PL215285B1 - Urate oxidase variants and their application - Google Patents

Abstract

Genetically modified proteins with uricolytic activity are described. Proteins comprising truncated urate oxidases and methods for producing them, including PEGylated proteins comprising truncated urate oxidase are described.

Description

Description of the invention

The present invention relates to an isolated, truncated mammalian uricase, a polyethylene glycol uricase conjugate comprising it, a method for its preparation, a pharmaceutical composition containing it and the use thereof, and an isolated nucleic acid encoding uricase, a vector thereof, and a host cell comprising the same.

The terms uricase and uricase are used interchangeably herein. Urate oxidases (E.C. uricases 1.7.3.3) are enzymes that catalyze the oxidation of uric acid to a more soluble product, allantoin, a purine metabolite that is more easily excreted from the body. Due to several mutations in the gene, acquired during the evolution of higher primates, humans fail to produce enzymatically active uricase. (See Wu, X, et al. (1992) J Mol Evol 34: 78-84, which is hereby incorporated by reference in its entirety). Consequently, in susceptible individuals, excessive levels of uric acid in the blood (hyperuricemia) can lead to painful arthritis (gout), distorting urate deposits (tophus) and kidney failure. For use in some affected individuals, the available drugs, such as allopurinol (an inhibitor of uric acid synthesis), appear to have significant limitations, such as treatment time limitation and side effects, and do not adequately alleviate these conditions. See, for example, Hande, KR, et al., (1984) Am J Med 76: 47-56; Fam, AG, (1990) Bailliere's Clin Rheumatol 4: 177-192, which is hereby incorporated by reference in its entirety. Uricase injections may reduce hyperuricemia and hyperuricosuria, at least transiently. Since uricase is a foreign protein to humans, even the first injection of an unmodified protein from Aspergillus flavus induces anaphylactic reactions in a few percent of the patients treated (Pui, CH, et al., (1997) Leukemia 11: 1813-1816, which is incorporated herein in its entirety. described as a reference) and immune responses limit its suitability for long-term or intermittent treatment. See, e.g., Donadio, D, et al., (1981) Nouv Presse Med 10: 711-712; Leaustic, M, et al., (1983) Rev Rhum Mal Osteoartic 50: 553-554, which is hereby incorporated by reference in its entirety.

The suboptimal nature of available treatments for hyperuricemia has been known for several decades. See, for example, Kissel, P, et al., (1968) Nature 217: 72-74, which is hereby incorporated by reference in their entirety. Likewise, it has been known to those skilled in the art for many years that certain groups of patients with severe gout may benefit from a safe and effective form of injectable uricase. See, for example, Davis, FF, et al. (1978) in GB Broun, et al. (Eds.) Enzyme Engineering, Tom. 4 (pp. 169-173) New York, Plenum Press; Nishimura, H, et al. (1979) Enzyme 24: 261-264; Nishimura, H, et al., (1981) Enzyme 26: 49-53; Davis, S, et al. (1981) Lancet 2 (8241): 281-283; Abuchowski, A, et al. (1981) J Pharmacol Exp Ther 219: 352-354; Chen, RH-L, et al., (1981) Biochim Biophys Acta 660: 293-298; Chua, CC, et al. (1988) Ann Int Med 109: 114-117; Greenberg, ML, et al. (1989) Anal Biochem 176: 290-293, which is hereby incorporated by reference in its entirety. Animal organ uricases are almost insoluble in solvents that are suitable for the safe administration of drugs by injection. See, for example, US Patent No. 3,616,231, which is hereby incorporated by reference in its entirety. Certain plant-derived uricases or microbial uricases are more soluble in medicinally acceptable solvents. However, injection of enzymes from microorganisms rapidly induces immune responses that can lead to life-threatening allergic reactions or to inactivation and / or accelerated clearance of circulating uricase. Donadio, et al., (1981); Leaustic, et al., (1983). Enzymes based on deduced amino acid sequences of uricases from mammals, including pigs and baboons, or from insects, e.g. Drosophila melanogaster or Drosophila pseudoobscura (Wallrath, LL, et al., (1990) Mol Cell Biol 10: 5114-5127, incorporated herein by reference in its entirety) are not suitable candidates for clinical use due to problems of immunogenicity and insolubility at physiological pH.

Previously, researchers have used injected uricase to catalyze the conversion of uric acid to allantoin in vivo. See, for example, Pui, et al., (1997). This is the basis for use in France and Italy for the prevention or temporary correction of hyperuricemia associated with the cytotoxic therapy of hematological neoplasms or the transient reduction of severe hyperuricemia in gout patients with Aspergillus flavus uricase (Uricozyme®). See, for example, Potaux, L, et al., (1975) Nouv Presse Med 4: 1109-1112; Legoux, R, et al. (1992) J Biol Chem

PL 215 285 B1

267: 8565-8570; US Patent Nos. 5,382,518 and 5,541,098, which are hereby incorporated by reference in their entirety. Due to its short disintegration time in circulation, Uricozyme® requires daily injections. Moreover, it is not suitable for use in long-term therapy because of its immunogenicity.

Certain uricases are useful for producing conjugates with polyethylene glycol or polyethylene oxide (both referred to as PEG) to produce therapeutically effective forms of uricase having an increased half-life and reduced immunogenicity. See, for example, U.S. Patent Nos. 4,179,337, 4,766,106, 4,847,325, and 6,576,235; US patent application publication US2003 / 0082786A1, which is hereby incorporated by reference in its entirety. Conjugates of uricase with polymers other than PEG have also been described in the art. See, for example, U.S. Patent 4,460,683, which is hereby incorporated by reference in its entirety.

In almost all attempts to PEGylate uricase (ie, covalently linking PEG to uricase), PEG is attached primarily to amino groups, including the amino acid residue and available lysine residues. In commonly used uricases, the total number of lysines in each of the four identical subunits is between 25 (Aspergillus flavus (US Patent No. 5,382,518, incorporated by reference in its entirety)) and 29 (Wu, X, et al., (1989) Proc Natl. Acad Sci USA 86: 9412-9416, incorporated herein by reference in its entirety). Some other lysines are unavailable for PEGylation in the native conformation of the enzyme. The most common approach to reducing the immunogenicity of uricase has been to attach a large number of low molecular weight PEG strands. This invariably leads to a huge reduction in the enzymatic activity of the resulting conjugates.

A single intravenous injection of a 5 kDa PEG-uricase preparation reduces serum uric acid to undetectable levels in subjects whose mean serum uric acid concentration by injection was 6.2 mg / dL, which is within the normal range. Davis, et al., (1981). These subjects were given additional injections four weeks later, but their responses were not provided. No antibodies to uricase were detected after the second (final) injection using the relatively insensitive gel diffusion test. This reference does not show the results for long-term or chronic treatment in human or experimental animals.

A preparation of Arthrobacter protoformiae uricase combined with 5 kDa PEG was used to temporarily control hyperuricemia in one lymphoma patient whose serum uric acid concentration prior to injection was 15 mg / dL. See, for example, Chua, et al. (1988). Due to the critical condition of the patient and the short duration of treatment (four injections over 14 days), the long-term efficacy and safety of the conjugate cannot be assessed.

Increased protection against immune recognition is possible by modifying each uricase subunit with 2-10 strands of high molecular weight PEG (> 5 kD - 120 kD) Saifer, et al. (US Patent No. 6,576,235; (1994) Adv Exp Med Biol 366: 377 -387, each incorporated herein by reference in its entirety This strategy allows for the retention of> 75% of uricase enzyme activity from various species after PEGylation, increased circulation duration, and allows for repeated injections of the enzyme without inducing antibodies in mice and rabbits.

Hershfield and Kelly (International Publication WO 00/08196; US Patent Application No. 60 / 095,489, which is hereby incorporated by reference in its entirety) have developed methods for delivering recombinant uricase proteins from various mammalian species with optimal numbers of PEGylation sites. They used PCR techniques to increase the number of available lysine residues at selected sites in the enzyme, which would serve to reduce recognition by the immune system following PEGylation, while maintaining the activity of the uric acid-degrading enzyme. Some of their uricase proteins are truncated at the carboxyl and / or amino terminus. They do not provide an indication of other genetically induced protein changes.

In the present application, the term "immunogenicity" refers to the induction of an immune response by an injected preparation of PEG-modified or unmodified uricase (antigen), while "antigenicity" refers to the reaction of an antigen with pre-existing - antibodies. In previous PEG-uricase studies, immunoreactivity has been tested by a variety of methods, including: 1) the in vitro reaction of PEG-uricase with preformed antibodies; 2) measurements of the induced antibody synthesis; and 3) an accelerated clearance rate after repeated injections.

PL 215 285 B1

Earlier attempts to eliminate the immunogenicity of uricase from different sources by joining different PEG strands through different linkers have had limited success. PEG-uricases were first disclosed by F.E. Davis and by Y. Inada and their colleagues. Davis, et al., (1978); US Patent No. 4,179,337; Nishimura, et al., (1979); Japanese Patents 55-99189 and 62-55079, each incorporated herein in its entirety by reference. The conjugate disclosed in U.S. Patent No. 4,179,337 was synthesized by reacting uricase from an undefined source with a 2000 fold molar excess of 750 Daltons PEG, indicating that a likely large number of polymer molecules have attached to each uricase subunit. U.S. Patent No. 4,179,337 discloses the addition of PEG or polypropylene glycol having a molecular weight of 500 to 20,000 daltons, preferably of 500 to 5,000 daltons, to provide active, water-soluble, non-immunogenic conjugates of various peptide hormones and enzymes, including oxidoreductases, which uricase is one of three examples. Additionally, US Patent 4,179,337 discloses the addition of 10 to 100 strands of polymer per enzyme molecule and retain at least 40% of the enzyme activity. The test results for the degree of binding of PEG to the available amino groups of uricase, the remaining specific uric acid-degrading activity or the immunoreactivity of the conjugate are not presented.

In previous publications it was reported that the significant reduction in the in vitro degrading activity of uric acid was caused by the addition of a different number of PEG strands to the uricase from Candida utilis. The addition of a large number of 5 kD PEG strands to porcine liver uricase produced similar results as reported in both the Chen publication and a symposium report by the same group. See Chen, et al., (1981); Davis, et al., (1978).

Seven prior art publications describe that uricase immunoreactivity is reduced by PEGylation, and five other studies have eliminated it. In three of the last five studies, the elimination of immunoreactivity is associated with a significant reduction in the uric acid-degrading activity - to at least 15%, 28%, or 45% of the original activity. See Nishimura, et al., (1979) (15% active); Chen, et al., (1981) (28% activity); Nishimura, et al., (1981) (45% activity). In the fourth report it was reported that PEG was attached to 61% of the available lysine residues, but the remaining specific activity was not mentioned. Abuchowski, et al., (1981). However, a research team made up of the same two scientists using the same methods reported elsewhere that this degree of bonding leaves only 23-28% of residual activity. Chen, et al., (1981). The 1981 publications of Abuchowski et al. And Chen et al. Indicate that to substantially reduce the immunogenicity of uricase, PEG must be attached to about 60% of the available lysine residues. The fifth publication which reports that uricase immunoreactivity has been eliminated, in contrast, does not disclose the degree of PEG incorporation, the residual uric acid-degrading activity, or the nature of PEG-protein binding. Veronese, FM, et al. (1997) in JM Harris, et al. (Eds.), Poly (ethylene glycol) Chemistry and Biological Applications. ACS Symposium Series 680 (pp. 182-192) Washington, DC: American Chemical Society, which is hereby incorporated by reference in its entirety.

The addition of PEG to a smaller fraction of lysine residues in uricase reduces but does not eliminate its immunoreactivity in experimental animals. See, for example, Tsuji, J, et al., (1985) Int J Immunopharmacol 7: 725-730, which is hereby incorporated by reference in its entirety (28-45% of bound amino groups); Yasuda, Y, et al., (1990) Chem Pharm Bull 38: 2053-2056, which is hereby incorporated by reference in its entirety (38% amine groups bound). The remaining uric acid-degrading activities of the respective adducts ranged from <33% (Tsuji, et al.) To 60% (Yasuda, et al.) Of their baseline values. Tsuji, et al. Synthesized conjugates with 7.7 kD and 10 kD PEGs, in addition to 5 kD PEG. All the resulting conjugates were to some extent immunogenic and antigenic, however, displaying significantly reduced enzymatic activities.

It was reported that PEGylated uricase preparations from Candida utilis, which are safely administered twice to each of five people, retained only 11% of their original activity. See Davis, et al., (1981). Several years later, PEG-modified uricase from Arthrobacter protoformiae was administered four times to a patient with advanced lymphoma and severe hyperuricemia. Chua, et al., (1988). Although the residual activities of this enzyme preparation were not measured, Chaa, et al. Demonstrated the absence of anti-uricase antibodies in the patient's serum 26 days after the first injection using an enzyme-linked immunosorbent assay (ELISA).

PL 215 285 B1

Previous studies of PEGylated uricase have shown that catalytic activity is significantly reduced by attaching enough strands of PEG to substantially reduce its immunoreactivity. In addition, most previous PEG-uricase preparations have been synthesized using PEG activated by cyanuric chloride, a triazine derivative (2,4,6-trichloro-1,3,5-triazine), which has been shown to introduce new antigenic determinants and induce the formation of antibodies in rabbits. Tsuji, et al., (1985).

Japanese Patent No. 3-148298, A Sano, et al., Which is hereby incorporated by reference in its entirety, discloses modified proteins, including uricases, derivatized with PEGs having a molecular weight of 1-12 kD, which exhibit reduced antigenicity. and "improved extended action and methods for producing such derivatized peptides. However, there is no disclosure regarding the number of strands, enzyme tests, bioassays, or the meaning of "improved extended. Japanese Patent Nos. 55-99189 and 62-55079, which are hereby incorporated by reference in their entirety, Y. Inada, disclose uricase conjugates made with PEG-triazine or bis-PEG-triazine (designated PEG2), respectively. See Nishimura, et al. (1979 and 1981). In the first type of conjugate, PEG molecular weights are 2 kDa and 5 kDa, while in the second type only 5 kDa PEG is used. Nishimura, et al., (1979) reported a recovery of 15% of the uric acid degrading activity after modification of 43% of the available lysines with a linear 5 kDa PEG, while Nishimura, et al., (1981) reported a recovery of 31% or 45% of the degrading activity uric acid after modification with 46% or 36% of the PEG2 lysines, respectively.

