WO2012034189A1 - Methods of using mirnas transcribed from the 14q32 region of human chromosome 14 as biomarkers for schizophrenia or symptoms thereof - Google Patents

Abstract

Provided herein are methods for detecting a risk profile for schizophrenia or a manifestation thereof or a sub-threshold phenotype or state thereof in a subject, comprising identifying a reduction or down regulation in expression of one or more miRNAs disclosed herein, or a molecule that regulates the expression of said miRNA, in blood from the subject wherein the reduction or down regulation of expression is indicative of a risk of the subject having or developing symptoms of schizophrenia. Also provided are methods of diagnosing schizophrenia based on the expression profiles of the miRNAs and miRNA regulatory molecules disclosed herein, and methods for treating schizophrenia by modulating the expression of said miRNAs and regulatory molecules.

Description

METHODS OF USING MIRNAS TRANSCRIBED FROM THE 14Q32 REGION OF HUMAN CHROMOSOME 14 AS BIOMARKERS FOR SCHIZOPHRENIA OR SYMPTOMS THEREOF

Field of the Invention

The present invention relates generally to biomarkers of schizophrenia and predisposition or susceptibility to schizophrenia, and to diagnostic and prognostic protocols for schizophrenia and its manifestations including sub-threshold phenotypes and states thereof. Profiling and stratifying individuals for schizophrenia and its various manifestations also form part of the present invention as well as monitoring and predicting efficacy of therapeutic, psychiatric, social or environmental intervention. The present invention further, contemplates methods of treatment of schizophrenia and symptoms thereof.

Background

Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country.

Psychological "disorders" are endemic in many societies. Reference to "disorders" in this context means that an individual exhibits behavioural patterns which are inconsistent with societal norms. Most psychological phenotypes have both environmental and genetic risk factors and bases. Early detection of disorders using genetic technology has considerable potential to identify those at risk prior to the development of this chronic condition. Commencement of a low dose antipsychotic regime and early cognitive behavioral therapy, for example, may prevent the emergence of more debilitating symptoms. Development of the full disorder is associated with significant impairment of social, cognitive and occupational functioning.

Schizophrenia is a particularly complex psychological phenotype characterized by a diverse range and spectrum of symptoms and neurocognitive impairments. Schizophrenia is a common, chronic, disabling illness affecting nearly 1 in 100 people. Additionally, "unaffected" first degree relatives show both child and adult deficits in cognitive functioning. Further evidence of deficits in cognitive functioning and anatomical abnormalities in siblings of those with schizophrenia suggest that the underlying pathophysiological state of schizophrenia is considerably more widespread in the general population than prevalence figures for schizophrenia would suggest and that a considerable genetic vulnerability for this disorder exists.

While its exact pathogenesis remains obscure, there is a broad consensus that schizophrenia is of neurodevelopmental origin, arising through the complex interplay of numerous genetic and environmental factors. While there are several gross neuroanatomical and histological features are associated with schizophrenia, none are consistent enough to be considered diagnostic. This scarcity of tangible pathology means that a diagnosis generally requires the persistent or episodic presence over 1-6 months of several symptoms to exclude alternative diagnoses such as mood disorder, transient psychosis and substance abuse. As early intervention in schizophrenia is crucial in improving disease outcome and long-term management, this delay in diagnosis has a negative prognostic impact.

Alternative biological markers are needed to accelerate and improve the accuracy of diagnosis, provide information by which to fine tune treatment according to individual needs and possibly even predict vulnerability, especially of at-risk individuals, to prevent the development of chronic schizophrenia. However hampering efforts to develop simple biochemical diagnostic tests are hampered by the genetic heterogeneity of the disorder. Some insight into molecular interactions contributing to schizophrenia has been provided by high throughput gene expression analyses of post-mortem brain tissues. These investigations have shown consistently that the activity of a large number of genes are affected in schizophrenia. While some of these changes reflect alterations in known candidate genes and their downstream influences, most are inexplicable and their origins may lie well beyond the reach of these well known mechanisms. Despite the perplexing array of findings, there are patterns in schizophrenia-associated gene expression indicative of systematic regulatory dysfunction. Where these coincide with functional pathways, for example, in neurotransmitter systems and neural development, they support plausible hypotheses that correspond with a limited understanding of schizophrenia pathophysiology. Efforts to understand the underlying mechanisms driving these changes in gene expression have focused predominantly on genetic and epigenetic influences on transcription, mediated by alterations in signal transduction pathways, their transcription factors, or gene promoter elements and associated chromatin structure.

There is a need to identify genetic factors predictive or a state of, or risk of developing, schizophrenia or its manifestations including sub-threshold phenotypes and states. Such genetic factors further provide targets for therapeutic intervention.

The present inventors have previously reported changes in cortical microRNA (miRNA) biogenesis and expression in schizophrenia patients (Beveridge et ai, 2010). Co-pending US patent application no. 12/564848, also by a present inventor, describes diagnostic targets in the form of expression of the DGCR8 gene, homologs thereof and associated genetic molecules such as miRNAs which, when elevated in brain tissue, are instructive as to the presence of schizophrenia or a predisposition thereto.

Now described herein is the first identification of miRNA species the expression of which is downregulated in peripheral blood mononuclear cells (PBMCs) from schizophrenic patients, thereby providing valuable blood-based biomarkers for schizophrenia.

Summary of the Invention

The present invention identifies a pathophysiological link between genetic indicators in the post-transcriptional environment in blood and the manifestations of schizophrenia. The term "schizophrenia" as used herein is to be considered as an individual condition as well as a spectrum of conditions including sub-threshold phenotypes and states thereof. In particular, the present invention provides diagnostic markers in the form of miRNAs which, when reduced or downregulated in expression in the blood, are instructive as to the presence of schizophrenia or a predisposition thereto. In a further embodiment, the post- transcriptional environment results in down stream gene expression modifications. Such affected genes also are considered diagnostic and prognostic targets of schizophrenia. The genetic indicators further provide therapeutic targets for the development of medicaments in the treatment of schizophrenia and its symptoms. The early detection of schizophrenia and its related or associated conditions enables therapeutic, psychological, social and/or environment intervention at a point which more readily facilitates control over the disease condition.

The genetic indicators disclosed herein are also useful in monitoring therapeutic protocols and for profiling or stratifying individuals or family members for schizophrenia. The genetic indicators are also therapeutic targets for medicaments which modulate expression of the global or individual miRNA environment or genes affected thereby.

Hence, in a first aspect the present invention provides a method for detecting a risk profile for schizophrenia or a manifestation thereof or a sub-threshold phenotype or state thereof in a subject, the method comprising identifying a reduction or downregulation in expression of one or more miRNAs listed in Table 4 or their families in blood from the subject wherein the reduction or downregulation of expression is indicative of a risk of having or developing symptoms of schizophrenia.

In an embodiment, a blood sample is obtained from the subject and determination of expression of the miRNA is made in the sample. The determination of expression may be made in whole blood, blood lymphocytes, blood plasma or blood serum. Typically the determination of expression may be made in peripheral blood mononuclear cells (PBMCs). The identification of miRNA expression in the blood will typically take place ex vivo, but the present invention also contemplates in vivo testing.

Typically the level of expression of the miRNA is determined relative to normal endogenous levels of the miRNA in question.

In an embodiment, the miRNAs are transcribed from the 14q32 region on human chromosome 14. In a further embodiment, the miRNAs are transcribed from 14q32.2 or 14q32.31. In particular embodiments the miRNAs are selected from hsa-miR-31 , hsa-miR-431 , hsa- miR-433, hsa-miR-107, hsa-miR-134, hsa-miR-128, hsa-miR-181b, hsa-miR-99b, hsa- miR-487b, hsa-miR-329, hsa-miR-409-3p, hsa-miR-432, hsa-miR-544, hsa-miR-342-5p, hsa-miR-654-5p, hsa-miR-485-3p, hsa-miR-370, hsa-miR-127-3p, hsa-miR-323-3p and hsa-miR-410.

Identifying a "risk profile" for schizophrenia includes identifying schizophrenia or its symptoms, as well as identifying susceptibility or predisposition to schizophrenia in a subject.

A further aspect of the invention provides a method for detecting a risk profile for schizophrenia or a manifestation thereof or a sub-threshold phenotype or state thereof in a subject, the method comprising identifying a reduction or downregulation in expression of one or more molecules that regulate the expression of one or more miRNAs listed in Table 4 or their families, in blood from the subject, wherein the reduction or downregulation of expression is indicative of a risk of having or developing symptoms of schizophrenia.

In an embodiment, the molecule regulates the transcription of one or more of the miRNAs. In a particular embodiment the molecule regulates the transcription of one or more miRNAs transcribed from the 14q32 region on human chromosome 14. For example, the molecule may be MEF2, optionally MEF2 isoform D.

