JP3127246B2 - Polypeptides, DNA and uses thereof - Google Patents

Description

The present invention relates to a heparin binding secretory
The present invention relates to a deletion type mutein of a transforming factor (hereinafter sometimes abbreviated as "hst-1" in the present specification) and a technique for producing the same.

Conventional technology hst-1 is sometimes described as HSTF1 (M. Yoshid
A et al., Proc. Natl. Acad. Sci. USA, vol. 85, pp. 4861-4864 (1
988)).

The hst-1 gene is a transforming gene isolated from human gastric cancer tissue [H. Sakamoto et al., Proc.
USA. 83 : 3997 (1986)], and its gene product is one of the cell growth factors, fibroblast growth factor (FG).
F) was found to be similar in structure and biological activity [T. Yoshida et al., Proc. Natl. Acad. Sci. USA 83 : 7305 (19
87), K. Miyagawa et al., Oncogene 3 , 383 (1988)]. In addition, hst-1 gene is not only gastric cancer, colorectal cancer, liver cancer,
It has been isolated from Kaposi's sarcoma of an AIDS patient (T. Koda
Et al., Jpn. J. Cancer Res. (Gann) 78 : 325 (1987), H. Nakag.
awa et al., Jpn. J. Cancer Res. (Gann) 78 : 651 (1987), Y. Yu
asa et al., Jpn. J. Cancer Res. (Gann) 78 : 1036 (1987), PD
elli Bovi et al., Cell 50 : 729 (1987)], and this gene is considered to form an FGF family with basic FGF, acidic FGF, int-2 gene product and the like. The gene isolated from the above Kaposi's sarcoma is also called K-FGF. As described above, since the hst-1 gene is a transforming gene having the function of a cell growth factor, its gene product has the potential to be a prophylactic or therapeutic drug such as a therapeutic drug for damage, like FGF.

The nucleotide sequence of the hst-1 gene has already been reported [MT
Aira et al., Proc. Natl. Acad. Sci. USA 84 : 2980 (1987), T.
Yoshida et al., Proc. Natl. Acad. Sci. USA 84 , 7305 (198
7)], The report also shows the constituent amino acids of hst-1 deduced from this.

However, naturally occurring hst-1 is considered to be extremely small, and there has been no report of obtaining hst-1 from a biomaterial.

On the other hand, production of hst-1 using a genetic recombination technique has been reported [P. Delli Bovi et al., Cell 50 : 729 (1987) and K. Miyagawa et al., Oncogene 3 : 383 (1988)]. However, even in these cases, mass production is very difficult.

Problems to be Solved by the Invention As described above, there are many unclear points regarding the properties and biological activities of hst-1. However, it is conceivable that hst-1 may be used as a medicine or a reagent.

However, as described above, there is no example in which hst-1 has been produced in large quantities.

Therefore, the present inventors used recombinant DNA technology to obtain this hst-
1 was considered to be modified so as not to adversely affect its activity, but to allow microbiological mass production. It is suggested that such modification may not only increase the productivity of the above-described cells but also increase the stability of hst-1, increase the cell growth activity per molecule, and activate unknown biological activities. Thought.

Means for Solving the Problems The present inventors have prepared a mutein gene in which a part of the hst-1 gene has been deleted by recombinant DNA technology, and expressed this gene in a microorganism, whereby this hst-1 mutein has been obtained. Intensive research on the intracellular production performance, increased activity, and changes in biological activity has led to the discovery of muteins that fulfill these objectives.
Furthermore, as a result of research based on these findings, the present invention has been completed.

The present invention provides: (1) a deletion type mutein of heparin binding secretory transforming factor (hst-1); (2) a recombinant DNA having a base sequence encoding the mutein of (1); (3) a vector containing the recombinant DNA of (2), (4), a transformant carrying the vector of (3),
And (5) a method for producing the mutein according to (1), wherein the transformant according to (4) is cultured in a medium.

Hst-1, which is the basis of the deletion type mutein of the present invention, is
It is a protein consisting of the 175 amino acid sequence shown in the figure.

hst-1 is described in Taira et al., Proc. Natl. Acad. Sci. USA, 84 , 298.
0-2984 (1987) shows that it consists of a 206 amino acid sequence. The amino acid sequence is shown in FIG. However, Delli-Bovi et al.
ellular Biology, 8, in 2933-2941 (1988) and expressed in monkey COS-1 cells and (is called the target product as K-FGF.), 30 pieces or 31 amino acids from the N-terminal is desorbed Is obtained. Therefore, it is most appropriate that the mature protein of hst-1 has an amino acid sequence in which 31 amino acids have been eliminated from the N-terminal of the 206 amino acid sequence (shown in FIG. 1). It is believed that there is.

Examples of the deletion type mutein of the present invention include those in which at least one amino acid among the constituent amino acids of hst-1 has been deleted and which has hst-1 activity.

As the deletion type mutein, those in which 1 to 47 consecutive constituent amino acids of hst-1 have been deleted are preferable,
Further, those having 1 to 43 deletions are preferable, and
Those having a deletion of from 27 to 27 are preferred.

More preferred examples of the deletion type mutein of the present invention include those in which the above-described deletion has a deletion of a continuous constituent amino acid from the N-terminus.

The chemical structure of the deleted hst-1 mutein of the present invention may depend on various factors. For example, the muteins may be obtained as acidic, basic or neutral salts.
Further, the mutein may be a derivative to which a sugar chain, a lipid, an acetyl group or the like is added. The mutein of the present invention is a deletion form of hst-1, may be the above-mentioned derivative, and is included in the mutein of the present invention as long as it has hst-1 activity.

The biological activity of the deleted hst-1 mutein of the present invention can be measured, for example, by the method of Sasada et al. (Mol. Cell Biol. 8 : 588).
According to the method of Tada et al. (Journal of Immunologic), the induction of DNA synthesis in mouse BALB / c3T3 cells was measured using [ ³ H] thymidine incorporation as an index according to -594 (1988)).
al Methods, 93 , 157 (1986)), or by measuring the promotion of proliferation of vascular endothelial cells, or according to the method of Auerbach et al. (Developmental Biology, 41 , 391 (1974)).
By measuring angiogenesis on the chicken chorioallantoic membrane,
Can do it.

