DE19929104A1 - Vector complex, useful for gene therapy of e.g. tumors, comprises nucleic acid, cationic carrier, charged polymer and targeting ligand - Google Patents

Abstract

A vector complex (A) comprising a nucleic acid sequence (I) of any suitable length, a cationic carrier (II), a polymer (III) with more than 3 each of cationic and anionic charges, and optionally a ligand (IV) that binds to any of (I)-(III) and includes a binding site for a target cell, is new. A vector complex (A) comprising a nucleic acid sequence (I) of any suitable length, a cationic carrier (II), a polymer (III) with more than 3 each of cationic and anionic charges, and optionally a ligand (IV) that binds to any of (I)-(III) and includes a binding site for a target cell, is new. (A) is produced by: (a) mixing (IV) with (I), (II) and/or (III) at mole ratio (IV): other components 1-1000:1, preferably 10-100:1; (b) mixing (I), alone or as a complex with (IV), with (II), alone or as a complex with (IV), particularly at mole ratio (I):(II) of 1:1-1000 which is adjusted so that the net charge on the complex formed is cationic or anionic; and (c) mixing the complex from (b) with (III), alone or complexed with (IV), so that (III) is present in excess and the net charge of the complex from (b) is neutralized completely. An Independent claim is also included for the preparation of (A).

Description

introduction

So far, the essential components of vectors for gene therapy are Nucleic acid sequences which are linked to a non-viral carrier (e.g. cationic Lipids or cationic polymers) complexed or inserted into a virus.

Previous experience with such vectors in gene therapy various diseases, especially tumor diseases, shows that after administration of a gene therapy vector in the circulation of an organism, this vector must be eliminated from the circulation in a short time and not for binding to the target cells and for transfecting these target cells more is available (Ogris et al. Gene Ther. 6: 595, 1999; Dash et al., Gene Ther. 6: 643, 1999; Li et al., Gene Ther. 5: 930, 1998; Liu et al. Gene Ther. 4: 517, 1997).

This elimination can be done by degradation of the DNA or by rapid Deposition of the vectors in the lungs, liver or the so-called reticuloendothelial system (RES), which is specially developed in the spleen and the lymph nodes (Zhu et al., Science 261: 209, 1993).

The causes of rapid elimination are varied. You can be one too large negative or positive charge, too large a volume or opsonization the vector particles through blood proteins. With viral vectors, they can also be the binding of the virus envelope proteins to virus-specific receptors in the Organs and / or antibodies or immune cells specific for the viruses, which bind to the vectors and thereby eliminate them.

Previous experience also shows that the coupling or insertion of a target cell-specific ligands in the vector complex whose rapid elimination not significantly reduced after administration to the bloodstream.  

Knowing these problems, there is an urgent need for new ones Preparations of vectors which make it possible for vectors to last as long as possible Cycle remain and cannot be eliminated prematurely from the cycle. To the Elimination of cationic lipids or cationic polymers in complex with To reduce nucleic acid sequences from the bloodstream Polyethylene glycol (Senior et al., Biochim. Biophys. Res. Acta 1062: 77, 1991; Mori et al., FEBS Lett 284: 263, 1991; Ogris et al., Gene Ther. 6: 595, 1999), vinyl polymers (Torchilin et al., Biochim. Biophys. Res. Acta 1195: 181, 1994) or others amphipathic polymers (Woodle et al., Bioconjugat. Chem. 5: 493, 1994) to the cationic lipids or cationic polymers coupled or negative with the help charged lipids produced anionic liposomes into which the Nucleic acid sequences in complex with cationic lipids or cationic Polymers were included (U.S. Patent No. 4,946,787; U.S. Patent No. 4,245,737; U.S. Patent No. 5,480,463; Heywood and Eanes, Calc. Tissue int. 40: 149, 1992; Lee and Huang, J. Biol. Chem. 271: 8481, 1996; Balicki and Beutler, Blood 88: 3884, 1996; Lucie et al., J. Lip. Res. 8: 57, 1998; Lakkaraju et al., J. Lip. Res. 8: 74, 1998; Turner et al., J. Lip. Res. 8: 114, 1998; Schoen et al., J. Lip. Res. 8: 485, 1998).