In an embodiment, the molecule post-transcriptionally regulates the expression of one or more of the miRNAs. In a particular embodiment the molecule post-transcriptionally regulates the expression of one or more miRNAs transcribed from the 14q32 region on human chromosome 14. For example, the molecule may be EIF2C2 (Ago2).

A further aspect of the invention provides a method for stratifying subjects for schizophrenia, the method comprising determining levels of expression of one or more miRNAs listed in Table 4 or their families in blood, wherein a reduction or downregulation of expression places a subject in a group for schizophrenia or at risk of developing schizophrenia. In an embodiment, the miRNAs are transcribed from the 14q32 region on human chromosome 14. In a further embodiment, the miRNAs are transcribed from 14q32.2 or 14q32.31.

In particular embodiments the miRNAs are selected from hsa-miR-31, hsa-miR-431 , hsa- miR-433, hsa-miR-107, hsa-miR- 134, hsa-miR-128, hsa-miR-181b, hsa-miR-99b, hsa- miR-487b, hsa-miR-329, hsa-miR-409-3p, hsa-miR-432, hsa-miR-544, hsa-miR-342-5p, hsa-miR-654-5p, hsa-miR-485-3p, hsa-miR-370, hsa-miR-127-3p, hsa-miR-323-3p and hsa-miR-410.

A further aspect of the invention provides a method for diagnosing schizophrenia, a manifestation thereof or a sub-threshold phenotype or state thereof, or determining predisposition or susceptibility to developing schizophrenia or symptoms thereof, the method comprising obtaining a blood sample from the subject and detecting the level of expression of one or more miRNAs listed in Table 4 or their families, wherein a reduction or downregulation of expression is indicative of ^"the subject having or at risk of developing schizophrenia or symptoms thereof.

In an embodiment, the miRNAs are transcribed from the 14q32 region on human chromosome 14. In a further embodiment, the miRNAs are transcribed from 14q32.2 or 14q32.31.

In particular embodiments the miRNAs are selected from hsa-miR-31 , hsa-miR-431 , hsa- miR-433, hsa-miR-107, hsa-miR-134, hsa-miR-128, hsa-miR-181b, hsa-miR-99b, hsa- miR-487b, hsa-miR-329, hsa-miR-409-3p, hsa-miR-432, hsa-miR-544, hsa-miR-342-5p, hsa-miR-654-5p, hsa-miR-485-3p, hsa-miR-370, hsa-miR-127-3p, hsa-miR-323 -3p and hsa-miR-410.

The present invention further contemplates the use of miRNAs disclosed herein in the manufacture of a diagnostic or prognostic assay for schizophrenia or a manifestation thereof or a sub-threshold phenotype or state thereof, wherein the assay is to be performed on a blood sample from a subject.

Methods for monitoring the therapeutic, psychological, social and environmental intervention of subjects diagnosed and/or suspected of having schizophrenia also form part of the present invention.

The present invention further provides diagnostic and prognostic kits for schizophrenia or manifestations thereof or sub-threshold phenotypes or states thereof. Such kits may be supplied generally or limited to health care providers.

Another aspect of the present invention provides a method for the treatment or prophylaxis of schizophrenia or manifestations thereof in a subject, the method comprising administering an effective amount of one or more miKNAs listed in Table 4 or their families, or an agent capable of upregulating or elevating the level or activity of one or more miR As listed in Table 4.

In an embodiment, the miRNAs are transcribed from the 14q32 region on human chromosome 14. In a further embodiment, the miRNAs are transcribed from 14q32.2 or 14q32.31.

In particular embodiments the miRNAs are selected from hsa-miR-31 , hsa-miR-431, hsa- miR-433, hsa-miR-107, hsa-miR-134, hsa-miR-128, hsa-miR-181b, hsa-miR-99b, hsa- miR-487b, hsa-miR-329, hsa-miR-409-3p, hsa-miR-432, hsa-miR-544, hsa-miR-342-5p, hsa-miR-654-5p, hsa-miR-485-3p, hsa-miR-370, hsa-miR-127-3p, hsa-miR-323-3p and hsa-miR-410.

The present invention further provides a use of one or more miRNAs listed in Table 4 or their families, or an agent capable of upregulating or elevating the level or activity of one or more miRNAs listed in Table 4 in the manufacture of a medicament in the amelioration of symptoms of schizophrenia. In an embodiment, the miRNAs are transcribed from the 14q32 region on human chromosome 14. In a further embodiment, the miRNAs are transcribed from 14q32.2 or 14q32.31.

In particular embodiments the miRNAs are selected from hsa-miR-31 , hsa-miR-431 , hsa- miR-433, hsa-miR-107, hsa-miR-134, hsa-miR-128, hsa-miR-181b, hsa-miR-99b, hsa- miR-487b, hsa-miR-329, hsa-miR-409-3p, hsa-miR-432, hsa-miR-544, hsa-miR-342-5p, hsa-miR-654-5p, hsa-miR-485-3p, hsa-miR-370, hsa-miR-127-3p, hsa-miR-323-3p and hsa-miR-410.

Methods of treating schizophrenia and its phenotypes also form part of the present invention.

Brief Description of the Drawings

Aspects and embodiments of the invention are described herein, by way of non-limiting example only, with reference to the following drawings.

Figure 1. Schizophrenia associated miRNA expression in PBMCs. (A). SAM Plot of differentially expressed miRNA in PBMCs from patients with schizophrenia (n=1 12) compared to non-psychiatric controls (n=76). The central solid blue line indicates equal expression and the upper and lower dashed black lines indicate significantly altered expression of 33 miRNA, all downregulated in schizophrenia relative to controls (Δ = 0.72, false discovery rate (FDR) of 0%). At a FDR of 5%, this number extends to 83 significantly downregulated miRNA. (B) qPCR validation by RT-PCR of downregulated miRNA significantly differentially expressed by miRNA array. The expression of miR-31, miR-431, miR-433, miR-107, miR-134, miR-99b and miR-487 is significantly downregulated in the PBMCs of patients with schizophrenia compared to non-psychiatric controls. Bars indicate mean fold change +SEM of 91 samples (57 schizophrenia cases and 34 non-psychiatric controls). The control cohort is set at 1. * p<0.05; ** p<0.01 ; *** pO.001 by Mann- Whitney U test.

Figure 2. Heatmap showing hierarchical clustering of significantly downregulated miRNA with diagnosis. Samples are colour coded according to diagnosis (Blue= CTRL, Yellow= SZ). Green indicates low expression and red indicates high expression (Java Treeview).

Figure 3. Genomic organisation of 14q32 miRNA clusters neighbouring the DLK1-GTL2 imprinted domain. The paternal (pat) and maternal (mat) chromosomes are shown. DLK1 , RTL1 and DI03 (filled rectangles) are paternally expressed genes and the m represents methylation at the differentially methylated region. A large non-coding transcript is produced from the maternal allele. miRNA genes are shown by vertical lines. The 14q32 miRNA cluster is actually two distinct segments: a small group at 14q32.2 (~10 miRNA) and a larger group at 14q32.31 (-38 miRNA) each spanning about 40kB and approximately 1 lOkB apart separated by a C/D snoRNA cluster.

Figure 4. MEF2D expression in PBMCs. MEF2D expression in PBMCs was 2.01-fold downregulated in the schizophrenia samples t=2.45 df=35.7, p=0.008 (1 -tailed) unequal variance.

Figure 5. Ago2 expression in PBMCs. EIF2C2 (Ago2) expression in PBMCs was 1.41- fold downregulated in the schizophrenia samples t=2.24, df=50.0, p=0.014 (1-tailed) unequal variance.

Nucleotide sequences are referred to by a sequence identifier number (SEQ ID NO). The SEQ ID NOs correspond numerically to the sequence identifiers <400>1 (SEQ ID NO: l), <400>2 (SEQ ID NO:2), etc. A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided after the claims.

Table 1: Summary of Sequence Identifiers

SEQ ID NO. DESCRIPTION

1 hsa-miR-31

2 hsa-miR-431

3 hsa-miR-433

4 hsa-miR-107

^■ ■ 5 hsa-miR-134 SEQ ID NO. DESCRIPTION

6 hsa-miR-128

7 hsa-miR-181b

8 hsa-miR-99b

9 hsa-miR-487b

10 hsa-miR-329

11 hsa-miR-409-3p

12 hsa-miR-432

13 hsa-miR-544

14 hsa-miR-342-5p

15 hsa-miR-654-5p

16 hsa-miR-485-3p

17 hsa-miR-370

18 hsa-miR-127-3p

1 hsa-miR-323-3p

20 hsa-miR-410

21-38 Oligonucleotide primer sequences as depicted in

Table 3 below

Detailed Description

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

The singular forms "a", "an", and "the" include single and plural aspects unless the context clearly indicates otherwise. Thus, for example, reference to "a miRNA" includes a single miRNA, as well as two or more miRNAs; reference to "an association" includes a single association or multiple associations; reference to "the invention" includes single or multiple aspects of an invention; and so forth. As described and exemplified herein the present inventors examined miRNA expression in peripheral blood mononuclear cells (PBMCs) derived from a large cohort of schizophrenia patients and non-psychiatric controls, and identified a significant schizophrenia-associated reduction in 83 miRNA. Remarkably, a large proportion of this expression signature was derived from a cluster of miRNA residing in a single imprinted domain on 14q32.