The expression type vector containing the DNA having the nucleotide sequence encoding the hst-1 mutein of the present invention includes, for example, (a) separating RNA encoding the hst-1 protein, and (b) single-stranded complementary DNA from the RNA. (CDNA) and then a double-stranded DNA, (c) incorporating the complementary DNA into a plasmid, (d) transforming a host with the obtained recombinant plasmid, and (e) transforming the resulting transformant. After culturing, a plasmid containing the target DNA is isolated from the transformant by a suitable method, for example, colony hybridization using a DNA probe, and (f) the target cloned DNA is cut out from the plasmid, (G) generating a deletion of interest on the cloned DNA; (h) optionally binding an oligonucleotide containing an ATG codon; (ii) linking the DNA downstream of the promoter in the vehicle. By tying, it can be manufactured.

RNA encoding hst-1 can be obtained from various human cancer cells, for example, gastric cancer, colorectal cancer, liver cancer, Kaposi's sarcoma, human germ cell tumor, NIH3T3 transformant by human hst-1 gene, and the like.

The methods for preparing RNA from human cancers, guanidine thiocyanate method [JMChirgwin et al, Biochemistry (Biochemistry), 18 5294 (1979 ) ] and the like.

Using the thus obtained RNA as a template, cDNA is synthesized, for example, by the method of Waston and Jackson (Watson, CJand Ja
ckson, JF, DNA Cloning, A Practical Approach IRL
Press, Oxford, p79, 1985), for example, a λ phage vector λgt10 (Huynh, TV et al., DNA Cloning a.
Practical approach, IRL Press, Oxford, p49,19
85) and use this in E. coli, for example, C600, HflA (Huy
nh, TV et al., supra) to create a cDNA library.

From the cDNA library thus obtained, a method known per se, for example, a plaque hybridization method (Maniatis et al., Molecular Cloning (Molecu
lar Cloning) Cold Spring Habor Laboratory, p320, 198
2) and DNA sequencing (Proc. Natl. Acad. Sci. USA
74 , 560 (1977), Nuclueic Acids Research 9 , 309 (1981)], and the desired phage clone is selected.

Next, the phage clones were collected and, for example, the method of Davis et al. (Davis et al., Advanced Bacterial Genetics, Cold Spri
ng Harbor Laboratory 1980), it is also convenient to extract the phage DNA, cut out the cDNA portion using a restriction enzyme, reassemble it into a plasmid such as pUC13, and use it.

The plasmid containing the cloned DNA containing the nucleotide sequence encoding hst-1 is cut out as it is or, if desired, with a restriction enzyme.

The cloned gene can be ligated downstream of a promoter in a vehicle (vector) suitable for expression to obtain an expression type vector.

To produce the muteins of the present invention, conventional recombinant
In addition to DNA technology, site-directed mutagenesis technology (Site-d
ireeted mutagenesis) is adopted. Such techniques are well known and are described in R. F. Racer (Lather, RF) and JP Lecoq (Lecoq. JP), Genetic Engineering, Academic Press (1983) pp. 31-50, Is shown in Oligonucleotide directed mutagenesis
Smith (M.) and Es Gillam (S.),
Genetic Engineering: Principles and Methods, Plenum Press (1981), Vol. 3, pp. 1-32.

In order to produce a structural gene encoding the mutein of the present invention, for example, (a) a single-stranded D consisting of a single strand of the structural gene of hst-1
Hybridizing NA with the mutant oligonucleotide primer, (b) extending the primer with a DNA polymerase,
Forming a mutated heteroduplex, and (c) replicating the mutated heterodimer.

The size of the oligonucleotide flyer is determined by the conditions required for stable hybridization of the primer to the gene region to be mutated and by the limitations of currently available oligonucleotide synthesis methods. In designing an oligonucleotide for use in oligonucleotide directed mutagenesis, factors to consider (eg, overall size, size of the portion bypassing the mutation site) are M Smith and S Gillam (Supra). In general, the total length of the oligonucleotide is such that it optimizes stable and unique hybridization at the mutation site, and the extensions from the mutation site to the 5 'and 3' ends It should be large enough to avoid editing mutations due to the exonuclease activity of the polymerase. Oligonucleotides used for mutagenesis according to the invention are usually
About 12 to about 24 bases, preferably about 14 to about
It contains 20 bases, more preferably about 14 to about 18 bases. These usually contain at least about 3 3 'bases of the codon to be changed.

In the case of obtaining a mutein in which the hst-1 constituent amino acid is deleted, three methods can be considered as a method for producing a mutant hst-1 gene. One is to delete the amino terminus of hst-1, the second is to delete the central part of hst-1, and the third is to delete the carboxyl terminus of hst-1.

When the amino terminus is to be deleted, the codon of the gene encoding the carboxyl terminus of the amino acid sequence to be deleted is changed to ATG encoding Met using the characteristic site-directed mutagenesis, and the codon 5 'Generates an appropriate restriction enzyme recognition site on the' -terminal side to facilitate ligation with the promoter, or reads the oligonucleotide with ATG in the gene whose amino terminus has been deleted with the restriction enzyme, and reads the reading frame. Join together.

When the amino acid sequence is deleted at the center thereof, unique restriction enzyme recognition sites are generated at the 5 'and 3' ends of the gene encoding the sequence to be deleted using characteristic site-directed variability. If this site is digested with an enzyme and extracted and religated to connect the gene, a gene encoding hst-1 in which the desired amino acid is deleted can be obtained. At this time, it goes without saying that the reading frame does not shift due to the restriction enzyme digestion.

When the amino acid sequence at the carboxyl terminal is deleted, the codon of the gene encoding the amino acid at the amino terminal of the sequence to be deleted may be changed to a stop codon by site-directed mutation.

The deletion type mutein of the present invention may be one in which the constituent amino acids of hst-1 have been deleted and at least one of the amino acids has been replaced with another amino acid.

Examples of the constituent amino acids before substitution include cysteine and those other than cysteine (eg, aspartic acid, arginine).

When the constituent amino acid before substitution is cysteine, the substituted amino acid is preferably, for example, a neutral amino acid. Specific examples of the neutral amino acid include glycine, valine, alanine, leucine, isoleucine, tyrosine, phenylalanine, histidine,
Tryptophan, serine, threonine, methionine and the like. Particularly, serine and threonine are preferred.

When the constituent amino acid before substitution is other than cysteine, another substituted amino acid is, for example, an amino acid before substitution in terms of hydrophilicity, hydrophobicity or charge of the amino acid. Choose one with different properties. Specifically, when the amino acid before substitution is aspartic acid, the amino acids after substitution are asparagine, threonine, valine, phenylalanine,
Although arginine etc. are mentioned, especially asparagine and arginine are preferable.

