SK43297A3 - Analogs of acidic fibroblast growth factor having enhanced stability and biological activity - Google Patents

Abstract

Analogs of proteins in the FGF family are provided in accordance with the present invention. These analogs are more stable than the corresponding naturally occurring proteins. Enhanced stability may be achieved by substituting at least one amino acid having a higher loop-forming potential for an amino acid residue having a lower loop-forming potential in an identified loop-forming region in the amino acid sequence of the protein. The analogs of the present invention are especially useful in therapeutic applications.

Description

Acid fibroblast growth factor analogs having enhanced stability and biological activity

Technical field

The complex course of treatment that follows tissue damage, such as injury or burn, is mediated by a number of protein factors that are sometimes associated with soft tissue growth factors. These factors are required for the growth and differentiation of new cells to restore damaged tissue. Within the soft tissue growth cell family, a protein family of soft tissue growth factors (FGFs) is included. FGFs are mitogenic and chemotactic chemotactic for various cells of epithelial, mesenchymal and neural origin.

In addition, FGFs are angiogenic, meaning that they have the ability to stimulate blood vessel formation. Members of the FGFs family include acidic FGF, basic FGF, KGF, Int-2, HST, FGF-5, and FGF-6.

BACKGROUND OF THE INVENTION

Acidic FGF (aFGF) and Basic FGF (bFGF) are considered to be two original original members of the FGF family. Both aFGF and. The bFGFs are apparently derived from the same genetic precursor, where both molecules have approximately 55% sequence identity outside the same intron / exon structure. Acid αFGF and basic bFGF are also known to bind the same receptor, although the existence of specific αFGF and bFGF receptors has not been excluded. Several forms of aFGF and bFGF molecular weight have been discovered in various tissues. However, Southern blotting experiments confirm that there is only one gene for each aFGF and bFGF with differences between these molecules that are likely due to post-translational processing. Both acidic and basic FGF are mitogens for a wide variety of cell types of mesodermal and neuroectodermal origin and are capable of inducing angiogenesis in both environments, in vitro and in vivo (see, e.g., Gospodarowicz et al., 1979, Exp. Feye Res., 28: 501-514.

The extent of biological activities of the two classes is almost identical, although bFGF is about ten times more potent than aFGF in most bioassay systems.

KGF represents a potent mitogenic activity for various cells and binds receptors to the cell surface to Balb / MK keratinocytes to which aFGF and bFGF can also bind (Bottaro et al., 1990, J. Biol. Chem., 265: 12767-12770) . However, KGF is distinct from known FGFs (e.g., aFGF and bFGF) because it is not mitogenic to fibroblasts or endothelial cells (see Rubin et al., 1989, Proc. Natl. Acad. Sci., USA, 86: 802-806) . KGF also has various receptors on NIH / 3β fibroblasts from αFGF and bFGF receptors that do not react with KGF (see Bottaro et al., Supra).

A common feature of aFGF and bFGF is the natural tendency of these factors to bind closely to heparin. The affinity of aFGF for heparin appears to be weaker than for bFGF, where aFGF has an anionic isoelectric point (Thomas et al., 1984, Proc. Nat. Acad. Sci., USA, 82: 6409-9413). The unique binding properties of heparin to aFGF and bFGF greatly facilitated the purification of these factors.

The finding that FGFs have a strong affinity for immobilized heparin has also fueled research due to the regulatory role of heparin-like molecules in the in vivo environment of FGFs. Although the full spectrum of functions for heparin has been determined, it is known that heparin can regulate FGF function in several ways (Lobb, 1988, Eur. J. Clin. Invest., 18: 231-236). For example, heparin-like molecules may play a driving role in the function of FGF, which involves activation or enhancement of aFGFs (Uhllrich et al., 1986, Biochem. Biophys. Res. Comm., 137: 1205-1213).

However, there is no direct link between the affinity of FGF for immobilized heparin and the ability of FGF to be enhanced by soluble heparin. For this reason, the enhancing strength of heparin appears to be selective for aFGF. For example, Uhllrich (et al., 1986, supra) found that the degree of enhanced pure aFGF is about ten-fold greater than for pure bFGF, which increases the strength for aFGF to about the same level as bFGF. However, in the presence of fetal bovine serum, a significantly reduced heparin enhancing effect was found (Uhllrich et al., 1986, supra).

The use of FGF proteins appears to be effective in promoting the treatment of tissues exposed to injury. The unique angiogenic properties of FGF proteins make these factors very suitable for the treatment of deep wounds. Natural FGF proteins have been reported to be useful in the treatment of myocardial infarction (US Patents 4,269,100 and 4,378,347). In addition, human bFGF has been found to increase the ability of nerve cells to survive and extend neurites in fetal neurons of rat hippocampus, confirming that this factor may be useful in the treatment of degenerative neurological disorders such as Alzheimer's and Parkinson's disease ( Wallicke et al., 1986, Proc., Natl. Acad. Sci., USA, 83: 3012-3016).

Main. the stumbling block for the efficient use of aFGF in therapeutic applications appears to be related to its significantly reduced biological activity as compared to bFGF. Although studies with heparin suggest that the observed difference in strength between aFGF and bFGF may be substantially reduced by heparin, which increases aFGF activity to a level comparable to bFGF, however, the use of heparin in pharmaceuticals does not need to be noted that with glycosaminoglycan a heterogeneous anticoagulant , which accelerates the average rate at which antithrombin III inactivates homeostasis proteases (Jacques, 1980, Pharmacol Rev., 31: 99-166). It is not known whether the use of heparin in pharmaceutical formulations may be detrimental in the treatment of deep wounds where some degree of coagulation may be required to achieve proper treatment.

Due to the sulphate known as always appropriate, heparin is highly structured

In addition, practical cases may arise where heparin is incorporated into a pharmaceutical preparation for the treatment of deep wounds. The drug delivery concen- trations include controlling the composition of the pharmaceutical preparation (containing the combination of aFGF and heparin) at the entry into the patient's body. However, the negative effect of fetal bovine serum on the enhancing effect of heparin on aFGF (found by Uhllirich et al.) Confirms that any advantage gained by incorporating heparin into the pharmaceutical formulation as activating or enhancing factor for aFGF could be completely negated or lost by a single contact if the patient's own serum will react.

SUMMARY OF THE INVENTION

It is an object of the present invention to provide an analogue of a protein of the FGF family, which has an increased stability over the naturally occurring form of the protein. It is a further object of the present invention to provide an analog and FGF that exhibits enhanced stability and biological activity in the absence of heparin. It is yet another object of the present invention to provide an αFGF analog for therapeutic use.

The present invention provides novel analogs of FGF family proteins. One of these analogs is aFGF, which is more stable and exhibits greater biological activity in the absence of heparin than is naturally occurring aFGF. Another such analog is the KGF analog, which has increased thermal stability compared to naturally occurring KGF. Increased stability is achieved by substituting at least one amino acid that has a higher loop-forming loop strength for the amino acid residue with a lower looping strength in or on the amino acid sequence of the Asn-His-Tyr-Asn-Thr-Tyr naturally occurring protein. For aFGF, the loop sequence appears in the amino acid space of about 92 to 96. For KGF, the loop region appears in the amino acid space of about 115 to 119. A preferred analog of the present invention comprises an amino acid substitution having a higher looping potential for a histidine residue in the loop sequence.

According to the present invention, new FGF family analogs are provided. These analogs exhibit improved stability over the corresponding naturally occurring proteins. In the case of the αFGF analog of the present invention, the analog exhibits increased stability and biological activity in the absence of heparin. In the case of the KGF analog of the present invention, this analog exhibits increased thermal stability. The analogs of the present invention have at least one other amino acid residue different from the respective naturally occurring protein in or on the Asn-His-Tyr-Asn-Thr-Tyr sequence found in the naturally occurring form. For the case of aFGF, the sequence loop occurs in the amino acid residue space of about 92 to 96 (based on the numbering of the known amino acid sequence for bovine aFGF as shown in Figure 1). For the case of HGF, the loop of the sequence occurs in the amino acid residue space from about 115 to 119 as shown in Figures 9 and 10. The various amino acids (na) are selected because of their higher loop forming potential to stabilize this space in the analog. Amino acids having a relatively high loop forming potential include glycine, proline, tyrosine, aspartic acid, asparagine, and serine (Leszcynski et al., 1986, Science, 234: 849-855, 1986, relative values of loop forming potential based on frequency of occurrence in loop structures of naturally occurring molecules). Advantageously, another amino acid having a higher looping potential may replace the histidine residue in the loop formed by the sequence. Even more preferably, the histidine residue in the loop formed by the sequence may be replaced by a glycine residue.

Additions, substitutions and / or deletions may also be included with the analogs of the present invention. For example, the analog may also advantageously comprise an amino acid substitution for non-conserved histidine residues (e.g., a cysteine residue at position 47 of the bovine aFGF molecule and a cysteine residue at position 16 of the human aFGF molecule). In addition, analogs of the present invention that are expressed in E. coli host cells may contain an initiating rithionine amino acid residue (ie, at position -1 as shown in Figure 1). Another alternative is that one or more termination amino acid residues may be deleted from the DNA sequence as known to those skilled in the art while substantially retaining increased biological activity that corresponds to the naturally occurring protein.