MiRNA are highly stable and due to their regulatory function are considered more informative and prognostic than gene expression. In the field of cancer biology, miRNA profiling of tissues and body fluids has been informative in a variety of cancer types including chronic lymphocytic leukaemia, lung, prostate, bladder and breast cancer. Furthermore, relevant to schizophrenia, miRNA profiling of whole blood in multiple sclerosis has revealed expression signatures associated with the disease and remission status. Similarly miRNA analysis in Alzheimer's disease revealed significant patterns of altered expression in PBMCs as well as cerebrospinal fluid and brain (Schipper et al., 2007; Cogswell et al., 2008). PBMCs in particular represent an attractive alternative tissue for profiling active disease in living patients at statistically robust numbers. This accessible tissue can reflect global disease-associated changes in an underlying genetic disorder and can form the basis for simple, rapid and cheap diagnostic tests.

The change in miRNA expression profile described herein has implications for the development and ongoing pathophysiology of schizophrenia as each miRNA has the capacity to regulate the expression of multiple target genes. In accordance with the present invention, an association between an alteration in levels of miRNAs such as those listed in Table 4 or their families or genes or other genetic factors and schizophrenia is identified. Examples of these miRNA include hsa-miR-31, hsa-miR-431 , hsa-miR-433, hsa-miR-107, hsa-miR-134, hsa-miR-99b and hsa-miR-487b. Similarly, an association between the expression of miRNA transcribed from region 14q32 of human chromosome 14, in particular 14q32.2 and 14q32.31 , and schizophrenia is identified. Some of the miRNA in this region could be processed from a single large polycistron such as Mirg (miRNA containing gene) although it is likely that the majority of miRNA in this cluster are encoded by tandem arrays of related intronic sequences. There is an influence of a decrease in global miRNA expression from this chromosomal locus on schizophrenia and hence, the present invention extends to global levels of miRNA transcribed from 14q32 as well as genes regulated by these miRNA, as diagnostic and prognostic markers of schizophrenia. Moreover, an association between the expression of two regulatory molecules that transcriptionally (MEF2) or post-transcriptionally (Ago2) regulate the expression of the miRNA transcribed from region 14q32 of human chromosome 14, in particular 14q32.2 and 14q32.31, and schizophrenia is identified.

Hence, the present invention contemplates methods for detecting a risk profile for schizophrenia or a manifestation thereof or a sub-threshold phenotype or state thereof, comprising identifying a reduction or downregulation in expression of one or more miRNAs listed in Table 4 or their families, or a reduction or downregulation in expression of molecules that regulate the expression of said miRNAs, in a blood sample from a subject, wherein the reduction or downregulation of expression is indicative of a risk of the subject having or developing symptoms of schizophrenia. Typically the level of expression of the miRNA or regulatory molecule is determined relative to normal endogenous levels of the miRNA or regulatory molecule in question.

The blood sample may comprise whole blood, blood lymphocytes, blood plasma or blood serum. Typically the blood sample comprises peripheral blood mononuclear cells (PBMCs). The identification of miRNA expression in the blood sample will typically take place ex vivo, but the present invention also contemplates in vivo testing.

In one embodiment, the miRNA is selected from those transcribed from 14q32, such as from I4q32.2 or 14q32.31, for example those miRNA identified within Table 4. In another embodiment, the. miRNA is selected from hsa-miR-31, hsa-miR-431, hsa-miR-433, hsa- miR-107, hsa-miR-134, hsa-miR-128, hsa-miR-181b, hsa-miR-99b, hsa-miR-487b, hsa- miR-329, hsa-miR-409-3p, hsa-miR-432, hsa-miR-544, hsa-miR-342-5p, hsa-miR-654-5p, hsa-miR-485-3p, hsa-miR-370, hsa-miR-127-3p, hsa-miR-323-3p and hsa-miR-410.

In an embodiment, the molecule regulates the transcription of one or more of the miRNAs, in particular the transcription of one or more miRNAs transcribed from the 14q32 region on human chromosome 14. For example, the molecule may be MEF2, optionally MEF2 isoform D. In another embodiment, the molecule post-transcriptionally regulates the expression of one or more of the miRNAs, in particular of one or more miRNAs transcribed from the 14q32 region on human chromosome 14. For example, the molecule may be EIF2C2 (Ago2).

Without wishing to be bound by theory, the inventors suggest that the changes in expression of miRNA at the 14q32 locus may result from epigenetic modification of a differentially methylated region at this locus.

Reference to "schizophrenia" includes a condition generally described as schizophrenia or a condition having symptoms related thereto. Schizophrenia can be considered a disease with a spectrum of manifestations with various threshold levels. Symptoms of schizophrenia may appear in a range of related disorders including classical schizophrenia as well as addiction, dementia, anxiety disorders, bipolar disorder, Tourette's syndrome, obsessive compulsive disorder (OCD), panic disorder, PTSD, phobias, acute stress disorder, adjustment disorder, agoraphobia without history of panic disorder, alcohol dependence (alcoholism), amphetamine dependence, brief psychotic disorder, cannabis dependence, cocaine dependence, cyclothymic disorder, delirium, delusional disorder, dysthymic disorder, generalized anxiety disorder, hallucinogen dependence, major depressive disorder, nicotine dependence, opioid dependence, paranoid personality disorder, Parkinson's disease, schizoaffective disorder, schizoid personality disorder, schizophreniform disorder, schizotypal personality disorder, sedative dependence, shared psychotic disorder, smoking dependence and social phobia.

Reference herein to "schizophrenia" includes, therefore, conditions which have symptoms similar to schizophrenia and hence are regard as schizophrenia-related conditions. Such symptoms of schizophrenia include behavioural and physiological conditions. A related condition may also have a common underlying genetic cause or association and/or a common treatment rationale. Due to the composition of schizophrenia and related conditions, the ability to identify a genetic profile or set of genetic risk factors to assist in defining schizophrenia is of significant importance. The present invention now provides this genetic profile generally within the post-transcriptional cellular environment. Furthermore, identification of potential genetic profiles may include a predisposition to developing schizophrenia or a related neurological, psychiatric or psychological condition.

A "neurological, psychiatric or psychological condition, phenotype or state" may be an adverse condition or may represent "normal" behaviour. The latter constitutes behaviour consistent with societal "norms".

Identifying a "risk profile" for schizophrenia includes identifying schizophrenia or its symptoms, as well as identifying susceptibility or predisposition' to schizophrenia in a subject.

Reference to "normal endogenous levels" of an miRNA in one context should be understood as a reference to the normal levels of expression and/or activity of the miRNA, either in a particular cell type, tissue, individual or group of individuals. At the individual level, for example, it will be appreciated by those skilled in the art that this "normal endogenous level" is likely to correspond to a range of levels, as opposed to a singularly uniform discrete level, due to differences between cohorts of individuals. By "cohort" is meant a cohort characterised by one or more features which are also characteristic of the subject who is undergoing treatment. These features include, but are not limited to, age, gender or ethnicity, for example. Accordingly, reference herein to reduced or downregulated miRNA levels relative to normal endogenous levels is a reference to decreased miRNA levels relative to either a discrete level which may have been determined for healthy of the individual, cells of normal individuals who are representative of the same cohort as the individual being treated, or relative to a defined range which corresponds to that expressed by a population of individuals corresponding to those from a range of different cohorts. It will also be appreciated that in the context of the diagnosis or prognosis of schizophrenia and the determination of predisposition or susceptibility thereto, reference to "normal endogenous levels" will normally be understood as a reference to the level of a given miRNA or group of miRNAs in individuals known not to suffer from schizophrenia, or known not to have a predisposition or susceptibility thereto, but is not limited to this context. Reference to "susceptibility" should be understood as a reference to both determining whether any existing symptoms associated with or indicative of schizophrenia experienced by an individual are linked to abnormal miRNA levels as described herein and to determining whether individuals who have not experienced symptoms indicative of schizophrenia nevertheless exhibit a predisposition or risk thereto. Thus, depending on the particular circumstances of a particular subject, the term "susceptibility" should be understood to mean vulnerability to schizophrenia or having an increased likelihood of development of schizophrenia in the future.

