et al., eds., Academic Press Inc., N.Y.; Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987; Handbook Of Experimental Immunology, Volumes I-IV, D. M. Weir and C. C. Blackwell, eds., 1986.

EXAMPLES The following Examples have been included to illustrate modes of the presently-disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill will appreciate that the following Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently-disclosed subject matter.

The presently-disclosed subject matter evidences that various coding genes representing multiple functional categories are downregulated in blood mononuclear cells (BMC) of patients with sporadic Alzheimer disease (AD). Non-coding miRNAs can regulate gene expression by suppressing mRNA stability or translation. In the present Examples, exemplary BMC miRNA expression is evaluated and correlated with sporadic AD.

MicroRNA levels from 16 AD patients and 16 normal elderly controls (NEC) were assessed using a miRNA microarray (MMChip) containing an exemplary 462 human miRNA, and the results validated by real time PCR. As demonstrated in the Examples below, the expression of several BMC miRNA was found to be increased in AD relative to NEC values, with gender specific signatures in some instances. For example, as compared to NEC, miRNA specifically upregulated in APOE4-negative AD subjects were let-7f, miR 137, miR-200a and miR 51 T, whereas miR-181 b, miR-371 , miR 569, miR-594 and miR-620 were upregulated in AD subjects bearing one or two APOE4 alleles. Within the AD group, patients treated with acetylcholinesterase inhibitors exhibited significantly lower expression levels of miR-182 and miR-600. Relative to the NEC cohort, gender-specific differences in miRNA expression were more pronounced in the AD group with levels higher in women than men.

Downregulated mRNAs in Alzheimer BMC that are predicted targets of the upregulated miRNAs were largely represented in the functional categories of DNA repair, injury response/redox homeostasis, transcription/translation and synaptic activity. Altered patterns of miRNA expression may be responsible for aberrant BMC mRNA levels in patients with sporadic AD.

MATERIALS AND METHODS FOR EXAMPLES 1 -4 Subjects

Written informed consent was obtained from all patients and their primary caregivers for AD subjects. Recruited patients with sporadic AD were assessed by a neurologist or geriatrician at the JGH-McGiII University Memory Clinic, a tertiary care facility for the evaluation of memory loss in Montreal. All AD subjects underwent formal neuropsychological testing as previously described [6]. AD was diagnosed according to National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association criteria [25]. Normal elderly controls (NEC) were recruited from Family Practice Clinics at the JGH. The latter scored within one SD of age- and education-standardized normal values on a series of memory and attention tests. The Mini-Mental State Examination (MMSE) [10] was administered to all subjects. In addition to detailed medical information available in subject's hospital charts, all subjects or their caregivers completed a questionnaire that addressed personal and family history of dementia and other neurological and medical conditions, nutritional status and intake of vitamins and medications. Subjects with chronic metabolic and inflammatory conditions (e.g. diabetes, rheumatoid arthritis, chronic active hepatitis) or acute illness (e.g. respiratory tract infection) within 3 weeks of screening were excluded from the study. Student's unpaired t-test was performed to assess statistical differences in age, years of formal education and MMSE scores between groups Apolipoprotein E (APOE) genotyping was accomplished as previously described [23]. APOE4- positive subjects were defined as individuals bearing one or two APOE4 alleles. Blood samples and extractions Whole blood was collected by phlebotomy in EDTA vacutainers (6 mL K2EDTA, Becton Dickinson, USA) as previously described [23]. BMC were isolated by Ficoll- Paque Plus (Amersham Biosciences, Canada) and washed in PBS (1 x) followed by centhfugation (50Og x 10 min). The cell pellet was lysed in TRIZOL (Invitrogen, Canada) and immediately stored at -80⁰C until further processing.

Extractions of RNA was performed as described by Lacelle et al. 2002 [17]. Briefly, for 1 ml_ of TRIZOL, 0.2 mL of chloroform was added and mixed for 15 seconds. After 3 minutes incubation at room temperature (RT), the samples were centrifuged at 12,000 g (4°C) for 15 min. The upper aqueous layer containing RNA was transferred to another microcentrifuge tube for RNA extraction. Total RNAwas solubilized in DEPC-treated water and purified using

RNeasy columns (Qiagen, Canada) according to manufacturer instructions.