Also provided are DNA sequences for all or part of the analogs of the present invention. Such sequences may advantageously include the introduction of preferred codons for expression by selected E. coli host strains (E. coli expression codons), providing cleavage sites with restriction endonuclease enzymes, and / or providing initiation, termination or intermediate DNA sequences that allow the construction of readily expressed vectors . These new DNA sequences include sequences that are useful for ensuring expression of the analogs of the present invention in both host eukaryotic and prokaryotic cells (such as E. coli).

More specifically, the DNA sequences of the invention may include the DNA sequences depicted in Figure 1, wherein at least one codon encoding an amino acid residue in the region of about 92 amino acids to about 96 amino acids is replaced by a codon that encodes another amino acid residue having a higher looping potential. (aFGF sequence (s) or sequence (s) analogs below), as well as a DNA sequence that hybridizes to one of the sequence analogs or fragments thereof and a DNA sequence that (except for the degenerate genetic code) could hybridize one from sequence analogues.

Similarly, the DNA sequence of the invention may comprise the DNA sequence depicted in Figure 10, wherein at least one codon encoding an amino acid residue in the region of about an amino acid

115 to about amino acid 119 is replaced by a codon that encodes another amino acid residue that has a higher looping potential (KGF analog sequence (s) or sequence analog (s) below), as well as a DNA sequence that hybridizes to one from sequence analogs or fragments thereof, and a DNA sequence that (except for the degenerate genetic code) could hybridize to one of the sequence analogs.

The analogs of the present invention can be encoded, expressed, and purified using any of a number of recombinant technologies known to those skilled in the art. Preferred production methods will vary depending on many factors and conditions, including the cost and availability of the material and other economic conditions. The optimal production procedure of obtaining the situation will be apparent to those skilled in the experiments. Analogs of this to be expressed at a very high level have knowledge of at least the minimum of the present invention can level using E. coli host cells that express the final product and are further purified to approximate homogeneity using procedures known in the art. A typical purification process involves first dissolving organs containing analogs, followed by ion exchange chromatography, followed by protein decomposition, and finally hydrophobic chromatography.

The analogs of the present invention represent a surprising degree of increased stability. In contrast to naturally occurring aFGF, the aFGF analogs of the present invention demonstrate increased stability and biological activity in the absence of heparin. While it is known that more stable bFGF analogs can be obtained by substituting serine or other neutral amino acids at the site of a certain cysteine residue (such as described in PCT Publication No. 88/04189), a substitution for the un-conserved cysteine residue at position 47 naturally The occurrence of bovine aFGF alone is not significant for enhancing biological activity and / or stability of the aFGF analog. This is shown by the lower activity shown by the bovine (Ala ⁴⁷ ) and FGF analog (substituted with cysteine) compared to the bovine (la ⁴⁷ , Gly ⁹³ ) and the FGF analog (having the desired amino acid residue substitution in the 92 to 96 region of the aFGF molecule). is shown in the examples that follow. The bovine (Ala ⁴⁷ , Gly ⁹³ ) aFGF analogue, although still less potent than bFGF, was specifically found to be approximately ten times more potent than the bovine (Ala ⁴⁷ ) aFGF analogue. At the addition of 45 µg / ml heparin, the biological activity was increased in all three forms of FGF, such as the bovine (Ala ⁴⁷ , Gly ⁹³ ) analogue, the bovine (Ala ⁴⁷ , Gly ⁹³ ) analogue and the human (Ser ⁷⁰ , Gly ⁹³ ) analogue. they have essentially the same potency.

The reason for increasing the mitogenic activity and stability of bovine (Ala ⁴⁷ , Gly ⁹³ ) aFGF analog relative to bovine (Ala ⁴⁷ ) and FGF analog in the absence of heparin was not immediately clear. Substitution of glycine for the histidine residue at position 93 showed the formation of the aFGF molecule somewhat more hydrophobic, but did not show a drastic change in its tertiary structure, as determined by circular dichroism and FTIR spectroscopy. However, these relative differences in observed activities in the in vitro assay environment for bovine (Ala ⁴⁷ , Gly ⁹³ ) and FGF analog and for bovine (Ala ⁴⁷ ) and FGF analog (with substitution at only 47 position) indicate that the substituted amino acid glycine at position 93 is bovine. (Ala ⁴⁷ , Gly ⁹³ ) aFGF analog may be within or near the region responsible for receptor binding. Although the αFGF receptor binding region has not been determined, position 93 in the aFGF corresponds to the region in bFGF that is inscribed within or near the receptor that binds the domain (Baird et al., 1988, Proc. Nat. Acad. Sci. USA, 85: 2324-2328).

In addition, the bovine (Ala ⁴⁷ , Gly ⁹³ ) aFGF analog of the present invention, in contrast to the bovine (Ala ⁴⁷ ) analog, shows an increased stability it maintains. its original mitogenic activity in the absence of heparin for 250 hours, while the bovine (Ala ⁴⁷ ) analog rapidly loses activity. The bovine (Ala ⁴⁷ , Gly ⁹³ ) aFGF analog was recrystallized and the resulting crystals examined r | by X-ray crystallography. X-ray crystallographic data obtained from the investigated crystals support histidine hydrophile. the analogous assumption is based on data from hydrophobic chromatography / that the residue at position 93 is exposed to dissolution, i. The detailed examination of the bovine (Ala ⁴⁷ , Gly ⁹³ ) aFGF sequence around residue 93 revealed an accumulation of approximately 8 amino acids with a higher potential of formation in the region of about a glutamic acid residue at position 90 to about a tyrosine residue at position 93. 97. Relative amino acid loop forming potentials are described, and it has been found that glycine is the amino acid residue having the highest loop forming potential among all the amino acids listed above (Leszcynski et al., Supra). Thus, glycine for histidine substitution is able to stabilize the predicted histidine-forming potential due to the much higher loop.

loops of glycine residue comparison

The KGF analogs of the present invention also show that the respective region in KGF is a solubility built-in loop that can be involved in receptor binding. With respect to the (Gly ¹¹⁶ ) KGF analog of the present invention, a varying reduced mitogenetic activity compared to naturally occurring KGF was specifically found, as shown in the examples that follow. As for the (Gly ¹¹⁶ ) kGF analog, it was also found to have 5-7 ° C higher thermal stability compared to naturally occurring kGF.

Other analogs, except the preferred (Gly ⁹³ ) aFGF and (Gyl ¹¹⁶ ) KGF specifically presented above, are predicted by the present invention. These other analogs could be readily prepared by those skilled in the art using the following teachings provided herein. For example, there are no fewer than 15 described acids having a higher loop forming potential than histidine (Leszcynski et al., 1986, supra). These amino acids are (in descending order of loop forming potential): glycine, proline or tyrosine, aspartic acid or asparagine, serine, cysteine, glutamic acid, threonine, lysine, cystine, glutamine, arginine, phenylalanine and tryptophan. Substitution of any of these amino acid residues with a histidine residue in the loop sequence of a naturally occurring protein could result in the expected analog of the present invention having enhanced stability. Of course, it will be preferable to replace the hystidine residue in the loop sequence by an amino acid having the highest possible loop formation potential without creating any negative potential effects, such as the formation of undesired disulfide bonds during insertion of the added cysteine or cysteine residue. Thus, other preferred amino acid substitutions of the histidine residue in the sequential loop (i.e. when glycine is added) are represented by proline, tyrosine, aspartic acid, serine, glutamic acid, threonine, lysine, glutamine, arginine, phenylalanine and tryptophan.

The present invention also contemplates the substitution of amino acids having a higher looping potential for other amino acid residues within the amino acid region of 92 to 96 naturally occurring aFGF (i.e., amino acids 92 and 94-96) and the amino acid region of 115 to 119 naturally occurring aFGF (i.e., amino acids 92 and 115-117-119). The aFGF analogs of the present invention include, for example, aFGF analogs having a threonine residue at position 96 of naturally occurring aFGF replaced by glycine, proline or tyrosine, aspartic acid, serine, or glutamic acid in the order of preference, although a minimal increase in stability and / or biological activity would was expected to substitute glutamic acid for threonine due to the similarity of the loop forming potential of the two amino acids.

The amino acid residues at positions 92, 94, 95 and 97 (asparagine, tyrosine, and asparagine and tyrosine) of naturally occurring aFGF have a sufficiently high loop forming potential such that the minimum benefits resulting from the substitution of these individual residues are predicted.

The analogs of the present invention appear to include analogs of both the human and animal (e.g., bovine) origin, as well as forms of a protein having such an amino acid sequence consisting of a loop:

93 94 95 96

-Asn-His-Tyr-Asn-Thr111 116 117 118 119 (KGF)

For example, both forms of the human and animal aFGF analogs are known and have been identified as having identical amino acid sequences (shown above) at positions from 92 to 96. In addition, approximately 92% sequence identity between human and bovine aFGF and 97% similarity ( ie 5% of the total 8% change between the two forms of aFGF is conserved). Both forms, human and bovine, of naturally occurring aFGF exhibit substantially the same mitogenic activity in vitro.