The term "subject" as used herein refers to mammals and includes humans, primates, livestock animals (eg. sheep, pigs, cattle, horses, donkeys), laboratory test animals (eg. mice, rabbits, rats, guinea pigs), companion animals (eg. dogs, cats) and captive wild animals (eg. foxes, kangaroos, deer). Typically, the mammal is human or a laboratory test animal. Even more typically, the mammal is a human which may be considered an individual, patient, host, recipient or target.

The present invention enables, therefore, a stratification of subjects based on a genetic profile. The genetic profile includes expression levels of one or more of the miRNA listed in Table 4 or their families. The stratification or profiling enables early diagnosis, conformation of a clinical diagnosis, treatment monitoring and treatment selection for a neurological, psychiatric or psychological conditions phenotype or state.

Another aspect of the present invention contemplates a method for stratifying subjects for schizophrenia, said method comprising determining levels of expression one or more of the miRNA listed in Table 4 or their families wherein a reduction or downregulation in expression places a subject in a group of schizophrenia or at risk schizophrenia subjects.

Yet another aspect of the present invention is directed to the use one or more of the miRNA listed in Table 4 or their families in the manufacture of a diagnostic or prognostic assay for schizophrenia or a manifestation thereof or a sub-threshold phenotype or state thereof. As described herein, a clustering of downregulated miRNA was identified wherein a significant proportion of the miRNA identified as being downregulated are transcribed from a single locus on 14q32, more particulary at 14q32.2 and 14q32.31. Thus, particular embodiments of the invention relate to the use of these miRNA as identified herein within Table 4 is the diagnostic and prognostic assays, tests and kits contemplated.

There are many methods which may be used to detect miRNA expression, including determining presence via sequence identification. Direct nucleotide sequencing, either manual sequencing or automated fluorescent sequencing can detect the presence of a particular mRNA species

A rapid preliminary analysis to nucleic acid species can be performed by looking at a series of Southern or Northern blots. Each blot may contain a series of "normal" individuals and a series of individuals having schizophrenia or a related neurological, psychiatric or psychological condition, phenotype or state.

Techniques for detecting nucleic acid species include PCR or other amplification technique

Nucleic acid analysis via microchip technology is also applicable to the present invention. In this technique, thousands of distinct oligonucleotide probes are built up in an array on a silicon chip. Nucleic acids to be analyzed are fluorescently labeled and hybridized to the probes on the chip. It is also possible to study nucleic acid-protein interactions using these nucleic acid microchips. Using this technique, one can determine the presence of specific nucleic acid species or even the level of a specific nucleic acid species. The method is one of parallel processing of many, including thousands, of probes at once and can tremendously increase the rate of analysis.

Hence, alteration of miRNA expression from a genetic loci can be detected by any techniques known in the art. These include Northern blot analysis, PCR amplification and RNase protection. An increase or decrease in miRNA expression indicates an alteration of an affected gene. Alteration of miRNA-regulated gene expression can also be detected by screening for alteration of expression product such as a protein. For example, monoclonal antibodies immunoreactive with a target protein can be used to screen a tissue. Immunological assays can be done in any convenient formats known in the art. These include Western blots, immunohistochemical assays and ELISA assays. Any means for detecting an altered protein can be used to detect alteration of the wild-type protein. Functional assays, such as protein binding determinations, can also be used.

Amplification-based assays are particularly useful for the detection of altered miRNA expression. As used herein, the phrase "amplifying" refers to increasing the content of a specific genetic region of interest within a sample. The amplification of the genetic region of interest may be performed using any method of amplification known to those of skill in the relevant art. In one embodiment, the method for detecting an miRNA species utilizes PCR as the amplification step.

PCR amplification utilizes primers to amplify a genetic region of interest. Reference herein to a "primer" is not to be taken as any limitation to structure, size or function. Reference to primers herein, includes reference to a sequence of deoxyribonucleotides comprising at least three nucleotides. Generally, the primers comprises from about three to about 100 nucleotides, preferably from about five to about 50 nucleotides and even more preferably from about 10 to about 25 nucleotides such as 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 nucleotides. The primers of the present invention may be synthetically produced by, for example, the stepwise addition of nucleotides or may be fragments, parts or portions or extension products of other nucleic acid molecules.

In an embodiment, one of the at least two primers is involved in an amplification reaction to amplify a target sequence. If this primer is also labelled with a reporter molecule, the amplification reaction will result in the incorporation of any of the label into the amplified product. The terms "amplification product" and "amplicon" may be used interchangeably. The primers and the amplicons of the present invention may also be modified in a manner which provides either a detectable signal or aids in the purification of the amplified product.

A range of labels providing a detectable signal may be employed. The label may be associated with a primer or amplicon or it may be attached to an intermediate which subsequently binds to the primer or amplicon. The label may be selected from a group including a chromogen, a catalyst, an enzyme, a fluorophore, a luminescent molecule, a chemiluminescent molecule, a lanthanide ion such as Europium (Eu³⁴), a radioisotope and a direct visual label. In the case of a direct visual label, use may be made of a colloidal metallic or non-metallic particular, a dye particle, an enzyme or a substrate, an organic polymer, a latex particle, a liposome, or other vesicle containing a signal producing substance and the like. A large number of enzymes suitable for use as labels is disclosed in U.S. Patent Nos. 4,366,241, 4,843,000 and 4,849,338. Suitable enzyme labels useful in the present invention include alkaline phosphatase, horseradish peroxidase, luciferase, β- galactosidase, glucose oxidase, lysozyme, malate dehydrogenase and the like. The enzyme label may be used alone or in combination with a second enzyme which is in solution. Alternatively, a fluorophore which may be used as a suitable label in accordance with the present invention includes, but is not limited to, fluorescein-isothiocyanate (FITC), and the fluorochrome is selected from FITC, cyanine-2, Cyanine-3, Cyanine-3.5, Cyanine-5, Cyanine-7, fluorescein, Texas red, rhodamine, lissamine and phycoerythrin. Examples of suitable fluorphores are well known to those skilled in the art.

In order to aid in the purification of an amplicon, the primers or amplicons may additionally be incorporated on a bead. The beads used in the methods of the present invention may either be magnetic beads or beads coated with streptavidin.

The extension of the hybridized primer to produce an extension product is included herein by the term amplification. Amplification generally occurs in cycles of denaturation followed by primer hybridization and extension. The present invention encompasses form about one cycle to about 120 cycles, preferably from about two to about 70 cycles, more preferably from about five to about 40 cycles, including 10, 15, 20, 25 and 30 cycles, and even more preferably, 35 cycles such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 1 1 1 , 1 12, 1 13, 1 14, 1 15, 116, 117, 118, 1 19, 120 cycles.

In order for the primers used in the methods of the present invention to anneal to a nucleic acid molecule containing the gene of interest, a suitable annealing temperature must be determined. Determination of an annealing temperature is based primarily on the genetic make-up of the primer, i.e. the number of A, T, C and Gs, and the length of the primer. Annealing temperatures contemplated by the methods of the present invention are from about 40°C to about 80°C, preferably from about 50°C to about 70°C, and more preferably about 65°C such as 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 or 80°C.

The PCR amplifications performed in the methods of the present invention include the use of MgCl₂ in the optimization of the PCR amplification conditions. The present invention encompasses MgCl₂ concentrations for about 0.1 to about 10 mM, preferably from 0.5 to about 5 mM, and even more preferably 2.5 mM such as 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5^* or 10 mM.

In one embodiment, results of nucleic acid detection tests and interpretive information are returned to the health care provider for communication to the tested individual. Such diagnoses may be performed by diagnostic laboratories, or, alternatively, diagnostic kits are manufactured and sold to health care providers or to private individuals for self- diagnosis. Suitable diagnostic techniques include those described herein as well as those described in U.S. Pat. Nos. 5,837,492; 5,800,998 and 5,891,628.

The identification of the association between the pathophysiology of schizophrenia and levels of miRNA expression permits the early presymptomatic screening of individuals to identify those at risk for developing schizophrenia or to identify the cause of such a disorder or the risk that any individual will develop same. Genetic testing enables practitioners to identify or stratify individuals at risk for certain behavioural states associated with schizophrenia or its manifestations including or an inability to overcome symptoms or schizophrenia after initial treatment. For particular at risk couples, embryos or fetuses may be tested after conception to determine the genetic likelihood of the offspring being pre-disposed to schizophrenia. Certain behavioural or therapeutic protocols may then be introduced from birth or early childhood to reduce the risk of developing schizophrenia. Presymptomatic diagnosis will enable better treatment of schizophrenia, including the use of existing medical therapies. Genotyping of individuals will be useful for (a) identifying a form of schizophrenia which will respond to particular drugs, (b) identifying a schizophrenia which responds well to specific medications or medication types with fewer adverse effects and (c) guide new drug discovery and testing.

