WO2001000241A2 - Novel vector complexes and their use in gene therapy - Google Patents

Novel vector complexes and their use in gene therapy Download PDF

Info

Publication number
WO2001000241A2
WO2001000241A2 PCT/EP2000/005371 EP0005371W WO0100241A2 WO 2001000241 A2 WO2001000241 A2 WO 2001000241A2 EP 0005371 W EP0005371 W EP 0005371W WO 0100241 A2 WO0100241 A2 WO 0100241A2
Authority
WO
WIPO (PCT)
Prior art keywords
component
vector
complex according
complex
cationic
Prior art date
Application number
PCT/EP2000/005371
Other languages
German (de)
French (fr)
Other versions
WO2001000241A3 (en
Inventor
Hans-Harald Sedlacek
Sabine BRÜSSELBACH
Thomas Kissel
Rolf Müller
Original Assignee
Aventis Pharma Deutschland Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aventis Pharma Deutschland Gmbh filed Critical Aventis Pharma Deutschland Gmbh
Priority to JP2001505948A priority Critical patent/JP2003503362A/en
Priority to AU61496/00A priority patent/AU6149600A/en
Priority to EP00947840A priority patent/EP1196618A2/en
Publication of WO2001000241A2 publication Critical patent/WO2001000241A2/en
Publication of WO2001000241A3 publication Critical patent/WO2001000241A3/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • vectors for gene therapy have so far been nucleic acid sequences which are complexed with a non-viral carrier (e.g. cationic lipids or cationic polymers) or inserted into a virus.
  • a non-viral carrier e.g. cationic lipids or cationic polymers
  • RES reticuloendothelial system
  • the causes of rapid elimination are varied. They can be too large a negative or positive charge, a too large volume or an opsonization of the vector particles by blood proteins.
  • viral vectors they can furthermore be the binding of the virus envelope proteins to virus-specific receptors in the organs and / or also antibodies or immune cells specific for the viruses which bind to the vectors and thereby eliminate them.
  • Vector particle size inhibited the aggregation of the vectors with themselves or with blood cells, reduced the opsonization of vectors by binding immunoglobulins, complement factors, fibrinogen or fibronectin, protected (adeno-) viral vectors from being eliminated by antibodies (Chillon et al., Gene Ther 5: 995, 1998) and caused an increase in the blood retention time of
  • the invention relates to a new vector for gene therapy consisting of the following components:
  • Component a) can be an unmodified or modified DNA sequence or an unmodified or modified RNA sequence.
  • the nucleotide sequence can perform an anti-DNA (triplex) or anti-RNA (antisense; ribozyme) function or code for an RNA sequence acting in this way or for a protein.
  • the nucleotide sequences and their modification can be such that the
  • Nucleotide sequence is largely resistant to degradation by DNAsen or RNAsen. Examples of such nucleotide sequences and their modifications are in Breaker, Nature Biotechnol. 15: 427, 1997; Gerwik, Critical Reviews in Oncogenesis 8: 93, 1997; Mukhopadhyay et al., Crit. Rev. Oncogen. 7: 151, 1996; Mercola et al., Cancer Gene Ther. 2: 47, 1995; Frank-Kamenetski, Annu. Rev. Biochem. 64: 65, 1995 and Fraser et al., Exp. Opin. Invest. Drugs 4: 637, 1995.
  • the DNA sequence can be linear or circular, for example in the form of a plasmid.
  • Component a) can also be a virus, preferably a virus, into which a nucleic acid sequence foreign to the virus has been inserted using the methods known to those skilled in the art.
  • viruses are RTV, AV, AAV, HSV, vaccinia viruses, influenza viruses.
  • RTV Radio Transmission Tube
  • AV Gene Ther. 7
  • AAV AAV
  • HSV vaccinia viruses
  • influenza viruses Such and further examples are from Vile, Nature Biotechnol. 15: 840, 1997; McKeon et al., Human Gene Ther. 7: 1615, 1996; Flotte et al., Gene Ther. 2: 357, 1995; Jolly, Cancer Gene Ther. 1:51, 1994; Dubensky et al., J. Virol. 70: 508, 1996.
  • Component b) represents any cationic carrier.
  • cationic carriers are cationic lipids, for example described by Kao et al., Oncology Reports 5: 625, 1998, Liu et al., J. Biol. Chem. 270: 24864, 1995; Feigner, Human Gene Ther. 7: 1791, 1996; Ledley, Human Gene Ther. 6: 1129, 1995; Goyal et al., J. Liposom. Res. 5: 49, 1995; Thierry et al., Gene Ther. 4: 226, 1997; Schofield et al., Br. Med. Bull. 51: 56, 1995; Behr, Bioconj. Chem. 5: 382, 1994; Cotten et al.,
  • Cationic polymers also include, for example, cationized albumin. Production and use of cationized albumin has been used in the
  • Patent application EP-A 0 790 312 described.
  • component b) is a polyethyleneimine (PEI), in a further particular embodiment of this invention the polyethyleneimine has a molecular weight in a range from 500-20,000 Da and in a further embodiment has an average molecular weight of about 2000 Da and was prepared as described in patent application EP-A 0 905 254.
  • PEI polyethyleneimine
  • Component c) represents any polymer with more than 3 cationic and more than 3 anionic charges.
  • the ratio of cationic to anionic charges should only be in the range between 3:10 and Fluctuate 10: 3.
  • the ratio 1 ( ⁇ 20%): 1 ( ⁇ 20%) should preferably be used.
  • the charges can be non-uniform, random or evenly distributed over the polymer.
  • preference is given to polymers with a uniform distribution of the cationic and anionic charge.
  • preference is furthermore given to polymers with cationic and anionic charge, the isoelectric point of which is in the pH range from 3-9.
  • the polymer according to the invention is albumin.
  • This albumin can be isolated from the blood or produced recombinantly.
  • the albumin is purified human albumin from the serum. The purification and properties of albumin have been described, for example, by T. Peters in FW Putnam "The Plasma Proteins", Academic Press, New York 1975, pp. 133-181.
  • Human serum albumin is a single chain polypeptide chain (610 amino acids) with an isoelectric point of 4.7 and approximately 101 positive and 101 negative charges, which are evenly distributed over the entire polypeptide chain.
  • component a) is complexed with component b) and this complex is in turn complexed with component c).
  • Another embodiment of the invention is that the complexes of components a) and b) in liposomes, preferably anionic liposomes [prepared, for example, as in U.S. Patent No. 4,946,787, U.S. Patent No. 4,245,737, U.S. Patent No. 5,480,463, Heywood and Eanes, Calc , Tissue int. 40: 149, 1992; Lee and Huang, J. Biol. Chem. 271: 8481, 1996; Balicki and Beutler, Blood 88: 3884, 1996; Lucie et al., J. Lip. Res.
  • the invention furthermore relates to the addition of the preparation according to the invention by adding a component d).
  • This component d) represents a ligand which binds with component a) or component b) or component c) and at the same time has a binding site for the target cell.
  • ligands can be
  • component d) can also be inserted into a liposome, preferably an anionic liposome, for example as described in US Pat. Nos. 5,252,348 and 5,753,258.
  • the target cell-specific protein or peptide selected from one of the aforementioned groups, is to be conjugated to a lipid, for example as described in US Pat. No. 5,662,930.
  • a lipid for example as described in US Pat. No. 5,662,930.
  • Invention is the target cell-specific protein or peptide associated with a fusiogenic peptide and this in turn with a lipid.
  • fusogenic peptides are described in detail in patent applications EP-A 0 846 772 and DE19850987.1 (not yet published).
  • the conjugation of the target cell-specific protein or peptide with a fusiogenic peptide is preferably carried out by expression as a recombinant fusion protein using the methods known to the person skilled in the art.
  • the vector according to the invention consisting of components a), b) and c) or a), b), c) and d) is produced, for example, in such a way that in the first step component d) with component a), b) and / or c) in the molar ratio [d): a), b) and / or c)] of 1: 1 to 1000: 1, preferably between 10 : 1 and 100: 1 is mixed, hereinafter
  • component a) [either alone or in a complex with component d)] is mixed with component b) [in a complex with component d) or alone], preferably in a molar ratio [a) ( ⁇ d): b ) ( ⁇ d)] from 1: 1 to 1: 1000, the mixing ratio being adjusted so that the net charge of the resulting overall complex is preferably either cationic or anionic and below
  • the complex resulting from step 2) is mixed with component c) [in complex with d) or alone] in such a way that component c) is in excess, measurable by the fact that the net charge of the from step 2) resulting complex was completely neutralized by step 3), preferably that the mixture of free albumin and albumin-containing complexes resulting from step 3) has a slightly anionic to neutral net charge, further preferably the albumin-containing complex has its isoelectric point in pH Has a value range of 4-7.
  • Such vector complexes according to the invention are largely shielded by their component c), i.e. their binding and transfection and transduction of cells that do not carry a receptor for component d) within the vector complex according to the invention is largely reduced.
  • the residence time is significantly extended, after administration in the blood circulation, for example, up to several Hours to a few days.
  • the vector complexes according to the invention accumulate, for example, in the tumor vessel bed due to the so-called "passive targeting" (Unezaki et al., Int. J. Pharmaceutics 114: 11, 1996; Sadzuka et al., Cancer Lett. 127: 99, 1998 and Wunder et al., Int. J. Oncol. 11: 497, 1997).
  • the vector complexes according to the invention bind via their component d) to the target cell and transfect them to release the nucleic acid sequence in the vector complex according to the invention.
  • this nucleic acid sequence can develop its effect in the target cell, i.e. For example, inhibit the transcription or translation of a particular gene or a particular RNA, or transduce the cell to express the RNA or the protein encoded by this nucleic acid sequence.
  • the vector complexes according to the invention are therefore preferably suitable for in vivo administration with the aim of prophylaxis or therapy of diseases.
  • Example 1 Preparation of a vector complex with a plasmid and a target cell-specific multivalent protein.
  • the plasmid expression system "pGL3" from Promega was used as component a) and contains the following nucleotide sequences:
  • the plasmid was introduced into E. coli bacteria, the bacteria were propagated in culture medium and the plasmids were isolated. Production of component b)
  • Low molecular weight polyethyleneimine (PEI-2000) was produced as described in patent application EP-A 0 905 254.
  • a 10% strength ethyleneimine monomer solution in water (5 ml of ethyleneimine monomer + 45 ml of distilled water, dissolution with stirring) with the addition of 1% (0.5 ml) of concentrated hydrochloric acid (37 ° C.) as catalyst for 4 days at 50 ° C stirred, evaporated and dried under vacuum at room temperature.
  • the molecular weight determinations were carried out by means of laser scattered light measurement (Wyatt Dwan DSP light scattering photometer) at 633 nm after direct injection into a K5 measuring cell. The molar masses are determined on the basis of the calibration constants determined in toluene and the known sample weight.
  • Human albumin 20% from Centeon was used as the polymer.
  • a multi-functional ligand produced as described in patent application EP-A 0 846 772 is used as component d).
  • the hybridoma of the anti-NCAM monoclonal antibody 575/100/2 serves as the starting material for the ZS ligand. About 10 7 cells of this hyridome are removed and the mRNA is extracted from these cells with the aid of an mRNA extraction kit (eg from Pharmacia, Gibco, Qiagen). This mRNA is then transcribed into cDNA by reverse transcription using a cDNA synthesis kit and "random" hexaoligonucleotides (Pharmacia).
  • This cDNA serves as a starting material for using variable primers (Clackson et al., Nature 352: 624, 1991) to use the variable heavy chain or the variable light chain of the immunoglobulins by means of a polymerase chain reaction (Saiki et al., Science 230: 1350, 1985 ) to amplify. Restriction sites are simultaneously introduced through the primers in order to clone the fragments into a bacterial expression vector (eg pHENIS, which is derived from pHENI) (Hoogenboom et al., Nucl. Acids Res. 19: 4133, 1991).
  • pHENIS which is derived from pHENI
  • pelB signal sequence for periplasmic secretion
  • histidine tag for purification using immobolized metal affinity chromatography (IMAC)
  • IMAC immobolized metal affinity chromatography
  • cloning region for the heavy and light chain between a short sequence for a 14 amino acid glycine serine linker coded.
  • the heavy and light chains are digested with the appropriate restriction enzymes (VH with Sfil and Xhol; VL with ApaL1 and Notl) and successively cloned into the vector. This creates a recombinant single-chain Fv fragment consisting of the variable heavy chain and light chain, which are covalently linked by a short peptide sequence.
  • Recombinant antibodies with specificity for N6-methyladenine are selected from native or semi-synthetic antibody libraries (Nissim et al., EMBO J. 13: 692, 1994) by biopanning on N6-methyladenine-BSA or KLH conjugates.
  • the Positive antibody fragments are identified by ELISA in antigen-coated microtiter plates (Nissim et al., EMBO J. 13: 692, 1994).
  • Antibodies from these libraries are already in the desired single-chain Fv format and can be used directly for further cloning.
  • a fusogenic peptide with the amino acid sequence GLFEALLELLESLWELLLEA (SEQ ID NO .: 1) serves as the linker.
  • the coding DNA for this peptide is produced as a double-stranded synthetic oligonucleotide, with suitable restriction cleavage sites (Ascl and Xbal) being appended to the ends.
  • Aptl and Xbal suitable restriction cleavage sites
  • O1 (5'GGCCGCAGGCTTATTTGAGGCCCTTCTGGAATTGCTAGAGAGCCTCTGGG AATTGCTTCTGGAGGCAT; SEQ ID NO .: 2) and O2 (5'CTAGATGCCTCCAGAAGCAATCCCAGAGGCCTCTAGCAATTCCAGAAGGGo3Co with the manufacturer; Enter 5) for the manufacturer (eg warmed and slowly cooled to room temperature. This double-stranded DNA fragment is used directly for further cloning.
  • the complete ligand system is inserted into the expression vector pAB1 (which is similar to pHENIS but has no fusion with g3p) e.g. made in the form of a 3-fragment cloning.
  • the starting material is the anti-NCAM single-chain Fv fragment (ZS ligand), which was cut with the restriction enzymes Sfil and Notl, the synthetic linker fragment which contains the cloning sites Notl and Xbal, and the anti-N6-methyladenine single-chain Fv Fragment (GS ligand).
  • ZS ligand anti-NCAM single-chain Fv fragment
  • Sfil and Notl the restriction enzymes Sfil and Notl
  • the synthetic linker fragment which contains the cloning sites Notl and Xbal
  • the anti-N6-methyladenine single-chain Fv Fragment GS ligand
  • the GS fragment is reamplified with primers which have the restriction sites Xbal or Nbal at the N and C terminus.
  • Insert ascl are cloned into the pAB1 vector cut with the restriction enzymes Sfil and Ascl.
  • the construct is transformed into suitable bacterial strains, for example E. coli TG1.
  • the regulation of the expression of the Ligand system takes place via the bacterial lacZ promoter and is induced by adding IPTG (as described, for example, in McCafferty et al., Appl. Biochem. Biotech. 47: 157, 1994).
  • the expressed protein is purified from periplasmic preparations using IMAC (see Griffiths et al., EMBO J. 13: 3245, 1994).
  • the total protein has a molecular weight of approximately 55,000 and is present as a monomer.
  • the protein recognizes NCAM-expressing tumor cells such as that of small cell bronchial carcinoma and it binds to N6-methylated DNA, which is produced by propagation of the plasmids in bacteria.
  • the ligand system is made by incubating the fusion protein with the DNA. The binding to the tumor cell or DNA can be checked by immunofluorescence or ELISA.
  • a reporter gene e.g. Luciferase (see component a)
  • a ligand system is created that is able to bind to the tumor cells.
  • the linker-mediated release from the endosomes takes place, which leads to the transcription and expression of the effector gene.
  • the binding of the ligand system to the cell and uptake into the cell can be carried out
  • Detect the use of fluorescence-labeled fusion protein and the functionality of the system is based on the detection of the enzymatic activity of luciferase.
  • Plasmids [component a)] are suspended in a concentration of 10 9 plasmids / ml in physiological saline.
  • the multifunctional ligand [component d)] dissolved in physiological saline, is added in portions to the suspension while shaking, until a molar ratio of about 1:10 (plasmid: multifunctional ligand) is reached.
  • the component a) / component d) complex or component a) is then [component b)] PEI-2000 (1 mg / ml physical saline with 1 N HCl adjusted to pH 7.4) in portions until a complete Cationization of the resulting complexes [component a) + d) + b) or component a) + b)] is reached.
  • the cationization is determined in the agarose shift assay, in which 50 ⁇ l aliquots are applied to an approximately 0.5 cm thick gel of 1% (w / v) agarose and in Tris-EDTA buffer pH 7.4 at 80 mV Be developed for 2 hours. The location of the DNA was visualized at 254 nm after reaction with ethidium bromide.
  • the cationic complexes from components a) + d) + b) are then suspended in an excess of component c) and incubated at 4 ° C. for at least 48 hours. In this excess, complexes are formed from components a) + d) + b) + c), which have a neutral to slightly anionic charge.
  • Charge is checked in the agarose shift assay and should be in the range between pH 4 and 7.
  • the vector complex according to the invention [component a) + d) + b) + c)] can then be used.
  • the vector complex component a) + b) is used as a control.
  • Tumor cells expressing NCAM small cell bronchial carcinoma
  • melanoma cells MeWo
  • fibroblasts 3T3
  • Components a) + b) are added to the cells in excess (ratio approx. 20: 1) and the mixture is incubated at 37 ° C. for 1 hour. Below are the Washed cells and incubated for another 60 hours in fresh cell culture medium.
  • the successful uptake of the complexes into the cell, the transcription and the expression of the reporter gene in the plasmid are then determined by detecting the luciferase with the aid of the method known to the person skilled in the art and according to information from Promega.
  • NCAM-positive cells which are incubated with the vector complex according to the invention [component a) + d) + b) + c)] show a clear expression of luciferase. In contrast, no or only a slight expression is found in the control cells.
  • Component c) in the vector complex according to the invention thus prevents the non-ligand-specific transfection of cells.
  • mice are injected with the complexes according to the invention [component a) + d) + b) + c)] or, as a control, complexes with components a) + b) into the tail vein.
  • the dose is 50 ⁇ g of component a) in the respective complexes per mouse, the suspension medium is physiological saline, the application volume is 250 ⁇ l.
  • the animals are anesthetized and bled 30 minutes and 2 hours after the injection.
  • the collected blood is mixed with sodium citrate (final concentration 25 mM) and the blood plasma is separated from the blood cells by centrifugation (10 min, 1000 g).
  • the DNA is isolated from the whole blood or from the blood plasma using the QIAamp Tissue Kit (Qiagen, Hilden).
  • 10 ⁇ l heparin 1000 IU7 ml Novo Nordisk
  • Samples of the isolated DNA were applied to 0.8% agarose gel and analyzed by Southern blot as described in detail by Obris et al. 1999 described.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The invention relates to a vector complex, containing the following components: a) a nucleic acid sequence of any length; b) a cationic carrier; c) a polymer which has more than 3 cationic charges and more than 3 anionic charges; and d) optionally a ligand which bonds with component a) or component b) or component c) and has at the same time a binding site for a target cell. The invention also relates to the production of said vector complex and the use thereof in the prophylaxis and treatment of diseases.