Such modifications led to a stabilization of the Vector particle size, inhibited the aggregation of the vectors with themselves or with blood cells, reduced the opsonization of vectors by binding Protect immunoglobulins, complement factors, fibrinogen or fibronectin (adeno) viral vectors before elimination by antibodies (Chillon et al., Gene Ther. 5: 995, 1998) and caused the blood residence time to be increased from Vectors, a significantly stronger accumulation in subcutaneously growing tumors and a transduction of the tumor cells (Ogris et al., Gene Ther. 6: 595, 1999).

At the same time, however, a considerable amount could also be found in the lungs, spleen and liver Enrichment of the vectors and transduction of the tissue cells in these organs are found (Ogris et al., Gene Ther. 6: 595, 1999) so that it can be concluded may, for example, the coupling of PEG is an improvement, but does not yet optimize the distribution of vectors.  

General description of the invention

The invention relates to a new vector for gene therapy consisting of the following components:

• a) a nucleic acid sequence of any length, possibly as part of a virus;
• b) a cationic carrier; and
• c) a polymer which has more than 3 cationic and more than 3 anionic Owns charges.

Component a) can be an unmodified or modified DNA sequence or be an unmodified or modified RNA sequence. The nucleotide sequence can have an anti-DNA (triplex) or anti-RNA (antisense; ribozyme) function or code for an RNA sequence acting in this way or for a protein. The Nucleotide sequences and their modification can be such that the Nucleotide sequence is largely resistant to degradation by DNAsen or RNase. Examples of such nucleotide sequences and their modifications are shown in Breaker, Nature Biotechnol. 15: 427, 1997; Gerwik, Critical Reviews in Oncogenesis 8: 93, 1997; Mukhopadhyay et al., Crit. Rev. Oncogen. 7: 151, 1996; Mercola et al., Cancer Gene Ther. 2: 47, 1995; Frank-Kamenetski, Annu. Rev. Biochem. 64: 65, 1995 and Fraser et al., Exp. Opin. Invest. Drugs 4: 637, 1995. The DNA Sequence can be linear or circular, for example in the form of a plasmid.

Component a) can also be a virus, preferably a virus, in which with the methods known to those skilled in the art is foreign to the virus Nucleic acid sequence was inserted. Examples of such viruses are RTV, AV, AAV, HSV, vaccinia viruses, immuno viruses. Such and other examples are from Vile, Nature Biotechnol. 15: 840, 1997; MeKeon et al., Human Gene Ther. 7: 1615, 1996; Flotte et al., Gene Ther. 2: 357, 1995; Jolly, Cancer Gene Ther. 1:51, 1994; Dubensky et al., J. Virol. 70: 508, 1996.

Component b) represents any cationic carrier. Examples of such cationic carriers are

• Cationic lipids, for example described by Kao et al., Oncology Reports 5: 625, 1998, Liu et al., J. Biol. Chem. 270: 24864, 1995; Felgner, Human Gene Ther. 7: 1791, 1996; Ledley, Human Gene Ther. 6: 1129, 1995; Goyal et al., J. Liposome. Res. 5: 49, 1995; Thierry et al., Gene Ther. 4: 226, 1997; Schofield et al., Br. Med. Bull. 51: 56, 1995; Behr, Bioconj. Chem. 5: 382, 1994; Cotten et al., Curr. Opin biotechnol. 4: 705, 1993; San et al., Human Gene Ther. 4: 781, 1993 or
• - Cationic polymers, for example described by Boussif et al., Proc. Natl. Acad. Sci. USA 92: 7297, 1995; Kaneda et al., Science 243: 375, 1989; Keown et al., Methods in Enzymology 185: 527, 1990; Baker et al., Gene Ther. 4: 773, 1997; Fritz et al., Human Gene Ther. 7: 1395, 1996; Wolfert et al., Human Gene Ther. 7: 2123, 1996 and Solodin et al., Biochem. 34: 13537, 1995.
  Cationic polymers also include, for example, cationized albumin. The production and use of cationized albumin has been described in patent application EP-A 0 790 312.

In a particular embodiment of this invention, component b) is adjusted Polyethyleneimine (PEI), in a further special embodiment of this Invention, the polyethyleneimine has a molecular weight in a range of 500-20,000 Da and in another embodiment a molecular weight of an average of about 2000 Da and was manufactured as in the patent application EP-A 0 905 254.