Due to their increased stability and biological activity in the absence of heparin, the novel analogs of the present invention are very suitable for use in pharmaceutical compositions for physicians and / or veterinarians in the treatment of many types of deep wounds of mammalian species. The KGF analogs of the present invention may also be suitable because of their increased thermal stability to be used in pharmaceutical formulations. The amount of biological analogs used in these treatments will of course depend on the severity of the wounds to be treated, the route of administration chosen and the specific activity or purity of the analog, and will be determined by the attending physician or veterinarian. The term therapeutically effective amount of an analog refers to an amount of an analogue designed to elicit a therapeutic response in a mammal. These therapeutically effective amounts are readily ascertainable by one of ordinary skill in the art.

The analogs of the present invention may be administered by any route suitable for the treatment of wounds or for the preparation of an organism. Conditions that may be beneficially treated in conjunction with therapeutic application (am.i) of the analog of the present invention include, but are not limited to, treatment of superficial wounds, treatment of nerve regeneration and organ formation, and / or not limited to bone, angiogenesis.

The pharmaceutical compositions of the present invention, for both veterinary and human uses, contain a therapeutically effective amount of the analog together with one or more pharmaceutically acceptable carriers, hence and preferably other therapeutic ingredients. others at the gentleman

The carrier (s) must be suitable pharmaceutical ingredients in the sense of being compatible with the composition and must therefore not be unobtrusive to the compositions and may be deleterious.

presented in a unit dosage form by any method known in the art. All methods include the step of bringing into association the active ingredient with the carrier which is ^"- made up of one or more accessory ingredients. In general, the pharmaceutical compositions are prepared by a clearly and perfectly established association of the analog with a liquid carrier or a purpose-divided solid carrier or both.

The following examples are provided to aid in understanding the present invention, the true scope of which is shown in the appended claims. It will be understood that modifications may be made to these procedures without departing from the spirit of the invention.

DETAILED DESCRIPTION OF THE INVENTION

Example 1: Production of Analog (Ala ⁴⁷ , Gly ⁹³ ) aFGF

synthesis

The analog (Ala ⁴⁷ , Gly ⁹³ ) aFGF and the analog (Gly ¹¹⁶ ) KGF were prepared using site-directed mutagenesis. However, it will be appreciated that these and other analogs of the present invention can be prepared using other methods, including chemical syntheses. For the analog (Ala ⁴⁷ , Gly ⁹³ ) aFGF, a bovine sequence was used. Specifically, the analog (Ala ⁴⁷ , Gly ⁹³ ) of aFGF was prepared as follows:

The bovine aFGF analog of the present invention was prepared and tested in the following examples. This analog, bovine (Ala ⁴⁷ , Gly ⁹³ ) aFGF was designed to contain the desired amino acid substitutions (glycine for histidine at position 93) in the remainder of the loop forming sequence from 92 to 93 of the aFGF molecule and an additional amino acid substitution of alanine for the unconverted cysteine residue. position 47, as shown in Figure 1. The bovine (Ala ⁴⁷ ) aFGF analog having only the alanine amino acid substitution for cysteine was also prepared for use as a control for the desired bovine analog (Ala ⁴⁷ , Gly ⁹³ ) aFGF. Although these examples represent the bovine aFGF analog of the present invention, the same results can be obtained for highly homologous human aFGF analogs. For example, the amino acid sequence corresponding to the human analog (Gyl ⁹³ ) of aFGF of the present invention is shown in Figure 2.

Synthetic genes that encode a bovine analog (Ala ⁴⁷ , Gly ⁹³ ) and FGF were assembled in two sections of a total of 28 oligonucleotide components. The amino acid sequence (Gimenez-Gallego et al., 1985, Science, 230: 1385-1388) was used as a basis for these genes with codon choices selected to optimize expression in E. coli (Gimenez-Gallego et al., 1985, above). Section I was assembled from 16 oligonucleotides to provide 287 nucleotide fragments that could be inserted into the plasmid vector at the Xba I and Xho I restriction endonuclease sites. Section II was assembled from 12 nucleotides to obtain 170 nucleotide fragments bound by Xho I and Bam HI compatible ends. These two sections were inserted into the expression plasmid pCFM1156, which had previously been digested with Xba I and Bam HI in a 3-component ligation, giving the complete aFGF gene under the control of the lambda pL promoter.

Plasmid pCFM1156 is prepared from the known plasmid pCFM836.

The preparation of plasmid p (1FM836 is described in U.S. Patent No. 4,710,473; the relevant parts of the specification, particularly Examples 1 to 7, are hereby incorporated by reference. To prepare plasmid PCFM1156 from plasmid pCFMS36, two endogenous Nde I are cut. restriction sites, exposed ends are filled with T4 polymerase, and the filled ends are ligated with blunt ends.

The resulting plasmid is then digested with Cla I and Κρη I and the excised DNA fragment is replaced with a DNA oligonucleotide of the following sequence:

5 'CGATTTGATTCTAGAAGGAGGAATAACATATGGTTAACGCGTTGGAATTCGGTAC3' '- TAAACTAA.GATCTTQCTCCTTATTGTATACCAATTGCGCAACCTTAAGC - 5'

Plasmid transformed E. coli cells were grown in a 16 L fermentation vessel (as described in Fox et al., 19SS, J. Biol. Chem., 263: 18452-1S45S).

The coding for the converted bovine analog gene (Gly ⁹³ , Ala ⁴⁷ ) and FGF was to (Ala ⁴⁷ ) form using site-directed mutagenesis of oligonucleotides. The aFGF gene was first transferred to the phage vector M13mpl8 and single stranded DNA was prepared as a template for the directed mutagenesis reaction. Approximately 0.5 µg of this DNA was mixed together with 5 picomoles of each mutagenic primer (5'-GAAGAAAACCATTACAACAC-3 ') and the M13 universal primer was used for DNA sequencing, heated to 65 for 3 minutes and gradually cooled slowly. The cooled matrix primer was mixed with ATP, a mixture of d.NTP, a large DNA polymerase fragment and DNA ligase, then incubated at 15 ° C for 4 hours. Aliquots of this reaction mixture were added to competent E. coli JM101 cells and plated in 0.7% agar. The resulting plaques were replicated to n itrocelulózových filters and the filters were hybridized with labeled mutagenic head physician ³² p. The prepared DNA from the phage that hybridized was sequenced to verify the successful completion of the desired mutagenic material. The resulting gene was then transferred back to the PCFM1156 vector for expression of the recombinant protein.

Purification of the aFGF analog

Both bovine (Gly ^93. Ala ⁴⁷ , and (Ala ⁴⁷ ) aFGF analogs were purified from the insoluble fraction obtained from centrifugation of mechanically pressed recombinant E. coli cells. The pellet fraction was dissolved in 8 M urea, 0.1 M glycine The pH of the supernatant was packed into a S-Sepharose ( ^R ) (Pharmacia, Uppsala, Sweden) column equilibrated with 6 M urea, 10 mM glycine, pH 3.0 and washed with 6 M urea. 20 mM sodium citrate, pH 6.5 Proteins bound to the column were eluted with a linear gradient of 0 to 0.5 M sodium chloride in 20 mM sodium citrate, pH 6.5 Fractions containing aFGF were pooled, diluted 20-fold with 20 mM sodium citrate, 0.1 ammonium sulfate and centrifuged to remove any precipitates The supernatant was mixed with one part 20 mM sodium citrate, 2 M ammonium sulfate and packed into a 1 Sepharose ( ^R ) equilibrium column with 20 mM sodium citrate, 1 M ammonium sulfate, pH 6.5. Bound protein was eluted from the column using a descending linear gradient (from 1 M to 0 M) of ammonium sulfate. Fractions containing αFGF analogs were pooled and dialyzed against 20 mM sodium citrate, pH 6.5. This product was essentially homogeneous, as demonstrated by the fact that no other binding appeared in the Coomasie blue SDS gel as shown in Figure 4.

Example 2: Gel filtration chromatography of aFGF analog

Gel using (Pharmacia, flow M chloride filtration was performed on a Superosa column ^(R > -12 on Uppsala, Sweden) .The column was filtered at room temperature Pharmacia FPLC at a rate of 0.5 ml / min 20 mM sodium, pH 6.5.

sodium citrate, 0.2

Gel filtration chromatography showed that purified, bovine (Ala ⁴⁷ ) and (Ala ⁴⁷ , Gly ⁹³ ) αFGF analogs eluted as single peaks were identical to the elution position of robinuclease A (Mr = 13,700). This indicates that both proteins are monomeric and have the same hydrodynamic radius, although there is a possibility that both forms of protein interact with the column matrix and provide delayed elution from the column.