Small RNA enrichment was performed according to Park et al.2002 [30]. Fifty μg of total RNA were adjusted to 400 μL with RNase-free water and then 50 uL of NaCI (5M) and 50 uL PEG 8000 (v/v 50%) were mix. The sample was incubated on ice for 2 hours, and centrifuged for 10 minutes at 13 000 rpm (4⁰C). Supernatant containing small RNA was transferred to a microcentrifuge tube and 5O uL of sodium acetate (3M, pH 4.6) and 1 mL of 100% ethanol were added. The samples were mixed and incubated at -2O⁰C for 2 hours and centrifuged for 10 minutes at 12 000 g (4⁰C). The supernatant was discarded, and the pellet was washed with 1 mL of cold 75% ethanol and, centrifuged for 10 minutes at 12 000 g (4⁰C). The pellet was dried and dissolved in 12 μL of RNase-free water at 6O⁰C for 10 minutes. Nucleic acid concentrations were determined at 260 nm by spectrophotometry and samples were stored at -8O⁰C. MicroRNA profiling

Small RNA samples were labeled with digoxigenin (DIG) at the 3' end using the DIG Oligonucleotide Tailing Kit, 2nd Generation (Roche Diagnostics, USA). One μg of small RNA was labeled in a total volume of 20 μL as described by Wang et al. [42]. The human miRNA microarray (MMChip) consisted of 462 human anti-sense DNA sequences of miRNAs obtained from the miRBase database (Sanger Institute, Cambridge, U.K.) and spotted on nitrocellulose membrane as described [42]. An individual microarray chip was pre-hybhdized in 1 ml_ of DIG Easy Hyb solution (Roche Diagnostics, USA) at 42⁰C for 1 hr. DIG-labeled small RNAs from one human subject were added to the membrane and hybridization was performed at 42⁰C for 16 hrs. The membrane was washed twice (5 min) in solution 1 (2^χSSC, 0.1 % SDS) at RT, then 20 minutes at 37⁰C in solution 2 (0.5*SSC, 0.1 % SDS), and finally 5 minutes in 1 x maleic acid solution (100 mM maleic acid, 150 mM NaCI, pH 7.5) at RT. The membrane was blocked in 1.5% Blocking reagent (w/v; Roche Diagnostics, USA) in 1 x maleic acid solution for 1 hr. The membrane was incubated for 30 minutes with the Anti-Digoxigenin-AP Fab fragments (Roche Diagnostics, USA) diluted 1 :1500 in 1.5% Blocking solution. The membrane was washed twice * 15 min with washing solution (0.1 M maleic acid; 0.15 M NaCI; 0.3% Tween20), then x 5 min in detection solution (0.1 M TRIS, pH 9.5; 2O⁰C; 0.15 M NaCI). The miRNAs hybridized on the MMchip were revealed by the alkaline phosphatase chromogenic reaction of NBT/BCIP dye as per manufacturer's instructions (Roche Diagnostics, USA).

Hybridization intensities were measured using an Expression 1680 scanner (Epson, USA) and data acquired using Array-Pro Analyzer 4.5 software (Media Cybernetics, MD, USA). Net intensity was derived from whole cell area measurement and corrected using mean intensity of ring background around spots. Microarray data analyses were performed with SAM software, version 2 (Significance Analysis of Microarrays, Stanford University, CA, USA). The data were evaluated further by two-way ANOVA for the factors, disease and gender (and their interaction) using GraphPad Prism version 3.00 (Graph Pad Software, USA). Hierarchical clustering analysis was performed using GenePattern software (Broad Institute, MA, USA) and heatmaps were generated by Gene Set Enrichment Analysis (GSEA) software [54]. Functional attribution was made according to the SOURCE database (available through the Web page of Stanford University) [16] and Gene Ontology Tree Machine (available through the Web page of Vanderbilt University), and biological interpretation was based on literature survey. QRT-PCR Validation For real time PCR validation, 0.1 μg of small RNA derived from four NEC men and women and four AD men and women were quantified using the NCode miRNA First-Strand cDNA Synthesis and qRT-PCR kit (Invitrogen, USA). Mature DNA sense sequences (miRBase, Sanger Institute, Cambridge, U.K.) of tested miRNAs were used as forward PCR primers.5S rRNA served as reference gene, and was probed using an internal forward primer (CAGGGTCGGGCCTGGTTAGTACTTG).

For the miRNA let-7f, the qRT-PCR was performed using the TaqMan

MicroRNA Reverse Transcription kit, TaqMan MicroArray assay (hsa-let-7f, RT 382) and TaqMan Fast Universal PCR (No AmpErase UNG; Applied

Biosystems, USA) with 1 ng of small RNA. The TaqMan specific primer U24 small nucleolar RNA (RNU24, RT 1001 ) was used as reference gene.

Real time PCR reactions were performed on a 7500 Fast System Real Time PCR cycler (Applied Biosystems, USA), according to manufacturer's instructions. MicroRNA fold changes between diagnostic groups or genders were calculated by the delta Ct method.

EXAMPLE 1 MICRORNA EXPRESSION IN ALZHEIMER BMC Mean ages between the NEC (76 ± 6 years) and AD (78 ± 5 years) groups were not significantly different (p=0.26; Table A). Subjects in the AD group had fewer years of formal education (12.6 years as compared to 15 years for NEC, p=0.05) and scored significantly lower on the MMSE (23/30 as compared to 29/30 for NEC, p<0.0001 ). Approximately 1.6 μg small RNA was extracted from an average of 50 μg of total RNA from BMC, with no significant difference in yield between the two diagnostic groups (p=0.94; Table A). Equal amount of small RNA (0.7 μg) from each subject was 3' end-labeled with DIG and the miRNAs immunodetected on the human miRNA microarrays (MMChips) (Figure 1 ). There were 91 miRNAs detected in elderly BMC, although 28 of them exhibited weak hybridization intensities (Table B).