The uricase proteins studied previously were either natural or recombinant proteins. However, SDS-PAGE and / or Western studies showed the presence of unexpectedly low molecular weight peptides which appeared to be degradation products and the frequency of which increased over time. The present invention relates to mutant recombinant uricase proteins having truncations and increased structural stability.

Summary of the invention

The present invention relates to an isolated, truncated mammalian amino terminus or carboxyl terminus or both amino and carboxyl terminus truncated uricase of 1-6 amino acids and further comprising amino acid substitution with threonine at position 7 (D7T), amino acid substitution with threonine at position 46 ( S46T), amino acid substitution with lysine at position 291 (R291K) and amino acid substitution with serine at position 301 (T301S), and the amino acid truncation and substitution are relative to porcine uricase with the amino acid sequence of SEQ. ID NO. 11. Preferably, an isolated truncated mammalian uricase according to the invention further comprises an amino terminal amino acid which is alanine, glycine, proline, serine or threonine. A particularly preferred amino-terminal amino acid is threonine, and especially preferably it comprises the amino acid sequence shown in SEQ ID NO: 8. In a particularly preferred embodiment, the isolated, truncated mammalian uricase of the invention is linked to a polymer.

In another preferred embodiment of the invention of the isolated truncated mammalian uricase, the N-terminal amino acid is methionine. Preferably, said isolated truncated mammalian uricase comprises the amino acid sequence shown in SEQ NF, ID: 7.

Another object of the invention is a polyethylene glycol uricase conjugate comprising the isolated, truncated mammalian uricase according to the invention. Preferably, the conjugate comprises 2 to 12 polyethylene glycol for each uricase subunit, more preferably 3 to 10 polyethylene glycol for each uricase subunit. According to a preferred embodiment _{3 of the} invention, each polyethylene glycol molecule has a molecular weight ranging from 1 * 10 ³ to

100 x 10 ^3, preferably from 1 * 10 ³ to 50 x 10 ³ U, more preferably 5 * 10 ³ to 20 * 10 ³ ₃ ua preferably a molecular weight of 10 x 10 ³ u.

The present invention also provides an isolated nucleic acid whose sequence encodes an isolated truncated mammalian uricase protein of the invention. Preferably, the nucleic acid sequence is operably linked to a heterologous promoter, which is particularly preferably the osmB promoter.

The invention also relates to a nucleic acid vector that comprises a nucleic acid according to the invention.

The present invention also relates to a host cell comprising the vector of the invention.

The invention also provides an isolated nucleic acid comprising a uricase encoding nucleic acid sequence comprising the amino acid sequence shown in SEQ ID NO: 7

Or SEQ ID NO: 8, which preferably also includes the sequences shown in SEQ ID NO: 9 or SEQ ID NO: 10. In a particularly preferred embodiment the nucleic acid sequence is operably linked to a heterologous promoter, and in a particularly preferred embodiment the promoter is osmB promoter.

The invention also relates to a nucleic acid vector, comprising a nucleic acid according to the invention.

In another embodiment, the invention provides a host cell comprising a vector of the invention.

In another embodiment, the present invention relates to a method of producing uricase which comprises the steps of culturing a host cell of the invention under conditions such that the nucleic acid sequence is expressed in the host cell, and isolating the expressed uricase.

The invention thus discloses methods of metabolizing uric acid comprising a novel recombinant uricase protein having uric acid-degrading activity. The uric acid-degrading activity is used herein to denote the enzymatic conversion of uric acid to allantions.

In one particular exemplary embodiment of the present invention, an isolated, truncated uricase is provided that comprises the amino acid sequence of a mammalian uricase truncated at the amino terminus or at the carboxy terminus or at both the amino and carboxyl terminus of about 1-13 amino acids and having an additional amino acid substitution at about position 46. In another specific embodiment, uricase comprises the amino terminal amino acid which is alanine, glycine, proline, serine or threonine. Also described herein is uricase in which there is a substitution at about position 46 with threonine or alanine. In one particular exemplary embodiment, uricase comprises the amino acid sequence of SEQ ID NO: 8. In one embodiment, uricase is linked to a polymer to produce, for example, a polyethylene glycol uricase conjugate. In another specific embodiment, the polyethylene glycol-uricase conjugates contain 2 to 12 polyethylene glycol molecules on each uricase subunit, preferably 3 to 10 polyethylene glycol molecules per uricase subunit. In a specific embodiment, each polyethylene glycol molecule of the polyethylene glycol-uricase conjugate has a molecular weight between about 1 kD and 100 kD; about 1 kD and 50 kD; approximately 5 kD and 20 kD; or about 10 kD.

The present invention also relates to a pharmaceutical composition containing the active ingredient and pharmaceutically acceptable excipients which contain the uricase according to the invention as the active ingredient.

In another embodiment, the pharmaceutical composition according to the invention comprises as the active ingredient the polyethylene glycol-uricase conjugate according to the invention.

Preferably, the compositions of the invention are suitable for repeated administration.

The present invention also relates to the use of a composition according to the invention for the manufacture of a medicament useful for reducing uric acid levels in biological fluids in a subject in need thereof. Preferably, the biological fluid is blood.

According to the present invention, therefore, there is provided a method of reducing uric acid levels in biological fluids of a subject in need thereof, comprising administering a pharmaceutical composition containing uricase according to the invention. In a specific embodiment, the biological fluid is blood.

In one exemplary embodiment, uricase comprises a peptide having the sequence from position 44 to position 56 Pig-KS-ΔΝ (SEQ ID NO: 14).

In one exemplary embodiment, uricase comprises an N-terminal methionine. In a specific embodiment, uricase comprises the amino acid sequence of SEQ ID NO: 7.

Brief Description of Figures

Figure 1 shows the structure of the plasmid pOUR-P ^ N-ks-1. The numbers next to the restriction sites indicate the nucleotide position relative to the HaeII site, designated 1. Restriction sites that have been lost during cloning are indicated by parentheses.

Figure 2 shows the DNA and the deduced amino acid sequence of Pig-KS-ΔΝ uricase (SEQ ID NO: 9 and SEQ ID NO: 7, respectively). The amino acid numbering in Figure 2 refers to the complete porcine uricase sequence. After the methionine initiation moiety, threonine replaces aspartic acid 7 in the porcine uricase sequence. Restriction sites that are used in different subcloning steps are indicated. The 3 'untranslated sequence is shown in lower case. The translation stop codon is marked with an asterisk.

PL 215 285 B1

Figure 3 shows the mutual alignment of the deduced amino acid sequences of different recombinant porcine uricase (SEQ ID NO: 11), PBC-ΔΝΟ (SEQ ID NO: 12) and Pig-KS-ΔΝ (SEQ ID NO: 7) sequences. Asterisks indicate positions where there are amino acid differences in Pig-KS-ΔΝ compared to the published porcine uricase sequence; circles indicate positions where there are amino acid differences in Pig-KS-ΔΝ compared to PBC-ANC. Dashed lines indicate the amino acid deletion.

Figure 4 shows SDS-PAGE of porcine uricase and highly purified uricase variants prepared according to Examples 1-3. The date of manufacture (month / year) and the corresponding track number for each sample is indicated in the legend below. The molecular weights of the markers are indicated on the Y axis, and the track numbers are indicated at the top of the figure. The lanes are as follows: Lane 1 molecular weight markers; Lane 2 - Pig-KS-ΔΝ (7/98); Track 3 - Pig (9/98); Lane 4 - Pig KS (6/99); Lane 5 - Pig KS (6/99); Lane 6 - Pig-ΔΝ (6/99); Lane 7 - Pig KS-ΔΝ (7/99); Lane 8 Pig KS-ΔΝ (8/99).

Figure 5 shows the pharmacokinetic profiles of PEGylated (9x10 kD) Pig-KS-ΔΝ uricase in rats after IM (intramuscular), SC (subcutaneous) and IV (intravenous) injection, determined by tracking enzymatic activity in blood samples. The enzymatic activity of uricase in the plasma samples that are collected at the indicated time points is determined using a colorimetric test. The activity values (mAU = milliabsorbance units) represent the enzymatic reaction rate per 1 μl of plasma sample. The bioavailability (amount of drug reaching the circulatory system relative to the IV injection) of the injected uricase was calculated from the area under the curve in the graph.

Figure 6 shows the pharmacokinetic profiles of PEGylated (9x10 kD) Pig-KS-ΔΝ uricase in rabbits after IM (intramuscular), SC (subcutaneous) and IV (intravenous) injection as determined by monitoring enzyme activity in blood samples. The enzymatic activity of uricase in the plasma samples that are collected at the indicated time points is determined using a colorimetric test. The activity values (mAU = milliabsorbance units) represent the enzymatic reaction rate per 1 μl of plasma sample. The bioavailability (amount of drug reaching the circulatory system versus IV injection) of the injected uricase was calculated from the area under the curve in the graph.

Figure 7 shows the pharmacokinetic profiles of PEGylated (9x10 kD) Pig-KS-ΔΝ uricase in dogs after IM (intramuscular), SC (subcutaneous) and IV injection, determined by monitoring enzymatic activity in blood samples. The enzymatic activity of uricase in the plasma samples that are collected at the indicated time points is determined using a colorimetric test. The activity values (mAU = milliabsorbance units) represent the enzymatic reaction rate per 1 μl of plasma sample. The bioavailability (amount of drug reaching the circulatory system versus IV injection) of the injected uricase was calculated from the area under the curve in the graph.

Figure 8 shows the pharmacokinetic profiles of PEGylated (9x10 kD) Pig-KS-ΔΝ uricase in pigs after IM (intramuscular), SC (subcutaneous) and IV (intravenous) injection as determined by monitoring enzymatic activity in blood samples. The enzymatic activity of uricase in the plasma samples that are collected at the indicated time points is determined using a colorimetric test. The activity values (mAU = milliabsorbance units) represent the enzymatic reaction rate per 1 μl of plasma sample. The bioavailability (amount of drug reaching the circulation system versus IV injection) of the injected uricase was calculated from the area under the curve in the graph.

Detailed Description of the Invention

Previous studies have shown that when a significant reduction in the immunogenicity and / or antigenicity of uricase by PEGylation is achieved, there is an invariably significant loss of uric acid-degrading activity. The safety, convenience, and cost-effectiveness ratio of biopharmaceuticals are all adversely affected by reducing their potency and, consequently, the need to increase the dose administered. Thus, there is a need for safe and effective alternative methods for reducing elevated levels of uric acid in body fluids, including blood. The present invention provides a mutant recombinant uricase where the uricase has been truncated by 1-20 amino acids at the amino terminus or the carboxyl terminus or both, and substantially retains the uric acid-degrading activity of naturally occurring uricase.

The term "uricase" as used herein includes individual subunits as well as tetrameter, unless otherwise stated.

The term "mutant uricase" as used herein refers to uricase molecules having amino acids changed to other amino acids.

PL 215 285 B1

The term "conservative mutation" as used herein is a mutation of one or more amino acids, at or near a position, which does not substantially alter the behavior of the protein. In a preferred embodiment, uricase containing at least one conservative mutation has the same uricase activity as uricase without such mutation. In another embodiment, uricase comprising at least one conservative mutation has substantially the same uricase activity, no more than 5% activity, no more than 10% activity, or no more than 30% activity, uricase without such mutation.

A conservative amino acid substitution is defined as a change in the amino acid composition by altering the amino acids of a peptide, polypeptide, or protein or fragment. In specific embodiments, uricase has one, two, three, or four conserved mutations. Substitution is amino acids with generally similar properties (e.g., acidic, basic, aromatic, sized, positively or negatively charged, polar, non-polar) such that substitutions do not substantially alter the nature (e.g., charge, IEF, affinity, visibility, conformation, solubility) ) or the activity of a peptide, polypeptide or protein. Typical substitutions that may be made as such conservative amino acid substitutions may be within the following groups of amino acids:

glycine (G), alanine (A), valine (V), leucine (L) and isoleucine (I) aspartic acid (D) and glutamic acid (E) alanine (A), serine (S) and threonine (T) histidine (H), lysine (K) and arginine (R) asparagine (N) and glutamine (Q) phenylalanine (F), tyrosine (Y) and tryptophan (W)

A protein having one or more conservative substitutions retains its structural stability and can catalyze a reaction even if its sequence is not the same as the starting protein.

Truncated uricase as used herein refers to uricase molecules having truncated primary amino acid sequences. Among the possible truncations are truncations at or near the amino and / or carboxyl terminus. Specific truncations of this type may be such that the last amino acids (those at the amino and / or carboxyl terminus) of the naturally occurring protein are present in the truncated protein. The amino terminal truncations may start at position 1, 2, 3, 4, 5 or 6. Preferably, the amino terminal truncations start at position 2, thus leaving the amino terminal methionine. This methionine can be removed by post-translational modification. In specific embodiments, the amino-terminal methionine is removed after uricase is produced. In a specific embodiment, methionine is removed by endogenous bacterial aminopeptidase.

A truncated uricase with respect to the full length sequence has one or more amino acid sequences eliminated. A protein containing truncated uricase may contain any amino acid sequence in addition to the truncated uricase sequence, but does not include a protein containing a uricase sequence containing any additional contiguous wild-type amino acid sequence. In other words, a protein containing truncated uricase where truncation starts at position 6 (i.e. truncated uricase starts at position 7) does not have any amino acid immediately before truncated uricase that wild-type uricase had at position 6.