When the amino acid before substitution is arginine, the amino acids after substitution are glutamine, threonine,
Leucine, phenylalanine and aspartic acid are exemplified, and glutamine is particularly preferred.

When the hst-1 deletion mutein of the present invention is produced by site-directed mutation, a plurality of mutations may be made in the DNA sequence, that is, a DN corresponding to an amino acid.
You must be aware that the codon for A is degenerate.

For example, in the case where the constituent amino acid is an amino acid other than cysteine and the purpose is to obtain a mutein in which the mutein is substituted with another amino acid, a method for producing a mutant hst-1 gene is the same as in the case of cysteine, using an oligonucleotide primer. Make codon changes.

However, it goes without saying that the design of the oligonucleotide primer differs depending on which amino acid is changed.

The primer used was M13 from which one strand of the hst-1 gene was cloned [Yanisch-Prror, C., Vieira, J. Messing, Gene, 33 103-119 (1985), Messing J. Methods in・ Enzymolog (Methods in Enzymolog
y), 101 20-78 (1983)], fd [R. Herrman et al.
Molecular and General Genetic (Mol. Gen. Genet,), 177 231 (1980)], or φ × 17
4 [M. Smith and S. Gillam, Genetic Engineering, Plenum Press, Vo
l. 3, is hybridized to the single-stranded phage such as pp1-32 (1981)]. It is recognized that the phage can carry either the sense strand or the antisense strand of the gene. When the phage carries the antisense strand, apart from a mismatch with this codon, which determines the triplet encoding another amino acid, the primer is identical due to codon degeneracy to the region of the sense strand containing the mutated codon. It may not be. Similarly, when the phage carries the sense strand, it may not be complementary to the region of the sense strand containing the codon to be mutated, except for the appropriate mismatch in the triplet that pairs with the codon to be deleted. Is also good. The conditions used for hybridization are described by M. Smith and S. Gillam (supra). Temperatures typically range from about 0 ° C to 70 ° C, more usually from about 10 ° C to 50 ° C. After hybridization, the primers are extended on phage DNA by reaction with E. coli DNA polymerase I, T4 DNA polymerase, reverse transcriptase, or other suitable DNA polymerase. The resulting dsDNA is converted to closed-ring dsDNA by treatment with a DNA ligase such as T4 DNA ligase. DNAB molecules containing single-stranded regions can be destroyed by S1 endonuclease treatment.

The resulting mutagenized heterodimer is used to transform a host organism or cell capable of being infected. In heterodimeric replication by the host, progeny are produced from both chains. Following replication, the mutant gene is isolated from the progeny of the mutant strand and inserted into a suitable vector, which is used to transform a suitable host organism or cell.

Next, the phage DN carrying the mutated gene
A is isolated and integrated into a plasmid.

The plasmid incorporating the DNA, eg Escherichia coli-derived pBR322 [Gene (gene), 2, 95 ( 1977)], pBR3
25 [Gene, 4 , 121 (1978)], pUC12 [Gene, 19 , 259]
(1978)], pUC13 [Gene, 19 , 259 (1982)], pUB110 derived from Bacillus subtilis [Biochemical and Biophysical Research Communication (Biochemical and Biop
hysical Research Communication), 112 , 678 (198
3)], etc.
Any of those that can be replicated and maintained in the host can be used.

As a method of integrating into a plasmid, for example, T.Ma
niatis et al., Molecular Cloning (Molecular C
loning) Cold Spring Harbor Laboratory, p. 239 (1
982).

The cloned gene can be ligated downstream of a promoter in a vehicle (vector) suitable for expression to obtain an expression-type recombinant vector.

As a vehicle (vector) for preparing a recombinant vector, for example, a plasmid pBR32 derived from E. coli is used.
2, [gene, 2 , 95 (1977)], pBR325 [gene, 4 , 121 (1978)], pUC12 [gene, 19, 259 (198
2)], pUC13 [Gene, 19 , 259 (1982)], pUB110 derived from Bacillus subtilis [Biochemical and Biophysical Research Communication (Biochemical and Biophysica)]
l Research Communication), 112 , 6678 (1983)], pTP
5, pC194), yeast-derived plasmids (eg, pSH19, pSH15),
Alternatively, bacteriophage such as λ phage and animal viruses such as retrovirus and vaccinia virus can be mentioned.

The gene has AT at its 5 'end as a translation initiation codon.
G and TA at the 3 'end as a translation stop codon
It may have A, TGA or TAG. In order to further express the gene, it is connected to a promoter upstream thereof.
The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression.

Further, when the host at the time of transformation is Escherichia, trp promoter, lac promoter, rec A promoter, λpL promoter, lpp promoter, T7 promoter, etc., when the host is Bacillus,
In the case of host yeast such as SPO1 promoter, SPO2 promoter, penP promoter, etc., PHO5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferable. It is particularly preferred that the host is Escherichia and the promoter is the trp promoter or T7 promoter.

When the host is an animal cell, SV40-derived promoter, a retroviral promoter, and the like,
Particularly, a promoter derived from SV40 is preferable.

Using the vector containing the DNA thus constructed, a transformant is produced.

Examples of the host include Escherichia, Bacillus, yeast, animal cells and the like.

Examples of the genus Escherichia include Escherichia
Escherichia coli K12DH1 [Proc. Natl. Acad. Sc
i.USA, 60 , 160 (1968)], M103 [Nucleic Acids Research, 9 , 309]
(1981)], JA221 [Journal of Molecular
Biology (Journal of Molecular Biology) 12
0, 517 (1978)], HB101 [ Journal of Molecular Biology, 41, 459 (1969)] , C600 [ Genetics (Genetics), 39, 440 ( 1954)] , and the like.

As the Bacillus genus, for example, Bacillus subtilis MI114 [(Gene, 24 , 255)
(1983)], 207-21 [Journal of Biochemistry 95 , 87 (1984)]
And the like.

As the yeast, for example, sucker Roy Streptomyces cerevisiae (Saccharomyces cerevisiae) AH22R ^-, NA87
-11A, DKD-5D and the like.

As an animal cell, a cell line is preferable. For example, monkey cell COS-7 [cell, 23 ,
157 (1981)], Vero, Chinese hamster cell CHO,
Mouse L cells, human FL cells and the like can be mentioned.