Table B. miRNA ex ression in elderl human blood mononuclear cells

The present AD study cohorts consisted of 16 NEC and 16 AD miRNA expression profiles from equal numbers of women and men. Data from women and men, analyzed together or separately by T-statistics using SAM software, are reported in Table 1. Only upregulated miRNA expression was found to be significantly altered in Alzheimer BMC. The following upregulated miRNAs were weakly detected: hsa-miR-18b; 155; 363; 371 ; 493-3p; 581 ; 594; 605. The relative increases in miRNA in Alzheimer BMC were modest, in the range of 1.1 to 1.6-fold. A false discovery rate (FDR) of 78% was obtained with both genders analyzed together, whereas FDR of 93% and 67% were obtained for women and men, respectively, when analyzed separately.

Table 1.

Decreasing the number of chips to eight individuals of same sex showed similar upregulated miRNAs at a 23% FDR. The discrepancies in FDR may have resulted, in part, from inter-individual variability and from the low resolution of densitometric measurements. A more sensitive detection method for miRNA using radioactive 5'-end labeling with T4 polynucleotide kinase was, however, highly biased in miRNA labeling: for a given sample, T4 kinase labeling resulted in a sharp reduction in the number of miRNAs detected as compared to template-independent 3'-end transferase labeling.

Significant microarray data analyzed by SAM (Table 1 ) was subsequently ranked by Kolmogorov-Smirnov statistics using the Gene Set Enrichment Analysis (GSEA) software [41]. The enrichments of the significant upregulated miRNA are shown for either the whole dataset (Figure 1A), or for women and men separately (Figures 1 B and 1 C). The full list of ranked miRNA tested is presented in Figure 5. Enriched miRNA upregulated in both AD men and women were miR-594, 34a, 155, and 181 b. Similarly, by SAM analysis, five miRNAs (miR-594, 181 b, 34a, 155, 620) of those tested were found to be elevated in AD in both genders (Table 1 , Figure 1A). The expression profiles varied considerably between genders, producing gender specific enrichments of miR-517^*, 605, and 493-3p in women and miR-34b, 371 and 489 in men (Figures 1 B and 1 C). Next, NEC and AD miRNA levels were stratified according to APOE4 status (Table 2). In these analyses, FDR varied between 30% to 46% for APOE4-negative women and men, respectively, and 95% FDR for the APOE4- positive cohorts. Similarly to the entire dataset (Table 1 ), common miRNA upregulated in AD specific to the APOE4-negative stratum (hsa-let-7f; miR-137; miR-200a; miR- 517^*) or APOE4-positive stratum (miR-181 b; miR-371 ; miR- 594; miR-620) were found.

Table 2.

Within the AD group, differences in miRNA levels could be detected between APOE4-negative and APOE4-positive subjects with FDR of 6% for the entire cohort, 3.5% for women and 95 % for men. For the AD group, there were also differences in miRNA levels between subjects exposed or not to acetylcholinesterase inhibitors, with FDR of 17% for the entire cohort and 10% for women (Table C). MiRNA miR-600 was detected at higher levels in Alzheimer APOE4 carriers but decreased in AD subjects receiving acetylcholinesterase inhibitors. Similarly, miR-182 was detected at higher levels in AD as compared to NEC (Table 1 ) and was decreased in AD subjects treated with acetyl cholinesterase inhibitor. Table C.

hsa-miR-600 0.8 -1 .8 0.6 -3.2 a. There were no significant differences between non- and carriers of the APOE4 allele within the NEC group.

EXAMPLE 2

GENDER DIFFERENCES AND HIERARCHICAL CLUSTERING Gender-specific analyses of the datasets yielded five common upregulated miRNA in AD (Figure 2A, Table 2). The FDRs were 38% for the entire cohort, 22% for NEC and 89% for AD. Women exhibited higher levels of several miRNA as compared to men in both the NEC and AD groups, with the exception of miR-551 a which was elevated in men (Table 3). More miRNA species were expressed in a gender-specific fashion in the AD group than in the NEC subjects (Figure 2B, Table 3), suggesting linkage of gender with the pathology. MiRNAs expressed at higher levels in women and upregulated in AD were: miR-34a, 34b, 137, 182, 513, 517^*, 579, 653.

Table 3.