Unless otherwise indicated by specific reference to other sequences or to a particular SEQ ID NO, reference to the numbered amino acid positions described herein is made with reference to the amino acid numbering of the porcine uricase sequence. The porcine uricase amino acid sequence and the numbered amino acid positions contained in this sequence can be found in Figure 3. As used herein, reference to amino acids or nucleic acids "from position X to position Y means a contiguous sequence starting at position X and ending at position Y, including including amino acids or nucleic acids in both X and Y positions.

Uricase genes and proteins have been identified in several mammalian species, such as pig, baboon, rat, rabbit, mouse, and rhesus monkey. The protein sequences of the various uricases are described herein with reference to their access numbers in public databases as follows:

gi | 50403728 | sp | P25689; gi | 20513634 | dbj | BAB91555.1; gi | 176610 | gb | AAA35395.1;

gi | 20513654 | dbj | BAB91557.1;

PL 215 285 B1 | 47523606 | ref | NP_999435.1;

gi | 6678509 | ref | NP_033500.1;

gi | 57463 | emb | CAA31490.1;

gi | 20127395 | ref | NP_446220.1;

gi | 137107 | sp | P11645;

gi | 51458661 | ref | XP_497688.1;

gi | 207619 | gb | AAA42318.1;

gi | 26340770 | dbj | BAC34047.1 and gi | 57459 | emb | CAA30378.1.

Each of these sequences and their footnotes in public databases available through the National Center for Biotechnology Information (NCBI) are herein incorporated by reference in their entirety.

In one embodiment of the invention, uricase is truncated 4-13 amino acids at the amino terminus. In one embodiment of the invention, uricase is truncated 4-13 amino acids at the carboxyl terminus. In one embodiment of the invention, uricase is truncated by 4-13 amino acids at both the amino and carboxyl terminals.

In one embodiment of the invention, uricase is truncated by 6 amino acids at the amino terminus. In one embodiment of the invention, uricase is truncated by 6 amino acids at the carboxyl terminus. In one embodiment of the invention, uricase is truncated by 6 amino acids at both the amino and carboxyl terminals.

In a specific embodiment, the uricase protein comprises an amino acid sequence from position 13 to position 292 of the porcine uricase amino acid sequence (SEQ ID NO: 11). In a specific embodiment, the uricase protein comprises an amino acid sequence from position 8 to position 287 of the amino acid sequence

PBC-ANC (SEQ ID NO: 12). In a specific embodiment, the uricase protein comprises an amino acid sequence from position 8 to position 287 of the amino acid sequence Pig-KS-ΔΝ (SEQ ID NO: 7).

In another embodiment, the uricase protein comprises an amino acid sequence from position 44 to position 56 Pig-KS-ΔΝ (SEQ ID NO: 14). This uricase region shares sequence homology within the tunneling fold (T-fold) domain of uricase and has a mutation therein at position 46 with respect to the native porcine uricase sequence. Surprisingly, this mutation does not significantly alter the protein uricase activity.

In one embodiment of the invention, the amino acids at or near amino acids 7, 46, and 291 and 301 are mutated. In a preferred embodiment of the invention, amino acids 7, 46, 291, and 301 are themselves mutated.

In a specific embodiment, the protein is encoded by a nucleic acid that encodes an N-terminal methionine. This N-terminal methionine is preferably followed by a codon which enables removal of the N-terminal methionine by bacterial methionine aminopeptidase (MAP). (Ben-Bassat and Bauer (1987) Nature 326: 315, incorporated herein by reference in their entirety. The amino acids which permit the most complete removal of the N-terminal methionine are alanine, glycine, proline, serine and threonine.

In one embodiment of the invention the amino acids at or near amino acids 7 and / or 46 are replaced with a threonine. Surprisingly, the enzymatic activity of the truncated uricases produced with these mutations is similar to that of the non-truncated enzyme. In a further embodiment of the invention, the amino acid mutations include threonine, threonine, lysine and serine at positions 7, 46, 291 and 301, respectively.

Truncated mammalian uricases disclosed herein may further include methionine at the amino terminus. The penultimate amino acid may be one that enables the removal of the N-terminal methionine by bacterial methionine aminopeptidase (MAP). The amino acids enabling the most complete removal of the N-terminal methionine are alanine, glycine, proline, serine and threonine. In a specific embodiment, uricase comprises two amino terminal amino acids, wherein the two amino terminal amino acids are methionine followed by an amino acid selected from the group consisting of alanine, glycine, proline, serine, and threonine.

In another embodiment of the invention, the substituted amino acids have been replaced with threonine.

In one embodiment of the invention the uricase is mammalian uricase.

In a further embodiment of the invention, the mammalian uricase comprises the sequence of porcine, bovine, sheep, or baboon liver uricase.

In yet another embodiment of the invention the uricase is a chimeric uricase from two or more mammalian uricases.

PL 215 285 B1

In one embodiment of the invention the mammalian uricases are selected from porcine, bovine, sheep, or baboon liver uricase.

In one embodiment of the invention, uricase comprises the sequence of SEQ ID NO: 8.

In yet another embodiment of the invention, the uricase comprises the sequence of SEQ ID NO: 13.

The present invention therefore provides nucleic acids encoding uricase comprising the sequence SEQ ID NO: 10.

In one embodiment of the invention the uricase comprises fungal or microorganism uricase.

In one embodiment of the invention the fungal or microorganism uricase is Aspergillus flavus, Arthrobaeter globiformis or Candida utilis.

In one embodiment of the invention, the uricase comprises invertebrate uricase.

In one embodiment of the invention the invertebrate uricase is Drosophila melanogaster or Drosophila pseudoobseura uricase.

In one embodiment of the invention, the uricase comprises vegetable uricase.

In one embodiment of the invention the plant uricase is Glycine max uricase from root tumors.

The present invention provides a nucleic acid sequence encoding uricase.

The present invention provides a vector comprising a nucleic acid sequence.

In a specific embodiment, uricase is isolated. In a specific embodiment, the uricase is purified. In specific embodiments, uricase is isolated and purified.

The present invention provides a host cell containing a vector.

The present invention provides a method of producing a nucleic acid sequence comprising modifying, by polymerase chain reaction (PCR) techniques, a nucleic acid sequence encoding non-truncated uricase. One skilled in the art knows that a desired nucleic acid sequence is generated by PCR using synthetic oligonucleotide primers that are complementary to the target DNA regions (one for each strand) to be amplified. Primers are added to the target DNA (need not be pure) in the presence of excess deoxynucleotides and Taq polymerase, a thermostable DNA polymerase. Over a series of (typically 30) temperature cycles, target DNA is repeatedly denatured (about 90 ° C), annealed to primers (typically at 50-60 ° C) and daughter strand extended from primers (72 ° C). Daughter strands themselves act as templates for subsequent cycles, DNA fragments matching both primers are amplified exponentially, not linearly.

The present invention provides a method for producing a mutant recombinant uricase, comprising transfecting a host cell with a vector where the host cell expresses uricase, isolating the mutant recombinant uricase from the host cell, isolating the purified mutant recombinant uricase, for example by using chromatographic techniques, and purifying the mutant recombinant uricase. For example, uricase can be produced according to the methods described in International Patent Application Publication No. WO 00/08196, incorporated herein by reference in its entirety.

Uricase can be isolated and / or purified using any method known to those skilled in the art. The expressed polypeptides of the invention are generally isolated in substantially pure form. It is preferred that the polypeptides are isolated to at least 80 wt% purity, more preferably at least 95 wt% purity, and most preferably at least 99% purity. Generally, such purification can be achieved, for example, by standard ammonium sulfate fractionation, SDS-PAGE electrophoresis, and affinity chromatography techniques. Preferably, uricase is isolated using a cationic surfactant such as cetylpyridinium chloride (CPC) according to the method described in co-pending US Patent Application filed April 11, 2005, Application Number 60 / 670,520 and Attorney Reference Number 103864.146644 , entitled "Protein Purification Using Cationic Surfactants," incorporated herein by reference in its entirety.

In a preferred embodiment, the host cell is treated so as to cause expression of the mutant recombinant uricase. One skilled in the art will appreciate that vector transfection of cells is typically achieved using calcium precipitated DNA, although a variety of other methods (e.g., electroporation) may be used.

In one embodiment of the invention, the vector is under the control of an osmotic pressure sensitive promoter. A promoter is a region of DNA to which RNA polymerase binds prior to initiating transcription of DNA into RNA. An osmotic pressure sensitive promoter initiates transcription as a result of an increased osmotic pressure sensed by the cell.

In one embodiment of the invention, the promoter is a modified osmB promoter.

In other specific embodiments, the uricase of the invention is polymer-linked uricase.

In one embodiment of the invention, a pharmaceutical composition containing uricase is provided. In one embodiment, the composition is a uricase solution. In a preferred embodiment of the invention, the solution is sterile and suitable for injection. In one embodiment, such a composition comprises uricase as a solution in phosphate buffered saline. In one embodiment, the composition is provided in a vial, optionally having an injection rubber closure. In specific embodiments, the composition comprises uricase in solution at a concentration of 2 to 16 milligrams per milliliter of solution, 4 to 12 milligrams per milliliter, or 6 to 10 milligrams per milliliter. In a preferred embodiment, the composition comprises uricase at a concentration of 8 milligrams per milliliter. Preferably, the weight of the uricase is measured with respect to the weight of the protein.

Modes for effective administration of the compositions of the invention can be determined by one skilled in the art. Useful indicators for testing the effectiveness of a given regimen are known to those skilled in the art. Examples of such indicators include the normalization or reduction of plasma uric acid (PUA) levels and the reduction or persistence of PUAs to 6.8 mg / dL or less, preferably 6 mg / dL or less. In a preferred embodiment, the subject treated with a composition of the invention has a PUA of 6 mg / ml or less for at least 70%, at least 80% or at least 90% of the entire treatment period. For example, it is preferred that the subject during 24 weeks of treatment has a PUA of 6 mg / ml or less for at least 80% of the 24-week treatment period, i.e. at least equal to the amount of time in 134.4 days (24 weeks x 7 days / week x 0.8 = 134.4 days).

In a specific embodiment, 0.5 to 24 mg of uricase in solution is administered once every 2 to 4 weeks. Uricase can be administered by any of the routes known to those skilled in the art, for example, intravenously, intramuscularly, or subcutaneously. For intravenous administration, it is preferable to administer 0.5 mg to 12 mg of uricase. For subcutaneous administration, it is preferable to administer 4 to 24 mg of uricase. In a preferred embodiment, uricase is administered by intravenous infusion over a period of 30 to 240 minutes. In one embodiment, 8 mg of uricase is administered every two weeks. In a specific embodiment, the infusion may be performed with 100 to 500 ml of physiological saline. In a preferred embodiment, 8 mg of uricase in solution is administered over a period of 120 minutes every two weeks or every four weeks; preferably uricase is dissolved in 250 ml of saline infusion. In specific embodiments, administration of uricase occurs over a treatment period of 3 months, 6 months, 8 months, or 12 months. In other embodiments, the treatment period is 12 weeks, 24 weeks, 36 weeks, or 48 weeks. In a specific embodiment, the treatment period is for a longer period of time, e.g., 2 years or more, until the end of the life of the subject being treated. Additionally, multiple treatment periods separated by some time without treatment may be used, e.g. 6 months of treatment followed by 3 months of no treatment, then 6 additional months of treatment etc.

In some embodiments, anti-inflammatory compounds can be administered prophylactically to eliminate or reduce the incidence of infusion reactions due to administration of uricase. In one embodiment, at least one corticosteroid, at least one antihistamine, at least one NSAID, or a combination thereof is also administered with the composition. Useful corticosteroids include betamethasone, budesonide, cortisone, dexamethasone, hydrocortisone, methylprednisolone, prednisolone, prednisone, and triamcinolone. Useful NSAIDs include ibuprofen, indomethacin, naproxen, aspirin, acetominophen, celecoxib, and valdecoxib. Useful antihistamines include azatadine, brompheniramine, cetirizine, chlorpheniramine, clemastin, cyproheptadine, desloratadine, dexchlorpheniramine, dimenhydrinate, diphenhydramine, doxylamine, fexofenadine, phenindazin, and phenindazin.

In a preferred embodiment, the antihistamine is fexofenadine, the NSAID is acetaminophen, and the corticosteroid is hydrocortisone and / or prednisolone. Preferably, the combination of all three (not necessarily simultaneously) is administered prior to infusion of the uricase solution. In a preferred embodiment, the NSAID and the antihistamine are administered orally 1 to 4 hours prior to the uricase infusion. A suitable dose of fexofenadine includes about 30 to about 180 mg, about 40 to about 150 mg, about 50 to about 120 mg, about 60 to about 90 mg, about 60 mg, preferably 60 mg. A suitable dose of acetaminophen is about 500 to about 1500 mg, about 700 to about 1200 mg, about 800 to about

PL 215 285 B1

1100 mg, about 1000 mg, preferably 1000 mg. A suitable dose of hydrocortisone is about 100 to about 500 mg, about 150 to about 300 mg, about 200 mg, preferably 200 mg. In one embodiment, the antihistamine is not diphenhydramine. In another embodiment, the NSAID is not acetaminophen. In a preferred embodiment, 60 mg of fexofenadine is administered orally the night before the uricase infusion; 60 mg of fexofenadine and 1000 mg of acetaminophen are given orally the next morning, and finally, 200 mg of hydrocortisone is given just before the infusion of the uricase solution. In one embodiment, prednisone is administered the night before, preferably in the evening, prior to the administration of uricase. A suitable dose of prednisone is 5 to 50 mg, preferably 20 mg. In some embodiments, these prophylactic treatments are for subjects that receive or are to receive uricase, including PEGylated and non-PEGylated uricase. In specific embodiments, these prophylactic treatments are applied to subjects receiving or to be receiving therapeutic peptides other than uricase, where the other therapeutic peptides are PEGylated or non-PEGylated.