To transform the above Escherichia, for example,
Proc. Natl. Acad. Sci. USA, 69 , 2110 (1972), Gene, 1
7 , 107 (1982).

To transform Bacillus sp., For example, Molecular and General Genetics (Molecu
lar & General Genetics), 168 , 111 (1979).

To transform yeast, for example, Proc.Natl.Acad.S
ci.USA 75 ; 1929 (1978).

Transformation of animal cells is performed, for example, according to the method described in Virology 52 , 456 (1973).

In this manner, a transformant transformed with the vector containing the hst-1 deletion mutein cDNA is obtained.

When culturing a transformant whose host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium to be used for culturing, and a carbon source necessary for the growth of the transformant is included therein. Nitrogen sources, inorganic substances, etc. are contained. Examples of carbon sources include glucose, dextrin, soluble starch, and sucrose. Examples of nitrogen sources include ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, and potato extract. Alternatively, examples of the organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. In addition, yeast extract, vitamins, growth promoting factors and the like may be added.

 The pH of the medium is preferably about 6-8.

As a medium for culturing the genus Escherichia, for example, an M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journal of Experiments in
Molecular Genetics), 431-433, Cold Spring Harbo
r Laboratory, New York 1972)]. Here, in order to make the promoter work efficiently if necessary,
For example, a drug such as 3β-indolyl acrylic acid can be added.

When the host is a bacterium belonging to the genus Escherichia, the culture is usually about 15 to 43.
C. for about 3 to 24 hours, and if necessary, aeration and stirring can be added.

When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually carried out at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be applied.

When culturing a transformant in which the host is yeast, for example, Burkholder's minimal medium [Bostian, KL et al., Proc. Natl. Acad. Sci. USA, 77 , 4505]
(1980)]. The pH of the medium is preferably adjusted to about 5-8. Culture is usually performed at about 20 ° C. to 35 ° C. for about 24 to 72 hours, and aeration and / or agitation are added as necessary.

When culturing a transformant in which the host is an animal cell, a MEM medium [Science 122 , 501 (1
952)], DMEM medium [Virology, 8 , 396
(1959)], RPMI1640 medium [Journ of the American Medical Association (The Journal)
al of the American Medical Association) 199,5
19 (1967)], 199 times [Proceeding of the
Proceeding of the Society for the Biolog
ical Medicine) 73 , 1 (1950)]. About 5 to 20% of fetal bovine serum may be further added thereto.
Preferably, the pH is between about 6 and 8. Culture is usually about 30-40
C. and the culturing time is about 15 to 60 hours, and aeration and stirring are added as necessary.

The hst-1 deletion mutein can be separated and purified from the culture by, for example, the following method.

When extracting the hst-1 deletion mutein from cultured cells or cells, after culturing, the cells or cells are collected by a known method and suspended in a buffer containing a protein denaturant such as guanidine hydrochloride. Eluting the target protein out of the cells by disrupting the cells or cells by French pressing, ultrasonication, lysozyme and / or freeze-thawing, and then obtaining the hst-1 deletion mutein by centrifugation. Etc. can be used as appropriate. In particular, a method in which lysozyme and ultrasonic treatment are used in combination is preferable.

Purification of the hst-1 deletion mutein from the supernatant can be carried out by appropriately combining known separation and purification methods. As these known separation and purification methods, methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, mainly molecular weight such as Method using difference in charge, method using charge difference such as ion exchange chromatography, method using specific affinity such as affinity chromatography, use of difference in hydrophobicity such as reverse phase high performance liquid chromatography Method,
A method utilizing the difference between isoelectric points, such as isoelectric point electrophoresis, may be used.

More specifically, contaminating nucleic acids and acidic proteins can be removed by subjecting the supernatant to ion exchange chromatography using DEAE cellulose or the like as a carrier. For example, it is effective to apply the supernatant to a DEAE cellulose column equilibrated with a buffer such as Tris near neutrality, and collect the flow-through fraction. Further, by carrying out ion exchange chromatography using CM cellulose or the like as a carrier, the deletion type mutein of hst-1 can be adsorbed on the carrier and purified by eluting it with a salt solution.

The hst-1 deletion mutein can be purified directly from the bacterial cell extract by column chromatography on an acidic resin such as CM Sephadex. For example, the supernatant is equilibrated with a weakly acidic buffer (eg, phosphate buffer).
-It can be carried out efficiently by applying to a cellulose column. After washing the column with the same buffer, the column can be eluted with a buffer further containing a salt (eg, NaCl) to elute the hst-1 deletion mutein. These eluates can be lyophilized after dialysis.

It is also advantageous to apply the affinity chromatography method using heparin-sepharose as a carrier to a hst-1 deletion mutein in an Escherichia coli extract as a method for purifying an hst-1 deletion mutein. For example, the above eluate is applied to a heparin-Sepharose column equilibrated with a buffer solution such as Tris, phosphate or the like near neutrality, washed thoroughly, and then subjected to a linear gradient elution such as NaCl to elute the hst.
-1 deletion mutein can be purified.

In particular, a heparin column developed for high-performance liquid chromatography (eg, Shodex AF-pak HR 894, manufactured by Showa Denko) is effective.

As in the case of the above-mentioned heparin sepharose column, when a sample is applied with a buffer near neutrality, washed sufficiently, and then subjected to a linear gradient elution such as NaCl, the deletion type mutein of hst-1 is recovered as a substantially uniform sample. be able to.

The sample thus obtained is dialyzed and freeze-dried,
It can also be a dry powder. Further, it is preferable to add serum albumin or the like as a carrier and preserve it, since the adsorption of the sample to the container can be prevented.

The coexistence of a trace amount of a reducing agent in the purification step or the storage step is suitable for preventing oxidation of the sample. Examples of the reducing agent include β-mercaptoethanol, dithiothreitol, and glutathione.

In this way, a substantially pure hst-1 truncated mutein substantially free of pyrodiene and endotoxin is obtained. As the substantially pure hst-1 deletion mutein of the present invention, the hst-1 deletion mutein having a protein content of 95% (w / w) or more, more preferably hst-1 Those having a deletion mutein of 98% (w / w) or more are mentioned. The polypeptide has at its N-terminus
You may have Met.

The activity of the hst-1 deletion mutein thus generated can be measured by a known BALBA / c3T3 cell growth promoting effect.