Hierarchical clustering was next performed using Pearson correlations on the upregulated miRNA data reported in Table 1. For the whole dataset, diagnostic and gender subgroups did not produce any clear classification (Figure 1 C). Nevertheless, miRNAs with common expression, such as let-7f and miR-200a, clustered together. Near-perfect classification of diagnostic groups was obtained when datasets for women and men were analyzed separately (Figures 1 D and 1 E). Using the women-specific miRNA data, one AD subject clustered with NEC and two NEC clustered with AD (Figure 1 D). Good hierarchical clustering for men was obtained using the subgroup's significant miRNAs (Figure 1 E).

EXAMPLE 3 REAL TIME PCR VALIDATION Although the FDR in the female subgroup was higher, the success rate for the validation of miRNA by real time PCR was superior for this subgroup (Figure 3A). A 50% success rate was obtained for upregulated miRNA in women compared with only 12.5% in men. Nevertheless, the slight (1.1 -fold) increase and low score(d) for miR-608 in AD men was validated. On the other hand, miR-137 was over-expressed in AD men on the basis of real time PCR, but was specifically upregulated in AD women in the microarray analysis. Without wishing to be bound by any particular theory, this suggests that there is variation in miR expression among individuals, and that the delta Ct fold differences in real time PCR were not sufficiently "n" powered to reveal significant miRNAfold differences between groups. Moreover, two miRNAs that ranked at the bottom of the GSEA enrichment list (miR-92b and 431 ; Figure 5) and thus expressed at lower levels in AD vs. NEC were also validated. Only one miRNA (miR-155) was not validated by real time PCR. Delta Ct fold differences between genders were also determined within either the NEC or AD groups (Figure 3B). Of the four miRNAs reported in Table 2 (miR-34a, 34b, 137, 431 ) and tested by real time PCR, miR-34a, 137 and 431 were found to be higher in AD women. Taken together, the above microarray results for the factors, gender and diagnosis, were validated by more than 60%.

EXAMPLE 4

TARGET PREDICTIONS

Target predictions for the upregulated miRNA in AD BMC (Table 1 ) ascertained from the miRBase Targets website (Sanger Institute, Cambridge, U.K.) were compared with the downregulated mRNAs previously reported in AD BMC [23]. Approximately 43% of the downregulated mRNAs (372 out of 848) were found to be targets of at least one upregulated miRNA in the present Examples (Table C). Of the predicted hundreds of targets for any specific miRNA, a range of 20 to 50 known downregulated mRNAs were identified. The functional categories for these putative targets are summarized in Figure 4A. Interestingly, genes with multifunctional roles in the CNS represented the most extensively-targeted category. However, the highest number of unique miRNAs targeting the same coding gene corresponded to the categories Injury response/Redox homeostasis and DNA repair (Figure 4B).

DISCUSSION OF EXAMPLES 1 -4

Human BMC expressed a broad range of miRNAs, representing 20% of the 462 exemplary miRNA spotted on the microarray. Several common miRNA species observed were previously reported in lymphocytes [20]. MicroRNA mi R- 34a [27] and let-7 family [37], known for their abundant expression across organs and cell types, were also highly expressed in elderly BMC (current study). Likewise, miRNA expression common to neurons [8,15,26,37] and BMC were miR-27b, 34a, 34b, 125b, 181. Significant differences in BMC miRNA expression profiles between persons with mild sporadic AD and age-matched normal controls were observed (see, e.g. Table E). However, the upregulated miRNAs in Alzheimer BMC in the present Examples differed from those previously reported in human AD hippocampus. For example, the brain specific miR-137 [37], found to be increased in Alzheimer BMC (current Examples), was not over-represented in AD hippocampus.

The patterns of miRNA upregulation in Alzheimer BMC were found to be influenced by APOE status, and AD patients carrying one or two copies of the APOE4 allele exhibited additional upregulated miRNA species (Table C). In the AD group, upregulated BMC miRNAs for the APOE4-negative stratum were let- 7f, miR-137, miR-200a and mR-517*, whereas miR-181 b, miR-371 , miR-594 and miR-620 were over-expressed in the APOE4-positive stratum. Of note, AD patients treated with acetylcholinesterase inhibitors showed a relative reduction in miR-128 and miR-600, suggesting that the latter may be responsive to and inform on this pharmacological intervention.

Significant gender differences in BMC miRNA expression patterns were discerned in the present Examples, particularly among the AD subjects. Gender differences may reflect hormonal influences, as the expression of certain miRNA (e.g. miR-34 and let-7) has been shown to be hormonally-regulated [36]. Five miRNAs were documented that are expressed at higher levels in women than men independently of diagnosis, viz., miR-34a, miR-182, miR-192, miR-380-5p and mR-431. Moreover, substantial gender-specific miRNA signatures in AD were observed, with relative upregulation of miR-493-3p, miR- 517* and miR-605 in AD women, and over-expression of miR-34b, miR-371 and miR-489 in affected men.