In one embodiment of the invention, the pharmaceutical composition comprises uricase that has been modified by association with a polymer, and the modified uricase retains uric acid-degrading activity. In a specific embodiment, polymer-uricase conjugates are prepared as described in International Patent Publication No. WO 01/59078 and US Application No. 09/501730, incorporated herein by reference in its entirety.

In one embodiment, the polymer is selected from the group consisting of polyethylene glycol, dextran, polypropylene glycol, hydroxypropylmethyl cellulose, carboxymethyl cellulose, polyvinylpyrrolidone, and polyvinyl alcohol.

In one embodiment of the invention the composition comprises 2-12 polymer molecules per uricase subunit, preferably 3 to 10 polymer molecules per subunit.

In one embodiment of the invention, each polymer molecule has a molecular weight between about 1 kD and about 100 kD.

In another embodiment of the invention, each polymer molecule has a molecular weight between about 1 kD and about 50 kD. In a preferred embodiment of the invention, each polymer molecule has a molecular weight between about 5 kD and about 20 kD, about 8 kD and about 15 kD, about 10 kD and 12 kD, preferably, about 10 kD. In a preferred embodiment, each polymer molecule has a molecular weight of about 5 kD or about 20 kD. In a particularly preferred embodiment of the invention, each polymer molecule has a molecular weight of 10 kD. A mixture of molecules of different weights is also considered. In one embodiment of the invention, the composition is suitable for repeated administration of the composition.

In a specific embodiment, the attachment of uricase to the polymer includes bonds selected from the group consisting of urethane bonds, secondary amine bonds, and amide bonds.

The present invention also relates to a cell capable of producing uricase having the amino acid sequence of recombinant uricase, wherein the uricase has been truncated by 1-20 amino acids and has mutated amino acids and uric acid metabolizing activity.

The present invention also discloses methods of metabolizing uric acid using uricase.

The present invention provides the use of a uricase composition to reduce uric acid levels in a biological fluid.

In one embodiment of the invention, a uricase composition is used to reduce uric acid levels in a biological fluid including blood.

New nucleic acid molecules encoding uricase polypeptides are also provided. The manipulations that lead to their production are well known to the person skilled in the art. For example, uricase nucleic acid sequences can be modified using any of a number of strategies known in the art (Maniatis, T., 1990, Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). The sequences may be cleaved at appropriate sites by restriction endonuclease (s) and then further enzymatically modified, isolated and ligated in vitro if desired. In generating the gene encoding uricase, care should be taken to ensure that the modified gene maintains the appropriate reading frame for translation, not interrupted by translation stop signals. Additionally, the uricase-encoding nucleic acid sequence can be mutated in vitro or in vivo to generate and / or destroy translational initiation and / or termination sequences or to create variations in the coding regions and / or to create new restriction enzyme sites or to destroy preexisting ones in to facilitate further in vitro modification. You can apply

Any mutagenesis technique known in the art including, but not limited to, in vitro site-directed mutagenesis (Hutchinson, C., et al., 1978, J. Biol. Chem 253: 6551), the use of linkers

TAB ^® (Pharmacia), etc.

The nucleotide sequence encoding the uricase protein can be inserted into an appropriate expression vector, i.e., a vector that contains the necessary elements for the transcription and translation of the inserted protein-coding sequence. This includes, but is not limited to, mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus), microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage DNA, plasmid DNA or cosmid DNA. The expression elements of these vectors can vary in strength and specificity. Depending on the host-vector system used, any of a number of suitable transcriptional and translational elements may be used.

Any of the known methods of inserting DNA fragments into a vector can be used to construct expression vectors containing a chimeric gene consisting of appropriate transcriptional / translational control signals and protein coding sequences. These methods may include in vitro recombinant DNA techniques and synthetic techniques, and in vivo recombination (genetic recombination). Expression of a uricase-encoding nucleic acid sequence can be regulated by a second nucleic acid sequence such that the uricase protein is expressed in a host transformed with the recombinant DNA molecule. For example, uricase expression can be under the control of any promoter / enhancer element known in the art. Promoters that can be used to control uricase expression include, but are not limited to, the SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290: 304-310), the Rous sarcoma virus 3 'long terminal repeat promoter (Yamamoto, et al., 1980). , Cell 22: 787-797), herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. USA 78: 144-1445), regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296: 39-42); prokaryotic expression vectors such as the β-lactamase promoter (Villa-Kamaroff, et al., 1978, Proc. Natl. Acad. Sci. USA 75: 3727-3731), the tac promoter (DeBoer, et al., 1983, Proc. Natl. Acad. Sci. USA 80: 21-25) and the osmB promoter. In specific embodiments, the nucleic acids contain a nucleic acid sequence encoding uricase operably linked to a heterologous promoter.

After the particular DNA molecule containing the encoding nucleic acid sequence has been produced and isolated, several methods known in the art can be used to amplify it. After an appropriate host system and growth conditions have been developed, recombinant expression vectors can be propagated and obtained in large amounts. As previously explained, expression vectors that can be used include, but are not limited to, the following vectors or derivatives thereof: human or animal viruses such as vaccinia virus or adenovirus, insect viruses such as baculovirus, yeast vectors, bacteriophage vectors (e.g. lambda) and vectors Plasmid and Cosmid DNA to name a few.

Additionally, a host cell strain can be selected that modulates the expression of the inserted sequences or modifies and processes the gene product in the specific manner desired. Expression from certain promoters can be increased in the presence of certain inducers and thus expression of the engineered uricase can be controlled. Moreover, different host strains have properties and specific mechanisms for translational and post-transposition processing and modification (glycosylation, cleavage) of proteins. Appropriate cell lines or host systems can be selected to ensure the desired modification and processing of the expressed foreign protein. Different vector / host expression systems can influence processing reactions, such as proteolytic cleavages, to a different extent.

In particular embodiments of the invention, expression of uricase in E. coli is preferably performed using vectors that contain an osmB promoter.

Examples for practicing the invention

Example 1. Gene construction and plasmid expression for uricase expression

Recombinant porcine uricase (urate oxidase), Pig-KS-ΔΝ (porcine uricase protein with truncated amino terminus, replacing amino acids 291 and 301 with lysine and serine, respectively) was expressed in E. coli strain K-12 W3110 F ^- . A series of plasmids was constructed, finally yielding pOUR-P-AN-ks-1, which, upon transformation of the E. coli host cells, was able to drive efficient uricase expression.

Isolation and subcloning of uricase cDNA from pig and baboon liver

Uricase cDNA was prepared from pig and baboon livers by isolation and cloning of the appropriate RNA. Total cellular RNA was extracted from pig and baboon livers (Erlich, HA (1989). PCR Technology; Principles and Application for DNA Amplification; Sambrook, J., et al. (1989). Molecular Cloning: A Laboratory Manual, 2nd Edition; Ausubel , FM et al. (1998). Current protocols in molecular Biology) and then transcribed using a first-strand cDNA Synthesis Kit (Pharmacia Biotech). PCR amplification was performed using Taq DNA polymerase (Gibco BRL, Life Technologies).

The synthetic oligonucleotide primers used for PCR amplification of porcine and baboon urate oxidases are shown in Table 1.

T a b e l a 1. Primers for PCR amplification of uricase cDNA

The restriction enzyme sequences introduced at the ends of the primers and written in lower case in Table 1 were sense EcoRI and NcoI (Swine and Baboon) and antisense NcoI, HindIII and XbaI (Swine), XbaI and NcoI (Baboon). In the baboon sense primer, the third GAC (aspartic acid) codon present in the baboon uricase was replaced with CAC (histidine), a codon that is present at this position in the human urate oxidase pseudogen coding sequence. The construct for recombinant baboon uricase produced with these primers is named D3H Baboon Uricase.

Porcine uricase PCR product was digested with EcoRI and HindIII and cloned into pUC18 to generate pUC18-Pig Uricase. The PCR product for D3H Baboon Uricase was cloned directly into the pCR ™ II vector using TA Cloning ™ (Invitrogen, Carlsbad, CA) to generate pCR ™ II-D3H Baboon Uricase.

The ligated cDNAs were used to transform the E. coli XL1-Blue strain (Stratagene, La Jolla, CA). Plasmid DNA containing the cloned uricase cDNA was produced and clones that had the published DNA sequence encoding uricase (with the difference being the D3H substitution in the baboon uricase shown in Table 1) were selected and isolated. In the selected pCR ™ II-D3H Baboon Uricase clone, the pCR ™ II sequences were adjacent to the uricase stop codon as a result of a PCR-introduced sequence deletion. Consequently, the XbaI and NcoI restriction sites from the 3 'untranslated region were eliminated allowing direct cloning using NcoI at the 5' end of the PCR product and BamHI which is derived from the pCR ™ II vector.

Subcloning of uricase cDNA into pET expression vectors

Subcloning of baboon uricase The baboon D3H cDNA containing the full-length uricase coding sequence was inserted into an expression vector pET-3d (Novagen, Madison, WI). pCR ™ II-D3H Baboon Uricase was digested with NcoI and BamIII and a 960 bp fragment was isolated. The expression plasmid pET-3d was digested with NcoI and BamHI and a 4600 bp fragment was isolated. The two fragments were ligated to form pET-3d-D3H Baboon.

Clobing chimeric porcine baboon uricase

Pig baboon chimera (PBC) was engineered to achieve higher expression, stability and activity of the recombinant gene. PBC was constructed by isolating a 4936 bp NcoI-ApaI fragment from the Baboon pET-3d-D3H clone and ligating the isolated fragment with a 624 bp NcoI-ApaI fragment isolated from pUC18-Pig Uricase to generate pET-3d-PBC. The PBC uricase cDNA consists of codons 1-225 of porcine uricase linked in frame to codons 226-304 of baboon uricase.

Subcloning of the Pig-KS uricase cDNA

Uricase Pig-KS was constructed to add one lysine residue that may provide an additional PEGylation site. KS is the insertion of the amino acid lysine into porcine uricase at position

PL 215 285 B1

291 in place of arginine (R291K). Additionally, threonine at position 301 was replaced with serine (T301S). The uricase PigKS plasmid was constructed by isolating a 4696 bp NcoI-NdeI fragment from pET-3d-D3H Baboon followed by ligation with an 864 bp NcoI-NdeI fragment isolated from pUC18-Pig Uricase to generate pET-3d- Pig-KS. The resulting PigKS uricase sequence consists of codons 1-288 linked in frame to codons 289-304 of the baboon uricase.

Subcloning of the uricase sequence regulated by the osmB promoter

The uricase gene was subcloned into an expression vector containing the osmB promoter (as taught in US Patent No. 5,795,776, incorporated herein by reference in its entirety). This vector enables the induction of protein expression in response to high osmotic pressure or aging of the culture. The pMFOA-16 expression plasmid contained the osmB promoter, the sequence of the ribosomal binding site (rbs) and the sequence of the transcriptional terminator (ter). It confers ampicillin resistance (AmpR) and expresses recombinant human acetylcholine esterase (AChE).

Subcloning of D3H Baboon Uricase

The plasmid pMFOA-18 was digested with NcoI and BamHI and the large fragment was isolated. The pET-3d-D3H Baboon Uricase construct was digested with NcoI and BamHI I, and a 960 bp fragment was isolated which contained the Baboon Uricase D3H gene. These two fragments were ligated to form pMF0U18.

The pMFXT133 expression plasmid contained the osmB promoter, rbs (E. coli deo operon), ter (E. coli TrypA), recombinant factor Xa inhibitor polypeptide (FxaI), and carries the tetracycline resistance gene (TetR). The baboon uricase gene was inserted into this plasmid to convert antibiotic resistance genes. Plasmid pMFOU18 was digested with NcoI, the ends were filled, then digested with XhoI and a 1030 bp fragment was isolated. Plasmid pMFXT133 was digested with NdeI, the ends were filled, then digested with XhoI and the large fragment was isolated. The two fragments were ligated to generate the expression vector for baboon uricase, pURBA16.

Subcloning of chimeric porcine baboon uricase

Plasmid pURBA16 was digested with ApaI and AlwNI and a fragment of 2320 bp was isolated. Plasmid pMFXT133 was digested with NdeI, the ends were filled and then digested with AlwNI, and a 620 bp fragment was isolated. The pET-3d-PBC construct was digested with XbaI, the ends were filled and then digested with ApaI and a 710 bp fragment was isolated. The three fragments were ligated to generate pURPB, a plasmid that expressed PBC uricase under the control of the promoter, and rbs osmB, as well as rbs T7, which was derived from the pET-3d vector.

Rbs T7 was cut in an additional step. pUR-PB was digested with NcoI, the ends were filled, and then digested with AlwNI and a 3000 bp fragment was isolated. Plasmid pMFXT133 was digested with NdeI, the ends were filled and then digested with AlwNI, and a 620 bp fragment was isolated. These two fragments were ligated into pDUR-PB which expresses PBC under the control of the osmB promoter.

POUR-PB-ANC construction

Several changes have been made to the uricase cDNA which lead to a substantial increase in the stability of the recombinant enzyme. The plasmid pOUR-PBC-ANC was constructed in which the N-terminal peptide of maturation of six residues and the C-terminal tripeptide that acted in vivo as a peroxisome targeting signal, both were removed. This was done using the PBC sequence in the pDUR-PB plasmid and the specific oligonucleotide primers listed in Table 2, using PCR amplification.

T a b e l a 2. Primers for PCR amplification of PBC-ANC uricase

Uricase PBC-ANC: ............................................. ..... i

Sensible

5 'gcgcatATGACTTACAAAAAGAATGATGAGGTAGAG 3' (SEQ ID NO: 5)

Antisense

5 'ccgtctagaTT AAG ACAACTTCCTCTTGACTGTACCAGTAATTTTTCCGT ATGG 3 ^f (SEQ ID NO: S)

Restriction enzyme sequences inserted at the ends of the primers shown in bold and non-coding regions are shown in Table 2 in lower case letters. NdeI is meaningful and XbaI is antisense. The sense primer was also used to eliminate the internal NdeI restriction site by introducing a point mutation (underlined) that did not affect the amino acid sequence and thus facilitated subcloning using NaeI.