Further, the present invention provides a method for screening drug candidates to identify molecules useful for treating schizophrenia involving a drug which affects levels of miRNA described herein. The terms "drug", "agent", "therapeutic molecule", "prophylactic molecule", "medicament", "candidate molecule" or "active ingredient" may be used interchangeable in describing this aspect of the present invention. It also includes a prodrug.

The present invention provides, therefore, information necessary for medical practitioners to select drugs for use in the treatment of schizophrenia. With the identification of a genetic risk of schizophrenia antipsychotic medications can be selected for the treatment.

Hence, the present invention contemplates the use of one or more of the miRNAs listed in table 4, or agents capable of elevating or upregulating the level or activity thereof in the manufacture of a medicament in the amelioration of symptoms of schizophrenia. Methods of treating schizophrenia and its phenotypes also form part of the present invention.

The present invention also provides a method for the treatment or prophylaxis of schizophrenia or manifestations thereof in a subject, the method comprising administering effective amounts of one or more of the miRNAs listed in Table 4, or an agent capable of elevating or upregulating the level or activity of one or more of these miRNAs.

As used herein the term "effective amount" includes within its meaning a non-toxic but sufficient amount or dose of an agent or compound to provide the desired effect. The exact amount or dose required will vary from subject to subject depending on factors such as the species being treated, the age and general condition of the subject, the severity of the condition being treated, the particular agent being administered and the mode of administration and so forth. Thus, it is not possible to specify an exact "effective amount". However, for any given case, an appropriate "effective amount" may be determined by one of ordinary skill in the art using only routine experimentation.

In one embodiment, the miRNA is selected from those miR A transcribed from I4q32, such as from 14q32.2 or 14q32.31, for example those miRNA identified within Table 4. In another embodiment, the miRNA is selected from hsa-miR-31 , hsa-miR-431 , hsa-miR- 433, hsa-miR-107, hsa-miR-134, hsa-miR-128, hsa-miR-181b, hsa-miR-99b, hsa-miR- 487b, hsa-miR-329, hsa-miR-409-3p, hsa-miR-432, hsa-miR-544, hsa-miR-342-5p, hsa- miR-654-5p, hsa-miR-485-3p, hsa-miR-370, hsa-miR-127-3p, hsa-miR-323-3p and hsa- miR-410.

Another aspect of the invention provides an animal model that mimics aspects of the dysregulation of miRNA expression and biogenesis identified in the molecular neuropathology of schizophrenia. For example, transgenic rodents are contemplated which constitutively or inducibly under express one or more of the miRNAs which have been shown to be downregulated in the present study. Such animal models provide a new model for schizophrenia for use in a range of applications including drug development or drug screening. In addition, the animal models provide a system for preclinical development and testing of miRNA targeting or miRNA biogenesis targeting medicaments.

The present invention is further described by the following non-limiting Examples. Examples

In the Examples, the materials and methods described below were employed: Participant Recruitment and Clinical Assessment Protocol

Subjects were recruited by the Australian Schizophrenia Research Bank (ASRB) and the Hunter DNA Bank (HDB) to give a total of 112 subjects with schizophrenia and 76 non-psychiatric controls. A cohort summary with basic patient and clinical variables are presented in Table 2.

Table 2: Summary statistics for clinical and demographic

variables characterising the PBMC schizophrenia and control cohort.

ASRB participants were clinically assessed using the Diagnostic Interview for Psychosis (DIP) and excluded if they were currently diagnosed with any organic brain disorders, substance dependence, brain injury that caused post traumatic amnesia lasting >24hrs,mental retardation (IQ<70), movement disorder or if they had electroconvulsive therapy (ECT) within 6 months. This exclusion criterion was likewise used for non-psychiatric control subjects with the additional criteria that they had no personal or family history of either psychosis or bipolar disorder type 1. Cases and controls were matched by age (within 3 years) and gender. Extraction of RNA and DN A from whole blood

Whole blood (20ml) was collected from subjects and transported to ASRB for processing. PBMCs were extracted by centrifugation using Lymphoprep (Vital Diagnostics, USA). Total RNA was extracted from PBMCs obtained using Trizol, as per the manufacturer's instructions (Invitrogen, Life Technologies, USA). RNA concentration was determined using a NanoDrop 2000 (Thermo Scientific, USA). Genomic DNA (gDNA) was extracted from PBMCs using a standard salt extraction method and quantified by PicoGreen assay (Invitrogen, CA, USA). The integrity of randomly selected gDNA was checked by agarose gel electrophoresis.

RNA integrity

RNA integrity was assessed by microcapillary electrophoresis using an Experion bioanalyser according to the manufacturer's instructions (Bio-Rad, USA) and produced an RNA Quality Indicator value (RQI). The average RQI for our cohort was 9.3. Samples with RQI values >6.3 were considered intact and therefore suitable for use in miRNA microarray experiments and quantitative real time RT-PCR (qPCR). miRNA expression profiling

Profiling of miRNA expression was achieved using the commercial miRNA microarray platform developed by Illumina. Each array matrix holds 96 sample arrays, and each array houses 1,536 unique oligonucleotide sequence probes for 470 annotated miRNA sequences (miRBase version 9.1) as well as 265 recently identified miRNA sequences. Total RNA (^g) was amplified and labelled within a 96-well plate format for hybridization to the miRNA beadarray matrix according to the manufacturer's instructions. Raw pixel intensities were extracted using BeadStudio software, version 3.1.3.0 (Illumina). Array data were compiled and background subtracted within the BeadStudio software (Illumina, version 3.0). Array data was normalized normalized with respect to the geometric mean of U44 and U49 snoRNA expression. Differential expression analysis was performed on normalized data using the Significance Analysis of Microarrays (SAM) statistical analysis program (full academic version 2.23, website http://www-stat.stanford.edu/~tibs/SAM/). This program reports the validity of genes that it identifies as being significantly differentially expressed according to a q-value; an adaptation of the p-value that is appropriate for multiple hypothesis testing, and denotes the lowest possible false discovery rate that may occur before a reported gene is not to be considered significantly differentially expressed. SAM differential expression analysis was performed using a two- class unpaired t-test of unlogged data and 5000 permutations. Significantly different miRNA were identified as those with a q-value < 5 (FDR < 5%). Unsupervised hierarchical clustering was performed in Cluster (Stanford University and a heat map visualised through Java Treeview V 1.1.1. Data was log transformed and median centered by genes. Genes and arrays were clustered, correlation un-centered, by average linkage clustering.

Quantitative real time reverse transcription PCR

Validation of differentially expressed miRNA was performed by qPCR on a subset consisting of 91 subjects (57 schizophrenia, 34 non-psychiatric controls), similarly to that described previously (Beveridge et al, 2008). Briefly, 500ng of sample RNA was treated with DNAse-I (Invitrogen, Life Technologies, USA) and multiplex reverse transcription performed with Superscript II reverse transcriptase (Invitrogen, Life Technologies, USA), a 3nM mix of miRNA sequence specific primers and primers for U44 snRNA and U49 snoRNA (Table 3). Triplicate reactions were set up in a 96- well format using the epMotion 5070 automated pipetting system (Eppendorf) and carried out using the Applied Biosystems 7500 real-time PCR machine. Relative miRNA expression was determined with respect to the geometric mean of U44 and U49 snoRNAs by calculating the difference between the average cycle threshold (Ct) of the miRNA of interest and the geometric mean of the average Ct values of housekeeping snoRNA for each sample (ACt). Data was not normally distributed (as determined by GraphPad Prism version 5.0) therefore the significance of differential expression was determined using a Mann- Whitney U test (PASW Statistics 18). Table 3: Oligonucleotide Sequences

1 The direction of primers with respect to the target sequence is denoted in the name as either F or R for forward and reverse respectively. Underlined sequence is not gene specific and was used to provide a primer recognition sequence

Target prediction and functional pathways analysis

A list of genes predicted to be targeted by members of the 14q32 miRNA cluster was compiled using DIANA miRGen (http://www.diana.pcbi.upenn.edu/miRGen.html). Targets were predicted for a union of several different prediction algorithms (DIANA- microT, TargetScan2, miRanda- microrna.org and miRBase, PicTar 4 way and 5 way) and submitted to DAVID Bioinformatics Resources 6.7 (http://david.abcc.ncifcrf.gov/) for functional annotation analysis.