In cells transfected or transformed with the DNA of the present invention, only a small amount of the deletion form of hst-1 is originally synthesized.
Or a large amount of hs in various cells that are not synthesized at all
t-1 deletion mutein can be produced, and hst
-1 deletion muteins can be advantageously derived.

The expression type plasmid containing the gene encoding the hst-1 deletion mutein of the present invention is capable of producing hst-1 deletion mutein in the cells by introducing the expression plasmid into various cells. , Hst-1 deletion muteins can be obtained in large quantities.

The hst-1 deletion mutein produced here has the activity of promoting the proliferation of cells such as vascular endothelial cells and the activity of promoting angiogenesis, and has low toxicity, so that it promotes healing of burns, wounds, postoperative tissues and the like. It can be used as a therapeutic agent such as an agent. Further, it can be used as a reagent for promoting cell culture.

In order to use the hst-1 deletion mutein of the present invention as a medicament, a pharmaceutical composition (eg, an injection, an injectable solution, or a diluent) may be used as a powder as it is or together with other pharmacologically acceptable carriers, excipients, and diluents. It can be completely administered parenterally or orally as a tablet, capsule, liquid, ointment to a warm-blooded mammal (eg, human, mouse, rat, hamster, rabbit, dog, cat).

Formulation of an injection is carried out, for example, using physiological saline or an aqueous solution containing glucose and other adjuvants according to a conventional method. Pharmaceutical compositions such as tablets and capsules can be prepared according to conventional methods. Furthermore, injections as pharmaceutical compositions,
When manufacturing liquids, tablets, capsules, etc., they are performed under aseptic conditions.

When the hst-1 deletion mutein of the present invention is used as the above-mentioned medicament, for example, the above-mentioned warm-blooded animal may be administered in a daily dose of about 1 ng to 100 ng in consideration of the administration route, symptoms, and the like.
An appropriate amount is selected from μg / kg and administered.

When the hst-1 deletion mutein of the present invention is used as a reagent for promoting cell culture, about 0.01 to 10 μg, more preferably about 0.1 to 10 μg per medium 1 is used.
It is preferable to add to the medium so that

The mutein of the present invention exhibits excellent cell growth promoting activity and the like and is stable under acidic conditions, and thus can be used as a therapeutic agent for ulcers such as ulcers of the digestive tract.

In the specification and the drawings of the present invention, when bases, amino acids and the like are indicated by abbreviations, IUPAC-IUB Commision on
This is based on the abbreviation by Biochemical Nomenclature or the abbreviation commonly used in this field, examples of which are described below. In addition, when an amino acid can have an optical isomer, the L-isomer is indicated unless otherwise specified.

DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate dCTP: deoxy Cytidine triphosphate ATP: Adenosine triphosphate Tdr: Thymidine EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate Gly: Glycine Ala: Alanine Val: Valine Lcu: Leucine Ile: Isoleucine Ser: Serine Thr: Threonine Cys: Cysteine Met: Methionine Glu: glutamic acid Asp: aspartic acid Lys: lysine Arg: arginine His: histidine Phe: phenylalanine Tyr: tyrosine Trp: tryptophan Pro: proline Asn: asparagine Gln: glutamine The transformant obtained in the examples described below is a foundation. Deposited with the Fermentation Research Institute (IFO) and trade industry Deposited under the Budapest Treaty with the Institute of Microbial Industry and Technology (FRI) of the Ministry of Industry and Technology. The accession numbers and accession dates are shown in Table 1 below.

Hereinafter, the present invention will be described more specifically with reference to Examples, but the present invention is not limited thereto.

The mutein obtained in the following Examples in which amino acid number 27 is deleted from the N-terminus is referred to as hst-1 mutein N27, and its amino acid sequence is shown in FIG.

Example 1 a) Construction of Expression Plasmid Plasmid pKOc5 (Proc. Natl. A) containing human hst-1 cDNA
USA 84 , 2980-2984 (1937)) was cut with Hind III and blunt-ended by the E. coli DNA polymerase I Klenow fragment reaction. After ligating a BamH I linker by a T4 ligase reaction, it was cut with BamH I-Sty I to obtain a 0.49 kb D
An NA fragment was obtained. Synthetic oligonucleotide 5'TATGCCGGTG
GCAGCGCAGCC3 'and 5'CTTGGGCTGCGCTGCCACCGGCA3'
Was ligated to the 5 'end of the above 0.49 kb DNA.
b Nde I-BamH I DNA fragment (start codon ATG, human hst-
1 cDNA containing nucleotides 413 to 916) was expressed in NdeI-BamHI of E. coli expression vector pET3c (Gene 53 , 125-135 (1987)) having a T10 phage φ10 promoter.
Incorporation was carried out to obtain pTB1051 (FIG. 4).

b) Expression of cDNA in E. coli λ phage DE3 (Studier, FW et al., J. Mol. Bio
189 : 113-130 (1986)), and the plasmid pLysS (Studi) containing the lysozyme gene of T7 phage.
er, FW, et al., J. Mol. Biol. 189 : 113-130 (1986)) to introduce E. coli MM294 (DE3) / pLysS strain.

The plasmid pTB1051 obtained in the above (a) was introduced into this E. coli MM294 (DE3) / pLysS strain, and the E. coli MM294 (DE
3) / pLysS, pTB1051 (IFO 14952, FERM BP-2621) was prepared. 10 μg / ml chloramphenicol, 35 μg
/ L medium containing ampicillin / ml and a Klett value of about 12
At time 0, isopropyl β-D thiogalactopyranoside (IPTG) was added to a final concentration of 0.4 mM and an additional 4
Culture was continued for hours. The cells were collected by centrifugation, washed with ice-cold phosphate buffered saline (PBS), re-repaired, and stored at -20 ° C until use.

c) Purification of recombinant hst-1 mutein Cells collected from a 10 liter culture were mixed with 250 ml of ice-cold 10 mM Trite.
s-HCl (pH 7.4), 10 mM EDTA, 0.5 M NaCl, 10% sucrose, 1 mM
The suspension was suspended in PMSF, and egg white lysozyme was added to a concentration of 0.5 mg / ml. After leaving in ice for 1 hour, incubate at 37 ° C for 5 minutes, sonicate under ice cooling (20 seconds, 2 times),
Centrifugation (SORVALL, 18K rpm, 30min, 4 ° C) was performed to obtain a supernatant, which was used as a cell extract.