Functional studies have determined that individual miRNAs can downregulate several mRNA species [19] and induce mRNA instability [39]. The results of the present Examples demonstrate miRNA induction in AD BMC can contribute to the suppression of multiple mRNA species and thereby impact a host of cellular mechanisms [22]. Further, concomitant induction of several miRNA species may act in an additive or synergistic manner to inhibit gene expression in AD BMC [16]. The 3' UTR context of target genes strongly influences the action of miRNA [7], and the present Examples provide insights leading to the identification of miRNA targets in human BMC. The downregulated mRNAs in Alzheimer BMC detected on the NIA cDNA microarray (-5000 genes) [23] were compared with computationally-predicted miRNA targets (Table D). A prevalence of putative genes in the functional categories of DNA repair and redox homeostasis were discerned. Without wishing to be bound by any particular theory of operation, this observation supports a model linking the development of AD pathology to systemic dysfunction in the cellular stress/antioxidant response and genomic maintenance [23]. These data are commensurate with reports of augmented oxidative DNA and RNA damage and deficient transcription and translation in AD brain and peripheral tissues [24,38]. The latter impairments may, in turn, contribute to the cytoskeletal abnormalities and neurofibrillary degeneration characteristic of AD-affected neural tissues [23]. Thus, and again without wishing to be bound by theory, certain hallmark neuropathological features of AD may represent remote downstream events of dysregulated miRNA processing. In this regard, it is interesting to note that, in Drosophila, a reduction in dicer activity promotes tau toxicity [4].

For the downregulated genes previously identified in Alzheimer BMC [23] and predicted from the exemplary upregulated miRNAs (present Examples), the enriched functional categories specified by gene ontology were: transcription (AD cohort), DNA repair and vesicle trafficking (AD women), lipid metabolism (AD men), DNA replication and protein transport (AD APOE-negative stratum) and glycogen metabolism (AD APOE-positive stratum). Interestingly among the AD patients, the APOE4 carriers exhibited downregulated targets enriched in the peroxisome category, whereas treatment with acetylcholinesterase inhibitors attenuated the repression of peroxisomal functions (i.e. miR-600 enriched target category). These data, suggest peroxisomal dysfunction as a potential therapeutic target of anticholinesterase intervention. MicroRNA expression profiles have shown greater accuracy in classifying cancers than have mRNA profiles [21]. Similarly, BMC miRNA signatures, as disclosed herein, can be effective in the classification of neurodegenerative diseases. Given the good hierarchical clustering observed in the present Examples using selected upregulated miRNAs in Alzheimer BMC, it can prove prognostically informative as to whether NEC or MCI (mild cognitive impairment) subjects clustering with AD are at increased risk for developing clinical or pathological manifestations of the disease. The present Examples provide the first evidence of augmented miRNA expression in AD BMC. Dysregulation of BMC miRNA in sporadic AD can shed new light on the pathogenesis of AD and provides useful diagnostic/prognostic biomarkers of this common affliction.

Table D.

Putative miRNA tar ets downre ulated in Alzheimer BMC

Ul

O

Ul

Ul K>

Ul

Ul

4-

Ul Ul

Ul

Ul

Ul

06

Table E - Exemplary Upregulated miRNA in AD

REFERENCES

[1] Ambros V. The functions of animal microRNAs. Nature 2004;431 (7006):350-5. [2] Babak T, Zhang W, Morris Q, Blencowe BJ, Hughes TR. Probing microRNAs with microarrays: tissue specificity and functional inference. Rna 2004;10(11 ):1813-9.

[3] Bilen J, Liu N, Bonini NM. A new role for microRNA pathways: modulation of degeneration induced by pathogenic human disease proteins. Cell Cycle 2006;5(24):2835-8. [4] Bilen J, Liu N, Burnett BG, Pittman RN, Bonini NM. MicroRNA pathways modulate polyglutamine-induced neurodegeneration. MoI Cell 2006;24(1 ):157-63.

[5] Boehm M, Slack F. A developmental timing microRNA and its target regulate life span in C. elegans. Science 2005;310(5756): 1954-7.

[6] Chertkow H, Bergman H, Schipper HM, Gauthier S, Bouchard R, Fontaine S, Clarfield AM. Assessment of suspected dementia. Canadian Journal of Neurological Sciences 2001 ;28 Suppl 1 :S28-41.

[7] Didiano D, Hobert O. Perfect seed pairing is not a generally reliable predictor for miRNA-target interactions. Nat Struct MoI Biol 2006;13(9):849-51.

[8] Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G. Numerous microRNPs in neuronal cells containing novel microRNAs. Rna 2003;9(2):180- 6.

[9] Eikelenboom P, Veerhuis R, Scheper W, Rozemuller AJ, van Gool WA, Hoozemans JJ. The significance of neuroinflammation in understanding Alzheimer's disease. J Neural Transm 2006;113(11 ):1685-95.

[10] Folstein MF, Folstein SE, McHugh PR. "Mini-mental state". A practical method for grading the cognitive state of patients for the clinician. J Psychiatr Res 1975;12(3):189-98. [11] Hammond SM. RNAi, microRNAs, and human disease. Cancer

Chemother Pharmacol 2006;58 Suppl 7:63-8.