Analysis of copy number variation

DNA copy number analysis was performed using Infinium Human 610 K BeadChips according to the manufacturer's instructions (Illumina). Briefly, 200ng of gDNA was amplified, fragmented and denatured before hybridization. After washing, extension, and staining steps, the BeadChips were dried and scanned on the IlluminaBeadArray Reader. Raw data were processed in the proprietary software genotype module in Genome Studio to export LogR ratio and B allele frequency data. Gene call threshold of 0.15 recommended by Illumina and the standard cluster file provided by Illumina using a multiethnic HapMap population were used to calculate SNP and sample statistics. Samples with call rate <0.985 were manually inspected by the plots of log R ratio and B allele frequency in the genome viewer tool and removed if plots were noisy. CNV analysis was accomplished using the SNP-FASST segmentation algorithm in the Nexus software package. Other parameters were set according to the recommended values (Nexus copy number user manual).

Example 1 - miR A expression analysis

MiRNA expression was analyzed in PBMCs of 1 12 patients with schizophrenia and 76 non psychiatric controls using human miRNA array matrices (Illumina). After normalization and background subtraction, signals corresponding to 358 miRNAs or approximately 40% of the array content remained. SAM analysis revealed a surprising number of significantly downregulated miRNA, 33 significant at a FDR of 0% (Fig 1 A) increasing to 83 at a FDR <5% (Table 4). By contrast there were no miRNA significantly increased according to these criteria. Seven of the differentially expressed miRNA were further analysed by qPCR in a representative sample of the schizophrenia and control cohorts, consisting of 57 and 34 subjects respectively. In each case, miRNA expression was normalized to the geometric mean of two constitutively expressed small nucleolar RNAs (snoRNAs) U44 and U49. These results were all highly concordant with the microarray analysis with all seven of the miRNA confirmed to be significantly downregulated in schizophrenia compared to controls (Fig IB) (two tailed Mann Whitney U test. These included miR-31 (2.97 fold, pO.001), miR-431 (2.79 fold, pO.001), miR-433 (2.06 fold, p= 0.017), miR-107 (2.25 fold, p<0.001), miR-134 (1.89 fold, p= 0.007), miR-99b (4.24 fold, pO.001) and miR- 487b (2.06 fold, p<0.001).

Table 4: miRNA with significant down-regulation of expression in schizophrenia compared with non-psychiatric controls. miRNA ID Fold change q-value (%) Chromosomal coordinates Cluster hsa-miR-329 0.753 0 hsa-miR-329- 1 14: 101493122-101493201 Γ+] , 14q32.31 hsa-miR-329-2 14: 101493437-101493520 [+]

hsa-miR-31 0.754 0 9: 215121 14-21512184 f-1

hsa-miR-409-3p 0.757 0 14: 101531637-101531715 [+1 14q32.31 hsa-miR-224 0.762 0 X: 151 127050-151 127130 1-1

hsa-miR-432 0.763 0 14: 101350820-101350913 [+1 14q32.2 hsa-miR-487b 0.764 0 14: 101512792-101512875 [+] 14q32. 1 lisa-iniR-134 0.764 0 14: 101521024-101521096 1+1 14q32.31 hsn-miR-431 0.765 0 14: 101347344-101347457 [+] 14q32.2 hsa-miR-150* 0.771 0 19: 50004042-50004125 Γ-1

hsa-miR-99b 0,783 0 19: 52195865-52195934 f+1

hsa-miR-1275 0.798 0 6: 33967749-33967828 [-1

lisa-miR^S* 0.799 0 7: 130135952-130136045 r+1

hsa-miR-200c 0.813 0 12: 7072862-7072929 Γ+1

hsa-miR-486-3p 0.815 0 8: 41517959-41518026 1-1

hsa-miR-29b-l * 0.817 0 7: 130562218-130562298 [-1

hsa-miR-16-2* 0.821 0 3: 160122533-160122613 i+1

hsa-miR-877 0.83 0 6: 30552109-30552194 1+1

hsa-miR-107 0.835 0 10: 91352504-91352584 [-]

hsa-miR-130b* 0.839 0 22: 22007593-22007674 [+]

hsa-miR-544 0.843 0 14: 101514995-101515085 f+1 14.q32.31 hsa-miR-342-5p 0.844 0 14: 100575992-100576090 (+1 . 14q32,2 hsa-miR-148b 0.844 0 12: 54731000-54731098 F+1

hsa-miR-625* 0.856 0 14: 65937820-65937904 1+1

hsa-miR-28-3p 0.858 0 3: 188406569-188406654 Γ+]

hsa-miR-576-5p 0.86 0 4: 1 10409854-1 1040995 1 i+1

hsa-miR-151 -3p 0.864 0 8: 141742663-141742752 Γ-1

hsa-miR-28-5p 0.869 ^' 0 3: 188406569-188406654 r+1

hsa-miR-664 0.871 0 1 : 220373880-220373961 Γ-]

hsa-miR-128 0.874 0 hsa-miR- 128-1 2: 136422967-136423048 Γ+1

hsa-miR-128-2 3: 35785968-3578605 [+1 hsa-miR-584 0.879 0 5: 148441876-148441972 [-]

hsa-miR-574-3p 0.883 0 4: 38869653-38869748 [+]

hsa-miR-) 81a 0.913 0 hsa-miR-181a-l 1 : 198828173-198828282 1-1

hsa-miR-181 a-2 9: 127454721-127454830 i+1 hsa-miR-30e* 0.917 0 1 : 4J.220027-41220 U8 [+]

lisa-miR-433 0.664 1.555 14: 101348223-101348315 (+1 14q32.2 hsa-miR-654-5p 0.73 1.555 14: 101506556-101506636 Γ+1 14q32.31 hsa-miR-193b 0.806 1.555 16: 14397824-14397906 M

hsa-miR-485-3p 0.816 ^• 1.555 14: 101521756-101521828 i+1 14q32.31 hsa-miR-370 0.831 1 ,555 14: 101377476-101377550 r+1 14q32.2 lisa-miR^O* 0.854 1.555 5: 179442303-179442397 f-1

hsa-miR-1271 0.854 1.555 5: 175794949-17579503 i+1

hsa-miR-151 0.855 1.555 8: 141742663-141742752 [-]

hsa-miR-15b« 0.86 1.555 3: 160122376-160122473 i+1

hsa-miR-502-3p, 0.86 1.555 X: 49779206-49779291 [+]

hsa-miR-500*

hsa-miR-27b 0.905 1.555 9: 97847727-97847823 f+1

hsa-miR-199a-3p, 0.922 1.555 hsa-miR-199a-l 19: 10928102-10928172 [-1

hsa-miR-199b-3p hsa-miR-199a-2 1 : 1721 13675-1721 13784 1-1

hsa-miR-199b 9: 131007000-131007109 |-1

hsa-miR-151-5p 0.933 1.555 8: 141742663-141742752 [-1

hsa-miR-146a 0.95 1.555 5: 159912359-159912457 1+1

hsa-miR-21 0.957 1.555 17: 57918627-57918698 [+]

hsa-miR-30d 0.959 1.555 8: 1358171 19-135817188 [-]

hsa-miR-127-3p 0.727 2.131 14: 101349316-101349412 1+1 14q32.2 hsa-miR-98 0.82 2.131 X: 53583184-53583302 1-1

hsa-miR-328 0.864 2.131 16; 67236224-67236298 f-1

hsa-miR-181b 0.875 2.131 hsa-miR-181 b-l 1 : 198828002-1 88281 1 1 M

hsa-miR-l 81 b-2 9: 127455989-127456077 i+1 hsa-miR-378 0.882 2.131 5: 1491 12388-1491 12453 i+1

hsa-miR-150 0.963 2.131 19: 50004042-50004125 [-]

hsa-miR-323-3p 0.796 2.74 14: 101492069-101492154 i+1 14q32.31 hsa-miR-874 0.797 2.74 5: 136983261 -136983338 1-1

hsa-miR-330-3p 0.857 2.74 19: 46142252 -461 2345 1-1

hsa-miR-500 0.862 2.74 X: 49773039-49773122 1+1

lisa-miR-i eia^' 0.878 2.74 9: 127454721-127454830 i+1

hsa-miR-146b-5p 0.912 2.74 10: 1041 6269-1041963 1 1+1

hsa-let-7b 0.952 2.74 22: 46509566-46509648 i+1

hsa-miR-25 0.956 2.74 7. 99691 183-99691266 [-1

hsa-miR-92a 0.957 2.74 hsa-miR-92a-l 13: 92003568-92003645 [+]

hsa-miR-92a-2 X: 133303568-133303642 [-] hsa-miR- 10 0.812 3.288 14: 101532249-1015323281+1 14q32.31 hsa-miR-221 * 0.815 3.288 X: 45605585-45605694 f-1 hsa-miR-942 0.825 3.288 1 : 1 17637265- 1 17637350 [+1

hsa-miR-664* 0.845 3.288 1 : 220373880-220373961 [-1

hsa-miR-20b 0.865 3.288 X: 133303839-133303907 [-]