Description

Neue Vektorkomplexe und deren Verwendung für die GentherapieNew vector complexes and their use for gene therapy
Einführungintroduction
Die wesentlichen Komponenten von Vektoren für die Gentherapie sind bislang Nukleinsäuresequenzen, welche mit einem nichtviralen Träger (z.B. kationische Lipide oder kationische Polymere) komplexiert oder in ein Virus eingefügt werden.The essential components of vectors for gene therapy have so far been nucleic acid sequences which are complexed with a non-viral carrier (e.g. cationic lipids or cationic polymers) or inserted into a virus.
Die bisherige Erfahrung mit solchen Vektoren bei der Gentherapie unterschiedlichster Erkrankungen, insbesondere jedoch von Tumorerkrankungen, zeigt, daß nach Verabreichung eines gentherapeutischen Vektors in den Kreislauf eines Organismusses dieser Vektor in kurzer Zeit aus dem Kreislauf eliminiert wird und für die Bindung an die Zielzellen und zur Transfektion dieser Zielzellen nicht mehr zur Verfügung steht (Ogris et al. Gene Ther. 6: 595, 1999; Dash et al., Gene Ther. 6: 643, 1999; Li et al., Gene Ther. 5: 930, 1998; Liu et al. Gene Ther. 4: 517, 1997).Previous experience with such vectors in gene therapy for a wide variety of diseases, but especially tumor diseases, shows that after administration of a gene therapeutic vector into the circulation of an organism, this vector is eliminated from the circulation in a short time and for binding to the target cells and for transfection of these target cells is no longer available (Ogris et al. Gene Ther. 6: 595, 1999; Dash et al., Gene Ther. 6: 643, 1999; Li et al., Gene Ther. 5: 930, 1998; Liu et al. Gene Ther. 4: 517, 1997).
Diese Elimination kann erfolgen durch Degradation der DNA oder durch schnelle Ablagerung der Vektoren in der Lunge, der Leber oder dem sogenannten retikuloendothelialen System (RES), welches besonders ausgebildet ist in der Milz und den Lymphknoten (Zhu et al., Science 261 : 209, 1993).This elimination can take place by degradation of the DNA or by rapid deposition of the vectors in the lungs, the liver or the so-called reticuloendothelial system (RES), which is specially developed in the spleen and lymph nodes (Zhu et al., Science 261: 209 1993).
Die Ursachen der schnellen Elimination sind vielgestaltig. Sie können sein eine zu große negative oder positive Ladung, ein zu großes Volumen oder eine Opsonierung der Vektorpartikel durch Blutproteine. Bei viralen Vektoren können sie des weiteren sein die Bindung der Virushüllproteine an virusspezifische Rezeptoren in den Organen und/oder auch Antikörper oder Immunzellen spezifisch für die Viren, welche an die Vektoren binden und diese hierdurch eliminieren.The causes of rapid elimination are varied. They can be too large a negative or positive charge, a too large volume or an opsonization of the vector particles by blood proteins. In the case of viral vectors, they can furthermore be the binding of the virus envelope proteins to virus-specific receptors in the organs and / or also antibodies or immune cells specific for the viruses which bind to the vectors and thereby eliminate them.
Die bisherige Erfahrung zeigt des weiteren, daß die Kopplung oder Einfügung eines zielzellspezifischen Liganden in den Vektorkomplex dessen schnelle Elimination nach Verabreichung in den Blutkreislauf nicht wesentlich vermindert. In Kenntnis dieser Probleme besteht die dringliche Notwendigkeit nach neuen Zubereitungen von Vektoren, die es ermöglichen, daß Vektoren möglichst lang im Kreislauf verbleiben und nicht vorzeitig aus dem Kreislauf eliminiert werden. Um die Elimination von kationischen Lipiden oder kationischen Polymeren im Komplex mit Nukleinsäuresequenzen aus dem Blutkreislauf zu vermindern, wurdeExperience to date also shows that the coupling or insertion of a target cell-specific ligand into the vector complex does not significantly reduce its rapid elimination after administration into the bloodstream. Knowing these problems, there is an urgent need for new preparations of vectors which enable vectors to remain in the circuit for as long as possible and not to be prematurely eliminated from the circuit. In order to reduce the elimination of cationic lipids or cationic polymers in complex with nucleic acid sequences from the bloodstream,
Polyethylenglykol (Senior et al., Biochim. Biophys. Res. Acta 1062: 77, 1991 ; Mori et al., FEBS Lett 284: 263, 1991 ; Ogris et al., Gene Ther. 6: 595, 1999), Vinylpolymere (Torchilin et al., Biochim. Biophys. Res. Acta 1195: 181 , 1994) oder andere amphipatische Polymere (Woodle et al., Bioconjugat. Chem. 5: 493, 1994) an die kationischen Lipide oder kationischen Polymere gekoppelt oder mit Hilfe negativ geladener Lipide anionische Liposomen hergestellt, in welche die Nukleinsäuresequenzen im Komplex mit kationischen Lipiden oder kationischen Polymeren eingeschlossen waren (US Patent Nr. 4,946,787; US Patent Nr. 4,245,737; US Patent Nr. 5,480,463; Heywood und Eanes, Calc. Tissue Int. 40: 149, 1992; Lee und Huang, J. Biol. Chem. 271 : 8481 , 1996; Balicki und Beutler, Blood 88: 3884, 1996; Lucie et al., J. Lip. Res. 8: 57, 1998; Lakkaraju et al., J. Lip. Res. 8: 74, 1998; Turner et al., J. Lip. Res. 8: 114, 1998; Schoen et al., J. Lip. Res. 8: 485, 1998).Polyethylene glycol (Senior et al., Biochim. Biophys. Res. Acta 1062: 77, 1991; Mori et al., FEBS Lett 284: 263, 1991; Ogris et al., Gene Ther. 6: 595, 1999), vinyl polymers ( Torchilin et al., Biochim. Biophys. Res. Acta 1195: 181, 1994) or other amphipatic polymers (Woodle et al., Bioconjugat. Chem. 5: 493, 1994) coupled to the cationic lipids or cationic polymers or with the aid of negative charged lipids prepared anionic liposomes in which the nucleic acid sequences were complexed with cationic lipids or cationic polymers (US Patent No. 4,946,787; US Patent No. 4,245,737; US Patent No. 5,480,463; Heywood and Eanes, Calc. Tissue Int. 40: 149, 1992; Lee and Huang, J. Biol. Chem. 271: 8481, 1996; Balicki and Beutler, Blood 88: 3884, 1996; Lucie et al., J. Lip. Res. 8: 57, 1998; Lakkaraju et al., J. Lip. Res. 8: 74, 1998; Turner et al., J. Lip. Res. 8: 114, 1998; Schoen et al., J. Lip. Res. 8: 485, 1998).
Derartige Modifikationen führten beispielsweise zu einer Stabilisierung derSuch modifications led to a stabilization of the
Vektorpartikelgröße, inhibierten die Aggregation der Vektoren mit sich selbst oder mit Blutzellen, reduzierten die Opsonierung von Vektoren durch Bindung von Immungiobulinen, Complementfaktoren, Fibrinogen oder Fibronektin, schützten (adeno-)virale Vektoren vor der Elimination durch Antikörper (Chillon et al., Gene Ther. 5: 995, 1998) und bewirkten eine Verlängerung der Blutverweilzeit vonVector particle size, inhibited the aggregation of the vectors with themselves or with blood cells, reduced the opsonization of vectors by binding immunoglobulins, complement factors, fibrinogen or fibronectin, protected (adeno-) viral vectors from being eliminated by antibodies (Chillon et al., Gene Ther 5: 995, 1998) and caused an increase in the blood retention time of
Vektoren, eine deutlich stärkere Anreicherung in subkutan wachsende Tumoren und eine Transduktion der Tumorzellen (Ogris et al., Gene Ther. 6: 595, 1999).Vectors, a significantly stronger accumulation in subcutaneously growing tumors and transduction of the tumor cells (Ogris et al., Gene Ther. 6: 595, 1999).
Zugleich konnte jedoch auch in der Lunge, der Milz und der Leber eine beträchtliche Anreicherung der Vektoren und Transduktion der Gewebezellen in diesen Organen festgestellt werden (Ogris et al., Gene Ther. 6: 595, 1999), so daß gefolgert werden kann, daß beispielsweise die Kopplung von PEG zwar eine Verbesserung, aber noch keine Optimierung der Verteilung von Vektoren bewirkt. Allgemeine Beschreibung der ErfindungAt the same time, however, a considerable accumulation of the vectors and transduction of the tissue cells in these organs could also be found in the lungs, spleen and liver (Ogris et al., Gene Ther. 6: 595, 1999), so that it can be concluded that for example, the coupling of PEG does improve, but does not yet optimize the distribution of vectors. General description of the invention
Gegenstand der Erfindung ist ein neuer Vektor für die Gentherapie bestehend aus folgenden Komponenten:The invention relates to a new vector for gene therapy consisting of the following components:
a) einer Nukleinsäuresequenz beliebiger Länge, ggfs. als Teil eines Virus; b) einem kationischen Träger; und c) einem Polymer, welches mehr als 3 kationische und mehr als 3 anionische Ladungen besitzt.a) a nucleic acid sequence of any length, possibly as part of a virus; b) a cationic carrier; and c) a polymer which has more than 3 cationic and more than 3 anionic charges.
Komponente a) kann eine nicht-modifizierte oder modifizierte DNA-Sequenz oder eine nicht-modifizierte oder modifizierte RNA-Sequenz sein. Die Nukleotidsequenz kann eine anti-DNA (Triplex) oder anti-RNA (antisense; Ribozym) Funktion ausüben oder für eine derartig wirkende RNA-Sequenz oder für ein Protein kodieren. Die Nukleotidsequenzen und ihre Modifikation kann dergestalt sein, daß dieComponent a) can be an unmodified or modified DNA sequence or an unmodified or modified RNA sequence. The nucleotide sequence can perform an anti-DNA (triplex) or anti-RNA (antisense; ribozyme) function or code for an RNA sequence acting in this way or for a protein. The nucleotide sequences and their modification can be such that the
Nukleotidsequenz weitgehend resistent ist gegen den Abbau durch DNAsen oder RNAsen. Beispiele für derartige Nukleotidsequenzen und ihre Modifikationen sind in Breaker, Nature Biotechnol. 15: 427, 1997; Gerwik, Critical Reviews in Oncogenesis 8: 93, 1997; Mukhopadhyay et al., Crit. Rev. Oncogen. 7: 151 , 1996; Mercola et al., Cancer Gene Ther. 2: 47, 1995; Frank-Kamenetski, Annu. Rev. Biochem. 64: 65, 1995 und Fräser et al., Exp. Opin. Invest. Drugs 4: 637, 1995 dargestellt. Die DNA- Sequenz kann linear oder zirkulär, beispielsweise in Form eines Plasmids vorliegen.Nucleotide sequence is largely resistant to degradation by DNAsen or RNAsen. Examples of such nucleotide sequences and their modifications are in Breaker, Nature Biotechnol. 15: 427, 1997; Gerwik, Critical Reviews in Oncogenesis 8: 93, 1997; Mukhopadhyay et al., Crit. Rev. Oncogen. 7: 151, 1996; Mercola et al., Cancer Gene Ther. 2: 47, 1995; Frank-Kamenetski, Annu. Rev. Biochem. 64: 65, 1995 and Fraser et al., Exp. Opin. Invest. Drugs 4: 637, 1995. The DNA sequence can be linear or circular, for example in the form of a plasmid.
