RU2601902C1 - Method for prediction of effectiveness of prevention by albendazole of postoperative recurrent of cistic echinococcosis - Google Patents
Method for prediction of effectiveness of prevention by albendazole of postoperative recurrent of cistic echinococcosis Download PDFInfo
- Publication number
- RU2601902C1 RU2601902C1 RU2015142288/15A RU2015142288A RU2601902C1 RU 2601902 C1 RU2601902 C1 RU 2601902C1 RU 2015142288/15 A RU2015142288/15 A RU 2015142288/15A RU 2015142288 A RU2015142288 A RU 2015142288A RU 2601902 C1 RU2601902 C1 RU 2601902C1
- Authority
- RU
- Russia
- Prior art keywords
- albendazole
- echinococcosis
- effectiveness
- cistic
- prevention
- Prior art date
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Abstract
Description
Предлагаемое изобретение относится к медицине, а именно к хирургии, и может быть использовано для прогнозирования риска развития рецидивных эхинококковых кист при профилактическом лечении альбендазолом.The present invention relates to medicine, namely to surgery, and can be used to predict the risk of recurrent echinococcal cysts during prophylactic treatment with albendazole.
Известно, что после операции по поводу цистного эхинококкоза, проведенной даже с применением высокотехнологичной современной хирургической помощи, могут развиться рецидивные кисты. С 1996 года по настоящее время широко применяют препарат «альбендазол» для противорецидивного лечения с эффективностью 40-70% [Назыров Ф.Г., Девятов А.В., Акбаров М.М., Махмудов У.М., Бабаджанов А.Х. Химиотерапия и проблемы рецидивного эхинококкоза печени. Анналы хирургической гепатологии. 2011. - Т. 16. - №4 - С. 19-24; Руководство по хирургии очаговых паразитарных заболеваний печени / Н.В. Мерзликин, Альперович Б.И., Бражникова Н.А. и др.; под ред. Н.В. Мерзликина. - Томск: Изд-во «Печатная мануфактура», 2013. - 468 с]. Абсолютной (100%) результативности химиотерапии цистного эхинококкоза альбендазолом добиться до сих пор не удается.It is known that after surgery for cystic echinococcosis, carried out even with the use of high-tech modern surgical care, recurrent cysts may develop. From 1996 to the present, the drug "albendazole" is widely used for anti-relapse treatment with an effectiveness of 40-70% [Nazyrov F.G., Devyatov A.V., Akbarov M.M., Makhmudov U.M., Babadzhanov A.Kh . Chemotherapy and problems of recurrent echinococcosis of the liver. Annals of surgical hepatology. 2011. - T. 16. - No. 4 - S. 19-24; Guidelines for the surgery of focal parasitic liver diseases / N.V. Merzlikin, Alperovich B.I., Brazhnikova N.A. and etc.; under the editorship of N.V. Merzlikin. - Tomsk: Publishing house "Printing Manufactory", 2013. - 468 s]. The absolute (100%) effectiveness of chemotherapy for cystic echinococcosis with albendazole is still not possible.
Большинство лекарственных средств, попадая в организм человека, не оказывают прямого биологического эффекта, а вначале подвергаются биотрансформации. В первой фазе биотрансформации участвуют ферменты суперсемейства цитохромов Р450, локализованных в основном на мембранах клеток печени и легких. Гены, кодирующие синтез цитохромов Р450, отличаются значительным полиморфизмом [Генетический паспорт - основа индивидуальной и предиктивной медицины / под ред. B.C. Баранова. - СПб. : Изд-во Н-Л, 2009. - 528 с].Most drugs, getting into the human body, do not have a direct biological effect, but in the beginning they undergo biotransformation. In the first phase of biotransformation, enzymes of the P450 cytochrome superfamily are involved, localized mainly on the membranes of liver and lung cells. Genes encoding the synthesis of P450 cytochromes are characterized by significant polymorphism [Genetic passport - the basis of individual and predictive medicine / ed. B.C. Baranova. - SPb. : Publishing house NL, 2009. - 528 s].