[12] Jison ML, Munson PJ, Barb JJ, Suffredini AF, Talwar S, Logun C, Raghavachari N, Beigel JH, Shelhamer JH, Danner RL, Gladwin MT. Blood mononuclear cell gene expression profiles characterize the oxidant, hemolytic, and inflammatory stress of sickle cell disease. Blood 2004;104(1 ):270-80.

[13] Kamboh Ml. Molecular genetics of late-onset Alzheimer's disease. Ann Hum Genet 2004;68(Pt 4):381 -404.

[14] Keller JN. Interplay Between Oxidative Damage, Protein Synthesis, and Protein Degradation in Alzheimer's Disease. Journal of Biomedicine and Biotechnology 2006;Volume 2006:1 -3.

[15] Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G. Identification of many microRNAs that copuhfy with polyribosomes in mammalian neurons. Proc Natl Acad Sci U S A 2004;101 (1 ):360-5. [16] Krek A, Grun D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, MacMenamin P, da Piedade I, Gunsalus KC, Stoffel M, Rajewsky N. Combinatorial microRNA target predictions. Nat Genet 2005;37(5):495-500.

[17] Lacelle C, Riol H, Xu S, Tang YJ, Wang YS, Chuang YL, Lin HS, Chang MC, Liang J, Wang E. Blood-sample processing for the study of age- dependent gene expression in peripheral blood mononuclear cells. J Gerontol A Biol Sci Med Sci 2002;57(7):B285-7.

[18] Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993;75(5):843-54.

[19] Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS, Johnson JM. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 2005;433(7027):769-73. [20] Liu CG, CaNn GA, Meloon B, Gamliel N, Sevignani C, Ferracin M,

Dumitru CD, Shimizu M, Zupo S, Dono M, Alder H, Bullrich F, Negrini M, Croce CM. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc Natl Acad Sci U S A 2004;101 (26):9740-4.

[21] Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA, Downing JR, Jacks T, Horvitz HR, Golub TR. MicroRNA expression profiles classify human cancers. Nature 2005;435(7043):834-8.

[22] Lukiw WJ. Micro-RNA speciation in fetal, adult and Alzheimer's disease hippocampus. Neuroreport 2007;18(3):297-300. [23] Maes OC, Xu S, Yu B, Chertkow HM, Wang E, Schipper HM.

Transcriptional profiling of Alzheimer blood mononuclear cells by microarray. Neurobiol Aging 2006.

[24] Markesbery WR, Lovell MA. DNA oxidation in Alzheimer's disease. Antioxid Redox Signal 2006;8(11 -12):2039-45. [25] McKhann G, Drachman D, Folstein M, Katzman R, Price D, Stadlan

EM. Clinical diagnosis of Alzheimer's disease: report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer's Disease. Neurology 1984;34(7):939-44. [26] Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR. Microarray analysis of microRNA expression in the developing mammalian brain. Genome Biol 2004;5(9):R68.

[27] Monticelli S, Ansel KM, Xiao C, Socci ND, Krichevsky AM, Thai TH, Rajewsky N, Marks DS, Sander C, Rajewsky K, Rao A, Kosik KS. MicroRNA profiling of the murine hematopoietic system. Genome Biol 2005;6(8):R71.

[28] O'Connell RM, Taganov KD, Boldin MP, Cheng G, Baltimore D. MicroRNA-155 is induced during the macrophage inflammatory response. Proc Natl Acad Sci U S A 2007; 104(5): 1604-9. [29] Ouellet DL, Perron MP, Gobeil LA, Plante P, Provost P. MicroRNAs in Gene Regulation: When the Smallest Governs It All. J Biomed Biotechnol 2006;2006(4):69616.

[30] Park W, Li J, Song R, Messing J, Chen X. CARPEL FACTORY, a Dicer homolog, and HEN1 , a novel protein, act in microRNA metabolism in Arabidopsis thaliana. Curr Biol 2002;12(17):1484-95.

[31] Pasinetti GM. Use of cDNA Microarray in the Search for Molecular Markers Involved in the Onset of Alzheimer's Disease Dementia. Journal of Neuroscience Research 2001 ;65:471-6.

[32] Puchades M, Hansson SF, Nilsson CL, Andreasen N, Blennow K, Davidsson P. Proteomic studies of potential cerebrospinal fluid protein markers for Alzheimer's disease. Brain Res MoI Brain Res 2003;118(1 -2):140-6.

[33] Ruvkun G, Wightman B, Ha I. The 20 years it took to recognize the importance of tiny RNAs. Cell 2004;116(2 Suppl):S93-6, 2 p following S6.

[34] Scherzer CR, Offe K, Gearing M, Rees HD, Fang G, Heilman CJ, Schaller C, Bujo H, Levey Al, Lah JJ. Loss of apolipoprotein E receptor LR11 in Alzheimer disease. Arch Neurol 2004;61 (8):1200-5.