Komponente a) kann des weiteren ein Virus darstellen, bevorzugt ein Virus, in welches mit den dem Fachmann bekannten Methoden eine für das Virus fremde Nukleinsäuresequenz eingefügt wurde. Beispiele für derartige Viren sind RTV, AV, AAV, HSV, Vaccinia Viren, Influenzaviren. Derartige und weitere Beispiele sind von Vile, Nature Biotechnol. 15: 840, 1997; McKeon et al., Human Gene Ther. 7: 1615, 1996; Flotte et al., Gene Ther. 2: 357, 1995; Jolly, Cancer Gene Ther. 1 : 51 , 1994; Dubensky et al., J. Virol. 70: 508, 1996 beschrieben worden.Component a) can also be a virus, preferably a virus, into which a nucleic acid sequence foreign to the virus has been inserted using the methods known to those skilled in the art. Examples of such viruses are RTV, AV, AAV, HSV, vaccinia viruses, influenza viruses. Such and further examples are from Vile, Nature Biotechnol. 15: 840, 1997; McKeon et al., Human Gene Ther. 7: 1615, 1996; Flotte et al., Gene Ther. 2: 357, 1995; Jolly, Cancer Gene Ther. 1:51, 1994; Dubensky et al., J. Virol. 70: 508, 1996.
Komponente b) stellt einen beliebigen kationischen Träger dar. Derartige kationische Träger sind beispielsweise - kationische Lipide, beispielsweise beschrieben von Kao et al., Oncology Reports 5: 625, 1998, Liu et al., J. Biol. Chem. 270: 24864, 1995; Feigner, Human Gene Ther. 7: 1791 , 1996; Ledley, Human Gene Ther. 6: 1129, 1995; Goyal et al., J. Liposom. Res. 5: 49, 1995; Thierry et al., Gene Ther. 4: 226, 1997; Schofield et al., Br. Med. Bull. 51 : 56, 1995; Behr, Bioconj. Chem. 5: 382, 1994; Cotten et al.,Component b) represents any cationic carrier. Examples of such cationic carriers are cationic lipids, for example described by Kao et al., Oncology Reports 5: 625, 1998, Liu et al., J. Biol. Chem. 270: 24864, 1995; Feigner, Human Gene Ther. 7: 1791, 1996; Ledley, Human Gene Ther. 6: 1129, 1995; Goyal et al., J. Liposom. Res. 5: 49, 1995; Thierry et al., Gene Ther. 4: 226, 1997; Schofield et al., Br. Med. Bull. 51: 56, 1995; Behr, Bioconj. Chem. 5: 382, 1994; Cotten et al.,
Curr. Opin Biotechnol. 4: 705, 1993; San et al., Human Gene Ther. 4: 781 , 1993 oderCurr. Opin biotechnol. 4: 705, 1993; San et al., Human Gene Ther. 4: 781, 1993 or
- kationische Polymere, beispielsweise beschrieben von Boussif et al., Proc. Natl. Acad. Sei. USA 92: 7297, 1995; Kaneda et al., Science 243: 375, 1989; Keown et al., Methods in Enzymology 185: 527, 1990; Baker et al., Gene Ther. 4: 773,- Cationic polymers, for example described by Boussif et al., Proc. Natl. Acad. Be. USA 92: 7297, 1995; Kaneda et al., Science 243: 375, 1989; Keown et al., Methods in Enzymology 185: 527, 1990; Baker et al., Gene Ther. 4: 773,
1997; Fritz et al., Human Gene Ther. 7: 1395, 1996; Wolfert et al., Human Gene Ther. 7: 2123, 1996 und Solodin et al., Biochem. 34: 13537, 1995.1997; Fritz et al., Human Gene Ther. 7: 1395, 1996; Wolfert et al., Human Gene Ther. 7: 2123, 1996 and Solodin et al., Biochem. 34: 13537, 1995.
Zu den kationischen Polymeren gehört beispielsweise auch kationisiertes Albumin. Herstellung und Verwendung von kationisiertem Albumin wurde in derCationic polymers also include, for example, cationized albumin. Production and use of cationized albumin has been used in the
Patentanmeldung EP-A 0 790 312 beschrieben.Patent application EP-A 0 790 312 described.
In einer besonderen Ausführungsform dieser Erfindung stellt die Komponente b) ein Polyethylenimin (PEI) dar, in einer weiteren besonderen Ausführungsform dieser Erfindung besitzt das Polyethylenimin ein Molekulargewicht in einem Bereich von 500-20.000 Da und in einer weiteren Ausführungsform ein Molekulargewicht von durchschnittlich etwa 2000 Da und wurde hergestellt, wie in der Patentanmeldung EP-A 0 905 254 beschrieben.In a particular embodiment of this invention, component b) is a polyethyleneimine (PEI), in a further particular embodiment of this invention the polyethyleneimine has a molecular weight in a range from 500-20,000 Da and in a further embodiment has an average molecular weight of about 2000 Da and was prepared as described in patent application EP-A 0 905 254.
Komponente c) stellt ein beliebiges Polymer mit mehr als 3 kationischen und mehr als 3 anionischen Ladungen dar. Im Gegensatz zum Stand der Technik (US Patent Nr. 3,155,474) soll das Verhältnis von kationischen zu anionischen Ladungen nur in dem Bereich zwischen 3:10 und 10:3 schwanken. Vorzugsweise ist das Verhältnis 1 (±20%):1 (±20%) zu verwenden. Die Ladungen können ungleichmäßig, zufällig oder auch gleichmäßig über das Polymer verteilt sein. Bevorzugt im Sinne der Erfindung werden Polymere mit einer gleichmäßigen Verteilung der kationischen und anionischen Ladung. Bevorzugt im Sinne der Erfindung sind des weiteren Polymere mit kationischer und anionischer Ladung, deren isoelektrischer Punkt im pH Bereich von 3-9 liegt. Des weiteren bevorzugt im Sinne der Erfindung sind Polymere mit kationischer und anionischer Ladung, deren isoelektrischer Punkt im pH Bereich von 3-7 liegt. In einer besonderen Ausführungsform stellt das erfindungsgemäße Polymer Albumin dar. Dieses Albumin kann aus dem Blut isoliert oder rekombinant hergestellt sein. In einer weiteren besonderen Ausführungsform ist das Albumin gereinigtes Humanalbumin aus dem Serum. Die Reinigung und die Eigenschaften von Albumin sind beispielsweise bei T. Peters in F.W. Putnam "The Plasma Proteins", Academic Press, New York 1975, S. 133-181 , beschrieben worden. Humanes Serumalbumin stellt eine einzelkettige Polypeptidkette (610 Aminosäuren) dar mit einem isoelektrischen Punkt von 4.7 und etwa 101 positiven und 101 negativen Ladungen, welche gleichmäßig über die gesamte Polypeptidkette verteilt sind.Component c) represents any polymer with more than 3 cationic and more than 3 anionic charges. In contrast to the prior art (US Pat. No. 3,155,474), the ratio of cationic to anionic charges should only be in the range between 3:10 and Fluctuate 10: 3. The ratio 1 (± 20%): 1 (± 20%) should preferably be used. The charges can be non-uniform, random or evenly distributed over the polymer. For the purposes of the invention, preference is given to polymers with a uniform distribution of the cationic and anionic charge. For the purposes of the invention, preference is furthermore given to polymers with cationic and anionic charge, the isoelectric point of which is in the pH range from 3-9. Furthermore preferred in the sense of the invention are polymers with cationic and anionic charge, the isoelectric point of which is in the pH range of 3-7. In a particular embodiment, the polymer according to the invention is albumin. This albumin can be isolated from the blood or produced recombinantly. In a further particular embodiment, the albumin is purified human albumin from the serum. The purification and properties of albumin have been described, for example, by T. Peters in FW Putnam "The Plasma Proteins", Academic Press, New York 1975, pp. 133-181. Human serum albumin is a single chain polypeptide chain (610 amino acids) with an isoelectric point of 4.7 and approximately 101 positive and 101 negative charges, which are evenly distributed over the entire polypeptide chain.
Entsprechend dieser Erfindung wird die Komponente a) mit der Komponente b) komplexiert und dieser Komplex wiederum mit der Komponente c) komplexiert. Eine weitere Ausführungsform der Erfindung ist, die Komplexe aus Komponente a) und b) in Liposomen, vorzugsweise anionische Liposomen [hergestellt beispielsweise wie im US Patent Nr. 4,946,787, US Patent Nr. 4,245,737, US Patent Nr. 5,480,463, Heywood und Eanes, Calc. Tissue Int. 40: 149, 1992; Lee und Huang, J. Biol. Chem. 271 : 8481 , 1996; Balicki und Beutler, Blood 88: 3884, 1996; Lucie et al., J. Lip. Res. 8: 57, 1998; Lakkaraju et al., J. Lip. Res. 8: 74, 1998; Turner et al., J. Lip. Res. 8: 114, 1998; Schoen et al., J. Lip. Res. 8: 485, 1998 beschrieben, mit der dem Fachmann bekannten Methodik [beispielsweise beschrieben von Li und Huang, J. Lip. Res. 7, 63 (1997) oder US Patent Nr. 4,946,787] einzufügen und diese Liposomen mit der Komponente c) zu komplexieren.According to this invention, component a) is complexed with component b) and this complex is in turn complexed with component c). Another embodiment of the invention is that the complexes of components a) and b) in liposomes, preferably anionic liposomes [prepared, for example, as in U.S. Patent No. 4,946,787, U.S. Patent No. 4,245,737, U.S. Patent No. 5,480,463, Heywood and Eanes, Calc , Tissue int. 40: 149, 1992; Lee and Huang, J. Biol. Chem. 271: 8481, 1996; Balicki and Beutler, Blood 88: 3884, 1996; Lucie et al., J. Lip. Res. 8: 57, 1998; Lakkaraju et al., J. Lip. Res. 8: 74, 1998; Turner et al., J. Lip. Res. 8: 114, 1998; Schoen et al., J. Lip. Res. 8: 485, 1998, using the methodology known to those skilled in the art [described, for example, by Li and Huang, J. Lip. Res. 7, 63 (1997) or US Patent No. 4,946,787] and to complex these liposomes with component c).
Gegenstand der Erfindung ist des weiteren die Ergänzung der erfindungsgemäßen Zubereitung von Vektoren durch Hinzufügung einer Komponente d).The invention furthermore relates to the addition of the preparation according to the invention by adding a component d).
Diese Komponente d) stellt einen Liganden dar, welcher mit der Komponente a) oder der Komponente b) oder der Komponente c) bindet und zugleich eine Bindungsstelle für die Zielzelle hat. Derartige Liganden können seinThis component d) represents a ligand which binds with component a) or component b) or component c) and at the same time has a binding site for the target cell. Such ligands can be
- mehrfach funktionelle Ligandensysteme zur zielzellspezifischen Übertragung von Nukleotidsequenzen, beschrieben in EP-A 0 846 772 - einzelkettige, zweifach-antigenbindende Moleküle beschrieben in DE198161417, noch unveröffentlicht- Multi-functional ligand systems for target cell-specific transfer of nucleotide sequences, described in EP-A 0 846 772 - Single-chain, double-antigen-binding molecules described in DE198161417, unpublished
- spezifisch Zellmembran-penetrierende Moleküle beschrieben in DE19850987.1 , noch unveröffentlicht oder- Specific cell membrane penetrating molecules described in DE19850987.1, still unpublished or
- zielzellspezifische, multivalente Proteine beschrieben in DE19910419.0, noch unveröffentlicht- Target cell-specific, multivalent proteins described in DE19910419.0, not yet published