Example 3: hydrophobic interaction chromatography

Hydrophobic interaction chromatography was performed at room temperature using a column Phenyl-Superose ^<R> to a Pharmacia FPLC system. A sample in 2M ammonium sulfate, 20mM sodium citrate, pH 6.5, was packed in a column that was equilibrated with 2M ammonium sulfate. After washing with 2M ammonium sulfate, the remaining protein was eluted with a descending gradient of 2M to 0 ammonium sulfate. M followed by a final wash with 20 mM sodium citrate, pH 6.5.

Since the elution position of the protein in the chromatography (HIC) of very strongly hydrophobic regions in the established state, the hydrophobic interaction depends on orientation, this technique provides a sensitive nucleotide probe of conformational homogeneity similar profiles for bovine Analog (Ala ⁴⁷ ) and FGF proteins. ⁽⁴ Ala ⁷⁾ and

Figure ⁽⁴ Al ^7, elution is Gly ⁹³⁾ aFGF analogs. shows a major peak eluted using 0.25 M ammonium sulfate while the analogue (Ala ⁴⁷ , Gly ⁹³ ) of aFGF shows a single peak using 0.13 M ammonium sulfate, suggesting that both proteins exist primarily in a different conformation ii. Elution at a lower salt concentration of the analog (Ala ⁴⁷ , Gly ⁹³ ) and FGF shows that it is slightly more hydrophobic than the form (Ala ⁴⁷ ). This observation is also consistent with replacing the histidine residue at position 93 with glycine if the protein conformation is such that the residue is exposed to the solvent. Alternatively, a change in this residue could cause an overall change in the conformation of the molecule to produce a more hydrophobic structure.

Example 4: Spectroscopy of aFGF Analog

Circular dichroism

The circular dichroic spectrum was determined at room temperature on a Jasco Model J-500C spectropolarimeter (Jasco, Tokyo, Japan) equipped with an Oki 1F S00 Model 30 computer (Oki, Tokyo, Japan). Measurements were made at 1 nm wavelength using cuvettes 1 and 0.02 cm for near and far ultraviolet. The data obtained were expressed by means of residual ellipticity, ()), calculated using the residual weight means of both forms of aFGF.

The circular dichroism (CD) spectrum of bovine analogs (Ala ⁴⁷ , Gly ⁹³ ) and '(Ala ⁴⁷ ) aFGF was nearly identical in both the far and near ultraviolet regions, as shown in Figures 4A and 4B. The CD spectrum of the analogs was also very similar to that recorded for human bFGF (Arakawa et al., 19S9, BBRC, 161: 335-341). The near-ultraviolet spectrum similarity is consistent with that of tertiary structures for FGF analogs.

Temperature transition

The thermal transition of the proteins was determined on a Response II spectrophotometer (Gilford, Medfield, Massachusetts) equipped with temperature programming and a temperature cuvette holder. The samples were heated at 0.1 ° C / min or 0.5 ° C / min and their absorbance was monitored at 2S7 nm. Protein concentrations were determined spectrophotometrically using an extinction coefficient of 0.98 for bFGF and 1.04 for both bovine aFGF analogs at 280 nm for 0.1% protein.

Thermal denaturation of αFGF analogs was tested in the presence and absence of heparin at two, pH 6.5 and 7.0, 20 mM sodium citrate. In all cases, the proteins precipitated as soon as the temperature was raised. In the absence of heparin, this temperature was about 10 ° C higher for the bovine analog (Ala ⁴⁷ , Gly ⁹³ ) and FGF than for the bovine analog (Ala ⁴⁷ ) and GF. Addition of either 1.4-fold or S-fold (w / w) excess heparin increased the denaturation temperature for both forms to 14-20 ° C, depending on the rate of use of the elevated temperature. The difference between the denaturation temperature of the two forms was about 10 ° C. However, there was no apparent effect of a 1.4-fold or 8-fold (w / w) excess of heparin on the CD spectrum of any protein in the 240 to 340 nm wavelength range, although in the case of an 8-fold excess of heparin aFGF spectrum in the wavelength range lengths from 240 to 260 were masked by absorbance of heparin alone.

Fourier transform infrared spectroscopy (FTIR)

The Fourier transform infrared spectrum was determined to test for further similarity in conformation of both αFGF analogs. For FTIR spectroscopy, proteins were thoroughly dialyzed against water. Each protein was prepared as a 2% solution in 20 mM imidazole buffer prepared in D2O (Sigma Chemical Co., 99.9% isotopic purity). The solutions were placed in IR chambers with CaFs strips and 100 µm spacers. For each spectrum, 1,500 interferons were collected and codified on a Nicolet S00 FTIR system equipped with a germanium-coated KBr beam splitter and a DTGS detector. The optical bench was continuously cleaned with dry nitrogen gas. The second derived spectrum was estimated (as described in Susi et al., 1988, Biochem. Biophys. Res. Comm., 115:

391-397). A 9-point smoothing funktion was applied to the water spectrum by steam reading.

Figure 5 shows the second derived spectrum (Ala ⁴⁷ , Gly ⁹³ ) and (Ala ⁴⁷ ) of the bovine aFGF analogs in the amide region I '(C = O stretch in deuterated proteins). The rates of single binding of proteins and polypeptides in this region are dependent on the content of the second structure (Surewicz et al., 1988, Biochem. Biophys. Acta, 952: 115-130). The spectra show strong bonds of 1630 cm ^-1 and

6S5 cm ^-1 , which indicate a significant amount of beta-structures in the two proteins. Strong bonds near 1,647 cm ^-1 are indicated by the presence of irregular or broken structures. Weak peaks near 1666 and 1673 cm ^-1 arise from altered structures. A small peak is reported near 1,651 cm ^-1 in the spectrum of both proteins · Amide I 'components near this rate are typically similar to alphahelix. However, it has recently been shown that these linkages may arise from loop structures (Wilder et al., 1990, Abstracts of the Fourth Symposium of the Protein Society, San Diego). As shown in Figure 5, highly resolved FTIR spectra, unlike CD spectra, clearly demonstrate the presence of beta structures of the turn (turn) and spectra for bovine analog (Ala ⁴⁷ ) aFGF and for bovine analog (Ala ⁴⁷ , Gly ⁹³ ) aFGF are closely aligned, again confirming the assumption that the two proteins have a similar conformation.

Obviously, the second derived spectrum does not show any difference in conformation between the two αFGF analogs. However, it was evident that exchangeable proton denaturation occurs more frequently for bovine (Ala ⁴⁷ ) and FGF analogs than for bovine analogs (Ala ⁴⁷ , Gly ⁹³ ) and FGF during equilibration of lyophilized protein with D2O solution. Since these two proteins have a similar conformation, the observed differences in HD ratio exchange cannot be explained by the differences in the degree of exposure of the exchangeable protons between these proteins. It is more likely that the (Ala ⁴⁷ ) αFGF analog has a more flexible structure that provides amide protons with greater solvent accessibility.

Example 5: Heparin Chromatography of Analog (Ala ⁴⁷ , Gly ⁹³ ) aFGF

Heparin Sepharose® ^R7 (Pharmacia) was packed into a 1x8 cm column equilibrated with 10 mM Tris-HCl, pH 7.2. The column was injected, washed with 10 mM Tris-HCl, pH 7.2 and eluted with a linear gradient from 0 to 2.8 M sodium chloride in the same buffer at a flow rate of 0.5 ml / min using a Pharmacia FPLC system.

Acidic and basic aFGFs are remarkable for their tendency to bind to heparin and heparin-like molecules. The two bovine analogues α (Ala ⁴⁷ , Gly ⁹³ ) and (Ala ⁴⁷ ) aFGF show a single peak relative to elution at 1.54 M sodium chloride pH 7.2.

Tris-HCl

Example 6: Biological Activity of aFGF Analogs

Bio-tests in vivo

The mitogenetic activity of NIH 3T3 αFGF analog cells from the previous examples was determined as described below. In addition, the human (Ser ⁷⁰ , Ser ⁸⁸ ) bFGF analog as described in PCT Publication No. Ser. 88 / 041S9 was also tested in bioactive assays in addition to aFGF analogs.

streptomycin. a week. The first one

NIH 3T3 αFGF analog cells were obtained from the ATCC. Cells were grown in DME supplemented with 10% bovine serum, 10 units / ml penicillin, 2 mM glutamine and 10 units / ml. Cells were passaged at a ratio of 1:40 twice per day of assay, confluent cultures were trypsin-dispersed and placed in a 24-well plate. at a concentration of 20,000 cells / ml, 1 ml per well of the above medium. On day 5, the medium was replaced with 1 ml / well of serum-free DMEM but containing penicillin, streptomycin and glutamine at the above concentration. On day 6, test samples were added to the medium in a volume not greater than 100 µl. Eighteen hours later, cells were pulsed for one hour with 1 ml of the above medium containing 2- 10 µCi tritium thymidine at 37 ° C. After pulsation, cells were washed once with medium and then 250 mM sucrose, 10 mM sodium phosphate, 1 mM EDTA, pH 8 was added and the plates were incubated at 37 ° C for 10 minutes to release the cells. Cells were harvested on a Skarton harvester (Skarton,

Inc., Sterling, Virginia). Scintillation fluid filters and counted were dried, placed in a scintillation counter

Beckman (Beckman Instruments, Inc., of Fullerton, California).