hsa-miR-628-3p 0.867 3.288 15: 55665 138-55665232 f-1

hsa-miR-152 0.892 3.288 1 7: 461 14527-461 14613 [-]

hsa-let-7d 0.957 3.288 9. 96941 1 16-96941202 [+]

hsa-miR- 15 0.766 4.484 14: 101526092- 101 5261 5 f+1 14q32.31 hsa-miR-337-3p 0.87 4.484 14. 101340830-101340922 M 14q32.2 hsa-miR-505 0.884 4,484 X: 139006307-139006390 f- hsa-miR-625 0.897 4.484 14: 65937820-65937904 f+|

hsa-miR-22* 0.898 4.484 17: 1617197- 1617281 [-]

hsa-let-7g 0.965 4.484 3: 52302294-52302377 [-1

hsa-miR-1301 0.869 4.853 2: 25551 509-25551 590 M

hsa-let-7d* 0.905 4.853 9: 96941 1 16-96941202 [+1

sa-miR-766 0.93 4.853 X: 1 18780701 -1 1878081 1 [-]

hsa-!et-7a 0.971 4.853 hsa-let-7a-l 9: 96938239-9693831 8 f+1

C hsa-let7a-2 1 1 : 12201 7230-12201 730) ]■}

hsa-let7a-3 22: 46508629-46508702 [+1

miRNA with significant differential expression (FDR<5%) in schizophrenia compared with non-psychiatric controls, ranked by significance and then by fold change. 83 miRNA were differentially expressed in PBMCs, all downregulated in schizophrenia. 17 of the significantly downregulated miRNA are transcribed from within the same genomic region (from within a cluster encompassing 14q32.2-q32.3 1) identified here in bold and red, with their chromosomal coordinates also listed

Example 2 - Cluster analysis of schizophrenia-associated miRNA

The miRNAs found to be associated with schizophrenia in the genome-wide expression analysis were also subjected to hierarchical clustering (Fig. 2). This segregated the subjects into two main groups in which reduced expression was enriched with subjects from the ^' schizophrenia cohort (left side of heat map) in contrast to the majority of controls, which were visually distinguished by their relatively higher expression (right side). Strikingly, a cluster of 17 of the most substantially downregulated miRNAs (fold change) were also structurally associated by their genomic position on the long arm of chromosome 14 (14q32). These miRNA all reside within two closely neighbouring segments each spanning about 40kB and separated by ~110kB, at 14q32.2 and 14q32.31 (Fig 3). This cluster encodes at least 48 miRNA genes of which 30 mature miRNA were expressed. This indicated that >50% of the miRNA expressed at this locus were significantly downregulated in schizophrenia. Moreover, when the inventors examined miRNAs expressed in this cluster that were not significantly altered after correction for multiple testing, a further 8 miRNA (including miR-493*, miR-665, miR-379, miR-41 1 , miR-376c, miR-495, miR-539, miR-889) also displayed an average reduction in schizophrenia consistent with the trend seen in the majority of miRNA expressed from this region. This pattern of expression amongst the clustered miRNAs associated with schizophrenia was also highly consistent between individuals suggesting that their transcription may be under the influence of a shared regulatory mechanism.

To investigate whether the downregulation of miRNA on chromosome 14q32.31-32.2 is related to any CNV events, the inventors analyzed a subset of samples including 19 controls and 53 cases. This region on Illumina 61 OK BeadChip has 1554 probes comprising 1530 SNP and 24 CNV probes. The median and mean of spacing between probes is 2,614bp and 4,372bp respectively. The minimum and maximum contiguous probe spacing is 9bp and 69,243bp respectively. No deletion or duplication was detected in this region in either cases or controls.

Example 3 - Regulation of schizophrenia-associated miRNA expression The schizophrenia-associated miRNA expression signature observed in PBMCs (Example 1), could be the result of an alteration of both the transcriptional and post-transcriptional regulatory environment shared by these miRNA genes. The inventors therefore considered whether a 14q32 cluster-associated transcription factor or other regulatory molecule is responsible for the change in miRNA expression observed in schizophrenia.

One such regulatory molecule is the Ca²⁺ activated transcription factor myocyte enhancer factor-2 (MEF2), which has been shown to positively regulate expression of miRNA in this cluster (Fiore et l, 2009). MEF2 isoforms have also been shown to regulate neuronal development by supporting newly differentiated neurons and synapse formation. The inventors have also previously shown that expression of the MEF2D isoform is upregulated in differentiating neurons in response to a reduction in miR-17 family miRNA expression (Beveridge et al, 2009). The inventors investigated MEF2D expression using quantitative RT-PCR in the same RNA as was studied in Example 1 using MEF2 forward primer AACGCCGACATCATCGAG (SEQ ID NO:39) and MEF2 reverse primer GGCTCTGTTCCAGCGAGT (SEQ ID NO:40), and found that it was down regulated (2- fold; p=0.008; Fig. 4) consistent with the change in miRNA expression. Thus, this lower expression of MEF2 in PBMCs may contribute to the reduction in transcription of the 14q32 miRNA cluster in schizophrenia.

The inventors also investigated whether the schizophrenia-associated miRNA expression signature observed is post-transcriptionally influenced. The 14q32 miRNA cluster have been shown to be represented (-25%) amongst miRNA showing downregulation in dopaminergic neurons from the striatum of Ago2 -deficient mice (Schaefer et al, 2010). Ago2 (Argonaute-2/ EIF2C2) is known to be a member of the multiprotein RNA-induced silencing complex (RISC). A large proportion of miRNA from the 14q32 cluster also contain primary and secondary structural features-associated with dicer-independent/Ago2- slicer activity dependent processing, including a preponderance for an AAJ base at the 5' terminal in the mature sequence (80%) and the preference for miRNA residing in the 3p side of precursor hairpins (-70%). Again using quantitative RT-PCR using primers EIF2C2-F TGACAAGAACGAGCGGGTTG (SEQ ID NO:41) and EIF2C2-R AGGTAGAAGTCGAACTCGGTG (SEQ ID NO:42), the inventors here determined that EIF2C2 /Ago2 expression was also significantly downregulated in the schizophrenia cohort (Fig. 5). This suggests that Ago2-dependent pre-miRNA processing is particularly important for the biogenesis of miRNA in this cluster and may be associated with the changes observed in schizophrenia.

Example 4 - Target gene and pathway analysis

To gain an appreciation of the biological implications of the schizophrenia associated miRNA expression pattern, the inventors gathered and pooled putative target genes identified from multiple miRNA target prediction algorithms and used these to identify overrepresented pathways. First a' composite target gene list was produced for the top 20 differentially expressed miRNA (0% FDR) (data not shown), A more specific target list derived from predictions made for 12 of the differentially expressed miRNA clustered on 14q32 was also prepared and analyzed. Interestingly while both lists were enriched with neurally significant signal transduction pathways, such as long-term potentiation (LTP), calcium signaling, MAPK signaling, the 1 q32 clustered miRNA associated target genes were even more prevalent in these pathways. Another interesting feature of the clustered mi A target gene analysis was the enrichment of pathways associated with the immune system, including primary immunodeficiency, autoimmune and infection pathways.

Example 5 - Treatment of schizophrenia in animal models

The specific miR As identified herein as being downregulated in schizophrenia, or agonists therefor are administered in the following animal models.

Phencyclidine (PCP) Ketamine model - NMDA receptor antagonist model of schizophrenia

PCP and/or ketamine (as well as other NMDA receptor antagonists) administration to animals induces behaviours and biological effects that are similar to the symptoms of schizophrenia in humans. Following acute exposure or long-term exposure of animals (for example, rodents and non-human primates) to PCP, effects on one or more of the following is assessed:

frontal cortex function

temporal cortex function

sensorimotor gating

motor function

motivation

associative processes

social behaviour

locomotion

The effects of the hereinbefore-described molecules or compounds on the above phenotypes are assessed by administering the molecules or compounds to the PCP-treated animal.

Dominant-negative (DN) Disrupted-In-Schizophrenia-1 (DISCI) mice

In this transgenic model, a dominant-negative form of DISCI (DN-DISC1) is expressed under the aCaMKII promoter. DN-DISC1 mice have enlarged lateral ventricles particularly on the left side, suggesting a link to the asymmetrical change in anatomy found in brains of patients with schizophrenia. Furthermore, selective reduction in the immunoreactivity of parvalbumin in the cortex, a marker for an interneuron deficit that may underlie cortical asynchrony, is observed in the DN-DISC1 mice. DN-DISC1 mice also display several behavioral abnormalities, including hyperactivity, disturbance in sensorimotor gating and olfactory-associated behavior, and an anhedoni a/depression-like deficit.