Auf die hier aufgeführten Patentanmeldungen wird ausdrücklich Bezug genommen.Reference is expressly made to the patent applications listed here.
Die Komponente d) kann jedoch auch in ein Liposom, vorzugsweise ein anionisches Liposom, eingefügt werden, beispielsweise wie in den US Patenten Nr. 5,252,348 und 5,753,258 beschrieben.However, component d) can also be inserted into a liposome, preferably an anionic liposome, for example as described in US Pat. Nos. 5,252,348 and 5,753,258.
Hierzu ist das zielzellspezifisches Protein oder Peptid, ausgewählt aus einer der zuvor erwähnten Gruppen, an ein Lipid zu konjugieren, beispielsweise wie im US Patent Nr. 5,662,930 beschrieben. In einer besonderen Ausführungsform derFor this purpose, the target cell-specific protein or peptide, selected from one of the aforementioned groups, is to be conjugated to a lipid, for example as described in US Pat. No. 5,662,930. In a special embodiment of the
Erfindung ist das zielzellspezifische Protein oder Peptid mit einem fusiogenen Peptid verbunden und dieses wiederum mit einem Lipid. Beispiel für fusiogene Peptide sind in den Patentanmeldungen EP-A 0 846 772 und DE19850987.1 (noch unveröffentlicht) ausführlich beschrieben. Die Konjugation des zielzellspezifischen Proteins oder Peptids mit einem fusiogenen Peptid erfolgt vorzugsweise durch die Expression als rekombinantes Fusionsprotein mit den dem Fachmann bekannten Methoden.Invention is the target cell-specific protein or peptide associated with a fusiogenic peptide and this in turn with a lipid. Examples of fusogenic peptides are described in detail in patent applications EP-A 0 846 772 and DE19850987.1 (not yet published). The conjugation of the target cell-specific protein or peptide with a fusiogenic peptide is preferably carried out by expression as a recombinant fusion protein using the methods known to the person skilled in the art.
Die Herstellung des erfindungsgemäßen Vektors bestehend aus den Komponenten a), b) und c) oder a), b), c) und d) erfolgt beispielsweise derartig, daß - im 1. Schritt Komponente d) mit Komponente a), b) und/oder c) im molaren Verhältnis [d):a), b) und/oder c)] von 1 :1 bis 1000:1 , vorzugsweise zwischen 10:1 und 100:1 vermischt wird, nachfolgendThe vector according to the invention consisting of components a), b) and c) or a), b), c) and d) is produced, for example, in such a way that in the first step component d) with component a), b) and / or c) in the molar ratio [d): a), b) and / or c)] of 1: 1 to 1000: 1, preferably between 10 : 1 and 100: 1 is mixed, hereinafter
- im 2. Schritt Komponente a) [entweder alleine oder im Komplex mit Komponente d)] mit Komponente b) [im Komplex mit Komponente d) oder alleine] vermischt wird und zwar bevorzugterweise im molaren Verhältnis [a) (±d):b) (±d)] von 1 :1 bis 1 :1000, wobei das Mischungsverhältnis so eingestellt werden soll, daß die Nettoladung des resultierenden Gesamtkomplexes vorzugsweise entweder kationisch oder anionisch ist und nachfolgend- in the second step component a) [either alone or in a complex with component d)] is mixed with component b) [in a complex with component d) or alone], preferably in a molar ratio [a) (± d): b ) (± d)] from 1: 1 to 1: 1000, the mixing ratio being adjusted so that the net charge of the resulting overall complex is preferably either cationic or anionic and below
- im 3. Schritt der aus Schritt 2) resultierende Komplex mit der Komponente c) vermischt wird [im Komplex mit d) oder alleine] und zwar derartig, daß die Komponente c) im Überschuß vorliegt, meßbar daran, daß die Nettoladung des aus Schritt 2) resultierenden Komplexes durch Schritt 3) komplett neutralisiert wurde, vorzugsweise, daß das aus Schritt 3) resultierende Gemisch aus freiem Albumin und Albumin-haltigen Komplexen eine leicht anionische bis neutrale Nettoladung aufweist, des weiteren vorzugsweise der albuminhaltige Komplex seinen isoelektrischen Punkt im pH-Wertbereich von 4-7 aufweist.- In the third step, the complex resulting from step 2) is mixed with component c) [in complex with d) or alone] in such a way that component c) is in excess, measurable by the fact that the net charge of the from step 2) resulting complex was completely neutralized by step 3), preferably that the mixture of free albumin and albumin-containing complexes resulting from step 3) has a slightly anionic to neutral net charge, further preferably the albumin-containing complex has its isoelectric point in pH Has a value range of 4-7.
Derartige erfindungsgemäße Vektorkomplexe sind durch ihre Komponente c) weitgehend abgeschirmt, d.h. ihre Bindung und Transfektion und Transduktion von Zellen, die keinen Rezeptor für die Komponente d) innerhalb des erfindungsgemäßen Vektorkomplexes tragen, ist weitgehend vermindert.Such vector complexes according to the invention are largely shielded by their component c), i.e. their binding and transfection and transduction of cells that do not carry a receptor for component d) within the vector complex according to the invention is largely reduced.
Infolgedessen ist nach Verabreichung der erfindungsgemäßen Vektorkomplexe in einen Organismus, entweder lokal, auf die Haut, in ein Organ, eine Körperhöhle, in ein Binde- oder Stützgewebe oder in den Blutkreislauf, die Verweilzeit deutlich verlängert, nach Verabreichung in den Blutkreislauf beispielsweise bis auf mehrere Stunden bis zu einigen Tagen.As a result, after administration of the vector complexes according to the invention into an organism, either locally, on the skin, in an organ, a body cavity, in a connective or supporting tissue or in the blood circulation, the residence time is significantly extended, after administration in the blood circulation, for example, up to several Hours to a few days.
Über diese lange Verweilzeit hinweg reichern sich die erfindungsgemäßen Vektorkomplexe beispielsweise im Tumorgefäßbett an aufgrund des sogenannten "passiven Targetings" (Unezaki et al., Int. J. Pharmaceutics 114: 11 , 1996; Sadzuka et al., Cancer Lett. 127: 99, 1998 und Wunder et al., Int. J. Oncol. 11 : 497, 1997).Over this long dwell time, the vector complexes according to the invention accumulate, for example, in the tumor vessel bed due to the so-called "passive targeting" (Unezaki et al., Int. J. Pharmaceutics 114: 11, 1996; Sadzuka et al., Cancer Lett. 127: 99, 1998 and Wunder et al., Int. J. Oncol. 11: 497, 1997).
Des weiteren und auch unabhängig vom passiven Targeting binden die erfindungsgemäßen Vektorkomplexe über ihre Komponente d) an die Zielzelle und transfizieren diese zur Freisetzung der Nukleinsäuresequenz im erfindungsgemäßen Vektorkomplex.Furthermore and independently of passive targeting, the vector complexes according to the invention bind via their component d) to the target cell and transfect them to release the nucleic acid sequence in the vector complex according to the invention.
Diese Nukleinsäuresequenz kann, je nach Zusammensetzung, in der Zielzelle ihre Wirkung entfalten, d.h. beispielsweise die Transkription oder Translation eines bestimmten Genes oder einer bestimmten RNA hemmen, oder die Zelle transduzieren zur Expression der RNA oder des Proteins kodiert von dieser Nukleinsäuresequenz.Depending on its composition, this nucleic acid sequence can develop its effect in the target cell, i.e. For example, inhibit the transcription or translation of a particular gene or a particular RNA, or transduce the cell to express the RNA or the protein encoded by this nucleic acid sequence.
Die erfindungsgemäßen Vektorkomplexe sind somit bevorzugt geeignet für die in vivo Verabreichung mit dem Ziel der Prophylaxe oder Therapie von Erkrankungen.The vector complexes according to the invention are therefore preferably suitable for in vivo administration with the aim of prophylaxis or therapy of diseases.
Beispiele zur Verdeutlichung des ErfindungsgedankensExamples to illustrate the idea of the invention
Die folgenden Beispiele erläutern, wie man die vorliegende Erfindung ausführen könnte.The following examples illustrate how one could practice the present invention.
Beispiel 1 : Herstellung eines Vektorkomplexes mit einem Plasmid und einem zielzellspezifischen multivalenten Protein.Example 1: Preparation of a vector complex with a plasmid and a target cell-specific multivalent protein.
Herstellung von Komponente a)Production of component a)
Als Komponente a) wurde das Plasmid Expressionssystem "pGL3" von Promega verwendet, welches folgende Nukleotidsequenzen enthält:The plasmid expression system "pGL3" from Promega was used as component a) and contains the following nucleotide sequences:
- SV40 Promoter und Enhancer- SV40 promoter and enhancer
(Genbank SV40 zirkuläres Genom; NIDg 965480: Nukleotide 5172-294)(Genbank SV40 circular genome; NIDg 965480: nucleotides 5172-294)
- der cDNA für Luciferase - SV40-Poly A-Signal- the cDNA for luciferase - SV40 poly A signal
Mit den dem Fachmann bekannten Methoden wurde das Plasmid in E. coli Bakterien eingeführt, die Bakterien in Kulturmedium vermehrt und die Plasmide isoliert. Herstellung von Komponente b)Using the methods known to the person skilled in the art, the plasmid was introduced into E. coli bacteria, the bacteria were propagated in culture medium and the plasmids were isolated. Production of component b)
Niedrigmolekulares Polyethylenimin (PEI-2000) wurde hergestellt wie in der Patentanmeldung EP-A 0 905 254 beschrieben. Hierzu wurde eine 10%ige Ethyleniminmonomer-Lösung in Wasser (5 ml Ethyleniminmonomer + 45 ml destilliertes Wasser, Auflösung unter Rühren) unter Zusatz von 1 % (0,5 ml) konzentrierter Salzsäure (37°C) als Katalysator 4 Tage lang bei 50°C gerührt, einrotiert und unter Vakuum bei Raumtemperatur getrocknet. Die Molekulargewichtsbestimmungen wurden mittels Laserstreulichtmessung (Lichtstreuphotometer Wyatt Dwan DSP) bei 633 nm nach Direktinjektion in eine K5- Meßzelle durchgeführt. Die Molmassen werden aufgrund der in Toluol bestimmten Kalibrierkonstanten und der bekannten Probeneinwaage bestimmt.Low molecular weight polyethyleneimine (PEI-2000) was produced as described in patent application EP-A 0 905 254. For this purpose, a 10% strength ethyleneimine monomer solution in water (5 ml of ethyleneimine monomer + 45 ml of distilled water, dissolution with stirring) with the addition of 1% (0.5 ml) of concentrated hydrochloric acid (37 ° C.) as catalyst for 4 days at 50 ° C stirred, evaporated and dried under vacuum at room temperature. The molecular weight determinations were carried out by means of laser scattered light measurement (Wyatt Dwan DSP light scattering photometer) at 633 nm after direct injection into a K5 measuring cell. The molar masses are determined on the basis of the calibration constants determined in toluene and the known sample weight.