250 ml of the cell extract is added to 20 mM Tris-HCl pH 7.6, 0.5 M NaCl
The solution was passed through a Q Sepharose (Pharmacia) column (diameter 5 × 5 cm) equilibrated with the solution to remove nucleic acid components in the extract. Flow-through solution from column and 20 mM Tris-HCl, pH 7.
The combined column washes with 6,0.5M NaCl solution were collected (Q
Sepharose flow-through fraction 450 ml). This fraction was applied to a high-performance liquid chromatography apparatus (Gilson) equipped with a heparin column Shodex AF-pak HR-2094, (2 cm ID × 25 cm, manufactured by Showa Denko). The column was washed with 20 mM Tris-HCl p
After washing with H7.6 solution and then with 20 mM Tris-HCl pH7.6, 0.5 M NaCl solution, 20 mM Tris-HCl pH7.6, 0.5
Linear gradient elutiion of NaCl from M to 2M
on, 180 min, flow rate 6.0 ml / min).

The elution pattern is shown in FIG. In FIG. 5, the ordinate indicates the OD ₂₈₀ absorption value and the NaCl concentration in the gradient. The horizontal axis shows the fraction number, ti
Gradient elution was started at me0. Fractions were collected every 0.75 minutes. Table 2 shows the specific activity of these proteins and the recovered amount of hst-1 mutein. FIG. 6 shows the SDS-PAGE (12.5% polyacrylamide gel) of each fraction giving a peak.

d) Reversed-phase C4HPLC About half the amount of the eluted fraction # 56 (300 μs of protein) from the heparin HPLC column was applied to a reversed-phase C4 column (VYDAC), and the mixture was subjected to 0.1 µl.
The elution pattern was examined by applying a linear concentration gradient from 0% to 90% acetonitrile in the presence of 1% TFA. The measurement was performed at a flow rate of 1 ml / min. And a gradient time of 60 minutes (FIG. 7). FIG. 8 shows the SDS-PAGE (12.5% polyacrylamide gel) of the peak fraction detected at 36 to 37 minutes, together with the fraction 56 eluted from the heparin column.

In FIG. 8, 1 is a molecular weight marker (50 ng).
2 is the fraction 56 (50 ng) eluted from the heparin HPLC column, 3 is the fraction 56 (100 ng) eluted from the heparin HPLC column, 4 is the reverse phase HPLC eluted fraction (50 ng), and 5 is the reverse 12.5% of phase HPLC elution fraction (100ng)
The patterns of polyacrylamide gel electrophoresis are shown. The specific activity of these proteins is
(RhbFGF) (European Patent Publication No. 237,966)
When it was 1.00, it was measured as 0.43. The change in specific activity during these purification steps and the amount of recovered hst-1 mutein N27
It is shown in the table. In Table 3, the activity of FGF derived from bovine pituitary gland (manufactured by Takara Shuzo) was defined as 1 for specific activity.

Thus, it has the amino acid sequence shown in FIG.
hst-1 mutein N27 was obtained.

e) Biological activity The activity of hst-1 mutein was determined by the method of Sasada et al.
Mouse B, according to Mol. Cell Biol. 8 : 588-594 (1988)).
The induction of DNA synthesis in ALB / c3T3 cells was measured using [ ³ H] thymidine incorporation as an index. The results are shown in Table 2 above.

Example 2 (Promotion of vascular endothelial cell proliferation) The effect of hst-1 mutein N27 obtained in Example 1 on cell proliferation was measured as follows. The cells used in this assay are venous vascular endothelial cells (HUVE cells) isolated from human umbilical cord. The MTT assay described below was used to measure the degree of cell proliferation. The method of the MTT assay was based on the method of Tada et al. [Journal of Immunological Methods (J. Immunol.
thods), 93 , 157 (1986)]. That is, the HUVE cells maintained for the passage are dissociated into single cells using a 0.125% trypsin enzyme solution (manufactured by Boehringer Mannheim) containing 0.002% EDTA (345-01882, manufactured by Dojin Chemical Co., Ltd.) and obtained. The cells thus obtained were suspended in a HUVE cell medium containing 2.5% of fetal calf serum (manufactured by Whittaker Bioproducts) and composed of a GIT medium (manufactured by Nippon Pharmaceutical, 398-00515). The number of cells contained in this cell suspension was calculated using a Coulter cell counting machine (Coulter, ZM type) and subjected to the following culture. 100 μl containing 2 × 10 ³ HUVE cells
Add the HUVE cell suspension to a 96-well culture dish (Nunc, F96),
Cultured at 37 ° C (Hitachi CO-nitrogen gas control incubator CH
-16 _{type, CO 2: 5%, O} 2: 7%). On the next day of culture, each sample was prepared using HUVE cell medium,
Each was added to HUVE cells cultured in a 96-well culture dish.
As the sample used for the assay, hst-1 mutein N27 prepared from a final concentration of 0.004 ng / ml to 2.0 ng / ml was used. Heparin (manufactured by Sigma) is further added to the above hst-1 mutein N27 to a final concentration of 5.0 μs / ml. After each sample was added, cultivation was further performed for 3 days, and the medium was removed from the culture dish.
Includes g / ml MTT reagent (34101823, Dojin Chemical Co., Ltd.)
HUVE medium (100 μl) was added, and the mixture was kept at 37 ° C. for 4 hours. Then, 10% SDS aqueous solution (manufactured by Wako Pure Chemical Industries, 191-07145) was added to 10%.
0 μ was added and the incubation was continued for 4 hours. After completion of the reaction, the 96-well culture dish containing the reaction solution was shaken, and the absorption of the reaction solution at a wavelength of 590 nm was measured using a microtiter plate absorbance meter (MCC341, manufactured by Titertec). The results obtained are shown in FIG.

In FIG. 9, the horizontal axis represents the concentration of hst-1 mutein N27 added to the culture solution of vascular endothelial cells. The vertical axis represents the absorbance at a wavelength of 590 nm of the solution measured after the completion of the culture and after adding the MTT reagent to cause a reaction and solubilizing the reaction product with the SDS solution, and the amount corresponds to the cell amount. The case where hst-1 mutein N27 alone was added is shown by a solid line of ■, and the case where heparin was added to each concentration of hst-1 mutein N27 is shown by a broken line of ●. As described above, hst-1 mutein N27 alone did not show the activity of promoting cell growth on HUVE cells within the range of the concentration examined, and when coexisted with 5.0 μg / ml heparin, Promoted growth.