Component c) represents any polymer with more than 3 cationic and more as 3 anionic charges. In contrast to the prior art (US Patent No. 3,155,474) the ratio of cationic to anionic charges is said to be only in fluctuate between 3:10 and 10: 3. The ratio is preferably 1 (± 20%): 1 (± 20%) to use. The charges can be uneven, random or also be evenly distributed over the polymer. Preferred in the sense of the ending are polymers with an even distribution of the cationic and anionic charge. Polymers are also preferred for the purposes of the invention with cationic and anionic charge, their isoelectric point in the pH range  from 3-9. Furthermore preferred in the sense of the invention are polymers with cationic and anionic charge, whose isoelectric point is in the pH range of 3-7 lies. In a special embodiment, the invention Polymer albumin. This albumin can be isolated from the blood or recombinant be made. In a further special embodiment, the albumin purified human albumin from the serum. The cleaning and the properties of albumin are, for example, in T. Peters in F. W. Putnam "The Plasma Proteins ", Academic Press, New York 1975, pp. 133-181. Human serum albumin is a single chain polypeptide chain (610 amino acids) with an isoelectric point of 4.7 and about 101 positive and 101 negative charges, which are evenly distributed over the entire polypeptide chain are.

According to this invention, component a) is combined with component b) complexed and this complex in turn complexed with component c). A is another embodiment of the invention, the complexes of components a) and b) in liposomes, preferably anionic liposomes [prepared for example as in U.S. Patent No. 4,946,787, U.S. Patent No. 4,245,737, U.S. Patent No. 5,480,463, Heywood and Eanes, Calc. Tissue int. 40: 149, 1992; Lee and Huang, J. Biol. Chem. 271: 8481, 1996; Balicki and Beutler, Blood 88: 3884, 1996; Lucie et al., J. Lip. Res. 8: 57, 1998; Lakkaraju et al., J. Lip. Res. 8: 74, 1998; Turner et al., J. Lip. Res. 8: 114, 1998; Schoen et al., J. Lip. Res. 8: 485, 1998, with which the Methodology known to those skilled in the art [described, for example, by Li and Huang, J. Lip. Res. 7, 63 (1997) or US Patent No. 4,946,787] and these Complex liposomes with component c).

The invention furthermore relates to the addition of the invention Preparation of vectors by adding a component d).

This component d) represents a ligand which with component a) or component b) or component c) binds and at the same time one Has binding site for the target cell.  

Such ligands can be

• - Multi-functional ligand systems for the target cell-specific transfer of Nucleotide sequences described in EP-A 0 846 772
• Single-chain, double-antigen-binding molecules described in DE 198 16 141.7, still unpublished
• - specifically cell membrane-penetrating molecules described in DE 198 50 987.1, still unpublished or
• Target cell-specific, multivalent proteins described in DE 199 10 419.0, yet unpublished

Reference is expressly made to the patent applications listed here.

However, component d) can also be in a liposome, preferably an anionic Liposome, for example as in U.S. Patent No. 5,252,348 and 5,753,258.

For this purpose, the target cell-specific protein or peptide is selected from one of the previously mentioned groups to conjugate to a lipid, for example as in US U.S. Patent No. 5,662,930. In a special embodiment of the Invention is the target cell-specific protein or peptide with a fusiogenic peptide connected and this in turn with a lipid. Examples of fusiogenic peptides are in patent applications EP-A 0 846 772 and DE 198 50 987.1 (still unpublished) described in detail. The conjugation of the target cell specific Protein or peptide with a fusiogenic peptide is preferably made by the Expression as a recombinant fusion protein with those known to the person skilled in the art Methods.

The vector according to the invention consisting of components a), b) and c) or a), b), c) and d) is produced, for example, in such a way that

• - In the 1st step component d) with component a), b) and / or c) in the molar Ratio [d): a), b) and / or c) j from 1: 1 to 1000: 1, preferably between 10: 1 and 100: 1 is mixed, hereinafter  
• - in step 2 component a) [either alone or in a complex with component d)] mixed with component b) [in complex with component d) or alone)] is preferably in the molar ratio [a) (± d): b) (± d)] of 1: 1 to 1: 1000, the mixing ratio should be set so that the Net charge of the resulting overall complex preferably either is cationic or anionic and subsequent
• - in step 3, the complex with component c) resulting from step 2) is mixed [in complex with d) or alone)] in such a way that the Component c) is in excess, measurable by the fact that the net charge of the complex resulting from step 2) completely neutralized by step 3) , preferably that the mixture resulting from step 3) of free Albumin and albumin-containing complexes are slightly anionic to neutral Has net charge, further preferably the albumin-containing complex has its isoelectric point in the pH range of 4-7.