Die Molekulargewichtsbestimmung mit Hilfe der Lichtstreuanalyse ergab 2000 Da. Vergleichsweise hatte das kommerziell (Fa. Fluka, Neu Ulm) erhaltene PEI ein Molekulargewicht entsprechend der Lichtstreuanalyse von 791 kDa (HMW-PEI).Molecular weight determination using light scattering analysis gave 2000 Da. By comparison, the PEI obtained commercially (from Fluka, Neu Ulm) had a molecular weight corresponding to the light scattering analysis of 791 kDa (HMW-PEI).
Herstellung von Komponente c)Production of component c)
Als Polymer wurde Humanalbumin 20% der Fa. Centeon verwendet.Human albumin 20% from Centeon was used as the polymer.
Herstellung von Komponente d)Production of component d)
Als Komponente d) dient ein mehrfach funktioneller Ligand hergestellt wie in der Patentanmeldung EP-A 0 846 772 beschrieben. 1 ) Herstellung des zellspezifischen Liganden (ZS)A multi-functional ligand produced as described in patent application EP-A 0 846 772 is used as component d). 1) Production of the cell-specific ligand (ZS)
Als Ausgangsmaterial für den ZS-Liganden dient das Hybridom des anti-NCAM monoklonalen Antikörpers 575/100/2 (Behringwerke). Etwa 107 Zellen dieses Hyridoms werden abzenthfugiert und die mRNA wird aus diesen Zellen unter Zuhilfenahme eines mRNA-Extraktionskits (z.B. der Firmen Pharmacia, Gibco, Qiagen) extrahiert. Diese mRNA wird dann durch reverse Transkription unter Zuhilfenahme eines cDNA-Synthese-Kits und "random" Hexaoligonukleotiden (Pharmacia) in cDNA umgeschrieben. Diese cDNA dient als Ausgangsmaterial um mit Hilfe von spezifischen Primern (Clackson et al., Nature 352: 624, 1991 ) die variable schwere Kette bzw. die variable leichte Kette der Immunglobuline mittels Polymerasekettenreaktion (Saiki et al., Science 230: 1350, 1985) zu amplifizieren. Durch die Primer werden gleichzeitig Restriktionsschnittstellen eingeführt, um die Fragmente in einen bakteriellen Expressionsvektor (z.B. pHENIS, der sich von pHENI ableitet) (Hoogenboom et al., Nucl. Acids Res. 19: 4133, 1991 ) zu klonieren. Er enthält eine pelB-Signalsequenz für die periplasmatische Sekretion, ein Histidin- tag für die Reinigung mittels immobolisierter Metallaffinitätschromatographie (IMAC) sowie eine Klonierungsregion für die schwere und leichte Kette zwischen einer kurzen Sequenz, die für einen 14 Aminosäure-langen Glycin-Serin-Linker codiert. Ferner erfolgt die Fusion mit dem g3p-Protein für das "display" an der Oberfläche von Bakteriophagen. Die schwere und leichte Kette werden mit den entsprechenden Restriktionsenzymen (VH mit Sfil und Xhol; VL mit ApaL1 und Notl) verdaut und nacheinander in den Vektor kloniert. Dadurch entsteht ein rekombinantes einzelkettiges Fv-Fragment bestehend aus der variablen schweren Kette und leichten Kette, die durch eine kurze Peptidsequenz kovalent verbunden sind.The hybridoma of the anti-NCAM monoclonal antibody 575/100/2 (Behringwerke) serves as the starting material for the ZS ligand. About 10 7 cells of this hyridome are removed and the mRNA is extracted from these cells with the aid of an mRNA extraction kit (eg from Pharmacia, Gibco, Qiagen). This mRNA is then transcribed into cDNA by reverse transcription using a cDNA synthesis kit and "random" hexaoligonucleotides (Pharmacia). This cDNA serves as a starting material for using variable primers (Clackson et al., Nature 352: 624, 1991) to use the variable heavy chain or the variable light chain of the immunoglobulins by means of a polymerase chain reaction (Saiki et al., Science 230: 1350, 1985 ) to amplify. Restriction sites are simultaneously introduced through the primers in order to clone the fragments into a bacterial expression vector (eg pHENIS, which is derived from pHENI) (Hoogenboom et al., Nucl. Acids Res. 19: 4133, 1991). It contains a pelB signal sequence for periplasmic secretion, a histidine tag for purification using immobolized metal affinity chromatography (IMAC) and a cloning region for the heavy and light chain between a short sequence for a 14 amino acid glycine serine linker coded. Furthermore, the fusion with the g3p protein for the "display" takes place on the surface of bacteriophages. The heavy and light chains are digested with the appropriate restriction enzymes (VH with Sfil and Xhol; VL with ApaL1 and Notl) and successively cloned into the vector. This creates a recombinant single-chain Fv fragment consisting of the variable heavy chain and light chain, which are covalently linked by a short peptide sequence.
2) Herstellung des genkonstruktspezifischen Liganden (GS)2) Production of the gene construct-specific ligand (GS)
Rekombinante Antikörper mit Spezifität für N6-Methyladenin werden aus nativen bzw. semi-synthetischen Antikörperbibliotheken (Nissim et al., EMBO J. 13: 692, 1994) durch Biopanning an N6-Methyladenin-BSA bzw. -KLH-Konjugaten selektioniert. Die Identifizierung positiver Antikörperfragmente erfolgt durch ELISA in antigengecoateten Mikrotiterplatten (Nissim et al., EMBO J. 13: 692, 1994). Antikörper aus diesen Bibliotheken sind bereits in dem gewünschten einzelkettigen Fv-Format und können direkt für weitere Klonierungen eingesetzt werden.Recombinant antibodies with specificity for N6-methyladenine are selected from native or semi-synthetic antibody libraries (Nissim et al., EMBO J. 13: 692, 1994) by biopanning on N6-methyladenine-BSA or KLH conjugates. The Positive antibody fragments are identified by ELISA in antigen-coated microtiter plates (Nissim et al., EMBO J. 13: 692, 1994). Antibodies from these libraries are already in the desired single-chain Fv format and can be used directly for further cloning.
3) Herstellung des Linkers3) Production of the linker
Als Linker dient ein fusiogenes Peptid mit der Aminosäuresequenz GLFEALLELLESLWELLLEA (SEQ ID NO.: 1 ). Die codierende DNA für dieses Peptid wird als doppelsträngiges, synthetisches Oligonukleotid hergestellt, wobei an den Enden geeignete Restriktionsschnittstellen (Ascl und Xbal) angehängt werden. Dafür werden die zwei synthetischen OligonukleotideA fusogenic peptide with the amino acid sequence GLFEALLELLESLWELLLEA (SEQ ID NO .: 1) serves as the linker. The coding DNA for this peptide is produced as a double-stranded synthetic oligonucleotide, with suitable restriction cleavage sites (Ascl and Xbal) being appended to the ends. For this, the two synthetic oligonucleotides
O1 (5'GGCCGCAGGCTTATTTGAGGCCCTTCTGGAATTGCTAGAGAGCCTCTGGG AATTGCTTCTGGAGGCAT; SEQ ID NO.: 2) und O2(5'CTAGATGCCTCCAGAAGCAATCCCAGAGGCCTCTAGCAATTCCAGAAGGG CCTCAAATAAGCCTG; SEQ ID NO.: 3) mit T4 Polynukleotidkinase (z.B. Gibco) entsprechend den Angaben des Herstellers phosphoryliert, für 5 min auf 80°C erwärmt und langsam auf Raumtemperatur abgekühlt. Dieses doppelsträngige DNA- Fragment wird direkt für weitere Klonierungen verwendet.O1 (5'GGCCGCAGGCTTATTTGAGGCCCTTCTGGAATTGCTAGAGAGCCTCTGGG AATTGCTTCTGGAGGCAT; SEQ ID NO .: 2) and O2 (5'CTAGATGCCTCCAGAAGCAATCCCAGAGGCCTCTAGCAATTCCAGAAGGGo3Co with the manufacturer; Enter 5) for the manufacturer (eg warmed and slowly cooled to room temperature. This double-stranded DNA fragment is used directly for further cloning.
4) Herstellung des Fusionsproteins4) Preparation of the fusion protein
Das komplette Ligandensystem wird in den Expressionsvektor pAB1 (der ähnlich wie pHENIS aufgebaut ist, jedoch keine Fusion mit g3p aufweist) z.B. in Form einer 3- Fragment-Klonierung hergestellt. Als Ausgangsmaterial dienen das anti-NCAM einzelkettige Fv-Fragment (ZS-Ligand), das mit den Restriktionsenzymen Sfil und Notl geschnitten wurde, das synthetische Linker-Fragment, das die Klonierungsstellen Notl und Xbal enthält, und das anti-N6-Methyladenin einzelkettige Fv-Fragment (GS-Ligand). Für die Klonierung wird das GS-Fragment mit Primern reamplifiziert, die am N- und C-Terminus die Restriktionsschnittstellen Xbal bzw.The complete ligand system is inserted into the expression vector pAB1 (which is similar to pHENIS but has no fusion with g3p) e.g. made in the form of a 3-fragment cloning. The starting material is the anti-NCAM single-chain Fv fragment (ZS ligand), which was cut with the restriction enzymes Sfil and Notl, the synthetic linker fragment which contains the cloning sites Notl and Xbal, and the anti-N6-methyladenine single-chain Fv Fragment (GS ligand). For the cloning, the GS fragment is reamplified with primers which have the restriction sites Xbal or Nbal at the N and C terminus.
Ascl einfügen. Diese Fragmente werden in den mit den Restriktionsenzymen Sfil und Ascl geschnittenen pAB1- Vektor kloniert. Das Konstrukt wird in geeignete Bakterienstämme, z.B. E. coli TG1 , transformiert. Die Regulation der Expression des Ligandensystems erfolgt über den bakteriellen lacZ-Promoter und wird durch Zugabe von IPTG induziert (wie z.B. beschrieben in McCafferty et al., Appl. Biochem. Biotech. 47: 157, 1994). Das exprimierte Protein wird aus periplasmatischen Präparationen mittels IMAC aufgereinigt (siehe Griffiths et al., EMBO J. 13: 3245, 1994). Das Gesamtprotein besitzt ein Molekulargewicht von ca. 55.000 und liegt als Monomer vor.Insert ascl. These fragments are cloned into the pAB1 vector cut with the restriction enzymes Sfil and Ascl. The construct is transformed into suitable bacterial strains, for example E. coli TG1. The regulation of the expression of the Ligand system takes place via the bacterial lacZ promoter and is induced by adding IPTG (as described, for example, in McCafferty et al., Appl. Biochem. Biotech. 47: 157, 1994). The expressed protein is purified from periplasmic preparations using IMAC (see Griffiths et al., EMBO J. 13: 3245, 1994). The total protein has a molecular weight of approximately 55,000 and is present as a monomer.
5) Funktionsprüfung des Fusionsproteins5) Functional test of the fusion protein