The mitogenetic activity of bovine (Ala ⁴⁷ , Gly ⁹³ ) and (Ala ⁴⁷ ) aFGF analogs of NIH 3T3 cells was determined as shown in Figure 6. In the absence of heparin, aFGF analog produced dose-dependent stimulation of ³ H thymidine absorption ranging from 1 to 100 ng / ml with half-stimulation of 25 ng / ml. Under the same conditions, the analog (Ala ^47. Gly ⁹³ ) of aFGF was able to produce the same mitogenetic activity at a much lower protein concentration, half the dose being about 1 mg / ml. Recombinant bFGF was 4-5 times more potent than the analog (Ala ⁴⁷ , Gly ⁹³ ) of aFGF at half the dose of 220 pg / ml. When 4.5 µg / ml heparin was added to both analogs, their activity in vitro was increased with the remaining greater potency of the analog (Ala ⁴⁷ , Gly ⁹³ ) and FGF. In the presence of 45 µg / ml heparin, the activities were such that the respective dose of the three molecules was almost identical at half the 90 µg / ml dose.

The stability of the aFGF analogs as determined by their retention, respectively. mitogenic activity was examined by incubating a 0.1 mg / ml solution of each FGF analog in 20 mM sodium citrate, pH 7, at 37 ° C, both in the presence and absence of 1 mg / ml heparin. In the absence of heparin, the bovine analog (Ala ⁴⁷ ) aFGF rapidly lost activity with a half-life of 13 hours as shown in Figure 7. However, in the presence of heparin, the bovine analog (Ala ⁴⁷ ) aFGF did not lose biological activity more than 250 hours during the experiment. In contrast, neither the bovine analog (Ala ⁴⁷ , Gly ⁹³ ) and the FGF nor the human analog lost activity for more than 250 hours, present or not.

(Ser ⁷⁰ , Ser ^{s 8} ) bFGF whether heparin was present

Example 7: crystallography of analog (Ala ⁴⁷ , Gly ⁹³ ) and FGF

The bovine analog crystals (Ala ⁴⁷ , Gly ⁹³ ) were grown by steam diffusion against 0.2 M NH 4 SO 4, 2 M NaCl, 0.099 M sodium citrate and 0.02 M sodium potassium phosphate, pH 5.6. The protein droplet contained equal volumes of stock solution and 10 mg / ml protein solution. The crystals were trigonal (spatial group P 31 21, α = 78.6 Å, c = 115.9 Å) and a deviation of 2.5 Å resolution.

using Siemens (Madison,

Intensive data were collected by a Wisconsin multiwire area detector installed on an 18 kw rotary anode generator. Appropriate Siemens process programs have also been used to reduce data. Multipole isomorphic surrogate phases (mir) were calculated on 3 A resolution from two derivatives with a numerical value of 0.68. After solvent stabilization, regions corresponding to two independent aFGF molecules in the asymmetric formation were identified. The general non-crystallographic symmetry of these molecules was determined from the spatial translation function and density. The molecular envelope was defined around the calculated diameter of the aFGF molecule modified by B.C. Wang algorithm. The phases were repeatedly purified using the molecular diameter determined and solvent-stabilized.

related between functions, real rotational studies of interrelationships

Initial maps revealed elongated areas of the beta sheet that were shortened in the loop due to the small molecular envelope as shown in Figure 8. The finished map for building modeling was calculated using mir phases, again cleaned from heavy atomic parameters against averaged phases (as described by Rould et al., 1989, Science, 246: 1135-1142) and repeatedly averaged with the molecular envelope generated by deploying 6 A spheres around atomic positions in the initial model. Calculation of the average at 3A resolution converged to a final factor R of 17.8% between the observed structural factors and the structural factors calculated from the average map and the solvent stabilized map. The T0M / FR0D0 graphics program, which was equipped with C. Cambillaua's Silicon Graphics 4D80, was used to incorporate aFGF sequence residues from 10 to 136 into an average electron density map.

The crystallographic results supported the hypothesis that the 90-97 region is involved in the loop structure. Indeed, if this region is involved in a receptor that binds (as suggested by Baird et al., 1988, supra) any amino acid substitution that stabilizes the loop, it may actually stabilize and / or enhance the biological activity of the molecule. This is presumably the mechanism for the observed increase in activity achieved with the bovine analog (Ala ⁴⁷ , Gly ⁹³ ) aFGF.

Example 8: Production of Analog (Gly ¹¹⁶ ) KGF

synthesis

To prepare the analog (Gly ¹¹⁶ ), the sequence encoding the naturally occurring KGF was first obtained and then changed to the codon for amino acid 116 to achieve the coding sequence for the analog.

The coding sequence for naturally occurring KGF was obtained using RNA isolated from human fibroblast cells (AG1523 cell line) as a starting material from which KGF cDNA was prepared using standard techniques known in the art. The KGF cDNA was then used as a polymerase chain reaction (PCR) template to amplify the KGF gene. Due to the presence of the internal NdeI site in the KGF gene, PCR DNA was prepared as two fragments, which were then joined together at the characteristic BsmI site. Oligonucleotides 23S-21 and 238-24 (shown below) were used to prepare a product which was then cut with BsmI and BamHI, and then the 311 base pair yield of the KGF fragment was isolated. These two DNA fragments, which are ligated together, form the gene for naturally occurring KGF, as shown in Figure 9.

In order to obtain the coding sequence for the desired analog (Gly ¹¹⁶ ) of KGF, it was necessary to replace the glycine codon with the histidine codon His ¹¹⁶ in the KGF gene. This was achieved using PCR of overlapping oligonucleotides by mutagenesis with oligonucleotides 315-17 and 315-18, flanking the KGF DNA sequence corresponding to the His ^{116 region} with appropriate base pair changes to encode the (Gly ¹¹⁶ ) KGF analog. The KGF DNA matrix for PCR was the same as shown in Figure 9 except that the DNA sequence between the KpnI and EcoRI sites was replaced by chemically synthesized DNA as shown in Figure 10. Any matching oligonucleotides corresponding to the KGF DNA regions 5'- and The 3'-mutation-driven sites, such as 23S-22 oligonucleotides, provided the outer primers Fraement DNA EcoRI and BamHI.

23S-24 could be used. for overlapping PCR mutagenesis. which contained the coding sequence

Even for the (Gly ¹¹⁶ ) KGF analog, it was then ligated into the previously described expression plasmid pCFMI156 already containing the KG gene to replace the corresponding region of the KGF gene with a region of the coding sequence that contained the necessary changes to encode the (Gly ¹¹⁶ ) KGF analog The ligated DNA was then transformed into FM5 cells (ATCC # 53911) and colonies containing the analog plasmid pCFM1156 (Gly ¹¹⁶ ) were isolated. The analogue mutant KGF FM5 / pCFM1156 KGF (Gly ¹¹⁶ ) was then fermented and cell paste was collected using standard techniques.

oligo 233-21 oligo 233-22 oligo 238-24 oligo .. 315-17 oligo 315-18 '- ACAACGCGTGCAATGACATGACTCCA - 3' '- ACÄCATATGTGCAATGACATGÄCTCCA · 3'

5 '- ACAGGATCCTATTAAGTTATTGCCATAGGAA - 3' 5 '- GGAAÄÄCGGTTACAACÄCATATGCA - 3' '- GTGTTGTAACCGTTTTCCAGAATTAG - 3'

Analog purification (Gly ¹¹⁶ ) KGF

Cells containing the (Gly ¹¹⁶ ) KGF analog from the fermentation described above were first broken by suspending 665 g of E. coli cell paste in about 4 liters of 20 mM sodium phosphate, pH 6, S, 0.2 M NaCl and then slurrying through Gaulin homogenizer at 9,000 psi. The suspension was further centrifuged on a Beckman JA-10 rotor (Beckman Instruments, Fullerton, Calif.) At 10,000 rpm for 30 minutes at 4 ° C.

Ion exchange chromatography was performed by using the supernatant from the centrifuged suspension by applying it to an S-Sepharose column ^(R1 Fast Flow (Pharmacia, Uppsala, Sweden, 5 x 23 cm, 450 mL total volume, equilibrating with 20 mM sodium phosphate, pH 7.5, 0.4 M NaCl at a flow rate of 25 ml / min The column was then washed with two liters of 20 mM sodium phosphate, pH 7.5, 0.4 M NaCl and the analog (Gly ¹¹⁶ ) KGF was eluted with a linear gradient from

0.4 M to 0.6 M NaCl in 20 mM sodium phosphate, pH ¹ 7.5. The total gradient volume was seven liters (about 16 times the column volume used). The fractions containing KGF were collected and concentrated about 20-fold through a YM membrane ( ^R > -10 (Amicon) in a 400 mL stirred chamber).