Почти все аллели генов цитохромов, в зависимости от влияния на метаболизм лекарств, подразделяются на группы: быстрых, промежуточных и медленных метаболайзеров. У медленных метаболайзеров, в отличие от быстрых и промежуточных, часто наблюдается существенно более длительный период полувыведения. Появление «быстрого» аллеля, приводящего к повышению активности фермента, вызывает усиление биотрансформации, быстрое выведение и поэтому слабый терапевтический эффект. В настоящее время известно, что в организме человека альбендазол метаболизируется в альбендазол-сульфоксид, обладающий противогельминтным действием, а затем в альбендазол-сульфон, не имеющий биологической активности. Превращение в альбендазол-сульфон осуществляет изоформа цитохрома Р450 CYP1A2 [Клиническая фармакология по Гудману и Гилману / под ред. А.Г. Гилмана // Изд. «Практика», 2006]. Ген, контролирующий синтез CYP1A2, имеет несколько полиморфизмов, один из наиболее функционально значимых - *1F(163A/C). Генотип CYP1A2F1*A/A этого гена, соответствующий «быстрому» метаболизму, а значит и непродолжительному терапевтическому действию, встречается с частотой 33% (у представителей европейской популяции) и 61% (у представителей азиатской популяции) [Анализ ассоциации полиморфного варианта С-163А гена у больных раком легкого в РС(Я) В.М. Николаев, Ф.Г. Иванова, П.М. Иванова, Е.Н. Александрова и др. // Сибирский онкологический журнал. 2013. - Приложение №2. - С.52].Almost all alleles of cytochrome genes, depending on the effect on drug metabolism, are divided into groups: fast, intermediate and slow metabolizers. Slow metabolizers, unlike fast and intermediate ones, often have a significantly longer half-life. The appearance of a “fast” allele, leading to an increase in enzyme activity, causes an increase in biotransformation, rapid elimination, and therefore a weak therapeutic effect. It is now known that in the human body, albendazole is metabolized to albendazole sulfoxide, which has an anthelmintic effect, and then to albendazole sulfone, which has no biological activity. The conversion to albendazole sulfone is carried out by the cytochrome P450 isoform CYP1A2 [Clinical Pharmacology by Goodman and Gilman / Ed. A.G. Gilman // Ed. "Practice", 2006]. The gene controlling the synthesis of CYP1A2 has several polymorphisms, one of the most functionally significant - * 1F (163A / C). The genotype CYP1A2F1 * A / A of this gene, corresponding to a “quick” metabolism, and therefore a short therapeutic effect, occurs with a frequency of 33% (in representatives of the European population) and 61% (in representatives of the Asian population) [Analysis of the association of the polymorphic variant C-163A gene in patients with lung cancer in MS (Y) V.M. Nikolaev, F.G. Ivanova, P.M. Ivanova, E.N. Alexandrova et al. // Siberian Oncology Journal. 2013. - Appendix No. 2. - S. 52].
Таким образом, генетическое тестирование полиморфизма *1F(163A/C) гена CYP1A2 у больных цистным эхинококкозом позволит прогнозировать слабый лечебный эффект альбендазола у носителей «быстрого» аллеля, а значит большую вероятность развития послеоперационной рецидивной кисты.Thus, genetic testing of the * 1F (163A / C) polymorphism of the CYP1A2 gene in patients with cystic echinococcosis will make it possible to predict a weak therapeutic effect of albendazole in carriers of the “fast” allele, which means a greater likelihood of developing a postoperative recurrent cyst.
Авторами в научно-медицинской и патентной литературе не обнаружено сведений об известности способа прогнозирования эффективности химиотерапии альбендазолом для профилактики рецидива у больных цистным эхинококкозом.The authors in the medical and patent literature did not find information about the popularity of the method for predicting the effectiveness of chemotherapy with albendazole for the prevention of relapse in patients with cystic echinococcosis.
Техническим результатом изобретения является получение критериев для прогнозирования повышенного риска рецидива у больных цистным эхинококкозом на основе выявления молекулярно-генетических маркеров.The technical result of the invention is to obtain criteria for predicting an increased risk of relapse in patients with cystic echinococcosis based on the identification of molecular genetic markers.
Указанный технический результат достигается способом прогнозирования эффективности профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза, характеризующимся тем, что из лимфоцитов периферической венозной крови выделяют ДНК, проводят генотипирование полиморфизма *1F(163A/C) гена CYP1A2, кодирующего изоформу цитохрома Р450, методом анализа полиморфизма длин рестрикционных фрагментов продуктов полимеразной цепной реакции синтеза ДНК, и при обнаружении генотипа CYP1A2F1*C/C прогнозируют высокую эффективность профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза у обследуемого, а при обнаружении генотипа CYP1A2F1 *А/А - низкую эффективность профилактики.The indicated technical result is achieved by a method for predicting the effectiveness of albendazole prophylaxis of postoperative recurrence of cystic echinococcosis, characterized in that DNA is isolated from peripheral venous blood lymphocytes, genotyping of the * 1F (163A / C) polymorphism CYP1A2 gene encoding the cytochrome P450 isoform is performed by restriction length fragmentation polymorphism analysis the products of the polymerase chain reaction of DNA synthesis, and upon detection of the CYP1A2F1 * C / C genotype, high prophylaxis of a lbendazole postoperative recurrence of cystic echinococcosis in the subject, and when the genotype CYP1A2F1 * A / A is detected - low prevention effectiveness.