Das Protein erkennt NCAM-exprimierende Tumorzellen wie z.B. die des kleinzelligen Bronchialkarzinoms und es bindet an N6-methylierte DNA, die durch Propagation der Plasmide in Bakterien hergestellt wird. Das Ligandensystem wird durch Inkubation des Fusionsproteins mit der DNA hergestellt. Die Bindung an die Tumorzelle bzw. DNA kann mittels Immunofluoreszenz bzw. ELISA überprüft werden. Durch Bindung des Fusionsproteins an Plasmid-DNA, die ein Reportergen enthält [z.B. Luciferase (siehe Komponente a)], entsteht ein Ligandensystem, das in der Lage ist, an die Tumorzellen zu binden. Nach Aufnahme der Komplexe in die Zelle erfolgt die Linker-vermittelte Freisetzung aus den Endosomen was zur Transkription und Expression des Effektorgens führt. Die Bindung des Ligandensystems an die Zelle und Aufnahme in die Zelle läßt sich durchThe protein recognizes NCAM-expressing tumor cells such as that of small cell bronchial carcinoma and it binds to N6-methylated DNA, which is produced by propagation of the plasmids in bacteria. The ligand system is made by incubating the fusion protein with the DNA. The binding to the tumor cell or DNA can be checked by immunofluorescence or ELISA. By binding the fusion protein to plasmid DNA containing a reporter gene [e.g. Luciferase (see component a)], a ligand system is created that is able to bind to the tumor cells. After the complexes have been taken up into the cell, the linker-mediated release from the endosomes takes place, which leads to the transcription and expression of the effector gene. The binding of the ligand system to the cell and uptake into the cell can be carried out
Verwendung von fluoreszenzmarkiertem Fusionsprotein nachweisen und die Funktionalität des Systems erfolgt durch den Nachweis der enzymatischen Aktivität von Luciferase.Detect the use of fluorescence-labeled fusion protein and the functionality of the system is based on the detection of the enzymatic activity of luciferase.
Herstellung des VektorkomplexesProduction of the vector complex
Plasmide [Komponente a)] werden in einer Konzentration von 109 Plasmide/ml in physiologischer Kochsalzlösung suspendiert. In die Suspension wird unter Schütteln der multifunktionelle Ligand [Komponente d)] gelöst in physiologischer Kochsalzlösung portionsweise hinzugegeben, bis ein molares Verhältnis von etwa 1 :10 (Plasmid: multifunktioneller Ligand) erreicht ist. Dem Komponente a)/Komponente d)-Komplex oder der Komponente a) wird anschließend [Komponente b)] PEI-2000 (1 mg/ml phys. Kochsalzlösung mit 1 N HCI auf pH 7,4 eingestellt) portionsweise hinzugegeben, bis eine vollständige Kationisierung der entstehenden Komplexe [Komponente a)+d)+b) bzw. Komponente a)+b)] erreicht ist.Plasmids [component a)] are suspended in a concentration of 10 9 plasmids / ml in physiological saline. The multifunctional ligand [component d)], dissolved in physiological saline, is added in portions to the suspension while shaking, until a molar ratio of about 1:10 (plasmid: multifunctional ligand) is reached. The component a) / component d) complex or component a) is then [component b)] PEI-2000 (1 mg / ml physical saline with 1 N HCl adjusted to pH 7.4) in portions until a complete Cationization of the resulting complexes [component a) + d) + b) or component a) + b)] is reached.
Die Kationisierung wird im Agarose-Shift-Assay bestimmt, bei welchem 50 μl Aliquots auf ein ca. 0,5 cm dickes Gel aus 1 % (w/v) Agarose aufgetragen und in Tris-EDTA-Puffer pH 7,4 bei 80 mV 2 h lang entwickelt werden. Die Lokalisation der DNA wurde bei 254 nm nach Reaktion mit Ethidiumbromid sichtbar gemacht.The cationization is determined in the agarose shift assay, in which 50 μl aliquots are applied to an approximately 0.5 cm thick gel of 1% (w / v) agarose and in Tris-EDTA buffer pH 7.4 at 80 mV Be developed for 2 hours. The location of the DNA was visualized at 254 nm after reaction with ethidium bromide.
Die kationischen Komplexe aus den Komponenten a)+d)+b) werden anschließend in einem Überschuß von Komponente c) suspendiert und für mindestens 48 Stunden bei 4°C inkubiert. In diesem Überschuß bilden sich Komplexe aus den Komponenten a)+d)+b)+c), welche eine neutrale bis leicht anionische Ladung haben. DieseThe cationic complexes from components a) + d) + b) are then suspended in an excess of component c) and incubated at 4 ° C. for at least 48 hours. In this excess, complexes are formed from components a) + d) + b) + c), which have a neutral to slightly anionic charge. This
Ladung wird im Agarose-Shift-Assay kontrolliert und sollte im Bereich zwischen pH 4 und 7 liegen.Charge is checked in the agarose shift assay and should be in the range between pH 4 and 7.
Anschließend ist der erfindungsgemäße Vektorkomplex [Komponente a)+d)+b)+c)] verwendungsfähig. Als Kontrolle gilt der Vektorkomplex Komponente a)+b).The vector complex according to the invention [component a) + d) + b) + c)] can then be used. The vector complex component a) + b) is used as a control.
Beispiel 2: Biologische Prüfung des VektorkomplexesExample 2: Biological testing of the vector complex
1 ) Untersuchungen an Kulturzellen1) Investigations on culture cells
NCAM exprimierende Tumorzellen (kleinzeliiges Bronchialkarzinom), Melanomzellen (MeWo) und Fibroblasten (3T3) wurden in der Zellkultur mit der dem Fachmann bekannten Zellkulturtechnik vermehrt und isoliert.Tumor cells expressing NCAM (small cell bronchial carcinoma), melanoma cells (MeWo) and fibroblasts (3T3) were multiplied and isolated in cell culture using the cell culture technique known to the person skilled in the art.
Komplexe mit den Komponenten a)+d)+b)+c) oder (zur Kontrolle) mit denComplexes with components a) + d) + b) + c) or (for control) with the
Komponenten a)+b) werden im Überschuß (Verhältnis ca. 20:1 ) zu den Zellen gegeben und das Gemisch bei 37°C für 1 Stunde inkubiert. Nachfolgend werden die Zellen gewaschen und für weitere 60 Stunden im frischen Zellkulturmedium inkubiert.Components a) + b) are added to the cells in excess (ratio approx. 20: 1) and the mixture is incubated at 37 ° C. for 1 hour. Below are the Washed cells and incubated for another 60 hours in fresh cell culture medium.
Anschließend wird die erfolgreiche Aufnahme der Komplexe in die Zelle, die Transkription und die Expression des Reportergens im Plasmid durch Nachweis der Luciferase mit Hilfe der dem Fachmann bekannten Methode und nach Angabe der Fa. Promega bestimmt.The successful uptake of the complexes into the cell, the transcription and the expression of the reporter gene in the plasmid are then determined by detecting the luciferase with the aid of the method known to the person skilled in the art and according to information from Promega.
Folgende Ergebnisse werden erzielt:The following results are achieved:
Etwa 15% der Zellen, welche mit Kontrollkomplexen inkubiert worden sind, zeigen eine Expression von Luciferase. In NCAM exprimierenden Tumorzellen ist diese etwa gleich wie in den anderen Zellen.About 15% of the cells which have been incubated with control complexes show an expression of luciferase. In NCAM expressing tumor cells this is approximately the same as in the other cells.
Im Gegensatz hierzu zeigen nur NCAM-positive Zellen, welche mit dem erfindungsgemäßen Vektorkomplex [Komponente a)+d)+b)+c)] inkubiert werden, eine deutliche Expression von Luciferase. In den Kontrollzellen ist dagegen keine oder nur eine geringfügige Expression festzustellen.In contrast to this, only NCAM-positive cells which are incubated with the vector complex according to the invention [component a) + d) + b) + c)] show a clear expression of luciferase. In contrast, no or only a slight expression is found in the control cells.
Die Komponente c) im erfindungsgemäßen Vektorkomplex verhindert somit die nicht ligandenspezifische Transfektion von Zellen.Component c) in the vector complex according to the invention thus prevents the non-ligand-specific transfection of cells.
2) Untersuchung der Blutverweilzeit in Mäusen2) Examination of blood retention time in mice
Mäusen (NMRI) werden in die Schwanzvene die erfindungsgemäßen Komplexe [Komponente a)+d)+b)+c)] oder zur Kontrolle Komplexe mit den Komponenten a)+b) injiziert. Die Dosis ist 50 μg der Komponente a) in den jeweiligen Komplexen pro Maus, das Suspensionsmedium physiologische Kochsalzlösung, das Applikationsvolumen 250 μl.Mice (NMRI) are injected with the complexes according to the invention [component a) + d) + b) + c)] or, as a control, complexes with components a) + b) into the tail vein. The dose is 50 μg of component a) in the respective complexes per mouse, the suspension medium is physiological saline, the application volume is 250 μl.
30 Minuten und 2 Stunden nach der Injektion werden die Tiere narkotisiert und entblutet. Das aufgefangene Blut wird mit Natriumzitrat (Endkonzentration 25 mM) versetzt und das Blutplasma von den Blutzellen durch Zentrifugation (10 min, 1000 g) abgetrennt. Die DNA wird aus dem Vollblut bzw. aus dem Blutplasma mittels des QIAamp Tissue Kits (Qiagen, Hilden) isoliert. Hierzu werden zu 100 μl von Blut oder Plasma jeweils 10 μl Heparin (1000 IU7ml Novo Nordisk) während der Erstinkubation bei 70% hinzugegeben, um die Plasmid DNA quantitativ zu isolieren. Proben der isolierten DNA wurden auf 0,8% Agarosegel aufgetragen und per Southern Blot analysiert wie im Detail bei Obris et al. 1999 beschrieben.The animals are anesthetized and bled 30 minutes and 2 hours after the injection. The collected blood is mixed with sodium citrate (final concentration 25 mM) and the blood plasma is separated from the blood cells by centrifugation (10 min, 1000 g). The DNA is isolated from the whole blood or from the blood plasma using the QIAamp Tissue Kit (Qiagen, Hilden). For this purpose, 10 μl heparin (1000 IU7 ml Novo Nordisk) are added to 100 μl of blood or plasma during the first incubation at 70% in order to quantitatively isolate the plasmid DNA. Samples of the isolated DNA were applied to 0.8% agarose gel and analyzed by Southern blot as described in detail by Obris et al. 1999 described.
ErgebnisseResults
Während nach Verabreichung der Kontrollpräparation nach 0,5 Stunden nur noch Spuren von Plasmid DNA im Blutplasma nachweisbar sind, kann im Blutplasma der Tiere verabreicht mit den erfindungsgemäßen Komplexen nach 0,5 und auch noch nach 2 Stunden beträchtliche Mengen an DNA nachgewiesen werden.While only traces of plasmid DNA can be detected in the blood plasma after administration of the control preparation after 0.5 hours, considerable amounts of DNA can be detected in the blood plasma of the animals administered with the complexes according to the invention after 0.5 and even after 2 hours.
Diese Ergebnisse zeigen, daß sich die erfindungsgemäßen Vektorkomplexe, wie erwünscht, durch eine bedeutende Verlängerung der Blutverweilzeit auszeichnen. These results show that, as desired, the vector complexes of the invention are characterized by a significant increase in blood residence time.