Concentrated Ionic Ene

Size exclusion chromatography (SEC) was performed using half the volume of KGF (total volume is 80 ml) obtained from Sephadex® ^R -G-75 column chromatography (Pharmacia, 4.4 x 85 cm, total volume 1,300 ml) equilibrated with 20 mM sodium phosphate, pH 6.8, 0.5 M NaCl and developing this column with this buffer. The process was then repeated with the other half of the concentrated KGF.

The second ion exchange chromatography procedure was then performed using the first pooled SEC fractions corresponding to the monomeric form of the (Gly ¹¹⁶ ) KGF and further collected fractions diluted in five volumes of 20 mM sodium phosphate, pH 6.8, 0.2 M NaCl and the diluted fractions were loaded onto a S-Sepharose® ^R Flow Fast (Pharmacia, 5 x 23 cm, 450 total volume) column equilibrated with 20 mM sodium phosphate, pH 6.8, 0.4 M NaCl. The column was then washed with about one and a half liters of 20 mM sodium phosphate, pH 6, S, 0.4 M NaCl. The purified (Gly ¹¹⁶ ) KGF analog was eluted with a linear one

NaCl in 20 mM sodium phosphate, pH 6, S.

was ten liters (about twenty times the column volume used) containing the (Gly ¹¹⁶ ) KGF analog as determined by SDS-PAGE was collected and the KGF content was determined by UV absorption.

gradient from 0.4 to 0.6 M Total Gradient Volume Samples, using

Example 9: Spectroscopy of KGF analog

Fourier-transform Infrared Spectroscopy (FTIR)

Samples were prepared for infrared spectroscopy using diafiltered protein solutions in 20 mM sodium phosphate, 0.5 M NaCl, pD = 6.8 buffer prepared in b 0; (Sigma, 99.9% + isotopic purity. PD values were determined using a 0.45 value read from a glass pH meter glass electrode (according to Covington et al., 1968, Anal. Chem., 40: 700-706). Final protein concentration The protein solutions were placed in IR chambers along with CaFα strips and 100 µM Teflon spacers.

For the structural characteristics, 256 bilateral interferons were codified and transformed after application of the irreversible Happ-genzel function using the S00 FTIR system. The results were estimated to be 2 cm ^-1 . Derived spectrum and fourier self-deconvolution were performed according to (Susi and Byler, 1983, Biochem. Biophys. Res. Comm., 115: 391-397) using the 'Nicolet software. The point curve was performed using the Peakfit ™ program (Jandel) The KGF infrared spectrum indicates strong similarity to these bFGF and aFGF analogs, which indicate similar structures for the three proteins.

Thermal stability studies of naturally occurring KGF and the KGF analog (Gly ¹¹⁶ ) were performed by placing IR cells in an electrically heated jacket controlled by an automatic temperature controller (Specac Inc., Fairfield, Connecticut). The temperature was raised at a rate of 0.5 ° C / min. The IR spectrum was selected at 8 cm ^-1 resolution.

At temperatures below 50 ° C, the spectra appeared with little change from those at ambient temperature. At temperatures above 50 ° C, the spectra indicated that naturally occurring KGF would withstand a thermotropic transition at this stage. Peaks near 1616 and 16S5 cm ^-1 were evident in the spectrum and at 65 ° C these peaks dominated with the corresponding loss of intensity at 1643 cm ^-1 . This spectral transition represents a cooperative offset folding of naturally occurring KGF. The observed thermal transitions were not most likely to be reversible due to the aggregation of the aligned proteins. The melting point T _r for the naturally occurring KGF was estimated at 60 ° C, while the T m for the (Gly, ¹¹⁶ ) KGF analog was estimated at 65 ° C. 0 5 ^C higher temperature than the naturally occurring KGF indicates that the analog (Gly ¹¹⁶⁾ KGF has a higher relative thermal stability than naturally occurring KGF.

Ultraviolet spectroscopy

The thermal denaturation of both (Gly ¹¹⁶ ) KGF and naturally occurring KGF was studied using a Response II UV spectrophotometer

Massachusetts) with temperature controller (Gi1ford, Peltier and program, mixed final

KGF solutions in 20 mM sodium phosphate, pH

Medf ield, thermal 6.8, with S M guanidine HCl or 20 mM sodium phosphate to a protein concentration of about 0.5 mg / ml and a final guanidine concentration of 0 to 2

M. Thermal scanning and wavelength velocities were imaged at 0.5 ° C / min monitored at 260 nm. The addition of a small amount of guanidine HCl eliminated protein precipitation during thermal denaturation, but did not ensure that denaturation was reversible during the reaction simultaneously.

for this reason the samples were

Thermal denaturation experiments were not successful in the presence of from 0 to 1 that turbidity occurred upon heating. However, the developed haze at a lower temperature for naturally occurring KGF than for the analog (Gly ¹¹⁶ ) KGF reveals that the aforementioned protein denatures and consequently aggregates at a lower temperature. In 1.5 M guanidine HCl, the absorbance at 2S7 nm is reduced as soon as the protein denatures and then again increased due to aggregation. Temperatures at which the absorbances decreased and increased occurred in this order of 25, and the addition of 2 M guanidine HCl naturally led to a temperature of 25 ° C.

to complete denaturation for proteins, it was about 37 ° C for KGF and near 46 ° C for the analog using UV guanidine HCl spectroscopy relative to ° C for the (Gly ¹¹⁶ ) KGF analog. partial denaturation for both KGF-occurring analogs and (Gly ¹¹⁶ ) KGF analog at temperature increase led to the end of denaturation of naturally-occurring (Gly ¹¹⁶ ) KGF.

These results indicate that the (Gly ¹¹⁶ ) KGF analog is more thermally stable at the appropriate degrees at melting point and that these results are consistent with an infrared analysis indicating an increase of approximately 5 ° C for the T _{m of the} (Gly ¹¹⁶ ) KGF analog relative to to naturally occurring KGF.

Example 10: mitogenetic activity of analog (Gly ¹¹⁶ ) KGF

The mitogenetic activity of the analog (Gly ¹¹⁶ ) of KGF was analyzed using mitogenetic assays (Rubin et al., 1989, Proc. Natl. Acad. Sci. Usa, 86: 802-S06). The (Gly ¹¹⁶ ) KGF analog demonstrates less 3H-thymidine incorporation than that observed with naturally occurring KGF, indicating lower specific activity for the (Gly ¹¹⁶ ) KGF analog.

Description of the figures in the attached drawings

Figure 1 shows the nucleic acid and amino acid sequences of the recombinant bovine analog (Ala ⁴⁷ , Gly ⁹³ ) and FGF.

Figure 2 shows the amino acid sequence of recombinant human analogue (Gly ⁹³ ) aFGF.

Figure 3 demonstrates elution profiles for bovine analogs (Ala ⁴⁷ ) and (Ala ⁴⁷ , Gly ⁹³ ) aFGF using hydrophobic interaction chromatography.

Figures 4A and 4B show the circular dichroic spectrum for bovine analogs (Ala ⁴⁷ ) and (Ala ⁴⁷ , Gly ⁹³ ) aFGF.

Figure 5 shows a second derived spectrum of FTIR bovine analogs (Ala ⁴⁷ ) and (Ala ⁴⁷ , Gly ⁹³ ) aFGF in the amide I 'region (C = 0 stretch in deuterated proteins).

Figure 6 is a graphical representation of the logarithm of the concentration of bovine analogs (Ala ⁴⁷ ) and (Ala ⁴⁷ , Gly ⁹³ ) aFGF and human analog (Ser ⁷⁰ , Ser ^ss ) bFGF versus percent maximal stimulation.

Figure 7 is a graphical representation of the loss of activity of the set time bovine analogs (Ala ⁴⁷ ) and (Ala ⁴⁷ , Gly ⁹³ ) aFGF in the absence of heparin as compared to human (Ser ⁷⁰ , Ser ⁸⁸ ) bFGF.

Figure S shows the structure of the bovine analog (Ala ⁴⁷ , Gly ⁹³ ) and FGF of the present invention as determined by X-ray crystallography.

Figure 9 shows the nucleic acid and amino acid sequences of naturally occurring KGF.

Figure 10 shows the nucleic acid and amino acid sequences of the recombinant analogue (Gly ¹¹⁶ ) of KGF.

List of Sequences (1)

(i) Applicant: Amgen Inc.