The 900 bp fragment generated by PCR amplification of pDUR-PB was cut with NdeI and XbaI and isolated. The obtained fragment was then introduced into the ex16 plasmid

The deo, pDBAST-RAT-N, which carries the deo-P1P2 promoter and rbs derived from E. coli and constitutively expresses the precursor of human recombinant insulin. The plasmid was digested with NdeI and XbaI, and a 4035 bp fragment was isolated and ligated with the PCR product for PBC uricase. The resulting construct, pDUR-PB-ANC, was used to transform E. coli K-12 Sφ733 (F-cytR strA), which expressed high levels of active truncated uricase.

The double truncated PBC-ANC sequence was also expressed under the control of the osmB promoter. The plasmid pDUR-PB-ANC was digested with AlwNI - NdeI and a fragment of 3459 bp was isolated. Plasmid pMFXT133, described above, was digested with NdeI-AlwNI, and a fragment of 660 bp was isolated. The fragments were then ligated to generate pOUR-PB-ANC which was introduced into E. coli K-12 W3110 F ^- strain and expressed high levels of active truncated uricase.

Construction of an expression plasmid for pOUR-P ^^ ks-1 uricase

This plasmid was constructed to improve the stability of the recombinant enzyme. Pig-KS-ΔΝ uricase was truncated only at the N-terminus (ΔΝ) where the N-terminal peptide of maturation of six residues was removed and contained the S46T, R291K and T301S mutations. At position 46, there was a threonine residue instead of a serine due to a conservative mutation that occurred during PCR amplification and cloning. At position 291, lysine replaced arginine, and at position 301, serine was replaced with threonine. Both residues were derived from the baboon uricase sequence. Modifications R291K and T301S are designated KS and were discussed above. The additional lysine residue provided an additional potential PEGylation site.

To construct pOUR-P-AN-ks-1 (Fig. 1), plasmid pOUR-PB-ANC was digested with ApaI XbaI and a fragment of 3873 bp was isolated. The pET-3d-PKS plasmid (construction shown in Fig. 4) was digested with ApaI-SpeI and a 270 bp fragment was isolated. Cleavage of Spel leaves the 5 'end of the CTAG protruding towards the 5' end, which was efficiently ligated to DNA fragments produced by XbaI. These two fragments were ligated to form pOUR-P-AN-ks-1. After ligation, the sites recognized by the enzymes Spel and XbaI were lost (their place is shown in parentheses in Fig. 9). Construct pour-P-AN-ks-1 was introduced into E. coli K-12 W3110 F ^-, prototroficznego, ATCC # 27325. The resulting Pig-KS-Δ KS uricase, expressed under the control of the osmB promoter, gave high levels of the recombinant enzyme having better activity and stability.

Figure 1 shows the structure of the pOUR-Ρ-ΔΝ-ks-1 plasmid. The numbers next to the restriction sites indicate the nucleotide position with respect to the HaeII site, designated I. 'Restriction sites that have been lost during cloning are indicated in parentheses. The pOUR-P-AN-ks-1 plasmid encoding Pig-KS-ΔΝ uricase is 4143 bp in length and contains the following elements:

1. A 113 bp DNA fragment extending from nucleotide number 1 to the NdeI site (at position 113), which contains the osmB promoter and the ribosome binding site (rbs).

2. A 932 bp DNA fragment extending from NdeI (at position 113) to the Spel / Xbal junction (at position 1045) which contains: 900 bp Pig-KS-ΔΝ coding region (nucleic acid sequence for the amino terminus of the truncated protein porcine uricase in which amino acids 291 and 301 are replaced with lysine, serine, respectively) and a 32 bp flanking sequence derived from pCR ™ II, from the TA cloning site upstream of the Spel / Xbal restriction site.

3. Multiple cloning sites (MCS) sequence of 25 bp from the Spel / Xbal interface (at position 1045) to HindIII (at position 1070).

4. A synthetic 40 bp oligonucleotide containing the transcription terminator TrpA (ter) with the ends HindIII (at position 1070) and AatII (at position 1110).

5. A 1519 bp DNA fragment extending from the AatII site (at position 1110) to the MscI / Scal (at position 2629) on pBR322, which contains the tetracycline resistance (TetR) gene.

6. A 1514 bp DNA fragment extending from the Scal site (at position 2629) to HaeII (at position 4143) on pBR322 which contains the origin of replication.

Figure 2 shows the DNA and deduced amino acid sequences of Pig-KS-ΔΝ uricase. In this figure, the amino acid numbering is according to the complete porcine uricase sequence. After the methionine initiation moiety, a threonine was inserted in place of aspartic acid in the porcine uricase sequence. This threonine residue allowed the removal of methionine by bacterial aminopeptidase. A gap in the amino acid sequence shows the deleted N-terminal maturation peptide. The restriction sites that were used in different stages of different subcloning are indicated

Uricase sequences (Apal, NdeI, BamHI, EcoRI and SpeI). The 3 'untranslated sequence, in lower case, was derived from the pCR ^TM II sequence. The translation stop codon is marked with an asterisk.

Figure 3 shows the alignment of the amino acid sequences of different recombinant uricase sequences. The top line shows porcine uricase which includes the complete amino acid sequence. The second line is the double-truncated chimeric porcine baboon uricase (PBC-ANC) sequence. The third line shows the sequence of the Pig-KS-ΔΝ uricase, which is only truncated at the N-terminus and contains the S46T mutations and the R291K and T301S amino acid changes, both reflecting the baboon origin of the uricase coding sequence. An asterisk indicates the position at which there are amino acid differences in Pig-KS-ΔΝ uricase compared to the published porcine uricase sequence; circles indicate positions where there are amino acid differences in Pig-KS-ΔΝ compared to PBC-ΔΝ, a pig-baboon chimera; and dashed lines indicate amino acid deletions.

Native Y97K mutant baboon, porcine and rabbit uricase cDNA and porcine / baboon chimera (PBC) were constructed for cloning in E. coli. Clones expressing high levels of uricase variants were constructed and selected such that they were all in E. coli W3110 F ^- and expression was regulated by osmB. Plasmid DNA was isolated, checked by DNA sequencing and restriction enzyme analysis, and cells were cultured.

Construction of truncated uricases including pig-ΔΝ and Pig-KS-ΔΝ was accomplished by cross-ligation between PBC-ANC and Pig-KS followed by restriction endonuclease cleavage with ApaI and XbaI and ApaI plus SpeI, respectively. It was believed that these truncated mutants would retain activity because the six N-terminal residues, the "maturation (1-2) peptide, and the C-terminal tri-peptide" peroxisome targeting signal (3-5), have no function, which significantly affects enzyme activity, and it is possible that these sequences may be immunogenic. Clones expressing very high levels of uricase were selected.

Example 2. Transformation of an expression plasmid into a bacterial host cell

An expression plasmid, pOUR-P-AN-ks-1, was introduced into you of the E. coli K-12 W3110 F ^- strain. Bacterial cells were prepared for transformation, which involved growing to the middle of the log phase in Luria buffer (LB), then the cells were harvested by centrifugation, washed with cold water and resuspended in 10% glycerol in water at a concentration of approximately 3x10 ¹⁰ cells per ml. Cells were stored in aliquots at -70 ° C. The plasmid DNA was then precipitated with ethanol and dissolved in water.

Bacterial cells and plasmid DNA were mixed and transformed using the high voltage electroporation method using the Gene Pulser II from BIO-RAD (Trevors et al. (1992). Electrotransformation of bacteria by plasmid DNA, in Guide to Electroporation and Electrofusion (DC Chang, BM Chassy, JA Saunders and AE Sowers, eds.), Pp. 265-290, Academic Press Inc., San Diego, Hanahan et al. (1991) Meth. Enzymol., 204, 63-113). Transformed cells were suspended in SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM glucose), incubated at 37 ° C for 1 hour and were selected for tetracycline resistance. High expression clones were selected.

Example 3. Production of recombinant uricase

Bacteria, such as those transformed (see above), were grown in a glucose-containing medium; The pH was maintained at 7.2 6 0.2 at about 37 ° C.

During the last 5-6 hours of culture, the medium was supplemented with KCl to a final concentration of 0.3 M. The culture was continued to allow accumulation of uricase.

Recombinant uricase accumulated in bacterial cells as an insoluble precipitate similar to inclusion bodies (IB). The cell suspension was washed by centrifugation and resuspended in 50 mM Tris buffer, pH 8.0 and 10 mM EDTA and brought to a final volume of about 40 times dry weight of the cells.

IB containing recombinant uricase was isolated by centrifugation after disrupting the bacterial cells using lysozyme and high pressure. Treatment with lysozyme (2000-3000 units / ml) was carried out for 16-20 hours at pH 8.0 and 7 ± 3 ° C with stirring. The pellet was washed with water and stored at -20 ° C until use.

Enriched IBs were processed further after resuspension in 50 mM NaHCO3 buffer, pH 10.3 0.1. The suspension was incubated overnight at room temperature to allow the IB-derived uricase to liquefy, and then clarified by centrifugation.

PL 215 285 B1

Uricase was then purified through several chromatographic steps. First, chromatography was performed on a Q-Sepharose FF column. The loaded column was washed with a bicarbonate buffer containing 150 mM NaCl and uricase was eluted with a bicarbonate buffer containing 250 mM NaCl. Xanthine Agarose (Sigma) was then used to remove minor impurities from the uricase preparation. The Q-Sepharose FF effluent was diluted with 50 mM glycine buffer, pH 10.3 0.1, to a protein concentration of about 0.25 mg / ml and applied to the column. The column was washed with bicarbonate buffer, pH 10.3 0.1, containing 100 mM NaCl, and the uricase was eluted with the same buffer supplemented with 60 μΜ xanthine. At this stage, uricase was re-purified by Q-Sepharose chromatography to remove aggregates.

The purity of each urucaase preparation is greater than 95% as assessed by molecular filtration. In each formulation, less than 0.5% of the aggregated forms were detected using the Superdex 200 column.

Table 3 summarizes the purification of Pig-KSAN uricase from IBs derived from 25 L of fermentation buffer.

T a b e l a 3. Purification of Pig-KSAN uricase

Purification step Protein (mg) Activity (unit) Specific activity (units / mg) Insoluble IB 12748 47226 3.7 Clear solution 11045 44858 4.1 Q-Sepharose I - main pot 7590 32316 4.3 Xanthine Agarose - main pot 4860 26361 5.4 Q-Sepharose II - the main pot 4438 22982 5.2 UF fraction of 30 kD 4262 27556 6.5

Example 4. Characterization of recombinant uricases on SDS-PAGE

SDS-PAGE analysis of the highly purified uricase variants (Fig. 4) showed a fairly distinguishable pattern. The samples were stored at 4 ° C in carbonate buffer, pH 10.3, for up to several months. The full-length variants Pig, Pig-KS and PBC showed the accumulation of two major degradation products having a molecular weight of about 20 and 15 kD. This observation suggests that at least a single cleavage splits the uricase subunit molecule. A different degradation pattern is detected for the amino-truncated clones and also for rabbit uricase, but in a smaller proportion. The amino terminus of rabbit resembles that of truncated clones. The amino terminal sequences of the uricase fragments generated during purification and storage were determined.

Peptide sequencing

N-terminal sequencing of large uricase preparations was performed using the Edman degradation method. Ten cycles were carried out. Recombinant Pig uricase (full length clone) gave more degradation fragments compared to Pig-KS-ΔΝ uricase. The deduced cleavage sites leading to degradation fragments are as follows:

1) Main site at position 168 having the sequence:

--QSG and FEGFI-2) Secondary site at position 142 having the sequence:

--IRN and GPPVI-The above sequences do not suggest any known proteolytic site. Nevertheless, cleavage can occur either as a result of proteolysis or some chemical reaction. The amino-truncated uricases are surprisingly more stable than the non-amino-truncated uricases. PBC-ANC also had a stability similar to other ΔΝ molecules and less than PBC without amine truncation.

Activity

Uricase activity was measured by the UV method. The rate of the enzymatic reaction was determined by measuring the reduction in absorbance at 292 nm resulting from the oxidation of uric acid to allantoin. One unit of activity is defined as the amount of uricase required for oxidation

One μmol of uric acid per minute at 25 ° C under the specified conditions. Uricase potency is expressed in activities per mg protein (U / mg).

-1 -1

The extinction coefficient of 1 mM uric acid at 292 nm is 12.2 mM ^-1 cm ^-1 . Thus, oxidation of 1 µmol of uric acid per ml of reaction mixture resulted in a decrease in absorbance of 12.2 mA292. The change in absorbance with time (ΔΑ292 per minute) was from the linear part of the curve.

Protein concentration was determined using a modified Bradford method (Macart and Gerbaut (1982) Clin Chim Acta 122: 93-101). The specific activity (potency) of uricase was calculated by dividing the activity in units / ml by the concentration in mg / ml. The results of the enzymatic activity for the various recombinant uricases are summarized in Table 4. The results of the commercial preparations are included in this table as reference values. It can be seen from these results that shortening the uricase proteins has no significant effect on their enzymatic activity.

T a b e l a 4. Summary of kinetic parameters of native uricases

Uricase Concentration ⁽¹⁾ of the stock solution (mg / ml) Specific activity (units / mg) ⁽²⁾ Km ⁽⁴⁾ ^ M uric acid) _Kcat ⁽⁵⁾ (1 / min.) Recombined The pig 0.49 7.41 4.39 905 Pig-AN 0.54 7.68 4.04 822 Pig-KS 0.33 7.16 5.27 1085 Pig-KS-AN 1.14 6.20 3.98 972 PBC 0.76 3.86 4.87 662 PBC-ANC 0.55 3.85 4.3 580 Rabbit 0.44 3.07 4.14 522 Native The pig (Sigma) 2.70 3.26 ⁽³⁾ 5.85 901 A.flavus 9merck) 1.95 0.97 ⁽³⁾ 23.54 671

Notes to Table 4:

(1) Protein concentration was determined by absorbance measured at 278 nm using an extinction coefficient of 11.3 for a 10 mg / ml uricase solution (Mahler, 1963).