[35] Selkoe DJ. The molecular pathology of Alzheimer's disease. Neuron

1991 ;6(4):487-98. [36] Sempere LF, Dubrovsky EB, Dubrovskaya VA, Berger EM, Ambros V. The expression of the let-7 small regulatory RNA is controlled by ecdysone during metamorphosis in Drosophila melanogaster. Dev Biol 2002;244(1 ):170-9. [37] Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E, Ambros V. Expression profiling of mammalian microRNAs uncovers a subset of brainexpressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol 2004;5(3):R13. [38] Shan X, Lin CL. Quantification of oxidized RNAs in Alzheimer's disease. Neurobiol Aging 2006;27(5):657-62.

[39] Sood P, Krek A, Zavolan M, Macino G, Rajewsky N. Cell-type- specific signatures of microRNAs on target mRNA expression. Proc Natl Acad Sci U S A 2006;103(8):2746-51. [40] Strauss WM, Chen C, Lee CT, Ridzon D. Nonrestrictive developmental regulation of microRNA gene expression. Mamm Genome 2006;17(8):833-40.

[41] Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL,

Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 2005;102:15545-

50.

[42] Wang E, Lacelle C, Xu S, Zhao X, Hou M. Designer microarrays: from soup to nuts. J Gerontol A Biol Sci Med Sci 2002;57(11 ):B400-5. It will be understood that various details of the presently-disclosed subject matter can be changed without departing from the scope of the subject matter disclosed herein. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation.

Claims

CLAIMSWhat is claimed is:

1. A method for diagnosing Alzheimer's disease (AD) in a subject, comprising:

(a) providing a biological sample from a subject;

(b) determining an amount of one or more micro-RNAs (miRNAs) correlated with Alzheimer's disease in the biological sample, wherein the one or more miRNAs are selected from Tables 1 -4 and Table D; and

(c) comparing the amount of the one or more miRNAs to one or more miRNA control levels, wherein the subject is diagnosed as having, or having a potential to develop, Alzheimer's disease if there is a measurable difference in the amounts of the one or more miRNAs in the sample as compared to the one or more control levels.

2. The method of claim 1 , wherein the biological sample comprises blood.

3. The method of claim 2, wherein the biological sample comprises blood mononuclear cells.

4. The method of claim 1 , wherein the subject is human.

5. The method of claim 1 , wherein the one or more miRNAs are selected from the group consisting of miR-594, miR-181 b, miR-34a, miR-155, miR-620, miR-579, miR-605, miR-517^*, miR-137, let-7f, miR-569, miR- 493-3p, miR-34b, miR-581 , miR-371 , miR-489, miR-363, miR-513, miR- 431 , miR-200a, miR-182, miR-520h, miR-377, and miR-653.

6. The method of claim 1 , wherein determining the amount of the one or more miRNAs comprises labeling the one or more miRNAs.

7. The method of claim 1 , wherein determining the amount of the one or more miRNAs comprises capturing the one or more miRNAs with one or more polynucleotide probes that each selectively bind the one or more miRNAs.

8. The method of claim 7, wherein the polynucleotide probes selectively bind mature miRNAs.

9. The method of claim 1 , further comprising selecting a treatment or modifying a treatment for the Alzheimer's disease based on the amount of the one or more miRNAs determined.

10. A method for determining treatment efficacy and/or progression of Alzheimer's disease in a subject, comprising:

(a) providing a series of biological samples over a time period from a subject;

(b) analyzing the series of biological samples to determine an amount of one or more miRNAs correlated with Alzheimer's disease in each of the biological samples, wherein the one or more miRNAs are selected from Tables 1 -4 and Table D; and

(c) comparing any measurable change in the amounts of the one or more miRNAs in each of the biological samples to thereby determine treatment efficacy and/or progression of Alzheimer's disease in the subject.

11. The method of claim 10, wherein the biological sample comprises blood.

12. The method of claim 11 , wherein the biological sample comprises blood mononuclear cells.

13. The method of claim 10, wherein the subject is human.

14. The method of claim 10, wherein the one or more miRNAs are selected from the group consisting of miR-594, miR-181 b, miR-34a, miR-155, miR-620, miR-579, miR-605, miR-517^*, miR-137, let-7f, miR-569, miR- 493-3p, miR-34b, miR-581 , miR-371 , miR-489, miR-363, miR-513, miR- 431 , miR-200a, miR-182, miR-520h, miR-377, and miR-653.

15. The method of claim 10, wherein determining the amount of the one or more miRNAs comprises labeling the one or more miRNAs.

16. The method of claim 10, wherein determining the amount of the one or more miRNAs comprises capturing the one or more miRNAs with one or more polynucleotide probes that each selectively bind the one or more miRNAs.