Example 3 (CAM assay) CAM was used for the hst-1 mutein N27 obtained in Example 1.
(Chorio Allantoic Membrane) assays were performed. C
The AM assay was performed according to Auerbach's method [Developmental Biology (Developmental Biology)].
ology, 41 , 391 (1974)]. That is, after the chicken fertilized eggs were incubated in an incubator at 37 ° C. for 3 days, the eggshell was removed, and the eggs were incubated at 37 ° C. for another week (Napco CO 2 incubator 63).
00 used, CO ₂ : 0%, H ₂ O saturation). Hst-1 mutein N27 solutions of various concentrations (hst-1 mutein N27 were added to 20 mM Tris-HCl (pH 7.4), 1.0 mM) on a polypropylene disk having a diameter of 6 mm.
M NaCl dissolved in a buffer consisting of
g and 50 ng, and air-dried in a clean bench. After standing still on chicken chorioallantoic membrane (CAM), the mixture was further incubated at 37 ° C. for 3 days to observe the state of angiogenesis. Further, an aqueous solution of heparin (manufactured by Sigma) was spotted on the hst-1 mutein N27 solution to a concentration of 10 μg, and as a control, bovine serum albumin (manufactured by Sigma) without hst-1 mutein N27 was used. The solution containing the amount was spotted, similarly air-dried, and left still on the chorioallantoic membrane. Table 4 shows the obtained results. hst-
Angiogenesis was observed alone with 200 ng of 1 mutein N27.
When heparin is used in combination, hst-1 mutein N27 20
Angiogenesis was observed not only at 0 ng but also at 50 ng. However, little angiogenesis was observed with the buffer alone and heparin alone.

Example 4 (Amino Acid Composition) The purified protein of hst-1 mutein N27 (14 μg) obtained in Example 1-d) was placed in a glass hydrolysis test tube,
After adding 200 times (v / w) constant boiling hydrochloric acid containing 4% thioglycolic acid, the tube was sealed under reduced pressure, and then hydrolyzed at 110 ° C. for 24 hours. After hydrolysis, the tube was opened, the hydrochloric acid was removed under reduced pressure, the residue was dissolved in 0.02N hydrochloric acid, and amino acid analysis was performed using a Model 835 high-speed amino acid analyzer manufactured by Hitachi, Ltd. Cystine and cysteine were not measured. The number of residues of each amino acid was calculated, and the results are shown in Table 5.

The number of amino acid residues shown in Table 5 agreed very well with the amino acid composition of hst-1 mutein N27 estimated from the nucleotide sequence of cDNA.

Example 5 (Amino Acid Sequence at Amino Terminal and Amino Acid Residue at Carboxyl Terminal) 28 μg of the purified protein of hst-1 mutein N27 obtained in Example 1-d) was subjected to a gas phase protein sequencer (Applied Biosystems Inc., model Amino acid sequence analysis of the N-terminal part was performed using 470A). Produced phenylthiohydantoin-amino acid (PTH-amino acid)
Was identified and quantified with a Varian high performance liquid chromatograph using a Micropak sp-C-18-3 column. The results are shown in Table 6. From these results, the amino acid sequence of the amino terminus of hst-1 mutein N27 agreed with the sequence expected from the DNA base sequence of the expression plasmid. It was found that methionine derived from the translation initiation codon had been removed.

In addition, as a result of examining the amino acid residues at the carboxyl terminal by hydrazinolysis, leucine predicted from the cDNA sequence was detected.

Example 6 (DNA synthesis-inducing activity of purified hst-1 mutein N27) Purified hst-1 mutein N obtained in Example 1-c) above
DNA synthesis-inducing activity on 27 columns BALB / c3T3 cells,
Examination was carried out by the method described in Example 1-e), and the
Shown in the figure.

In FIG. 10,-□-indicates the results of FGF derived from bovine pituitary gland,-○-indicates the results of hst-1 mutein N27, and-△-indicates the results of hst-1 mutein N in the presence of heparin (50 μg / ml).
27 results are shown respectively. From FIG. 10, it was found that hst-1 mutein N27 has the same activity as bovine pituitary-derived FGF (Takara Shuzo) and does not show heparin dependence.

Example 7 (Cell growth promoting activity of purified hst-1 mutein N27) BA in DMEM medium (manufactured by Flow) supplemented with 5% FCS (manufactured by MBA)
The LB / c3T3 cells were spread on a limb dish (manufactured by Flow), and the next day, the solution was exchanged with a DMEM medium supplemented with 0.5% FCS, and at the same time, the sample was added.
Shown in the figure.

In FIG. 11,-●-indicates the result of hst-1 mutein N27, Shows the results of hst-1 mutein N27 in the presence of heparin (50 μg / ml). From FIG. 11, it was found that hst-1 mutein N27 has a cell growth promoting activity, and that this activity is enhanced by the addition of heparin.

Example 8 (Stability under acidic conditions) hst-1 mutein N27 (1 μm) obtained in Example 1-c)
g / ml) and rhbFGF were placed at pH 4.0 and 37 ° C., respectively, and the residual activity was measured with time according to the method of Example 1-e). The results are shown in FIG.

In FIG. 12,-○-indicates the result of hst-1 mutein N27, Shows the results of bFGF, respectively. In FIG. 12, the activity at the start of incubation is represented as 100%.
These results indicate that hst-1 mutein N27 is more stable than bFGF under acidic conditions.

Example 9 (Transforming activity of hst-1 mutein N27) 10 ng / ml of hst-1 mutein N27 was added to mouse BALB / c3T3 A1
When the cells were added to the cells and cultured, remarkable morphological changes like transformed cells were observed. Heparin (25μ)
g / ml), hst-1 mutein N27 1 ng / ml
Similar morphological changes were observed in ml.

Further, it was revealed that hst-1 mutein N27 has a colony forming activity on a soft agar medium. That is, BA was placed on 0.5 ml of 10% FCS-DMEM medium containing 0.5% agar (Bacto Agar, Difco) using a phosphorus broth.
0.3% agar medium was suspended 10 ³ LB / c3T3 A31 cells were overlaid. At this time, hst-1 mutein N27 100-1000ng / ml
Was added to an agar medium and cultured in a CO ₂ incubator. After about 2 weeks, colony formation was observed at a frequency of 0.5 to 1 × 10 ⁻² .