(2) 1 unit of uricase activity is defined as the amount of enzyme which oxidizes 1 µmol of uric acid to allantoin per minute at 25 ° C.

(3) Specific activity values were taken from Lineweaver-Burk plots at a substrate concentration of 60 µΜ.

(4) The reaction mixtures consisted of various combinations of the following stock solutions

100 mM sodium borate buffer, pH 9.2

300 μΜ uric acid in 50 mM sodium borate buffer, pH 9.2 mg / ml BSA in 50 mM sodium borate buffer, pH 9.2 (5) Kcat was calculated by dividing Vmax (calculated from the corresponding Lineweaver-Burk plots) by uricase concentration in the reaction mixture (expressed in molar equivalents, based on the molecular weight of the tetrameric uricases).

Example 5. Conjugation of uricase with m-PEG (PEGylation)

Pig-KS-ΔΝ uricase was coupled using m-PEG-NPC (monomethoxypoly (ethylene glycol) nitrophenyl carbonate). Conditions were established to result in 2 - 12 strands of 5, 10 or 20 kD PEG per uricase subunit. m-PEG-NPC was gradually added to the protein solution. After the addition of PEG was complete, the uricase / m-PEG-NPC reaction mixture was incubated at 2-8 ° C for 16-18 hours until the maximum number of unbound m-PEG strands were attached to the uricase.

PL 215 285 B1

The number of PEG strands per PEG uricase monomer was determined by size exclusion chromatography (SEC) on Superose 6 using PEG and uricase as standards. The number of PEG strands bound per subunit was determined using the following equation:

PEG strands 3.42 x Amount of PEG in injected sample ^ g) / subunit = Amount of protein in injected sample ^ g)

The concentration of PEG and protein residues in the PEG-uricase sample was determined by molecular filtration (SEC) using ultraviolet (UV) and refractive index (RI) detectors in series (developed by Kunitani et al., 1991). Three calibration curves were generated: protein curve (absorption measured at 220 nm); protein curve (measured by RI) and PEG curve (measured by RI). The PEG-uricase samples were then analyzed using the same system. The resulting area values under the UV and RI peaks of the experimental samples were used to calculate the PEG and protein concentrations against the calibration curves. The factor 3.42 is the ratio of the molecular weight of the uricase monomer (34192 Daltons) to the weight of the 10 kD PEG.

The addition of PEG improved the solubility of uricase in solutions having physiological pH values. Table 5 shows the lot-to-lot variation of the PEGylated uricase Pig-KS-ΔΝ. In general, there is an inverse ratio between the number of PEG strands attached and the specific activity (SA) of the enzyme retained.

T a b e l a 5

Enzymatic activity of PEGylated uricase Pig-KS-ΔΝ conjugates

Conjugate lots PEG MW (kD) PEG threads for under- uricase unit SA uricase (U / mg) SA-percent control Pig-KS-AN - - 8.2 100 1-17 # 5 9.7 5.8 70.4 LP-17 10 2.3 7.8 94.6 1-15 # 10 5.1 6.4 77.9 # 13 10 6.4 6.3 76.9 # 14 10 6.5 6.4 77.5 5-15 # 10 8.8 5.4 65.3 5-17 # 10 11.3 4.5 55.3 4-17 # 10 11.8 4.4 53.9 1-18 # twenty 11.5 4.5 54.4

Example 6. PEGylation of uricase by PEG 1000 D and 100000 D

Pig-KS-ΔΝ uricase was combined with m-PEG-NPC 1000 D and 100000 D as described in Example 5. The conditions used were to obtain 2-11 strands of PEG per uricase subunit. After the addition of PEG was complete, the uricase / m-PEG-NPC reaction mixture was incubated at 2-8 ° C for 16-18 hours until the maximum number of unbound m-PEG strands attached to the uricase.

The number of PEG strands per PEG uricase monomer was determined as described above.

The addition of PEG improved the solubility of uricase in solutions having physiological pH values.

Example 7. Pharmacokinetics of Pig-KS-AN uricase linked to PEG

Biological experiments were performed to determine the optimal extent and amount of PEGylation necessary to deliver a therapeutic benefit.

Pharmacokinetic studies in rats using intravenous (IV) injection of 0.4 mg (2 U) per kg body weight of unmodified uricase on Day 1 and Day 8 resulted in a circulating half-life of approximately 10 minutes. However, a study of the clearance rate in rats for 2-11x10 kD PEG-Pig-KS-ΔΝ uricase, followed by as many as 9 weekly injections, indicated that clearance was independent of PEG strand count (within this range) and remained relatively constant throughout the study period ( see Table 6; with a half-life of approximately 30 hours). The week to week differences are in terms of experimental error. The same pattern is seen after nine injections of the 10x5kD PEG- and 10x20kD PEG-uricase conjugates. The results indicate that in the rat model, regardless of the degree of PEGylation of uricase in this range, similar biological effects were observed.

PL 215 285 B1

T a b e l a 6. Half-lives of PEGylated uricase Pig-KS-ΔΝ preparations in rats

Degree of modification (PEG strands per uricase subunit) 5kD PEG 10kD PEG 20kD PEG Week 10x 2x 5x 7x 9x 11x 10x 1 25.7 ± 1.7 29.4 ± 3.4 37.7 ± 3.1 37.6 ± 3.9 36.9 ± 4.3 31.4 ± 4.3 21.6 ± 1.5 (5) (5) (5) (5) (5) (5) (5) 2 26.7 ± 3.0 28.4 ± 1.6 (5) (5) 3 27.5 ± 3.8 29.0 ± 2.6 29.9 ± 11.7 32.7 ± 11.1 26.3 ± 4.7 11.8 ± 3.3 14.5 ± 2.7 (5) (5) (5) (5) (5) (5) (5) 4 27.1 ± 5.3 18.4 ± 2.2 19.7 ± 5.6 (5) (4) (4) 5 28.6 ± 1.7 22.5 ± 2.7 34.4 ± 3.9 37.3 ± 3.0 30.4 ± 3.6 30.5 ± 1.3 19.3 ± 2.5 (5) (5) (4) (5) (5) (5) (5) 6 35.4 ± 3.1 27.1 ± 3.6 30.7 ± 2.9 (14) (13) (13) 7 16.5 ± 4.9 32.5 ± 4.3 16.12 ± 2.7 25.8 ± 2.5 (5) (5) (5) (5) 8 - - - - - - - 9 36.8 ± 4.0 28.7 ± 2.7 34.0 ± 2.4 24.2 ± 3.4 31.0 ± 2.6 29.3 ± 1.4 26.7 ± 0.5 (15) (15) (13) (13) (13) (15) (15)

Notes to Table 4:

The results are indicated in hours ± standard errors of the mean. The numbers in parentheses indicate the number of animals tested.

Rats received weekly i.v. injections of 0.4 mg per kg body weight of Pig-KS-ΔΝ uricase modified as indicated in the table. Each group originally consisted of 15 rats that were bled sequentially in subgroups of 5. Several rats died during this study due to anesthesia. Half-life was determined by measuring uricase activity (colorimetric assay) in plasma samples collected at 5 minutes, 6, 24 and 48 hours after injection.

Table 5 describes the lots of PEGylated uricase used in these studies.

A study of the bioavailability of 6x5 kD PEG-Pig-KS ^ N uricase in rabbits indicates that after the first injection, the circulating half-life is 98.2 ± 1.8 hours (iv) and bioavailability after intramuscular (im) and subcutaneous (sc) injection. ) was 71% and 52% respectively. However, significant titers of anti-uricase antibody were detected after the second i.m injection. go. in all rabbits and clearance was accelerated after subsequent injections. Injection of the rats with the same conjugates resulted in a half-life of 26 ± 1.6 hours (i.v.) and bioavailability after i.m. injection. go. was 33% and 22% respectively.

Studies in rats with 9x10 KD PEG-Pig-KS-ΔΝ uricase indicate a circulating half-life after the first injection at 42.4 hours (i.v.) and bioavailability after i.m. injection. go. was 28.9% and 14.5% respectively (see Fig. 5 and Table 7). After the fourth injection, the circulating half-life was 32.1 ± 2.4 hours and the bioavailability after i.m. injection. go. was 26.1% and 14.9%, respectively.

Similar pharmacokinetic studies in rabbits for 9x10 kD PEG-Pig-KS-ΔΝ uricase indicate that no accelerated clearance was observed after injection of this conjugate (4 injections every two weeks were given). In these animals, the circulating half-life after the first injection was 88.5 hours (i.v.) and the bioavailability after i.m. injection. go. it was 98.3% and 84.4%, respectively. (see Fig. 6 and Table 7). After the fourth injection, the circulating half-life was 141.1 ± 15.4 hours and the bioavailability after i.m. injection. go. was 85% and 83% respectively.

Similar pharmacokinetic studies for 9x10 kD PEG-Pig-KS-ΔΝ uricase were performed to test the bioavailability in beagle dogs (2 male and 2 female in each group). Period

The circulating half-lives were recorded as 70 ± 11.7 hours after the first i.v. injection and the bioavailability after i.m. injection. go. it was 69.5% and 50.4%, respectively (see Fig. 7 and Table 7).

A study with 9x10 kD PEG-Pig-KS-ΔΝ uricase preparations was performed in pigs. Three animals per group were used for IV, s.c. administration. and them. The circulating half-life was recorded as 178 ± 24 hours after the first i.v. injection and the bioavailability after i.m. injection. go. it was 71.6% and 76.8%, respectively (see Fig. 8 and Table 7).

T a b e l a 7. Pharmacokinetic studies with uricase 9x10 kD PEG-Pig-KS-ΔΝ

Injection # Half-life (hours) Bioavailability i.v. them. s.c. Rats 1 42.4 ± 4.3 28.9% 14.5% 2 24.115.0 28.9% 14.5% 4 32.1 ± 2.4 26.1% 14.9% Rabbits 1 88.5 ± 8.9 98.3% 84.4% 2 45.7 ± 40.6 100% 100% 4 141.1 ± 15.4 85% 83% Dogs 1 70.0 ± 11.7 69.5% 50.4% Pigs 1 178 ± 24 71.6% 76.8%

Absorption, distribution, metabolism, and excretion (ADME) studies were performed after iodination of 9x10 kD PEG-Pig-KS-ΔΝ uricase using

125 the Bolton & Hunter method using ¹²⁵ I. The labeled conjugate was injected into 7 groups, each of 4 rats (2 male and 2 female). Radioactivity distribution was analyzed after 1 hour and every 24 hours for 7 days (except day 5). Each group was consecutively sacrificed and the various organs excised and analyzed. The seventh group was housed in a metabolic cage from which urine and faeces were collected. The distribution of the material in the animal's body was assessed by measuring the total radioactivity in each organ and the fraction of counts (kidney, liver, lung and spleen) that was available for TCA inclusion (i.e. bound protein, normalized to organ size). Of the organs that were excised, none had a higher specific radioactivity than the others, and thus no significant accumulation was observed, for example in liver or kidney. 70% of the radioactivity was excreted by day 7.

P r z k ł a d 8. Results of clinical tests

Randomized, open-label, multicentre, parallel group studies were conducted to investigate urate response and the safety profiles of PEG-uricase (Puricase®, Savient Pharmaceuticals) in human patients with hyperuricemia and acute gout who were unresponsive to or intolerant to conventional therapy. The mean duration of illness was 14 years and 70 percent of the study population had one or more tophi.

In this study, 41 patients (mean age 58.1 years) were randomized to 12 weeks of treatment with intravenous PEG-uricase in one of four dosing regimens: 4 mg every two weeks (7 patients); 8 mg every two weeks (8 patients); 8 mg every two weeks (13 patients); or 12 mg every four weeks (13 patients). Plasma uricase activity and urate levels were measured at specified intervals. Pharmacokinetic parameters, mean plasma urate concentration and percent of time plasma urate was less than or equal to 6 mg / dL were derived from analyzes of uricase activity and urate levels.

PL 215 285 B1

Patients who received 8 mg of PEG-uricase every two weeks had a greater reduction

PUA, with levels below 6 mg / dL for 92 percent of the treatment time (pre-treatment plasma urate 9.1 mg / dL vs. mean plasma urate 1.4 mg / dL over 12 weeks).

Sustained and sustained lower plasma urate levels were also observed in other dose groups with PEG-uricase treatment: PUA less than 6 mg / ml for 86 percent of treatment time in the 8 mg every four weeks group (pre-treatment plasma urate 9.1 mg / dL vs. mean plasma urate 1.4 mg / dL over 12 weeks); PUA less than 6 mg / ml for 84 percent of treatment time in the 12 mg every four weeks group (pre-treatment plasma urate 8.5 mg / dl vs. mean plasma urate level of 2.6 mg / dl over 12 weeks) and PUA below 6 mg / ml for 73 percent of treatment in the 4 mg every four weeks group (pre-treatment plasma urate level 7.6 mg / dL vs. mean plasma urate level 4.2 mg / dL over 12 weeks).

The maximum percent reduction in plasma uric acid from baseline during the first 24 hours of PEG-uricase dosing was 72% for subjects receiving 4 mg / 2 weeks (p is 0.0002); 94% for subjects receiving 8 mg / 2 weeks (p less than 0.0001); 87% for subjects receiving 8 mg / 4 weeks (p less than 0.0001); and 93% for subjects receiving 12 mg / 4 weeks (p less than 0.0001).

The percent reduction in plasma uric acid from baseline over the 12-week treatment period was 38% for subjects receiving 4 mg / 2 weeks (p is 0.0002); 86% for subjects receiving 8 mg / 2 weeks (p less than 0.0001); 58% for subjects receiving 8 mg / 4 weeks (p less than 0,0001); and 67% for subjects receiving 12 mg / 4 weeks (p less than 0.0001).