Such vector complexes according to the invention are characterized by their component c) largely shielded, d. H. their binding and transfection and transduction of Cells that do not have a receptor for component d) within the Carrying vector complex according to the invention is largely reduced.

As a result, after administration of the vector complexes according to the invention in an organism, either locally, on the skin, into an organ, into a body cavity, into a connective or supporting tissue or in the bloodstream, the dwell time clearly prolonged, for example to several after administration in the bloodstream Hours to a few days.

Over this long dwell time, those of the invention accumulate Vector complexes, for example, in the tumor vessel bed due to the so-called "passive targeting" (Unezaki et al., Int. J. Pharmaceutics 114: 11, 1996; Sadzuka et al., Cancer Lett. 127: 99, 1998 and Wunder et al., Int. J. Oncol. 11: 497, 1997).  

Furthermore, and regardless of passive targeting, they bind Vector complexes according to the invention via their component d) to the target cell and translate these to release the nucleic acid sequence in the invention Vector complex.

Depending on the composition, this nucleic acid sequence can be in the target cell Develop effect, d. H. for example the transcription or translation of a inhibit certain genes or a certain RNA, or the cell transduce to the expression of the RNA or the protein encoded by this Nucleic acid sequence.

The vector complexes according to the invention are therefore preferably suitable for the in Vivo administration for the prophylaxis or therapy of diseases.

Examples to illustrate the idea of the invention

The following examples illustrate how to practice the present invention could.

example 1 Preparation of a vector complex with one plasmid and one target cell-specific multivalent protein Production of component a)

The plasmid expression system "pGL3" from Promega was used as component a) and contains the following nucleotide sequences:

• - SV40 promoter and enhancer (Genbank SV40 circular genome; NIDg 965480: nucleotides 5172-294)
• - the cDNA for luciferase
• - SV40 poly A signal

Using the methods known to the person skilled in the art, the plasmid in E. coli bacteria introduced, the bacteria multiplied in culture medium and the plasmids isolated.  

Production of component b)

Low molecular weight polyethyleneimine (PEI-2000) was produced as in the Patent application EP-A 0 905 254 described. For this, a 10% Ethyleneimine monomer solution in water (5 ml ethyleneimine monomer + 45 ml distilled water, dissolution with stirring) with the addition of 1% (0.5 ml) concentrated hydrochloric acid (37 ° C) as a catalyst for 4 days at 50 ° C, evaporated and dried under vacuum at room temperature. The Molecular weight determinations were made using laser scattered light measurement (Wyatt Dwan DSP light scattering photometer) at 633 nm after direct injection into a K5 Measuring cell carried out. The molecular weights are determined based on those in toluene Calibration constants and the known sample weight determined.

Molecular weight determination using light scattering analysis gave 2000 Da. By comparison, the PEI obtained commercially (from Fluka, Neu Ulm) had one Molecular weight according to the light scattering analysis of 791 kDa (HMW PEI).

Production of component c)

Human albumin 20% from Centeon was used as the polymer.

Production of component d)

A multi-functional ligand is produced as component d) as in FIG Patent application EP-A 0 846 772.

1) Production of the cell-specific ligand (ZS)