Example 10 (Effect on binding between bFGF and receptor) The hst-1 mutein N27 of the present invention has high homology with bFGF. bFGF has its receptor in several cell lines,
Its cell proliferation activity is expressed. It was determined that bFGF binds to its receptor on cells by the hst-1 mutein N27 of the present invention.
Was examined to see if it inhibited. For the binding experiment between bFGF and the receptor, the method of another binding experiment of cell growth factor (TGF-B) by Wakefield was used [Methods in Enzymol.
ogy), 146 , 167 (1987)]. Rat C6 glioma cells (purchased from Dainippon Pharmaceutical) were used as target cells.
The radiolabeled bFGF used was iodine-labeled bovine bFGF from Amersham. As a control, a recombinant human bFGF (rhbFGF) obtained by the method described in European Patent Publication No. 237,966 was used. C6 glioma cells are cultured in a 24-well culture plate, and the culture medium is removed, and a buffer (Eagle MEM medium, 25 mM HEPES (pH 7.5), 0.15% gelatin,
5.0 μg / ml dextran sulfate) was added. 1.7 KBq of iodine-labeled bFGF and various concentrations of hst-1 mutein N27 or rhbFGF as a control were added, and the reaction was performed at 4 ° C. for 3 hours at a reaction volume of 300 μm. After the completion of the reaction, the reaction solution was removed, and washed with Hank's balanced salt solution.
The cell membrane was solubilized with the n-X100 solution, and the radioactivity contained therein was measured with a gamma dosimeter manufactured by Aloka. The radioactivity when a large excess of rhbFGF 4.0 μg / ml was coexisted in the reaction solution was separately obtained, and the value was taken as the non-specific binding amount, and the specific binding amount was calculated by subtracting it from the previously obtained radioactivity amount. did. This specific binding amount was divided by the radiospecific activity of the radiolabel to calculate the concentration of rhbFGF, and the number of cells used in the reaction was separately quantified using a cell counter (Coulter, Coulter Counter ZM type). Thus, the binding amount of rhbFGF per cell was determined. The results obtained are shown in FIG. In FIG. 13, the horizontal axis represents hst-1 mutein N27 added to the reaction solution of the binding experiment, and rh added as a control.
Shows the concentration of bFGF. The vertical axis was calculated from the amount of radiolabeled rhbFGF measured after the reaction. Cells used for reaction 10
^The amount of rhbFGF binding per ⁶ mice (femtomole (fmol)) is shown. The amount corresponds to the amount of rhbFGF binding to the rhbFGF receptor. The case where hst-1 mutein N27 was added is indicated by a solid line of ●, and the case where rhbFGF was added is indicated by a broken line of Δ.

As is clear from FIG. 13, the hst-1 mutein N of the present invention
No. 27 showed no effect of inhibiting the binding of rhbFGF to the receptor in the concentration range studied.

Effect of the Invention Since the hst-1 mutein of the present invention has a high healing promoting action on damage to living tissues, it can be advantageously used as a therapeutic agent such as a healing promoting agent for burns and wounds.
It can also be used as a therapeutic agent for gastrointestinal ulcer disease.

[Brief description of the drawings]

FIG. 1 shows the amino acid sequence of the mature protein of hst-1. FIG. 2 shows the amino acid sequence predicted from the coding region of hst-1 including the leader sequence constituting the open reading frame of hst-1 cDNA. FIG. 3 shows the amino acid sequence of hst-1 mutein N27 obtained in Example 1. FIG. 4 shows a construction diagram of plasmid pTB1051 obtained in Example 1. FIG. 5 shows the elution pattern obtained in Example 1. FIG. 6 shows the SDS-PAGE electrophoresis pattern obtained in Example 1. FIG. 7 shows the elution pattern obtained in Example 1. FIG. 8 shows the SDS-PAGE electrophoresis pattern obtained in Example 1. FIG. 9 shows the results of measurement of the promoting effect of hst-1 mutein N27 on cell proliferation of human vascular endothelial cells obtained in Example 2. FIG. 10 shows the results of the DNA synthesis-inducing activity on mouse BALB / c3T3 cells obtained in Example 6. FIG. 11 shows the results of the cell growth promoting activity obtained in Example 7. FIG. 12 shows the residual activity under acidic conditions obtained in Example 10. FIG. 13 shows the results of measurement of the effect of hst-1 mutein N27 on the binding experiment of radiolabeled rhbFGF obtained in Example 10.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI C12N 1/21 C12P 21/02 H 15/09 ZNA C12N 15/00 ZNAA C12P 21/02 A61K 37/02 // (C12N 1 / 21 C12R 1:19) (C12P 21/02 C12R 1:19) (72) Inventor Teruhiko Yoshida 7-7-603 Mitsugaoka, Nerima-ku, Tokyo (72) Inventor Koichi Igarashi Sakyo-ku, Kyoto-shi, Kyoto 66 (72) Inventor Yoshio Kosai 1-9-5 Seifuso, Toyonaka-shi, Osaka (56) Reference Proc. Natl. Acad. Sc i. USA, Vol. 84, (1987), p. 2980-2984 Molecular and Cellular Biology, Vol. 7, (1988), p. 2933− 2941 (58) Fields investigated (Int.Cl. ⁷ , DB name) C07K 14/00-14/825 C12N 15/00-15/90 C12N 1/00-1/38 C12P 21/00-21 / 08 A61K 38/00 A61P 1/00-43/00 BIOSIS (DIALOG) GenBank / EMBL / DDBJ (GENETYX) MEDLINE (STN) WPI (DIALOG)

Claims (9)

(57) [Claims] 1. A mutein in which 1 to 47 consecutive constituent amino acids have been deleted from the N-terminus of the mature heparin binding secretory transforming factor (hst-1). 2. The mutein according to claim 1, wherein 1 to 27 consecutive constituent amino acids are deleted from the N-terminal of hst-1. 3. The mutein according to claim 1, wherein 27 consecutive constituent amino acids are deleted from the N-terminal of hst-1. 4. A recombinant DNA having a nucleotide sequence encoding the mutein according to claim 1. A vector comprising the recombinant DNA according to claim 4. [6] A transformant transformed with the vector according to [5]. 7. The method for producing mutein according to claim 1, wherein the transformant according to claim 6 is cultured in a medium. 8. A cell growth promoting agent comprising the mutein according to claim 1. 9. An angiogenesis promoter comprising the mutein according to claim 1.