Claims

Patentansprüche:1 ) Vektorkomplex, enthaltend folgende Komponenten: a) eine Nukleinsäuresequenz beliebiger Länge; b) einen kationischen Träger; c) ein Polymer, welches mehr als 3 kationische und mehr als 3 anionische Ladungen besitzt; und d) optional einen Liganden, welcher an die Komponente a) oder dieKomponente b) oder die Komponente c) bindet und zugleich eine Bindungsstelle für eine Zielzelle hat; erhältlich durch Claims: 1) Vector complex containing the following components: a) a nucleic acid sequence of any length; b) a cationic carrier; c) a polymer which has more than 3 cationic and more than 3 anionic charges; and d) optionally a ligand which binds to component a) or component b) or component c) and at the same time has a binding site for a target cell; available through
1. gegebenenfalls Mischung von Komponente d) mit Komponente a), b) und/oder c) im molaren Verhältnis [d):a),b) und/oder c)] von 1 :1 bis1. optionally mixture of component d) with component a), b) and / or c) in the molar ratio [d): a), b) and / or c)] from 1: 1 to
1000:1 , vorzugsweise zwischen 10:1 und 100:1 ;1000: 1, preferably between 10: 1 and 100: 1;
2. Mischung von Komponente a), entweder alleine oder im Komplex mit Komponente d), mit Komponente b), entweder alleine oder im Komplex mit Komponente d); bevorzugterweise im molaren Verhältnis [a) ±d) : b) ± d)] von 1 :1 bis 1 :1000, wobei das Mischungsverhältnis so eingestellt werden soll, daß die Nettoladung des resultierenden Gesamtkomplexes vorzugsweise entweder kationisch oder anionisch ist; und2. Mixture of component a), either alone or in a complex with component d), with component b), either alone or in a complex with component d); preferably in the molar ratio [a) ± d): b) ± d)] from 1: 1 to 1: 1000, the mixing ratio being adjusted so that the net charge of the resulting overall complex is preferably either cationic or anionic; and
3. Mischung des aus Schritt 2) resultierenden Komplexes mit der Komponente c), entweder alleine oder im Komplex mit d), und zwar so, daß die Komponente c) im Überschuß vorliegt, wobei die Nettoladung des aus Schritt 2) resultierenden Komplexes durch Schritt 3) komplett neutralisiert wird.3. Mixing the complex resulting from step 2) with component c), either alone or in complex with d), in such a way that component c) is present in excess, the net charge of the complex resulting from step 2) being obtained by step 3) is completely neutralized.
2) Vektorkomplex nach Anspruch 1 ), bei welchem der isoelektrische Punkt des Polymers [Komponente c)] im pH-Bereich von 3-9 liegt.2) Vector complex according to claim 1), wherein the isoelectric point of the polymer [component c)] is in the pH range of 3-9.
3) Vektorkomplex nach Anspruch 2), bei welchem der isoelektrische Punkt des Polymers [Komponente c)] im pH-Bereich von 3-7 liegt. 4) Vektorkomplex nach Ansprüchen 1-3), bei welchem die Komponente c) Albumin ist.3) Vector complex according to claim 2), wherein the isoelectric point of the polymer [component c)] is in the pH range of 3-7. 4) Vector complex according to claims 1-3), in which component c) is albumin.
5) Vektorkomplex nach Ansprüchen 1-4), bei welchem die Komponente c) rekombinant hergestelltes humanes Albumin ist.5) vector complex according to claims 1-4), in which component c) is recombinantly produced human albumin.
6) Vektorkomplex nach Ansprüchen 1-4), bei welchem die Komponente c) humanes Serumalbumin ist.6) Vector complex according to claims 1-4), in which component c) is human serum albumin.
7) Vektorkomplex nach einem der Ansprüche 1-6), bei welchem die Komponente a) eine DNA oder RNA darstellt.7) vector complex according to one of claims 1-6), in which component a) is a DNA or RNA.
8) Vektorkomplex nach einem der Ansprüche 1-6), bei welchem die Komponente a) ein viraler Vektor ist.8) Vector complex according to one of claims 1-6), in which component a) is a viral vector.
9) Vektorkomplex nach Anspruch 8), bei welchem der virale Vektor ausgewählt wird aus einer Gruppe umfassend RTV, AV, AAV, Vaccinia V., Influenza V, HSV, Lenti V.9) Vector complex according to claim 8), in which the viral vector is selected from a group comprising RTV, AV, AAV, Vaccinia V., influenza V, HSV, Lenti V.
10) Vektorkomplex nach einem der Ansprüche 1-9), bei welchem der kationische Träger ein kationisches Lipid ist.10) vector complex according to any one of claims 1-9), wherein the cationic carrier is a cationic lipid.
11 ) Vektorkomplex nach einem der Ansprüche 1 -9), bei welchem der kationische Träger ein kationisches Polymer ist.11) Vector complex according to one of claims 1-9), in which the cationic carrier is a cationic polymer.
12) Vektorkomplex nach Anspruch 11 ), bei welchem das kationische Polymer Polyethylenimin (PEI) ist.12) vector complex according to claim 11), wherein the cationic polymer is polyethyleneimine (PEI).
13) Vektorkomplex nach Anspruch 12), bei welchem das Molekulargewicht des PEI in einem Bereich von 500 bis 20.000 Da liegt.13) The vector complex according to claim 12), wherein the molecular weight of the PEI is in a range from 500 to 20,000 Da.
14) Vektorkomplex nach Anspruch 13), bei welche das PEI ein Molekulargewicht von durchschnittlich 2000 Da aufweist. 15) Vektorkomplex nach Ansprüchen 1-14), bei welchem die Komponenten a) und b) in ein Liposom eingefügt sind und das Liposom mit Komponente c) komplexiert ist.14) Vector complex according to claim 13), in which the PEI has a molecular weight of 2000 Da on average. 15) Vector complex according to claims 1-14), in which components a) and b) are inserted into a liposome and the liposome is complexed with component c).
16) Vektorkomplex nach Anspruch 15), bei welchem das Liposom eine anionische Ladung aufweist.16) Vector complex according to claim 15), in which the liposome has an anionic charge.
17) Vektorkomplex nach einem der Ansprüche 1-16), bei welchem die Komponente d) ausgewählt ist aus einer Gruppe umfassend einen multifunktionellen Liganden, ein einzelkettiges, doppelantigenbindendes Protein oder ein komplexbildendes Protein.17) Vector complex according to one of claims 1-16), in which component d) is selected from a group comprising a multifunctional ligand, a single-chain, double-antigen-binding protein or a complex-forming protein.
18) Vektorkomplex nach einem der Ansprüche 1-16), bei welchem die Komponente d) aus einem zielzellspezifischen Liganden und einem Lipid besteht und in ein Liposom eingefügt ist.18) Vector complex according to one of claims 1-16), in which component d) consists of a target cell-specific ligand and a lipid and is inserted into a liposome.
19) Vektorkomplex nach einem der Ansprüche 1-16), bei welchem die Komponente d) aus einem zielzellspezifischen Liganden, einem fusiogenen oder translozierendem Peptid und einem Lipid besteht und in ein Liposom eingefügt ist.19) Vector complex according to one of claims 1-16), in which component d) consists of a target cell-specific ligand, a fusiogenic or translocating peptide and a lipid and is inserted into a liposome.
20) Vektorkomplex nach Ansprüchen 17-19), bei welchem die Komponente d) die Bindung an und die Translokation in eine Zielzelle vermittelt.20) vector complex according to claims 17-19), in which the component d) mediates the binding to and the translocation into a target cell.
21 ) Vektorkomplex nach Anspruch 20), wobei die Zielzelle eine Gewebezelle, ein Epithelzelle, eine Endothelzelle, eine Blutzelle, eine Leukämiezelle oder eine Tumorzelle ist.21) Vector complex according to claim 20), wherein the target cell is a tissue cell, an epithelial cell, an endothelial cell, a blood cell, a leukemia cell or a tumor cell.
22) Vektorkomplex nach einem der Ansprüche 1-20), bei welchem der isoelektrische Punkt des Komplexes im pH-Bereich von 4-7 liegt.22) Vector complex according to one of claims 1-20), in which the isoelectric point of the complex is in the pH range of 4-7.
23) Verwendung eines Vektorkomplexes nach einem der Ansprüche 1-22) für die Prophylaxe oder Therapie einer Erkrankung. 24) Verwendung des Vektorkomplexes nach Anspruch 23) zur Verabreichung auf die Haut, auf eine Schleimhaut, in eine Körperhöhle, in das Bindegewebe, in ein Organ oder in den Blutkreislauf.23) Use of a vector complex according to any one of claims 1-22) for the prophylaxis or therapy of a disease. 24) Use of the vector complex according to claim 23) for administration to the skin, on a mucous membrane, in a body cavity, in the connective tissue, in an organ or in the bloodstream.
25) Verfahren zur Herstellung eines Vektorkomplexes, enthaltend folgende Komponenten: a) eine Nukleinsäuresequenz beliebiger Länge; b) einen kationischen Träger; c) ein Polymer, welches mehr als 3 kationische und mehr als 3 anionische Ladungen besitzt; und e) optional einen Liganden, welcher an die Komponente a) oder die Komponente b) oder die Komponente c) bindet und zugleich eine Bindungsstelle für eine Zielzelle hat; wobei folgende Verfahrensschritte durchlaufen werden: 1. gegebenenfalls Mischung von Komponente d) mit Komponente a), b) und/oder c) im molaren Verhältnis [d):a), b) und/oder c)] von 1 :1 bis 1000:1 , vorzugsweise zwischen 10:1 und 100:1 ;25) Method for producing a vector complex, comprising the following components: a) a nucleic acid sequence of any length; b) a cationic carrier; c) a polymer which has more than 3 cationic and more than 3 anionic charges; and e) optionally a ligand which binds to component a) or component b) or component c) and at the same time has a binding site for a target cell; the following process steps are carried out: 1. optionally mixing component d) with component a), b) and / or c) in a molar ratio [d): a), b) and / or c)] of 1: 1 to 1000 : 1, preferably between 10: 1 and 100: 1;
2. Mischung von Komponente a), entweder alleine oder im Komplex mit Komponente d), mit Komponente b), entweder alleine oder im Komplex mit Komponente d); bevorzugterweise im molaren Verhältnis [a) ±d):b)2. Mixture of component a), either alone or in a complex with component d), with component b), either alone or in a complex with component d); preferably in the molar ratio [a) ± d): b)
±d)] von 1 :1 bis 1 :1000, wobei das Mischungsverhältnis so eingestellt werden soll, daß die Nettoladung des resultierenden Gesamtkomplexes vorzugsweise entweder kationisch oder anionisch ist; und± d)] from 1: 1 to 1: 1000, the mixing ratio being adjusted so that the net charge of the resulting overall complex is preferably either cationic or anionic; and
3. Mischung des aus Schritt 2) resultierenden Komplexes mit der Komponente c), entweder alleine oder im Komplex mit d), und zwar so, daß die Komponente c) im Überschuß vorliegt, wobei die Nettoladung des aus Schritt 2) resultierenden Komplexes durch Schritt 3) komplett neutralisiert wird. 3. Mixing the complex resulting from step 2) with component c), either alone or in complex with d), in such a way that component c) is present in excess, the net charge of the complex resulting from step 2) being obtained by step 3) is completely neutralized.
PCT/EP2000/005371 1999-06-24 2000-06-10 Novel vector complexes and their use in gene therapy WO2001000241A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2001505948A JP2003503362A (en) 1999-06-24 2000-06-10 Novel vector conjugates and their use for gene therapy
AU61496/00A AU6149600A (en) 1999-06-24 2000-06-10 Novel vector complexes and their use in gene therapy
EP00947840A EP1196618A2 (en) 1999-06-24 2000-06-10 Novel vector complexes and their use in gene therapy