The hybridoma of the anti-NCAM monoclonal antibody 575/100/2 (Behringwerke) serves as the starting material for the ZS ligand. About 10 ⁷ cells of this hyridome are centrifuged off and the mRNA is extracted from these cells with the aid of an mRNA extraction kit (eg from Pharmacia, Gibco, Qiagen). This mRNA is then transcribed into cDNA by reverse transcription using a cDNA synthesis kit and "random" hexaoligonucleotides (Pharmacia). This cDNA serves as a starting material for using variable primers (Clackson et al., Nature 352: 624, 1991) to use the variable heavy chain or the variable light chain of the immunoglobulins by means of a polymerase chain reaction (Saiki et al., Science 230: 1350, 1985 ) to amplify. Restriction sites are simultaneously introduced through the primers in order to clone the fragments into a bacterial expression vector (e.g. pHENIS, which is derived from pHEN1) (Hoogenboom et al., Nucl. Acids Res. 19: 4133, 1991). It contains a pelB signal sequence for periplasmic secretion, a histidine tag for purification using immobolized metal affinity chromatography (IMAC) and a cloning region for the heavy and light chain between a short sequence that codes for a 14 amino acid long glycine serine linker . Furthermore, the fusion with the g3p protein for the "display" takes place on the surface of bacteriophages. The heavy and light chains are digested with the appropriate restriction enzymes (VH with Sfil and Xhol; VL with ApaL1 and Notl) and successively cloned into the vector. This creates a recombinant single-chain Fv fragment consisting of the variable heavy chain and light chain, which are covalently linked by a short peptide sequence.

2) Production of the gene construct-specific ligand (GS)

Recombinant antibodies with specificity for N6-methyladenine are derived from naive or semi-synthetic antibody libraries (Nissim et al., EMBO J. 13: 692, 1994) selected by biopanning on N6-methyladenine-BSA or KLH conjugates. The Positive antibody fragments are identified by ELISA in antigen-coated microtiter plates (Nissim et al., EMBO J. 13: 692, 1994). Antibodies from these libraries are already in the desired single chain Fv format and can be used directly for further cloning.

3) Production of the linker

A fusogenic peptide with the amino acid sequence GLFEALLELLESLWELLLEA (SEQ ID NO .: 1) serves as the linker. The coding DNA for this peptide is produced as a double-stranded, synthetic oligonucleotide, with suitable restriction cleavage sites (Ascl and Xbal) being appended to the ends. For this, the two synthetic oligonucleotides
O1 (5'GGCCGCAGGCTTATTTGAGGCCCTTCTGGAATTGCTAGAGAGCCTCTGGG AATTGCTTCTGGAGGCAT; SEQ ID NO .: 2) and
O2 (5'CTAGATGCCTCCAGAAGCAATCCCAGAGGCCTCTAGCAATTCCAGAAGGG CCTCAAATAAGCCTG; SEQ ID NO .: 3) with T4 polynucleotide kinase (e.g. Gibco) according to the manufacturer's instructions, phosphorylated, heated to 80 ° C for 5 min and slowly cooled to room temperature. This double-stranded DNA fragment is used directly for further cloning.

4) Preparation of the fusion protein

The complete ligand system is expressed in the expression vector pAB1 (which is similar to pHENIS is built up, but has no fusion with g3p) z. B. in the form of a 3- Fragment cloning made. The anti-NCAM serves as the starting material single-chain Fv fragment (ZS ligand), which with the restriction enzymes Sfil and Notl was cut the synthetic linker fragment that the Contains cloning sites Notl and Xbal, and the anti-N6-methyaladenine single chain Fv fragment (GS ligand). The GS fragment is used for cloning reamplified with primers containing the restriction sites at the N and C terminus Insert Xbal or Ascl. These fragments are in the with the Restriction enzymes Sfil and Ascl cloned pAB1 vector cloned. The The construct is made into suitable bacterial strains, e.g. B. E. coli TG1. The The expression of the ligand system is regulated via the bacterial lacZ- Promoter and is induced by the addition of IPTG (as described e.g. in McCafferty et al., Appl. Biochem. Biotech. 47: 157, 1994). The expressed protein is purified from periplasmic preparations using IMAC (see Griffiths et al., EMBO J. 13: 3245, 1994). The total protein has a molecular weight of approximately 55,000 and is available as a monomer.

5) Functional test of the fusion protein

The protein recognizes NCAM-expressing tumor cells such as B. that of the small cell Bronchial carcinoma and it binds to N6-methylated DNA by propagation  the plasmid is made in bacteria. The ligand system is through Incubation of the fusion protein with the DNA. Binding to the Tumor cells or DNA can be checked using immunofluorescence or ELISA become. By binding the fusion protein to plasmid DNA, which is a reporter gene contains [e.g. B. luciferase (see component a)], a ligand system is formed which in is able to bind to the tumor cells. After including the complexes in the The linker-mediated release from the endosomes takes place in the cell Transcription and expression of the effector gene leads. The binding of the Ligand system to the cell and uptake into the cell can be Detect the use of fluorescence-labeled fusion protein and the Functionality of the system takes place through the detection of the enzymatic activity by Luciferase.