Способ доступен по реактивам и оборудованию и осуществляется следующим образом.The method is available for reagents and equipment and is as follows.
Материалом для исследования служат образцы ДНК, выделенные из лимфоцитов периферической венозной крови у больных эхинококкозом методом фенольно-хлороформной экстракции, описанным Mathew С.С. (The isolation of high molecular weight eucariotic DNA // Methods in Molecular Biology / Ed. J.M. Walker.- New York., London. - 1984,- Vol. 2. - P. 31-34).The material for the study is DNA samples isolated from peripheral venous blood lymphocytes in patients with echinococcosis by the phenol-chloroform extraction method described by Mathew S.S. (The isolation of high molecular weight eucariotic DNA // Methods in Molecular Biology / Ed. J. M. Walker. - New York., London. - 1984, - Vol. 2. - P. 31-34).
1. Кровь в пробирке с консервантом тщательно перемешивают и переливают в центрифужный стакан на 100 мл, туда же добавляют 50 мл охлажденного лизирующего буфера, содержащего 320 мМ сахарозы, 1% раствор тритона Х-100, 5 мМ MgCl2, 10 мМ трисНСl (рН 7,6).1. Blood in a test tube with preservative is thoroughly mixed and poured into a 100 ml centrifuge beaker, 50 ml of chilled lysis buffer containing 320 mM sucrose, 1% Triton X-100 solution, 5 mM MgCl2, 10 mM TrisHCl (pH 7) are added there. , 6).
2. Смесь центрифугируют 20 мин при 4 000 об./мин.2. The mixture is centrifuged for 20 minutes at 4,000 rpm.
3. Надосадочную жидкость сливают, к получившемуся осадку приливают 8 мл 25 мМ ЭДТА, рН 8.0 и суспензируют.3. The supernatant is drained, 8 ml of 25 mM EDTA is added to the resulting precipitate, pH 8.0 and suspended.
4. К суспензии добавляют 0,8 мл 10% SDS и протеиназу К (концентрация - 10 мг/ мл). Смесь для лизиса оставляют на ночь в термостате при температуре 38°С.4. To the suspension add 0.8 ml of 10% SDS and proteinase K (concentration - 10 mg / ml). The lysis mixture is left overnight in an incubator at a temperature of 38 ° C.
Экстракцию ДНК осуществляют в следующем порядке.DNA extraction is carried out in the following order.
1. Для депротеинизации к лизату добавляют 0.5 мл 5 М перхлората натрия и 8 мл фенола, насыщенного 1 М трисНСl до рН 7,8.1. For deproteinization, 0.5 ml of 5 M sodium perchlorate and 8 ml of phenol saturated with 1 M TrisHCl to pH 7.8 are added to the lysate.
2. Смесь центрифугируют при 3000 об./мин в течение 10 мин.2. The mixture is centrifuged at 3000 rpm for 10 minutes.
3. Отбирают водную фазу, содержащую ДНК, РНК и неденатурированные белки.3. Select the aqueous phase containing DNA, RNA and undenatured proteins.
4. Отобранную фазу обрабатывают смесью фенол-хлороформа (1:1), а затем - хлороформом.4. The selected phase is treated with a mixture of phenol-chloroform (1: 1), and then with chloroform.
5. Препараты осаждают двумя объемами 96% этанола.5. The preparations are precipitated with two volumes of 96% ethanol.
6. Образовавшийся осадок ДНК растворяют в 1,5 мл деионизированной H2O; раствор хранят при t -20°C.6. The resulting DNA precipitate is dissolved in 1.5 ml of deionized H 2 O; the solution is stored at t -20 ° C.