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE1999129104 DE19929104A1 (en) 1999-06-24 1999-06-24 Vector complex, useful for gene therapy of e.g. tumors, comprises nucleic acid, cationic carrier, charged polymer and targeting ligand
DE19929104.7 1999-06-24

Publications (2)

Publication Number Publication Date
WO2001000241A2 true WO2001000241A2 (en) 2001-01-04
WO2001000241A3 WO2001000241A3 (en) 2001-08-09

Family

ID=7912489

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2000/005371 WO2001000241A2 (en) 1999-06-24 2000-06-10 Novel vector complexes and their use in gene therapy

Country Status (5)

Country Link
EP (1) EP1196618A2 (en)
JP (1) JP2003503362A (en)
AU (1) AU6149600A (en)
DE (1) DE19929104A1 (en)
WO (1) WO2001000241A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004045583A1 (en) * 2002-11-15 2004-06-03 Nipro Corporation Liposome
JP2005298486A (en) * 2004-03-15 2005-10-27 Nipro Corp Liposome-containing medicinal composition for treating cancer

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4847240A (en) * 1978-01-16 1989-07-11 The Trustees Of Boston University Method of effecting cellular uptake of molecules
US5354844A (en) * 1989-03-16 1994-10-11 Boehringer Ingelheim International Gmbh Protein-polycation conjugates
US5574142A (en) * 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
WO1997012051A1 (en) * 1995-09-28 1997-04-03 Rhone-Poulenc Rorer S.A. Pharmaceutical composition useful for nucleic acid transfection, and use thereof
WO1998006869A1 (en) * 1996-08-14 1998-02-19 The Children's Hospital Of Philadelphia Non-viral vehicles for use in gene transfer
EP0846772A1 (en) * 1996-11-29 1998-06-10 Hoechst Aktiengesellschaft Multifunctional ligand system for cell-specific transfer of nucleic acid
US5972707A (en) * 1994-06-27 1999-10-26 The Johns Hopkins University Gene delivery system

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4119590A (en) * 1975-05-22 1978-10-10 Toyo Soda Manufacturing Co., Ltd. Process for producing a polyion complex having a nucleic acid base
US5908777A (en) * 1995-06-23 1999-06-01 University Of Pittsburgh Lipidic vector for nucleic acid delivery
DE19605279A1 (en) * 1996-02-13 1997-08-14 Hoechst Ag Target cell-specific vectors for the introduction of genes into cells, drugs containing such vectors and their use
GB9623051D0 (en) * 1996-11-06 1997-01-08 Schacht Etienne H Delivery of DNA to target cells in biological systems

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4847240A (en) * 1978-01-16 1989-07-11 The Trustees Of Boston University Method of effecting cellular uptake of molecules
US5354844A (en) * 1989-03-16 1994-10-11 Boehringer Ingelheim International Gmbh Protein-polycation conjugates
US5792645A (en) * 1989-03-16 1998-08-11 Boehringer Ingelheim International Gmbh Protein-polycation nucleic acid complexes and methods of use
US5574142A (en) * 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5972707A (en) * 1994-06-27 1999-10-26 The Johns Hopkins University Gene delivery system
WO1997012051A1 (en) * 1995-09-28 1997-04-03 Rhone-Poulenc Rorer S.A. Pharmaceutical composition useful for nucleic acid transfection, and use thereof
WO1998006869A1 (en) * 1996-08-14 1998-02-19 The Children's Hospital Of Philadelphia Non-viral vehicles for use in gene transfer
EP0846772A1 (en) * 1996-11-29 1998-06-10 Hoechst Aktiengesellschaft Multifunctional ligand system for cell-specific transfer of nucleic acid

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
BONFILS E ET AL: "DRUG TARGETING: SYNTHESIS AND ENDOCYTOSIS OF OLIGONUCLEOTIDE- NEOGLYCOPROTEIN CONJUGATES" NUCLEIC ACIDS RESEARCH,GB,OXFORD UNIVERSITY PRESS, SURREY, Bd. 20, Nr. 17, 11. September 1992 (1992-09-11), Seiten 4621-4629, XP000461068 ISSN: 0305-1048 *
DASH P R ET AL: "Factors affecting blood clearance and in vivo distribution of polyelectrolyte complexes for gene delivery." GENE THERAPY, Bd. 6, Nr. 4, April 1999 (1999-04), Seiten 643-650, XP000982444 ISSN: 0969-7128 *
GOTTSCHALK S ET AL: "A NOVEL DNA-PEPTIDE COMPLEX FOR EFFICIENT GENE TRANSFER AND EXPRESSION IN MAMMALIAN CELLS" GENE THERAPY,GB,MACMILLAN PRESS LTD., BASINGSTOKE, Bd. 3, Nr. 5, 1. Mai 1996 (1996-05-01), Seiten 448-457, XP000577712 ISSN: 0969-7128 *
GUPTA P K ET AL: "ALBUMIN MICROSPHERES II: APPLICATIONS IN DRUG DELIVERY" JOURNAL OF MICROENCAPSULATION,GB,TAYLOR AND FRANCIS INC. LONDON, Bd. 6, Nr. 4, 1. Oktober 1989 (1989-10-01), Seiten 463-472, XP000086853 ISSN: 0265-2048 *
HAN JUNGHEE ET AL: "Receptor-mediated gene transfer to cells of hepatic origin by galactosylated albumin-polylysine complexes." BIOLOGICAL & PHARMACEUTICAL BULLETIN, Bd. 22, Nr. 8, August 1999 (1999-08), Seiten 836-840, XP000979353 ISSN: 0918-6158 *
HAN JUNGHEE ET AL: "Receptor-mediated gene transfer to cells of hepatic origin by galactosylated albumin-polylysine conjugates." PHARMACEUTICAL RESEARCH (NEW YORK), Bd. 14, Nr. 11 SUPPL., November 1997 (1997-11), Seite S55, Zusammenfassung Nummer 1171, XP000982439 & Annual Meeting of the American Association of Pharmaceutical Scientists; Boston, US; November 2-6, 1997 ISSN: 0724-8741 *
KINSEY B. ET AL: "Polmethyleneimine conjugated to macroaggregated albumin mediates high level transfection in vitro and in vivo" PROCEEDINGS OF THE CONTROLLED RELEASE SOCIETY, 1999, NO. 26, PAGE(S) 619-620, XP000982539 & INTERNATIONAL SYMPOSIUM ON CONTROLLED RELEASE BIOACTIVE MATERIALS, 20. - 25. Juni 1999, BOSTON, US *
SANDIG M ET AL: "The homophilic binding site of the neural cell adhesion molecule NCAM is directly involved in promoting neurite outgrowth from cultured neural retinal cells" JOURNAL OF BIOLOGICAL CHEMISTRY,US,AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, Bd. 269, Nr. 20, 20. Mai 1994 (1994-05-20), Seiten 14841-14848, XP002104481 ISSN: 0021-9258 *
SHEN W -C ET AL: "CONJUGATION OF POLY-L-LYSINE TO ALBUMIN AND HORSERADISH PEROXIDASE:A NOVEL METHOD OF ENHANCING THE CELLULAR UPTAKE OF PROTEINS" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES,NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC,US, Bd. 75, Nr. 4, April 1978 (1978-04), Seiten 1872-1876, XP000953474 ISSN: 0027-8424 *
WU C H ET AL: "TARGETING GENES: DELIVERY AND PERSISTENT EXPRESSION OF A FOREIGN GENE DRIVEN BY MAMMALIAN REGULATORY ELEMENTS IN VIVO" JOURNAL OF BIOLOGICAL CHEMISTRY,US,AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, Bd. 264, Nr. 29, 15. Oktober 1989 (1989-10-15), Seiten 16985-16987, XP002030967 ISSN: 0021-9258 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004045583A1 (en) * 2002-11-15 2004-06-03 Nipro Corporation Liposome
JPWO2004045583A1 (en) * 2002-11-15 2006-03-16 ニプロ株式会社 Liposome
JP4848637B2 (en) * 2002-11-15 2011-12-28 ニプロ株式会社 Liposome
JP2005298486A (en) * 2004-03-15 2005-10-27 Nipro Corp Liposome-containing medicinal composition for treating cancer

Also Published As

Publication number Publication date
AU6149600A (en) 2001-01-31
JP2003503362A (en) 2003-01-28
EP1196618A2 (en) 2002-04-17
DE19929104A1 (en) 2000-12-28
WO2001000241A3 (en) 2001-08-09

Similar Documents

Publication Publication Date Title
DE69535540T2 (en) COMPOSITION CONTAINING NUCLEIC ACIDS AND CATIONIC POLYMERS, PREPARATION AND USE
DE69635609T2 (en) NUCLEIC ACID COMPOSITION, MANUFACTURE AND USE
Behr Synthetic gene transfer vectors II: back to the future.
DE60032739T2 (en) IMMUNOLIPOSOME WITH A TARGETING ANTIBODY FRAGMENT FOR SYSTEMIC GENERIC ADMINISTRATION
CN109475646A (en) Lipid nanoparticle preparation for CRISPR/CAS ingredient
AU705816B2 (en) Peptides which enhance transport across tissues and methods of identifying and using the same
CN112040988A (en) Modified AAV capsid polypeptides for the treatment of muscle diseases
DE69822473T2 (en) LIPID-POLYAMIDE CONJUGATES AND COMPOSITIONS FOR ADMINISTRATING NUCLEIC ACID MOLECULES
WO2017136520A1 (en) Mitochondrial genome editing and regulation
JP2002515418A (en) Polymer gene carrier for polyethylene glycol conjugated poly-L-lysine targeting hepatocytes
DD294969A5 (en) THERMALLY STABLE CYTOSINE DEAMINEASE
JP2000506865A (en) Targeted delivery of genes encoding interferons
KR20130103562A (en) Compositions of a peptide targeting system for treating cancer
EP0905254A2 (en) DNA vector associated with biocompatible low molecular weight polyethyleneimines
DE112016002962T5 (en) Family of ATP-binding cassette-encoding polyribonucleotides and formulations thereof
EP1270586B1 (en) Composition for the cell-specific transfer of active substances
KR19990063814A (en) Pharmaceutical compositions useful for nucleic acid transfection and uses thereof
US8796027B2 (en) Nucleic acid complex and method of introducing nucleic acid into cell using the same
MXPA01012802A (en) Copolymers for the transfer of nucleic acids to the cell.
EP1196618A2 (en) Novel vector complexes and their use in gene therapy
DE19856052A1 (en) Conjugate for enrichment in neuronal cells
DE19850718C1 (en) Cell permeability-mediating polypeptide
EP1007549B1 (en) Compositions and methods for highly efficient transfection
JP2022502081A (en) Genetically engineered microorganisms and how to make and use them
DE19925143A1 (en) New liposomal vector complexes and their use for gene therapy

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 2000947840

Country of ref document: EP

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 505948

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 2000947840

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 2000947840

Country of ref document: EP