Production of the vector complex

Plasmids [component a)] are at a concentration of 109 plasmids / ml physiological saline suspended. Shake into the suspension the multifunctional ligand [component d)] dissolved in physiological Add saline in portions until a molar ratio of about 1:10 (plasmid: multifunctional ligand) is reached.

The component a) / component d) complex or component a) is then [component b)] PEI-2000 (1 mg / ml physical saline with 1 N HCl. adjusted to pH 7.4) added in portions until a complete Cationization of the resulting complexes [component a) + d) + b) or Component a) + b)] is reached.

The cationization is determined in the agarose shift assay, in which 50 ul Aliquots are applied to an approximately 0.5 cm thick gel of 1% (w / v) agarose and in Tris-EDTA buffer pH 7.4 is developed at 80 mV for 2 h. The location of the DNA was visualized at 254 nm after reaction with ethidium bromide.

The cationic complexes from components a) + d) + b) are then in an excess of component c) suspended and for at least 48 hours  incubated at 4 ° C. In this excess, complexes form from the components a) + d) + b) + c), which have a neutral to slightly anionic charge. This Charge is controlled in the agarose shift assay and should be in the range between pH 4 and 7 are.

Then the vector complex according to the invention [component a) + d) + b) + c)] usable. The vector complex component a) + b) is used as a control.

Example 2 Biological testing of the vector complex 1) Investigations on culture cells

Tumor cells expressing NCAM (small cell bronchial carcinoma), melanoma cells (MeWo) and fibroblasts (3T3) were in the cell culture with the expert known cell culture technology multiplied and isolated.

Complexes with components a) + d) + b) + c) or (for control) with the Components a) + b) are in excess (ratio about 20: 1) to the cells given and the mixture incubated at 37 ° C for 1 hour. Below are the Washed cells and for another 60 hours in fresh cell culture medium incubated.

Then the successful uptake of the complexes into the cell, the Transcription and expression of the reporter gene in the plasmid by detection of the Luciferase using the method known to those skilled in the art and after specifying the Promega determined.

The following results are achieved:

About 15% of the cells which have been incubated with control complexes show an expression of luciferase. This is in tumor cells expressing NCAM about the same as in the other cells.

In contrast to this, only NCAM-positive cells showing the vector complex according to the invention [component a) + d) + b) + c)] are incubated,  a clear expression of luciferase. In contrast, there is none in the control cells or only a slight expression.

Component c) in the vector complex according to the invention therefore does not prevent this ligand-specific transfection of cells.

2) Examination of blood retention time in mice

Mice (NMRI) become the complexes of the invention in the tail vein [Component a) + b) + c)] or to control complexes with components a) + b) injected. The dose is 50 µg of component a) in each complex Mouse, the suspension medium physiological saline that Application volume 250 µl.

The animals are anesthetized 30 minutes and 2 hours after the injection exsanguinated. The blood collected is treated with sodium citrate (final concentration 25 mM) and the blood plasma from the blood cells by centrifugation (10 min. 1000 g) separated. The DNA is extracted from the whole blood or from the blood plasma using the QIAamp tissue kits (Qiagen, Hilden) isolated.

For this purpose, 10 µl heparin (1000 IU7MI Novo Nordisk) during the initial incubation at 70% added to the plasmid Isolate DNA quantitatively. Samples of the isolated DNA were on 0.8% agarose gel applied and analyzed by Southern blot as detailed in Obris et al. 1999 described.

Results

While after the administration of the control preparation only after 0.5 hours Traces of plasmid DNA are detectable in the blood plasma Animals administered with the complexes according to the invention after 0.5 and also considerable amounts of DNA are detected after 2 hours.  

These results show that the vector complexes according to the invention, such as desired, characterized by a significant increase in blood retention.