Surprisingly, some people receiving PEG-uricase experienced infusion-related side effects, ie infusion reactions. These reactions occurred in 14% of all infusions.

All references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

Many modifications and variations of the present invention can be made without departing from the spirit and scope of the invention, as will be apparent to those skilled in the art. The specific embodiments described herein are provided by way of example only and the invention is to be limited only by the appended claims, including the full scope of the equivalents to which those claims pertain.

PL 215 285 B1

Sequence Listing <110> Savient Pharmaceuticals, Inc.

Hartman, 3acob Mendelovitz, Simona <120> Uricase variants and their use <130> 103864-146638 <150> US 60 / 670,573 <151> 2005-04-11 <160> 16 <170> Patentln version 3.3 <210> 1 <211> 36 <212> DNA <213> Dummy <22O>

<223> porcine liver uricase (meaningful) <400> 1 gcgcgaattc catggctcat taccgtaatg actaca 36 <210> 2 <211> 40 <212> DNA <213> Artificial sequence <220>

<223> Pig liver uricase (antisense) <400> 2 gcgctctaga agcttccatg gtcacagcct tgaagtcagc 40 <210> 3 <211> 35 <2ł2> DNA <213> Artificial sequence <220>

<223> baboon liver uricase (D3n) (sensible) <400> 3 gcgcgaattc catggcccac taccataaca actat 35 <210> 4 <211> 40 <212> DNA <213> Artificial sequence <22O>

<223> baboon liver uricase (D3H) (antisense) <400> 4 gcgcccatgg tctagatcac agtcttgaag acaacttcct 40 <210> 5 <211> 36 <212> DNA <213> Artificial sequence

PL 215 285 B1 <220>

<223> PBC-DeltaNC uricase (sensible) <400> 5 gcgcatatga cttacaaaaa gaatgatgag gtagag 36 <210> 6 <211> 54 <212> DNA <213> Dummy <22O>

<223> PBC-DeltaNC uricase (antisense) <400> 6 ccgtctagat taagacaact tcctcttgac tgtaccagta atttttccgt atgg 54 <21O> 7 <211> 299 <212> PRT <213> Artificial sequence <22O>

<223> Pig-KS-DeltaN <400> 7

Met Thr 1 Tyr Lys Lys 5 Asn Asp Glu Val Glu Phe Val 10 Arg Thr Gly 15 Tyr Gly Lys Asp Underworld twenty How much Lys Val Leu Hi 5 25 how much Gin Arg Asp Gly thirty Lys Tyr HIS Cheese how much Lys Glu Val Ala Thr Thr val Gin Leu Thr Leu Cheese Cheese 35 40 45 Lys Lys Asp Tyr Leu Hi s Gly Asp Asn Cheese Asp val how much pro Thr ASP 50 55 60 Thr how much Lys Asn Thr val Asn Val Leu Ala Lys Phe Lys Gly how much Lys 65 70 75 80 Cheese How much Glu Thr Phe Ala val Thr how much Cys Glu His Phe Leu Cheese Cheese 85 90 95 phe Lys His Val how much Arg Ala Gin val Tyr Val Glu Glu Val Pro Trp 100 105 110 Lys Arg Phe Glu Lys Asn Gly val Lys His val HIS Ala Phe How much Tyr 115 120 125 Thr pro Thr Gly Thr His Phe Cys Glu Val Glu Gin How much Arg Asn Gly 130 135 140 Pro Pro val How much Hi S Cheese Gly how much Lys Asp Leu Lys Val Leu Lys Thr 145 150 155 160

PL 215 285 B1

Thr Main Cheese Gly Phe 165 Glu Gly Phe how much Lys 170 Asp Main Phe Thr Thr 175 Leu Pro Glu val Lys ASP Arg Cys Phe Ala Thr Main Val Cys Lys Trp 180 185 190 Arg Tyr Hi s Main Gly Arg Asp Val Asp Phe Glu Ala Thr Trp Asp Thr 195 200 205 Val Arg Cheese how much val Leu Main Lys Phe Al a Gly Pro Tyr Asp Lys Gly 210 215 220 Glu Tyr cheese pro cheese Va1 Main Lys Thr Leu Tyr ASP He Main val Leu 225 230 235 240 Thr Leu Gly Main val Pro Glu How much Glu Asp vet Glu how much Cheese Leu Pro 245 2 50 255 Asn how much His Tyr Leu Asn ll e Asp Underworld Cheese Lys Underworld Gly Leu how much Asn 260 265 270 Lys Glu Glu val teu Leu Pro Leu Asp Asn Pro Tyr Gly thousand How much Thr 275 280 285 Gly Thr val Lys Arg Lys Leu Cheese cheese Arg Leu

290 295 <210> 8 <211> 298 <212> PRT <213> artificial sequence <22O>

<223> Pig-KS-DeltaN without starting Met <400> 8

Thr Tyr Lys 1 Lys Asn 5 Asp Glu val Glu Phe Val Arg Thr 10 Gly Tyr 15 Gly Lys ASP Underworld How much Lys val Leu HIS how much Main Arg Asp Gly Lys Tyr Hi s twenty 25 thirty Cheese how much Lys Glu val Ala Thr Thr val Main Leu Thr Leu Cheese Cheese Lys 35 40 45 Lys Asp Tyr Leu His Gly Asp Asn cheese Asp val How much Pro Thr Asp Thr 50 55 60 How much Lys Asn Thr Val Α5Π val Leu Ala Lys Phe Lys Gly How much Lys Cheese 65 70 75 80 How much Glu Thr Phe Ala val Thr how much Cys Glu His Phe Leu Cheese Cheese Phe 85 90 95

PL 215 285 B1

Lys HIS val how many Arg Ala Gin val Tyr Val Glu Glu val Pro Trp Lys 100 105 Arg Phe Glu Lys Asn Gly val Lys His val His Ala Phe how much Tyr Thr 115 120 125 Pro Thr Gly Thr Hi s phe cys Glu val Glu Gin how much Arg Asn Gly pro 130 135 140 Pro Val how much His Cheese Gly how much Lys Asp Leu Lys val Leu Lys Thr Thr 145 150 155 160 Gin Cheese Gly Phe Glu Gly Phe how much Lys Asp Gin Phe Thr Thr Leu Pro 165 170 175 Glu val Lys Asp Arg Cys Phe Ala Thr Gin val Tyr cys Lys Trp Arg 180 185 190 Tyr His Gin 195 Gly Arg Asp val Asp 200 Phe Gl u Ala Thr Trp 205 ASp Thr Val Arg cheese How much val Leu Gin Lys Phe Ala Gly Pro Tyr Asp Lys Gly Glu 210 215 220 Tyr Cheese pro Cheese Val Gin Lys Thr Leu You Asp how much Gin Val Leu Thr 225 230 235 240 Leu Gly Gin Val Pro Glu How much Glu Asp Underworld Glu how much Cheese Leu Pro Asn 245 250 255 how much His Tyr Leu Asn how much Asp Underworld Cheese Lys Underworld Gly Leu How much Asn Lys 260 265 270 Glu Glu val Leu Leu Pro Leu Asp Asn Pro Tyr Gly Lys How much Thr Gly 275 280 285 Thr Val Lys Arg Lys Leu Cheese Cheese Arg Leu 290 295

<210> 9 <213> 897 <212> DNA <213> Dummy <22O>

<223> Pig-KS-DeltaNA <400> 9 atgacttaca aaaagaatga tgaggtagag tttgtccgaa ctggctatgg gaaggatatg 60 ataaaagttc tccatattca gcgagatgga aaatatcaca gcattaaaga ggtggacaaccagtggacaaccaggtgacaactggatctaaga cagtgacaga 180 acagtgacaa

PL 215 285 B1

atccctacag acaccatcaa gaacacagtt aatgtcctgg cgaagttcaa aggcatcaaa 240 agcatagaaa cttttgctgt gactatctgt gagcatttcc tttcttcctt caagcatgtc 300 atcagagctc aagtctatgt ggaagaagtt ccttggaagc gttttgaaaa gaatggagtt 360 aagcatgtcc atgcatttat ttatactcct actggaacgc acttctgtga ggttgaacag 420 ataaggaatg gacctccagt cattcattct ggaatcaaag acctaaaagt cttgaaaaca 480 acccagtctg gctttgaagg attcatcaag gaccagttca ccaccctccc tgaggtgaag 540 gaccggtgct ttgccaccca agtgtactgc aaatggcgct accaccaggg cagagatgtg 600 gactttgagg ccacctggga cactgttagg agcattgtcc tgcagaaatt tgctgggccc 660 tatgacaaag gcgagtactc gccctctgtc cagaagacac tctatgacat ccaggtgctc 720 accctgggcc aggttcctga gatagaagat atggaaatca gcctgccaaa tattcactac 780 ttaaacatag acatgtccaa aatgggactg atcaacaagg aagaggtctt g _ctaccttta 840 gacaatccat atggaaaaat tactggtaca gtcaagagga agttgtcttc aagactg 897 <210 »10 <211 »894 <212 »DNA <213 »Artificial sequence <220> <223 »Pig-KS-DeltaN without starting ATG <400 »10 acttacaaaa agaatgatga ggtagagttt gtccgaactg gctatgggaa ggatatgata 60 aaagttctcc atattcagcg agatggaaaa tatcacagca ttaaagaggt ggcaactaca 120 gtgcaactga ctttgagctc caaaaaagat tacctgcatg gagacaattc agatgtcatc 180 cctacagaca ccatcaagaa cacagttaat gtcctggcga agttcaaagg catcaaaagc 240 atagaaactt ttgctgtgac tatctgtgag catttccttt cttccttcaa gcatgtcatc 300 agagctcaag tctatgtgga agaagttcct tggaagcgtt ttgaaaagaa tggagttaag 360 catgtccatg catttattta tactcctact ggaacgcact tctgtgaggt tgaacagata 420 aggaatggac ctccagtcat tcattctgga atcaaagacc taaaagtctt gaaaacaacc 480 cagtctggct ttgaaggatt catcaaggac cagttcacca ccctccctga ggtgaaggac 540 cggtgctttg ccacccaagt gtactgcaaa tggcgctacc accagggcag agatgtggac 600 tttgaggcca cctgggacac tgttaggagc attgtcctgc agaaatttgc tgggccctat 660 gacaaaggcg agtactcgcc ctctgtccag aagacactct atgacatcca ggtgctcacc 720 ctgggccagg ttcctgagat agaagatatg gaaatcagcc tgccaaatat tcactactta 780 aacatagaca tgtccaaaat gggactgatc aacaaggaag aggtcttgct acctttagac 840 aatccatatg gaaaaattac tggtacagtc aagaggaagt tgtcttcaag actg 894

<210 »11 <211> 304 <212» PRT <213 »Sus scrofa

PL 215 285 B1 <400> 11

Underworld Ala His Tyr Arg Asn Asp Tyr Lys Lys Asn Asp Glu Val Glu Phe Ł 5 10 15 val Arg Thr Gly twenty Tyr Gly Lys ASP Underworld 25 how much Lys val Leu His thirty how much Gl n Arg Asp Gly 35 Lys Yy p His Cheese how much 40 Lys Glu Val Ala Thr 45 cheese val Main Leu Thr Leu Cheese Cheese thousand Lys Asp Yy f Leu His Gly Asp Asn Cheese Asp 50 55 60 val How much Pro Thr Asp Thr how much Lys Asn Thr Val Asn val Leu Ala Lys 65 70 75 80 Phe Lys Gly How much Lys cheese How much Glu Thr Phe Ala val Thr how much Cys Glu 85 90 95 Hi s Phe Leu Cheese Cheese Phe Lys His val li e Arg Ala Main val Tyr val 100 105 110 Glu Glu val Pro Trp Lys Arg Phe Glu Lys Asn Gly Val Lys His Val 115 120 125 His Ala Phe How much Tyr Thr Pro Thr Gly Thr His Phe Cys Glu Val Glu 130 135 140 Main How much Arg Asn Gly Pro pro val how much His Cheese Gly how much Lys Asp Leu 145 150 155 160 Lys Val Leu Lys Thr Thr Main Cheese Gly Phe Glu Gly Phe How much Lys Asp 165 170 175 Main Phe Thr Thr Leu Pro Glu val Lys Asp Arg Cys Phe Ala Thr Main 180 185 190 Val Tyr cys Lys Trp Arg Tyr His Gin Gly Arg Asp val Asp Phe Glu 195 200 205 Ala Thr Trp Asp Thr val Arg Cheese How much Val Leu Main Lys Phe Ala Gly 210 215 220 Pro Tyr Asp Lys Gly Glu Tyr Cheese Pro Cheese Val Main Lys Thr Leu Tyr 225 230 235 240 Asp how much Main val Leu Thr Leu Gly Main va1 Pro Glu how much Glu Asp Underworld 245 250 255 Glu how much Cheese Leu Pro Asn How much His Tyr Leu Asn How much Asp Underworld Cheese Lys 260 265 270

PL 215 285 B1

Underworld Gly Leu Asn Lys Gl U Glu val Leu Leu Pro Leu Asp Asn Pro 275 280 285 Tyr Gly Arg how much Thr Gly Thr val Lys Arg Lys Leu Thr Cheese Arg Leu 290 295 300