В дальнейшем полученную ДНК используют для исследования генного полиморфизма CYP1A2*1F(163A/C) методом ПЦР-ПДРФ анализа (полиморфизма длин рестрикционных фрагментов продуктов полимеразной цепной реакции синтеза ДНК) в стандартных условиях по ранее описанной методике [Sachsa С, Bhambra U., Smith G., Lightfoot T.J. et al. Polymorphisms in the cytochrome P450 CYP1A2 gene in colorectal cancer patients and controls: allele frequencies, linkage diequilibrium and influence on caffeine metabolism/ Br. J. Clin. Pharmacol. 2003. V.55(l). P68-76.]. Для амплификации нужного фрагмента применяют локусспецифические олигонуклеотидные праймеры: F5′ TGAGGCTCCTTTCCAGCTCTCA3′ и R5′AGAAGCTTGTGGCCGAGAAGG3′ с температурой отжига 57°С.Subsequently, the obtained DNA is used to study the gene polymorphism CYP1A2 * 1F (163A / C) by PCR-RFLP analysis (length polymorphism of restriction fragments of products of the polymerase chain reaction of DNA synthesis) under standard conditions according to the previously described method [Sachsa C, Bhambra U., Smith G., Lightfoot TJ et al. Polymorphisms in the cytochrome P450 CYP1A2 gene in colorectal cancer patients and controls: allele frequencies, linkage diequilibrium and influence on caffeine metabolism / Br. J. Clin. Pharmacol 2003. V. 55 (l). P68-76.]. For amplification of the desired fragment, locus-specific oligonucleotide primers are used: F5 ′ TGAGGCTCCTTTCCAGCTCTCA3 ′ and R5′AGAAGCTTGTGGCCGAGAAGG3 ′ with an annealing temperature of 57 ° C.
После амплификации ПЦР-продукты подвергают гидролизу эндонуклеазой рестрикции ApaI в стандартных условиях. Для этого 5 мкл амплификата смешивают с 5 ед фермента в соответствующем буфере, смесь инкубируют при температуре согласно инструкциям производителей («Сибэнзим», Новосибирск) на протяжении 12 часов. Фрагменты ДНК разделяют электрофоретически в 7-8% ПААГ, окрашивают раствором бромида этидия и анализируют в проходящем ультрафиолетовом свете на трансиллюминаторе.After amplification, the PCR products are digested with ApaI restriction endonuclease under standard conditions. To do this, 5 μl of the amplificate is mixed with 5 units of the enzyme in the appropriate buffer, the mixture is incubated at a temperature according to the instructions of the manufacturers (Sibenzyme, Novosibirsk) for 12 hours. DNA fragments are separated electrophoretically in 7-8% PAG, stained with ethidium bromide solution and analyzed in transmitted ultraviolet light on a transilluminator.
При обнаружении фрагментов ДНК размером 265 пн диагностируют генотип CYP1A2F1*A/A «быстрого» метаболайзера альбендазол-сульфоксида; при выявлении фрагментов длиной 265, 211 и 54 пн - генотип CYP1A2F1*A/C «промежуточного»; и при обнаружении фрагментов ДНК размерами 211 и 54 пн - генотип CYP1A2F1*C/C «медленного» метаболайзера.Upon detection of 265 bp DNA fragments, the CYP1A2F1 * A / A genotype of the “fast” albendazole sulfoxide metabolizer is diagnosed; upon detection of fragments 265, 211 and 54 bp long, the CYP1A2F1 * A / C genotype is “intermediate”; and upon detection of DNA fragments of sizes 211 and 54 bp - the CYP1A2F1 * C / C genotype of the “slow” metabolizer.
Изобретение иллюстрируется следующими клиническими примерами.The invention is illustrated by the following clinical examples.
Пример 1. Пациент А., обратился в клинику с жалобами на боли в области правого подреберья. При УЗИ органов брюшной полости в правой доле печени (сегмента VIII) выявлено объемное образование размерами 71x62 мм неоднородной структуры, смешанной эхогенности, с четкими контурами. При осмотре и физикальном исследовании по системам органов других патологических изменений не выявлено. Больной оперирован, выполнена эхинококкэктомия. Проведено исследование по предложенной методике. Установлено: является носителем генотипа CYP1A2F1*A/A «быстрого» метаболайзера. В отношении эффективности профилактики альбендазолом развития рецидивных эхинококковых кист у обследуемого прогноз неблагоприятный.Example 1. Patient A., went to the clinic with complaints of pain in the right hypochondrium. Ultrasound of the abdominal organs in the right lobe of the liver (segment VIII) revealed a volumetric formation with dimensions 71x62 mm of a heterogeneous structure, mixed echogenicity, with clear contours. Upon examination and physical examination of the organ systems, other pathological changes were not detected. The patient was operated on, echinococcectomy was performed. A study on the proposed methodology. Found: is a carrier of the genotype CYP1A2F1 * A / A "fast" metabolizer. In relation to the effectiveness of prophylaxis with albendazole for the development of recurrent echinococcal cysts, the prognosis is poor.