(ii) name of the invention: Acid fibroblast growth factor analogs having enhanced stability and biological activity (iii) (iv) (v) (vi) number of sequences: 17 correspondence address:

(A) address: Amgen Inc (B) street: 1840 DeHavillnad Drive (C) city: Thousand Oaks (D) country: California (E) country: USA (F) postal code: 91320-1789 computer read form:

(A) media type: flopydisk (B) computer: IBM PC compatible (C) operating system: PC-DOS / MS-DOS (D) software: Patentln Release # 1.0 Version # 1.25 Application Details:

(A) Application number:

(B) Check-in date:

(C) classification:

(2) sequence information for SEQ ID NO: 1: (i) sequence characteristics:

(A) length: 463 base pairs (B) type: nucleic acid (C) chain: unknown (D) topology: unknown (ii) molecule type: cDNA (xi) sequence description: SEQ ID NO: 1:

I

I ι

TGTAGAAAAA ACCAAGGAGG TAATAAATAA tgttcaacct GCCGCTGGGT AACTACAAAA 60 AACCTAAGCT TCTGTACTGC TCTAACGGCG GTTACTTCCT GCGCATTCTC CCGGATGGCA 120 CTGTAGACGG TACCAAAGAT CGTTCCGACC AGCACATTCA GCTCCAGCTC GCTGCAGAAT 130 CTATCGGTGA AGTTTACATC AAATCCACCG AAACTGGTCA GTTCCTGGCT ATGGATACTG 240 ATGGTCTCCT CTACGGTTCT CAGACTCCGA ACGAAGAGTG CGTGTTCCTC GAGCGTCTGG 300 AAGAAAACGG TTACAACACC TACATCTCCA AAAAACACGC TGAAAAACAC TGGTTCGTTG. 360 GTCTGAAAAA AAACGGTCGT F TCTAAACTGG GTCCGCGCAC TCACTTCGGT CAGAAAGCTA 420 TCCTGTTCCT CCCTCTGCCG gtttcttccg ATTAATAGGA TCC 453

Information for SEQ ID NO (i) sequence characteristics: (A) length: 141 amino acids (B) type: amino acid (C) string: unknown (D) topology: unknown

(ii) molecule type: protein (xi) sequence description: SEQ ID NO: 2:

Met Phe same time Leu for Leu Gly same time Tyr Lys Lys for Lys Leu Leu Tyr 1 5 10 15 Cys Ser same time Gly Gly Tyr Phe Leu Arg Ile Leu for Asp Gly Thr wall 20 25 30 Asp Gly Thr Lys Asp Arg Ser Asp gin His Ile gin Leu gin Leu Ala 35 .40 45

Ala Glu Ser I Gly Glu Val Tyr I Lys Ser Thr Glu Thr Gly Gin

55 60

Phe Leu Ala Met Asp Thr Asp Gly Leu Leu Tyr Gly Ser gin Thr for 65 ·· 70 75 80 same time Glu Glu Cys Leu Glu Glu same time Gly Tyr same time 85 90 95 Thr Tyr Ser Lys Lys His Ala Glu Lys His Trp Phe wall Gly Leu 100 105 110 Lys Lys Asn Gly Arg. Ser Lys Leu Gly Pro Arg Thr His Phe Gly gin 115.. 120 125 Lys Ala leu Phu Leu Pro Leu Pro Val Ser Ser Asp ¹³⁰ 135 140 (2) information for SEQ ID NO: (i) sequence characteristics: (A) length: 155 amino acids (B) type: amino acid (C) string: unknown (D) topology: unknown (ii) type of molecule: protein (xi) sequence description: SEQ ID NO: 3: 3: Met Ala Glu Gly Glu White Thr Thr Phe Thr Ala Leu Thr Glu Lys Phe 1 5 10 15 same time Leu Gly Asn Tyr Lys Lys Leu Leu Tyr Ala 20 25 3 0 same time Gly Gly His Phe Leu Arg White Leu Pro Asp Gly Thr val · Asp Gly 35 40 4 5 Thr Arg Asp Arg Ser Asp Gin His ile Gin Leu gin Leu Ser Ala Glu 50 55 60 Ser Val i • Gly Glu Val Tyr White Lys Ser Thr Glu Thr Gly gin Tyr Leu 65 70 75 30

Ala Met Asp Thr Asp Gly Leu

3

90 95

Glu Cys Leu Phlu Leu Glu Arg Leu Glu Glu Asn Gly Tyr Asn Thr Thr

100 105 110 ile Ser Lys Lys His Glu Lys Asn Trp Phe Val Gly Leu Lys Lys

115 120 125

Asn Gly Ser Cys Lys Arg Gly Pro Arg Thr His Tyr Gly Gin Lys Ala 130 135 140 ile Leu Phe Leu Pro Leu Pro Val Ser Ser Asp

145 150 155 (2) information for sequence SEQ ID NO: 4:

(i) sequence characteristics:

(A) length: 502 base pairs (B) type: nucleic acid (C) chain: unknown (D) topology: unknown (ii) molecule type: cDNA (xi) sequence description: SEQ ID NO: 4:

TATGTGCAAT .GACATGACTC CAC-AGCAAAT GGCTACAAAT GTGAACTGTT CCAGCCCTGA 60 x »· GCGACACACA AGÄAGTTATG ATTACATGGA AGC-AGGGGAT ATAAGAGTGA GAAGACTCTC 120 TGTCGAACAC AGTGGTACCT GAGC-ATCC AAAAGAGGCA AAGTAAAAGG CACCCAAGAG 180 ATC-AAGA ATTACAATAT CATGGAAATC AGC-ACAGTGG CAGTTC-C-AAT TGTGC-CAATC 240 AAAGGGGTGG AAAGTGAATT CTATCTTGCA ATGAACAAC-G AAGGAAAACT CTATC-CAAAG 300 AAAGAATGCA ATGAAGATTG TAACTTCAAA GAACTAATTC TGGAAAACCA TTACAACACA 360 TATGCATCAG CTAAATGGAC ACACAACGGA GGGGAAATGT TTC-TTGCCTT AAATCAAAAG 420 GGGATTCCTG TAAGAGC AAA- AAAÄACGAAG AAAGAACAAA AAACAGCCCA CTTTCTTCCT 480

ATGGCAATAA CTTAATAGGA TC

502 (2) information for sequence SEQ ID NO: 5:

(i) sequence characteristics:

(A) length: 497 base pairs (B) tyypic nucleic acid (C, chain: unknown (D) topology: unknown (ii) type of molecule: cDNA (ix) characteristic features:

(A) name / key: (B) location: additional (1..497) (xi) sequence description: SEQ ID NO: 5:

. CTATTAAGTT J *. '· ATTGCCATAG GAAGAAAGTG GGCTGTTTTT TGTTCTTTCT TCGTTTTTTT 60 ; TCCTCTTACA GGAATCCCCT TTTGATTTAA GGCAACAAAC ATTTCCCCTC CGTTGTGTGT 120 CCATTTAGCT GATGCATATG TGTTGTAATG GTTTTCCAGA ATTÄGTTCTT TGAAGTTACA 130 ATCTTCATTG CATTCTTTCT TTGCÄTAGAG TTTTCCTTCC TTGTTCATTG CAAGATAGAA 240 TTCACTTTCC A CCCCTTTGA TTGCCACAAT TCCAACTGCC ACTC-TCCTGA TTTCCATGAT 300 ATTGTAATTA yŕcTTCATCT 1 CTTGGGTCCC TTTTACTTTG CCTCTTTľAT CGATCCTCAG 360 GTACCACTGT GTTCGACAGA AGAGTCTTCT CÄCTCTTATA TCCCCTCCTT CCATGTAATC 420 ATAACTTCTT GTGTGTCGCT CAC-GGCTGGA ACAGTTCACA TTTGTAGCCA TTTGCTCTGG 430

AGTCATGTCA TTGCACA 497 (2) information for sequence SEQ ID NO: 6:

(i) sequence characteristics:

(A) length: 164 amino acids (B) type: amino acid (C) chain: unknown (D) topology: unknown (ii) molecule type: protein

(Xi) sequence description SEQ ID NO: 6: Met Cys « Asn Asp Met Thr Pro Glu gin Met Ala Thr Asn Val same time Cys 1 5 10 15 Ser Ser For Glu Arg His Thr Arg Ser Tyr Asp Tyr Met Glu Gly Gly

Asp Ile Arg wall Arg Arg Leu Phe Cys Arg Thr gin Trp Tyr Leu Arg 35 40 45 Ile Asp Lys Arg Gly Lys wall Lys Gly Thr gin Glu Met Lys same time same time 50 55 6 0 Tyr same time Ile Met Glu Ile Arg Thr Val Ala wall Gly Ile wall Ala Ile 65 ' 70 75 80 Lys Gly wall Glu Ser Glu Phe Tyr Leu Ala Met same time Lys Glu Gly Lys .85 90 95 Leu Tyr Ala Lys Lys. Glu Cys same time Glu Asp Cys same time Phe Lys Glu Leu 100 105th 110 Ile Leu Glu same time His Tyr same time Thr Tyr Ala Ser Ala Lys Trp Thr His 115 120 125 same time Gly Gly r Glu Met Phe wall Ala Leu Asn gin Lys Gly Ile for wall 130 r 135 140 Arg Gly Lys Lys Thr Lys Lys Glu Gin Lys Thr Ala H i s The bottom Leu ? ro 14 5 150 155 1 £ f) J_ v

Met Ala ile Thr (2) sequence information for SEQ ID NO: 7: (i) sequence characteristics:

(A) length: 503 base pairs (B) type: nucleic acid (C) chain: unknown (D) topology: unknown (ii) molecule type: cDNA (xi) sequence description: SEQ ID NO: 7:

TATGTGCAAT GACATGACTC CAGAGCAAAT GGCTACAAAT GTGAACTGTT CCAGCCCTGA ⁶⁰ GCGACACACA AGAAGTTATG ATTACATGGA AGGAGGGGAT ATAAGAGTGA GAAGACTCTT 120 CTGTCGAACA CAGTGGTACC TGCGTATCGA CAAACGCGGC AAAGTCAAGG GCACCCAAGÄ 180 GATGAAAAAC AACTACAATA T7A7GGAAAT CCGTACTGTT GCTGTTGG7A TCGTTGCÄAT 240 CAAAGGTGTT GAATCTGAAT 7C7ATCTTGC AATGAACAAG GAAGGAAAAC TCTATGCAAA 300 GAAAGAATGC AATGAAGATT GTAACTTCAA AGAÄCTAATT CTGGAAAACG GTTACAACAC 36 0 A7ATGCATCA GCTAAA7GGA CACACAACGG AGGGGAAATG TTTGTTGCCT TAAA7CAAAA 420 GGGGATTCCT. T TATGGCAATÄ GTAAGAGGAA AAAAAACGAA GAAAGAACAA AAAACAGCCC ACTTTCTTCC 430 ACTTAATAGG A7C 503

(2) information for SEQ ID NO: 8:

(i) sequence characteristics:

(A) length: 497 base pairs (B) type: nucleic acid (C) chain: unknown (D) topology: unknown (ii) type of molecule: cDNA (ix) features:

(A) name / key: (B) location: additional (1..497) (xi) sequence description: SEQ ID NO: S:

CTATTAAGTT ATTGCCATAG C - AAGAAAGTG C - GCTGTTTTT TGTTCTTTCT TCGTTTTTTT 6 0 TCCTCTTACA. GGAATCCCCT TTTC-ATTTA.Ä GGCTTCAAAC ATTTCCCCTG CGTTGTGTGT 120 CCATTľAGCT GATGCATATG TGTTGTAACC GTT7TCCAGA ATTAGTTCTT TGAAGTľACA ISO ATCTTCATTG CATTCTTTCT TTGCATAGAG TTTTCCTTCC TTCTTCATTG CAAGATAGAA 24 0 TTCAGATTCA ACACCTTTGA TTGCAACGAT ACCAACAC-CA ACAGTACGGA TTTCCATAAT 3 CO ATTGTAGTTG TTTTTCATCT CTTGGGTGCC CTTGACTTTG CCGCGTTTGT CGATACGCAG 350 GTACCACTGT GTTCGACAGA AC AGTCTTCT CACTCTTATA TCCCCTCCTT CCATGTAATC 420 ATAACTTCTT GTGTGTCGCT CAGGGCTGGA ACAG7TCACA TTTGTAGCCA TTTGCTC7GG 480 AGTCATGTCA TTGCACA 497 (2) sequence information for SEQ ID NO: 9: (i) sequence characteristics:

(A) length: 164 amino acids (B) type: amino acid (C) chain: unknown (D) topology: unknown (ii) molecule type: protein (xi) sequence description: SEQ ID NO: 9:

Met Cys Asn Asp Met Thr Pro Glu , Gin Met Ala Thr same time wall same time Cys 1 5 10 15 Ser Ser Pro Glu Arg His Thr Arg Ser Tyr Asp . Ty r Met Glu Gly Gly 20 25. 30 Asp Val Arg Arg Arg Leu Phe Cys Arg Thr gin Trp Tyr Leu Arg 35. ' 40 45 Asp Lys Arg Gly Lys Val Lys Gly Thr gin Glu Met Lys same time same time 50 55 50 Tyr Asn ile Met Glu White Arg Thr Val Ala wall Gly Ile wall Ala Ile δ 5 70 75 30 Val Glu Ser Glu Phe Tyr Leu Ala Met same time Lys Glu Gly Lys 1 '' I ' 35 90 95 Leu Tyr Ala Lys Lys Glu Cys same time Glu Asp Cys same time Phe Lys Glu Leu 100 105 110 Leu Glu Asn Gly Tyr Asn Thr Tyr Ala Ser Ala Lys Tro Thr His 115 120 125 Asn Gly Gly Glu Met Phe Val Ala Leu Asn gin Lys Gly Ile for wall 130 135 140 Arg Gly-Lys Lys Market Lys Lys Glu Gin Lys Thr Ala. His Phe Leu for 1 D 150 155 160

(2) sequence information for SEQ ID NO: 10: (i) sequence characteristics:

(A) length: 55 base pairs (B) type: nucleic acid (C) chain: unknown (D) topology: unknown (ii) molecule type: cDNA (xi) sequence description: SEQ ID NO: 10:

CC-ATTTGÄTT CTAGAAGGA

TGGTTAACGC GTTGGAATTC GC-TAC

S (2) sequence information for SEQ ID NO: 11: (i) sequence characteristics:

(A) length: 49 base pairs _ (B) type: · nucleic acid (C) chain: unknown (D) topology: unknown (ii) type of molecule: cDNA (xi) sequence description: SEQ ID NO: 11:

ČGAATTCCAA CGCGTTAACC ATATGTTATT CCTCCTTCTA CAATCAAAT (2) information for sequence SEQ ID NO: 12:

(i) sequence characteristics:

(A) length: 20 base pairs (B) type: * nucleic acid (C) chain: unknown (D) topology: unknown (ii) type of molecule: cDNA (xi) sequence description: SEQ ID NO: 12:

.GAAGAAAACC ATTACAACAC ²⁰ (2) information for sequence SEQ ID NO: 13:

(i) sequence characteristics:

(A) length: 26 base pairs (B) type: nucleic acid (C) chain: unknown (D) topology: unknown (ii) type of molecule: cDNA (xi) sequence description: SEQ ID NO: 13:

ACAACGCGTG CAATGACATG ACTCCA 26 (2) information for sequence SEQ ID NO: 14:

(i) sequence characteristics:

(A) length: 27 base pairs (B) type: nucleic acid (C) chain: unknown (D) topology: unknown (ii) molecule type: cDNA (xi) sequence description: SEQ ID NO: 14:

(2) sequence information for SEQ ID NO: 15: (i) sequence characteristics: ACACATATGT GCAATGACAT GACTCCA 27 (2) sequence information:

(A) length: 31 base pairs (B) type: nucleic acid (C) chain: unknown (D) topology: unknown (ii) type of molecule: cDNA (xi) sequence description: SEQ ID NO: 15:

(2) sequence information for SEQ ID NO: 16: (i) sequence characteristics: ACAGGATCCT ATTAAGTTAT TGCCATAGGA A 31

(A) length: 25 base pairs (B) type: nucleic acid (C) chain: unknown (D) topology: unknown (ii) type of molecule: cDNA (xi) sequence description: SEQ ID NO: 16:

GGAAAACGGT:, ATACCA 25 (2) information for SEQ ID NO: 17: (i) sequence characteristics:

(A) length: 26 base pairs (B) type: nucleic acid (C) chain: unknown (D) topology: unknown (ii) type of molecule: cDNA (xi) sequence description: SEQ ID NO: 17:

GTGTTGTAAC CGTTTTCCAG AA7TAG

Claims (16)

PATENT CLAIMS An analogue of a naturally occurring FGF family protein, wherein at least one amino acid in the -Asn-His-Tyr-Asn-Thr- loop forming sequence in said protein is replaced by the remainder of the various amino acids having a higher looping potential. The analog of claim 1, wherein said naturally occurring protein is KGF. The analog of claim 2, wherein said substituted amino acid is amino acid 116. The analog of claim 3, wherein said amino acid having a higher loop forming potential is selected from the group consisting of glycine, proline, tyrosine, aspartic acid, asparagine, serine, glutamic acid, threonine, lysine, glutamine, arginine, phenylalanine, and tryptophan. . The analog of claim 4, wherein said amino acid having a higher loop forming potential is glycine. The analog of claim 5 having the amino acid sequence shown in Figure 10. The analog of claim 6, wherein the at least one terminal amino acid residue is deleted, although said analog substantially retains increased biological activity. The analog of claim 7, wherein at least one cysteine residue of said naturally occurring protein is replaced by a neutral amino acid residue. A DNA sequence that encodes the analog of claim 1 for prokaryotic or eukaryotic expression. ' The DNA sequence of claim 10, wherein said analog is the analog of claim 6. Pharmaceutical compositions comprising a therapeutically effective amount of the analog of claim 1 and one or more pharmaceutically acceptable excipients. Pharmaceutical compositions according to claim 11, wherein said analog is an analog according to claim 6. A method of treating deep wounds, comprising introducing into said wounds a therapeutically effective amount of the analog of claim 1. The method of claim 13, wherein said analog is an analogue of claim 6. The analog of claim 5 having the amino acid sequence shown in Figure 1. The analog of claim 5 having the amino acid sequence shown in Figure 2.