<210> 12 <211> 296 <212> PRT <213> Dummy sequence

<22O> <223> PBC-DeltaNC <400> 12 Met Thr Tyr Lys Lys Asn Asp Glu val Glu Phe val Arg Thr Gly Tyr 15 10 15 Gly thous Asp Met ile Lys val Leu His Ile Gin Arg Asp Gly Lys Tyr 20 25 30 His Ser ile Lys Glu Va1 Ala Thr Thr Val Gin Leu Thr Leu Ser Ser 35 40 45 Lys Lys Asp Tyr Leu His Gly Asp Asn Ser Asp Val Ile Pro Thr Asp 50 55 60 Thr how many Lys Asn Thr val Asn val Leu Ala Lys Phe thousand Gly how many Lys 65 70 75 80 Ser ile Glu Thr Phe Ala Val Thr Ile Cys Glu His Phe Leu Ser Ser 85 90 95 Phe Lys His Va1 ile Arg Ala Gin Val Tyr val Glu Glu val Pro Trp 100 105 110 Lys Arg Phe Glu Lys Asn Gly val Lys His Val His Ala Phe Ile Tyr 115 120 125 Thr Pro Thr Gly Thr His Phe Cys Glu val Glu Gin ile Arg Asn Gly 130 135 140 Pro Pro val ile His Ser Gly ile Lys Asp Leu Lys val Leu Lys Thr 145 150 155 160 Thr Gin Ser Gly Phe Glu Gly Phe ile Lys Asp Gin Phe Thr Thr Leu 165 170 175 Pro Glu val Lys Asp Arg Cys Phe Ala Thr Gin val Tyr cys Lys Trp 180 185 190 Arg Tyr His Gin Gly Arg Asp Val Asp Phe Glu Ala Thr Trp Asp Thr

PL 215 285 B1

195 200 205

Val Arg Cheese Ile Val 210 Leu Gln Lys Phe Ala Gly Pro Tyr Asp Lys Gly 215 220 Glu Tyr Cheese Pro Cheese Val Main Lys Thr Leu Tyr Asp how much Main val Leu 225 230 235 240 cheese Leu Cheese Arg val Pro Glu how much Glu ASp Underworld Glu how much cheese Leu pro 245 250 255 Asn How much His Tyr Phe Asn how much Asp Underworld Cheese Lys Underworld Gly Leu How much Asn 260 265 270 Lys Glu Glu Val Leu Leu Pro Leu Asp Asn Pro Tyr Gly Lys How much Thr 275 280 285 Gly Thr val Lys Arg Lys Leu Cheese 290 295

<210> 13 <211> 295 <212> PRT <213> Dummy <22O>

<223> PBC-DeltaNC without starting Met <400> 13

Thr Tyr Lys Lys 1 Asn Asp 5 Glu va! Glu Phe val Arg Thr Gly Tyr Gly 10 15 Lys Asp Underworld How much twenty Lys val Leu His how much 25 Main Arg Asp Gly Lys thirty Tyr Hi s Cheese how much Lys Glu val Ala Thr Thr va1 Main Leu Thr Leu Cheese Cheese Lys 35 40 45 Lys ASp 50 py p Leu His Gly Asp 55 Asn cheese Asp val How much 60 Pro Thr Asp Thr How much Lys Asn Thr val Asn val Leu Ala Lys Phe Lys Gly how much Lys Cheese 65 70 75 80 How much Glu Thr phe Ala Va1 Thr how much cys Glu His phe Leu Cheese Cheese phe 85 90 95 Lys His Val how much Arg Ala Main val Tyr val Glu Gl u val pro Trp Lys 100 105 110 Arg Phe Glu Lys Asn Gly val Lys His Val His Ala Phe how much Tyr Thr 115 120 125

PL 215 285 B1

pro Thr 130 Gly Thr His phe Cys Glu 135 val Glu Gin how much 140 Arg Asn Gly pro pro val how much His Cheese Gly How much Lys Asp Leu Lys Val Leu Lys Thr Thr 145 150 155 160 Gin Cheese Gly Phe Glu Gly Phe How much Lys Asp Gin Phe Thr Thr Leu Pro 165 170 175 Glu val Lys Asp Arg cys Phe Ala Thr Gl n val Tyr Cys Lys Trp Arg 180 185 190 Tyr Hi s Gin 195 Gly Arg Asp Val Asp 200 Phe Glu Ala Thr Trp 205 Asp Thr Val Arg Cheese how much val Leu Gin Lys Phe Al a Gly Pro Tyr Asp Lys Gly Glu 210 215 220 Tyr Cheese Pro Cheese val Gin Lys Thr Leu Tyr Asp How much Gin Va1 Leu Cheese 225 230 235 240 Leu Cheese Arg Val Pro Glu how much Gl u Asp Underworld Glu How much Cheese Leu Pro Asn 245 250 255 How much His Tyr phe 260 Asn how much Asp Underworld cheese 265 Lys Underworld Gly Leu how much 270 Asn Lys Glu Glu Val Leu Leu Pro Leu Asp Asn Pro Tyr Gly Lys How much Thr Gly 275 280 285 Thr Yal Lys Arg Lys Leu Cheese 290 295

<210> 14 <211> 13 <212> PRT <213> Dummy <22O>

<223> PBC-DeltaNC (Fragment 44-56 of PBC-DeltaNC) <400> 14

Ala Thr Thr Val Gin Leu Thr Leu Ser Ser Lys Lys Asp 1 5 10 <210> 15 <211> 936 <212> DNA <213> Papio hamadryas (hamadryas baboon) <400> 15 ccagaagaaa atggccgact accataacaa ctataaaaag aatgatgaat tggcgatgtg 60cagttgactgtg atatggtaaa agttctccat attcagcgag atggaaaata 120 tcacagcatt aaagaggtgg caacttcagt gcaacttact ctgagttcca aaaaagatta 180

PL 215 285 B1

cctgcatgga gataattcag atatcatccc tacagacacc atcaagaaca cagttcatgt 240 cttggcaaag tttaagggaa tcaaaagcat agaagccttt ggtgtgaata tttgtgagta 300 ttttctttct tcttttaaec atgtaatccg agctcaagtc tacgtggaag aaatcccttg 360 gaagcgtctt gaaaagaatg gagttaagca tgtccatgca tttattcaca ctcccactgg 420 aacacacttc tgtgaagttg aacaactgag aagtggaccc cccgtcatta cttctggaat 480 caaagacctc aaggtcttga aaacaacaca gtctggattt gaaggtttca tcaaggacca 540 gttcaccacc ctccctgagg tgaaggaccg atgctttgcc acccaagtgt actgcaagtg 600 gcgctaccac cagtgcaggg atgtggactt cgaggctacc tggggcacca ttcgggacct 660 tgtcctggag aaatttgctg ggccctatga caaaggcgag tactcaccct ctgtgcagaa 720 gaccctctat gatatccagg tgctctccct gagccgagtt cctgagatag aagatatgga 780 aatcagcctg ccaaacattc actacttcaa tatagacatg tccaaaatgg gtctgatcaa 840 caaggaagag gtcttgctgc cattagacaa tccatatgga aaaattactg gtacagtcaa 900 gaggaagttg tcttcaagac tgtgacattg tggcca 936

<210> 16 <211> 304 <212> PRT <213> Paplo hamadryas (hamadryas baboon) <400> 16

Underworld 1 Ala Asp Tyr HIS 5 Asn Asn Tyr Lys Lys Asn Asp Glu Leu Glu Phe 10 15 Val Arg Thr Gly twenty Tyr Gly Lys Asp Underworld 25 val Lys val Leu His thirty how much Gin Arg Asp Gly Lys Tyr His Cheese how much Lys Glu Val Ala Thr Cheese Val Gin 35 40 45 Leu Thr Leu Cheese Cheese thousand Lys Asp Tyr Leu Hi s Gly Asp Asn Cheese Asp 50 55 60 How much How much Pro Thr Asp Thr How much Lys Asn Thr Val His val Leu Ala Lys 65 70 75 80 Phe Lys Gly How much Lys Cheese ll e Glu Ala Phe Gly Val Asn How much Cys Glu 85 90 95 Tyr phe Leu Cheese Cheese Phe Asn His val how much Arg Ala Gin Val Tyr Val 100 105 110 Glu Glu how much Pro Trp Lys Arg Leu Glu Lys Asn Gly val Lys Hi s val 115 120 125 His Ala Phe how much His Thr Pro Thr Gly Thr His Phe Cys Glu Val Glu 130 135 140

PL 215 285 B1

Gin 145 Leu Arg Gly cheese Pro 150 Pro Val How much Thr Gly Ile Cheese 155 Lys Asp Leu 160 Lys val Leu Lys Thr r * Gin cheese Gly phe Glu Gly phe how much Lys Asp 165 170 175 Gin Phe Thr Thr Leu Pro Glu Val Lys Asp Arg Cys Phe Ala Thr Gin 180 185 190 va1 Tyr Cys 195 Lys Trp Arg Tyr His 200 Gin Cys Arg Asp val 205 ASP Phe Glu Ala Thr Trp Gly Thr how much Arg Asp Leu val Leu Glu Lys Phe Ala Gly 210 215 220 Pro Tyr ASP Lys Gl y Gl u Tyr Cheese Pro Cheese Val Gin Lys Thr Leu Tyr 225 230 235 240 ASP how much Gin val Leu Cheese Leu Cheese Arg val Pro Glu How much Glu Asp Underworld 245 250 255 Glu how much Cheese Leu Pro Asn how much His Tyr Phe Asn how much Asp Underworld Cheese Lys 260 265 270 Underworld Gly Leu How much Asn Lys Glu Glu val Leu Leu pro Leu ASP Asn Pro 275 280 285 Tyr Gly Lys How much Thr Gly Thr Val Lys Arg Lys Leu Cheese Cheese Arg Leu 290 295 300

Patent claims

Claims (34)

Patent claims 1. Isolated, truncated mammalian uricase characterized by being truncated at the amino terminus or at the carboxyl terminus, or at both the amino and carboxyl terminus, by 1-6 amino acids and additionally includes an amino acid substitution with threonine at position 7 (D7T), an amino acid substitution threonine at position 46 (S46T), amino acid substitution with lysine at position 291 (R291K), and amino acid substitution with serine at position 301 (T301S), and the amino acid truncation and substitution are relative to porcine uricase with the amino acid sequence of SEQ. ID NO. 11. 2. Isolated truncated mammalian uricase according to claim 1; The composition of claim 1, further comprising the amino terminal amino acid which is alanine, glycine, proline, serine or threonine. 3. Isolated truncated mammalian uricase according to claim 3; The method of claim 2, wherein the amino terminal amino acid is threonine. 4. Isolated truncated mammalian uricase according to claim 1; The method of claim 3, characterized in that it comprises the amino acid sequence shown in SEQ ID NO: 8. 5. Isolated truncated mammalian uricase according to any one of claims 1 to 5; 1-4, characterized in that it is bonded to a polymer. 6. A polyethylene glycol uricase conjugate comprising an isolated, truncated mammalian uricase as defined in any one of Claims 1 to 6. from 1 to 4. 7. The conjugate of claim 1 The method of claim 6, comprising from 2 to 12 polyethylene glycol molecules for each uricase subunit. PL 215 285 B1 8. The conjugate of claim 1 The method of claim 7, comprising from 3 to 10 polyethylene glycol molecules for each uricase subunit. 9. The conjugate of claim 1 6, characterized in that each polyethylene glycol molecule has a molecular weight in the range of 1 x 10 ³ to 100 x 10 ³ u. 10. The conjugate of claim 1 9, characterized in that each polyethylene glycol molecule has a molecular weight in the range from 1 * 10 ³ to 50 x 10 ³ u. 11. The conjugate of claim 11 10, characterized in that each polyethylene glycol molecule has a molecular weight in the range of 5 * 10 ³ to 20 x 10 ³ u. 12. The conjugate of claim 1 11, characterized in that each _three polyethylene glycol molecule has a molecular weight of 10 x 10 ³ u. 13. A pharmaceutical composition containing the active ingredient and pharmaceutically acceptable excipients, characterized in that the active ingredient is uricase as defined in any of claims 1 to 3. from 1 to 3. 14. A pharmaceutical composition containing the active ingredient and pharmaceutically acceptable excipients, characterized in that the active ingredient is a polyethylene glycol-uricase conjugate according to claim 1 6. 15. The pharmaceutical composition of Claim 13. The product of claim 13, which is suitable for repeated administration. 16. A pharmaceutical composition according to claim 1 14. The pharmaceutical composition of claim 14 which is suitable for repeated administration. 17. Use of a composition as defined in claim 1 For the manufacture of a medicament useful for reducing uric acid levels in biological fluids in a subject in need thereof. 18. Use of a composition as defined in claim 1 For the manufacture of a medicament useful for reducing uric acid levels in biological fluids in a subject in need thereof. 19. Use according to claim 1 17. The method of claim 17, characterized in that the biological fluid is blood. 20. Use according to Claim 18. The method of claim 18, wherein the biological fluid is blood. 21. An isolated truncated mammalian uricase as defined in claim 1; The method of claim 1, wherein the N-terminal amino acid is methionine. 22. Isolated truncated mammalian uricase according to claim 1; 21, characterized in that it comprises the amino acid sequence shown in SEQ ID NO: 7. 23. An isolated nucleic acid, the sequence of which encodes a protein according to claim 1, 1, claim 3, claim 4, claim 21 or claim 22. 24. An isolated nucleic acid according to claim 24. The method of claim 23, wherein the nucleic acid sequence is operably linked to a heterologous promoter. 25. The isolated nucleic acid of claim 1, 24, characterized in that the promoter is the osmB promoter. 26. A nucleic acid vector which comprises a nucleic acid as defined in claim 1, 24. 27. A host cell comprising the vector of claim 1; 26. 28. An isolated nucleic acid comprising a nucleic acid sequence encoding uricase comprising the amino acid sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8. 29. An isolated nucleic acid according to claim 29. The method of claim 28, wherein the nucleic acid sequence comprises the sequence shown in SEQ ID NO: 9 or SEQ ID NO: 10. 30. The isolated nucleic acid of claim 1, The method of claim 28, wherein the nucleic acid sequence is operably linked to a heterologous promoter. 31. Nucleic acid according to claim 1 30, characterized in that the promoter is the osmB promoter. 32. A nucleic acid vector comprising the nucleic acid of claim 1 thirty. 33. A host cell comprising the vector of claim 1; 32. 34. A method of producing uricase comprising the steps of culturing the host cell according to claim 1. 27 or 33 under conditions such that the nucleic acid sequence is expressed in the host cell, and isolating the expressed uricase.