Через 2 года пациент обратился с теми же жалобами. При УЗИ в правой доле печени (сегмента VIII) выявлено объемное образование размерами 30×25 мм.After 2 years, the patient filed the same complaints. Ultrasound in the right lobe of the liver (segment VIII) revealed a volume formation of 30 × 25 mm in size.
Пример 2. Пациент С., обратился в клинику с жалобами на боли в области правого подреберья. При УЗИ органов брюшной полости в правой доле печени (сегмента VIII) выявлено объемное образование размерами 75×55 мм неоднородной структуры, смешанной эхогенности, с четкими контурами. При осмотре и физикальном исследовании по системам органов других патологических изменений не выявлено. Больной оперирован, выполнена эхинококкэктомия. Проведено исследование по предложенной методике. Установлено: является носителем генотипа CYP1A2F1*C/C «медленного» метаболайзера. В отношении эффективности профилактики альбендазолом рецидивных эхинококковых кист прогноз благоприятный. Через 3 года у пациента при диспансерном наблюдении кист не обнаружено.Example 2. Patient S., went to the clinic with complaints of pain in the right hypochondrium. Ultrasound of the abdominal organs in the right lobe of the liver (segment VIII) revealed a volume formation of 75 × 55 mm of heterogeneous structure, mixed echogenicity, with clear contours. Upon examination and physical examination of the organ systems, other pathological changes were not detected. The patient was operated on, echinococcectomy was performed. A study on the proposed methodology. Found: is a carrier of the CYP1A2F1 * C / C genotype of the "slow" metabolizer. With regard to the effectiveness of prophylaxis with albendazole for recurrent echinococcal cysts, the prognosis is favorable. After 3 years, the patient did not find cysts during follow-up.
Claims (1)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2015142288/15A RU2601902C1 (en) | 2015-10-05 | 2015-10-05 | Method for prediction of effectiveness of prevention by albendazole of postoperative recurrent of cistic echinococcosis |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2015142288/15A RU2601902C1 (en) | 2015-10-05 | 2015-10-05 | Method for prediction of effectiveness of prevention by albendazole of postoperative recurrent of cistic echinococcosis |
Publications (1)
Publication Number | Publication Date |
---|---|
RU2601902C1 true RU2601902C1 (en) | 2016-11-10 |
Family
ID=57277941
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
RU2015142288/15A RU2601902C1 (en) | 2015-10-05 | 2015-10-05 | Method for prediction of effectiveness of prevention by albendazole of postoperative recurrent of cistic echinococcosis |
Country Status (1)
Country | Link |
---|---|
RU (1) | RU2601902C1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2810944C1 (en) * | 2023-03-17 | 2024-01-09 | Государственное бюджетное учреждение здравоохранения города Москвы городская клиническая больница имени С.П. Боткина департамента здравоохранения города Москвы (ГБУЗ ГКБ им. С.П. Боткина ДЗМ) | Method of personalized selection of antiparasitic therapy in patients with liver echinococcosis |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2279274C2 (en) * | 2004-10-11 | 2006-07-10 | Всероссийский научно-исследовательский институт гельминтологии имени К.И. Скрябина (ВИГИС) | Method for preventing secondary alveolar echinococcosis (hydatidosis) |
RU2324940C1 (en) * | 2007-02-28 | 2008-05-20 | Государственное образовательное учреждение высшего профессионального образования "БАШКИРСКИЙ ГОСУДАРСТВЕННЫЙ МЕДИЦИНСКИЙ УНИВЕРСИТЕТ Федерального Агентства по здравоохранению и социальному развитию" (ГОУ ВПО БГМУ РОСЗДРАВА) | Method of prediction of cystic echinococcosis course in children |
-
2015
- 2015-10-05 RU RU2015142288/15A patent/RU2601902C1/en not_active IP Right Cessation
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2279274C2 (en) * | 2004-10-11 | 2006-07-10 | Всероссийский научно-исследовательский институт гельминтологии имени К.И. Скрябина (ВИГИС) | Method for preventing secondary alveolar echinococcosis (hydatidosis) |