Claims (25)

1. Vector complex containing the following components:

• a) a nucleic acid sequence of any length;
• b) a cationic carrier;
• c) a polymer which has more than 3 cationic and more than 3 anionic charges; and
• d) optionally a ligand which binds to component a) or component b) or component c) and at the same time has a binding site for a target cell;

available through

• 1. optionally mixture of component d) with component a), b) and / or c) in the molar ratio [d): a), b) and / or c)] of 1: 1 to 1000: 1, preferably between 10 : 1 and 100: 1;
• 2. Mixture of component a), either alone or in a complex with component d), with component b), either alone or in a complex with component d); preferably in the molar ratio [a) ± d): b) ± d)] from 1: 1 to 1: 1000, the mixing ratio being adjusted so that the net charge of the resulting overall complex is preferably either cationic or anionic; and
• 3. Mixing of the complex resulting from step 2) with component c), either alone or in complex with d), in such a way that component c) is present in excess, the net charge of the complex resulting from step 2) being obtained by step 3) is completely neutralized.

2. Vector complex according to claim 1), wherein the isoelectric point of the Polymers [component c)] is in the pH range of 3-9. 3. Vector complex according to claim 2), wherein the isoelectric point of the Polymers [component c)] is in the pH range of 3-7.   4. Vector complex according to claims 1-3), in which component c) albumin is. 5. vector complex according to claim 1-4), in which the component c) recombinantly produced human albumin. 6. vector complex according to claim 1-4), in which the component c) human Is serum albumin. 7. Vector complex according to one of claims 1-6), in which the component a) represents a DNA or RNA. 8. Vector complex according to one of claims 1-6), in which the component a) is a viral vector. 9. A vector complex according to claim 8), wherein the viral vector is selected is made up of a group comprising RTV, AV, AAV, Vaccinia V., Influenza V, HSV, Lenti V. 10. Vector complex according to one of claims 1-9), in which the cationic Carrier is a cationic lipid. 11. Vector complex according to one of claims 1-9), in which the cationic Carrier is a cationic polymer. 12. Vector complex according to claim 11), in which the cationic polymer Is polyethyleneimine (PEI). 13. A vector complex according to claim 12), wherein the molecular weight of the PEI is in a range from 500 to 20,000 Da. 14. Vector complex according to claim 13), in which the PEI has a molecular weight of 2000 Da on average.   15. Vector complex according to claim 1-14), in which the components a) and b) are inserted into a liposome and the liposome is complexed with component c) is. 16. A vector complex according to claim 15), wherein the liposome is an anionic Has charge. 17. Vector complex according to one of claims 1-16), in which the component d) is selected from a group comprising a multifunctional Ligands, a single chain, double antigen binding protein or a complexing protein. 18. Vector complex according to one of claims 1-16), in which the component d) consists of a target cell-specific ligand and a lipid and in one Liposome is inserted. 19. Vector complex according to one of claims 1-16), in which the component d) from a target cell specific ligand, a fusiogenic or translocating peptide and a lipid and inserted into a liposome is. 20. Vector complex according to claim 17-19), in which the component d) Binding to and the translocation mediated into a target cell. 21. The vector complex according to claim 20), wherein the target cell is a tissue cell Epithelial cell, an endothelial cell, a blood cell, a leukemia cell or Is tumor cell. 22. Vector complex according to one of claims 1-20), in which the isoelectric point of the complex is in the pH range of 4-7. 23. Use of a vector complex according to any one of claims 1-22) for Prophylaxis or therapy for a disease.   24. Use of the vector complex according to claim 23) for administration the skin, on a mucous membrane, in a body cavity, in the connective tissue, in an organ or into the bloodstream. 25. A method for producing a vector complex, comprising the following components:

• a) a nucleic acid sequence of any length;
• b) a cationic carrier;
• c) a polymer which has more than 3 cationic and more than 3 anionic charges; and
• d) optionally a ligand which binds to component a) or component b) or component c) and at the same time has a binding site for a target cell;

the following process steps are carried out:

• 1. optionally mixture of component d) with component a), b) and / or c) in the molar ratio [d): a), b) and / or c)] of 1: 1 to 1000: 1, preferably between 10 : 1 and 100: 1;
• 2. Mixture of component a), either alone or in a complex with component d), with component b), either alone or in a complex with component d); preferably in the molar ratio [a) ± d): b) ± d)] from 1: 1 to 1: 1000, the mixing ratio being adjusted so that the net charge of the resulting overall complex is preferably either cationic or anionic; and
• 3. Mixing of the complex resulting from step 2) with component c), either alone or in complex with d), in such a way that component c) is in excess, the net charge of the complex resulting from step 2) being obtained by step 3) is completely neutralized.