17. The method of claim 16, wherein the polynucleotide probes selectively bind mature miRNAs.

18. The method of claim 10, wherein the series of biological samples comprises a first biological sample collected prior to initiation of treatment for the Alzheimer's disease and/or onset of the Alzheimer's disease and a second biological sample collected after initiation of the treatment or onset.

19. A kit for diagnosing Alzheimer's disease in a subject, the kit comprising a plurality of polynucleotide probes that each selectively bind a plurality of micro-RNAs (miRNAs) correlated with Alzheimer's disease, wherein the plurality of miRNAs are selected from Tables 1 -4 and Table D.

20. The kit of claim 19, wherein the plurality of polynucleotide probes selectively bind mature miRNAs.

21. The kit of claim 19, wherein the plurality of polynucleotide probes each selectively bind an miRNA selected from the group consisting of miR- 594, miR-181 b, miR-34a, miR-155, miR-620, miR-579, miR-605, miR- 517^*, miR-137, let-7f, miR-569, miR-493-3p, miR-34b, miR-581 , miR-

371 , miR-489, miR-363, miR-513, miR-431 , miR-200a, miR-182, miR- 52Oh, miR-377, and miR-653.

22. The kit of claim 19, comprising instructions for using the kit.

23. The kit of claim 19, wherein the subject is human.

24. The kit of claim 19, wherein the plurality of polynucleotide probes are each bound to a substrate.

25. The kit of claim 19, comprising:

(a) at least one randomly-generated sequence used as a negative control; (b) at least one oligonucleotide sequence derived from a housekeeping gene, used as a standardized control for total RNA degradation; (c) at least one randomly-generated sequence used as a positive control; and (d) a series of dilutions of at least one positive control sequence used as saturation controls, wherein at least one positive control sequence is positioned on the substrate to indicate orientation of the substrate.

26. A method for diagnosing amyloid β₄2 accumulation, or a risk thereof, within a subject, comprising:

(a) providing a biological sample from a subject;

(b) determining an amount of one or more micro-RNAs (miRNAs) correlated with amyloid β₄2 (Aβ) accumulation in the biological sample, wherein the one or more miRNAs are selected from miR- 517, miR-579, and miR-181 b; and

(c) comparing the amount of the one or more miRNAs to one or more miRNA control levels, wherein the subject is diagnosed as having, or at an increased risk of developing, Aβ accumulation if there is a measurable difference in the amounts of the one or more miRNAs in the sample as compared to the one or more control levels.

27. The method of claim 26, wherein the Aβ accumulates within the brain of the subject.

28. The method of claim 26, wherein the biological sample comprises blood.

29. The method of claim 28, wherein the biological sample comprises blood mononuclear cells.

30. The method of claim 26, wherein the subject is human.

31. The method of claim 26, wherein determining the amount of the one or more miRNAs comprises labeling the one or more miRNAs.

32. The method of claim 26, wherein determining the amount of the one or more miRNAs comprises capturing the one or more miRNAs with one or more polynucleotide probes that each selectively bind the one or more miRNAs.

33. The method of claim 32, wherein the polynucleotide probes selectively bind mature miRNAs.

34. A method for isolating micro-RNA (miRNA) from a biological sample for use in diagnosing Alzheimer's disease in a subject, comprising: (a) providing a biological sample from a subject, wherein the biological sample comprises blood mononuclear cells (BMC);

(b) isolating the BMC from the biological sample;

(c) lysing the isolated BMC; (d) extracting miRNA from the lysed BMC; and

(e) analyzing the miRNA to thereby diagnose Alzheimer's disease in the subject.

35. The method of claim 34, wherein the biological sample comprises blood.

36. The method of claim 34, wherein the subject is human.

37. The method of claim 34, wherein the miRNA comprises one or more miRNAs selected from Tables 1 -4 and Table D.

38. The method of claim 37, wherein the one or more miRNAs are selected from the group consisting of miR-594, miR-181 b, miR-34a, miR-155, miR-620, miR-579, miR-605, miR-51 T, miR-137, let-7f, miR-569, miR-

493-3p, miR-34b, miR-581 , miR-371 , miR-489, miR-363, miR-513, miR- 431 , miR-200a, miR-182, miR-520h, miR-377, and miR-653.

39. The method of claim 34, wherein analyzing the miRNA comprises:

(i) determining an amount of one or more miRNAs correlated with Alzheimer's disease in the biological sample; and

(ii) comparing the amount of the one or more miRNAs to one or more miRNA control levels, wherein the subject is diagnosed as having or potentially developing Alzheimer's disease if there is a measurable difference in the amounts of the one or more miRNAs in the sample as compared to the one or more control levels.

40. The method of claim 39, wherein determining the amount of the one or more miRNAs comprises capturing the one or more miRNAs with one or more polynucleotide probes that each selectively bind the one or more miRNAs.

41. The method of claim 40, wherein the polynucleotide probes selectively bind mature miRNAs.