RU2324940C1 (en) * | 2007-02-28 | 2008-05-20 | Государственное образовательное учреждение высшего профессионального образования "БАШКИРСКИЙ ГОСУДАРСТВЕННЫЙ МЕДИЦИНСКИЙ УНИВЕРСИТЕТ Федерального Агентства по здравоохранению и социальному развитию" (ГОУ ВПО БГМУ РОСЗДРАВА) | Method of prediction of cystic echinococcosis course in children |
Non-Patent Citations (1)
Title |
---|
АХМЕДОВ И.Г. Рецидив эхинококковой болезни: патогенетические аспекты, профилактика, ранняя диагностика и лечение // Автореф. дисс., Махачкала, 2006. ХАРНАС П.С. Профилактика рецидива после хирургического лечения эхинококкоза печени // Автореф. дисс., Москва, 2006. ШЕВЧЕНКО Ю.Л. и др., Противорецидивная терапия в хирургическом лечении больных эхинококкозом печени // Анналы хирургии, 2007, N.5, C.35-38. * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2810944C1 (en) * | 2023-03-17 | 2024-01-09 | Государственное бюджетное учреждение здравоохранения города Москвы городская клиническая больница имени С.П. Боткина департамента здравоохранения города Москвы (ГБУЗ ГКБ им. С.П. Боткина ДЗМ) | Method of personalized selection of antiparasitic therapy in patients with liver echinococcosis |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Kaneko et al. | siRNA-mediated knockdown against CDCA1 and KNTC2, both frequently overexpressed in colorectal and gastric cancers, suppresses cell proliferation and induces apoptosis | |
ES2415245T3 (en) | Methods of using miRNA for the detection of cell death in vivo | |
CN109097477B (en) | circRNA marker for breast cancer diagnosis and application thereof | |
ES2663069T3 (en) | Molecular markers in prostate cancer | |
US20190276897A1 (en) | Egfr and pten gene alterations predicts survival in patients with brain tumor | |
Cesaratto et al. | BNC2 is a putative tumor suppressor gene in high-grade serous ovarian carcinoma and impacts cell survival after oxidative stress | |
Habieb et al. | Potential role of lncRNA-TSIX, miR-548-a-3p, and SOGA1 mRNA in the diagnosis of hepatocellular carcinoma | |
Kumar et al. | Oncogenic KIAA1549-BRAF fusion with activation of the MAPK/ERK pathway in pediatric oligodendrogliomas | |
CN109680064B (en) | Application of YTHDF2 gene in diagnosis, prevention and treatment of urothelial cancer | |
Argadal et al. | Long noncoding RNA MALAT1 may be a prognostic biomarker in IDH1/2 wild-type primary glioblastomas | |
WO2015062179A1 (en) | Method for detecting single nucleotide polymorphism sequence of tert promoter | |
Zazzeroni et al. | KCTD11 tumor suppressor gene expression is reduced in prostate adenocarcinoma | |
ES2964940T3 (en) | Methods for the diagnosis of Alzheimer's disease and viral vectors for use in its therapy | |
Costa et al. | Structural and molecular analysis of the cancer prostate cell line PC3: Oocyte zona pellucida glycoproteins | |
RU2393772C1 (en) | Method of predicting development of recurrent invasive urinary bladder cancer | |
RU2601902C1 (en) | Method for prediction of effectiveness of prevention by albendazole of postoperative recurrent of cistic echinococcosis | |
CN110387423B (en) | Biomarker for diagnosing vestibular nerve sheath tumor | |
Ahmed et al. | Evaluation of the diagnostic and therapeutic roles of non-coding RNA and cell proliferation related gene association in hepatocellular carcinoma | |
Schmidt et al. | Detection of cell-free nucleic acids in bronchial lavage fluid supernatants from patients with lung cancer | |
Wei et al. | Relationship between structure and function of JWA in the modulation of cell differentiation | |
RU2324940C1 (en) | Method of prediction of cystic echinococcosis course in children | |
RU2591807C1 (en) | Method for differentiation of nature of origin of recurrent cysts during cyst echinococcosis | |
US20200399710A1 (en) | Method of identifying tumor specific macromolecular isoforms | |
RU2348039C1 (en) | Method for prediction of suppuration of unicameral echinococcus cyst in noninvasive children | |
RU2578441C1 (en) | Method for prediction of moderate severity of chronic true eczema |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MM4A | The patent is invalid due to non-payment of fees |
Effective date: 20171006 |