Neonatal Brain Lesion Models

Neonatal damage of restricted brain regions of rodents or non-human primates disrupts development of the hippocampus, a brain area consistently implicated in human schizophrenia. The lesions involve regions of the hippocampus that directly project to the prefrontal cortex, i.e., ventral hippocampus and ventral subiculum, and that correspond to the anterior hippocampus in humans, a region that shows anatomical abnormalities in schizophrenia.

For example, neonatal excitotoxic lesions of the rat ventral hippocampus (VH) lead in adolescence or early adulthood to the emergence of abnormalities in a number of dopamine-related behaviors, which bear close resemblance to behaviors seen in animals sensitized to psychostimulants. In adolescence and adulthood (postnatal day 56 and older), rats with VH lesions display markedly changed behaviours thought to be primarily linked to increased mesolimbic/nigrostriatal dopamine transmission (motor hyperresponsiveness to stress and stimulants, enhanced stereotypies). They also show enhanced sensitivity to glutamate antagonists (MK-801 and PCP), deficits in PPI and latent inhibition, impaired social behaviors and working memory problems, phenomena showing many parallels with schizophrenia.

Such models as described above also allow for elucidation of a molecular signature associated with the various induced phenotypes, and allow for the molecular consequences of treatment with the hereinbefore antagonists to be investigated.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to, or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

References

Beveridge et al, Hum Mol Genet / 7. 1 156-1168, 2008

Beveridge et al, Cell Signal 21 :1837-1845, 2009

Beveridge et al, Mol Psychiatry 15:1176-1 189, 2010

Cogswell et al, J Alzheimer s Dis 14:27-41, 2008

Fiore et al, EMBO J '28:697-710, 2009

Schaefer et al, J Exp Med 207: 1843-1851 , 2010

Schipper et al, Gene Regul Syst Bio 1 :263-274, 2007

Claims

Claims

1. A method for detecting a risk profile for schizophrenia or a manifestation thereof or a sub-threshold phenotype or state thereof in a subject, the method comprising identifying a reduction or downregulation in expression of one or more miRNAs transcribed from the 1 q32 region of human chromosome 14, or a molecule that regulates the expression of said miRNA, in blood from the subject wherein the reduction or downregulation of expression is indicative of a risk of the subject having or developing symptoms of schizophrenia.

2. The method of claim 1 wherein at least one miRNA is transcribed from 14q32.2 or 14q32.31.

3. The method of claim 1 or 2 wherein the at least miRNA is selected from hsa-miR-

431, hsa-miR-433, hsa-miR-134, hsa-miR-487b, hsa-miR-329, hsa-miR-409-3p, hsa-miR-

432, hsa-miR-544, hsa-miR-342-5p, hsa-miR-654-5p, hsa-miR-485-3p, hsa-miR-370, hsa- miR-154 and hsa-miR-337-3p.

4. The method of any one of claims 1 to 3 wherein a blood sample is obtained from the subject and the measurement of determination of expression of the miRNA is made in the sample.

5. The method of any one of claims 1 to 4 wherein the determination of expression of the miRNA is made in whole blood, blood lymphocytes, blood plasma or blood serum.

6. The method of claim 5 wherein the determination of expression of the miRNA is made in peripheral blood mononuclear cells (PBMCs).

7. The method of any one of claims 1 to 6 wherein the level of expression of the miRNA is determined relative to normal endogenous levels of the miRNA in question.

8. The method of claim 1 wherein the molecule that regulates the expression of said one or more miRNAs is selected from MEF2D and EIF2C2 (Ago2).

9. A method for detecting a risk profile for schizophrenia or a manifestation thereof or a sub-threshold phenotype or state thereof in a subject, the method comprising identifying a reduction or downregulation in expression of at least one of the miRNAs listed in Table 4 or their families in blood from the subject wherein the reduction or downregulation of expression is indicative of a risk of the subject having or developing symptoms of schizophrenia.

10. . The method of claim 9 wherein a blood sample is obtained from the subject and the measurement of determination of expression of the miRNA is made in the sample.

1 1. The method of claim 9 or 10 wherein the determination of expression of the miRNA is made in whole blood, blood lymphocytes, blood plasma or blood serum.

12. The method of claim 11 wherein the determination of expression of the miRNA is made in peripheral blood mononuclear cells (PBMCs).

13. The method of any one of claims 9 to 12 wherein the level of expression of the miRNA is determined relative to normal endogenous levels of the miRNA in question.

14. The method of any one of claims 9 to 13 wherein at least one miRNA is transcribed from the 14q32 region on human chromosome 14.

15. The method of claim 14 wherein at least one miRNA is transcribed from 14q32.2 or 14q32.31.

16. The method of any one of claims 9 to 15 wherein the miRNAs are selected from hsa-miR-31, hsa-miR-431, hsa-miR-433, hsa-miR-107, hsa-miR-134, hsa-miR-128, hsa- miR-181b, hsa-miR-99b, hsa-miR-487b, hsa-miR-329, hsa-miR-409-3p, hsa-miR-432, hsa-miR-544, hsa-miR-342-5p, hsa-miR-654-5p, hsa-miR-485-3p, hsa-miR-370, hsa-miR- 127-3p, hsa-miR-323-3p and hsa-miR-410.

17. A method for stratifying subjects for schizophrenia, the method comprising determining levels of expression of one or more miRNAs listed in Table 4 or their families in blood, wherein a reduction or downregulation of expression places a subject in a group for schizophrenia or at risk of developing schizophrenia.

18. A method for diagnosing schizophrenia, a manifestation thereof or a sub-threshold phenotype or state thereof, or determining predisposition or susceptibility to developing schizophrenia or symptoms thereof, the method comprising obtaining a blood sample from the subject and detecting the level of expression of one or more miRNAs transcribed from the 14q32 region of human chromosome 14, or a molecule that regulates the expression of said miRNA, wherein a reduction or downregulation of expression is indicative of the subject having or being at risk of developing schizophrenia or symptoms thereof.

19. A method for diagnosing schizophrenia, a manifestation thereof or a sub-threshold phenotype or state thereof, or determining predisposition or susceptibility to developing schizophrenia or symptoms thereof, the method comprising obtaining a blood sample from the subject and detecting the level of expression of one or more miRNAs listed in Table 4 or their families, wherein a reduction or downregulation of expression is indicative of the subject having or being at risk of developing schizophrenia or symptoms thereof.

20. A method for the treatment or prophylaxis of schizophrenia or manifestations thereof in a subject, the method comprising administering to the subject an effective amount of one or more miRNAs transcribed from the 14q32 region of human chromosome 14, or a molecule that regulates the expression of said miRNA, or an agent capable of upregulating or elevating the level or activity thereof.

21. A method for the treatment or prophylaxis of schizophrenia or manifestations thereof in a subject, the method comprising administering to the subject an effective amount of one or more miRNAs listed in Table 4 or their families, or an agent capable of upregulating or elevating the level or activity thereof.

22. Use of one or more miRNAs transcribed from the 14q32 region of human chromosome 14, or a molecule that regulates the expression of said miRNA, or an agent capable of upregulating or elevating the level or activity thereof in the manufacture of a medicament in the amelioration of symptoms of schizophrenia.

23. Use of one or more miRNAs listed in Table 4 or their families, or an agent capable of upregulating or elevating the level or activity thereof in the manufacture of a medicament in the amelioration of symptoms of schizophrenia.

24. A method for determining the efficacy of a treatment for schizophrenia or manifestations thereof in a subject, the method comprising:

(a) determining the level of expression of one or more miRNAs transcribed from the 14q32 region of human chromosome 14 or listed in Table 4, or a molecule that regulates the expression of said miRNA(s), in blood of the subject;

(b) treating the subject with a treatment regime for a period sufficient to evaluate the efficacy of the regime; and

(c) subsequently determining the level of expression of said one or more miRNAs or regulatory molecules in blood of the subject,

wherein an increase in the level of expression of said one or more miRNAs or regulatory molecules following said treatment is indicative of the efficacy of the treatment regime.

25. The method of claim 24 further comprising repeating step (c) at least once over the period of treatment; and (d) determining whether the level of expression of said one or more miRNAs or regulatory molecules changes over the period of treatment, wherein an increase in the level of expression of said one or more miRNAs or regulatory molecules in the blood over the period of treatment is indicative of the efficacy of the treatment regime.

26. A method for designing a suitable treatment regime for a subject suffering from schizophrenia or manifestations thereof or predisposed thereto, the method comprising monitoring the level of expression of one or more miRNAs transcribed from the 14q32 region of human chromosome 14 or listed in Table 4, or a molecule that regulates the expression of said miRNA(s) in blood of the subject in the presence or absence of a treatment regime for treating the schizophrenia or manifestations thereof and adjusting the identity, timing and/or intensity of the treatment regime so as to increase the level of expression of said one or more miRNAs or regulatory molecules in the blood.