MXPA99011601A - Fatty acid desaturases and mutant sequences thereof - Google Patents

Abstract

Seeds, plants and oils are provided having high oleic acid;low linoleic acid;and low linoleic acid plus linolenic acid;and advantageous functional or nutritional properties. Plants are disclosed that contain a mutation in a delta-12 or delta-15 fatty acid desaturase gene. Preferred plants are rapeseed and sunflower plants. Plants carrying such mutant genes have altered fatty acid composition in seeds. In one embodiment, a plant contains a mutation in a region having the conserved motif His-Xaa-Xaa-Xaa-His, found in delta-12 and delta-15 fatty acid desaturases. A preferred motif has the sequence His-Glu-Cys-Gly-His. A preferred mutation in this motif has the amino acid sequence His-Lys-Cys-Gly-His. Nucleic acid fragments are disclosed that comprise a mutant delta-12 or delta-15 fatty acid desaturase gene sequence.

Description

FATTY ACID DESATURASES AND MUTATING SEQUENCES THEREOF Technical Field This invention relates to fatty acid desaturases and nucleic acids encoding the desaturase proteins. More particularly, the invention relates to nucleic acids encoding delta-12 and delta-15 fatty acid desaturases proteins that affect the fatty acid composition in plants, the polypeptides produced from said nucleic acids and plants expressing said nucleic acids. BACKGROUND OF THE INVENTION Many reproduction studies have been carried out to improve the fatty acid profile of the Brassica varieties. Pleines and Freidt, Fat Sci. Technol. , 90 (5), 167-171 (1988) describe lines of plants with reduced C? 8: 3 levels (2.5-5.8%) combined with high oleic content (73-79%). Rakow and McGregor, J. Amer. Oil Chem. Soc, 50, 400-403 (October 1973) describe the problems associated with selection mutants for linoleic and linolenic acids. I n. Can. J. Plant Sci. , 68, 509-51 1 (April 1988) rape is described in the stellar summer to produce seed oil with 3% linolenic acid and 28% linoleic acid. Roy and Tarr, Z. Pflanzenzuchtg, 95 (3), 201-209 (1985) teaches gene transfer by a specific cross of Brassica júncea in Brassica napus resulting in a reconstituted line in combination with high linoleic content and low linolenic acid content. Roy and Tarr, Plant Breeding, 98, 89-96 (1987) describe the prospects for the development of B. napus L. which has improved linolenic and linolenic acid content. European Patent Application 323,753 published July 12, 1989 describes seeds and oils having more than 795 oleic acid combined with less than 3.5% Mnlenic acid. Canvin, Can. J. Botany, 43, 63-69 (1965) describes the effect of temperature on the fatty acid composition of oils of various seed crops including rape seed. Mutations are normally induced with extremely high doses of radiation and / or chemical mutagens (Gaul, H. Radiation Botany (1964) 4: 155-232). High dose levels that exceed LD50, and usually reach LD90, lead to maximum mutation regimens that can be achieved. In the reproduction of the Brassica variety mutation, high levels of chemical mutagens alone or combined with radiation have been induced to a limited number of fatty acid mutations (Rakow, G.Z. Pflanzenzuchtg (1973) 69: 62-82). The low a-linolenic acid mutation, derived from the Rakow mutation reproduction of the program that has no direct commercial application due to low seed yield. The first commercial culture using the a-linolenic acid mutation derived in 1973 was released in 1988 as the stellar variety (Scarth, R., et al., Can J Plant Sci. (1988) 68: 509-511). Stellar had a 20% lower yield than commercial crops at the time of its release. Alterations in the fatty acid composition of vegetable oils are convenient to meet specific food and industrial uses. For example, the. Brassica varieties with increased mono-unsaturated levels (oleic acid) in the seed oil, and oil-derived products, could improve lipid nutrition. Canola lines that are low in polyunsaturated fatty acids and high in oleic acid tend to have superior oxidative stability, which is a useful feature for the retail food industry.

The delta-12 fatty acid desaturase (also known as oleic desaturase) is involved in the enzymatic conversion of oleic acid to linoleic acid. The delta-15 fatty acid desaturase (also known as linoleic acid desaturase) is involved in the enzymatic conversion of linoleic acid to a-linolenic acid. The microsomal delta-12 desaturase has been cloned and characterized by using a T-DNA tag. Okuley, and others, Plant Cell 6: 147-158 (1994). The nucleotide sequences of higher plant genes encoding the microsomal delta-12 fatty acid desaturase are described in Lightner et al., W O94 / 11516. The gene sequences of higher plants encoding the fatty acid desaturases delta-15 plastid microsomal are described in Yadav, N., et al., Plant Physiol., 103: 467-476 (1993), WO 93/11245 and Arondel , V. et al., Science, 258: 1353-1355 (1992).

However, there are no teachings describing mutations in delta-12 or delta-15 fatty acid desaturase that encode the plant sequences. There is a need in the art for more efficient methods to develop the plant lines containing the sequence mutations of the delta-12 or delta-15 fatty acid desaturase gene effective to alter the fatty acid composition of the seeds. SUMMARY OF THE INVENTION The invention comprises seeds, plants and plant lines of Brassicaceae or Helianthus that have at least one mutation that controls the levels of unsaturated fatty acids of plants. One embodiment of the invention is an isolated nucleic acid fragment comprising a nucleotide sequence encoding a mutation of a mutant delta-12 fatty acid desaturase that confers the altered fat composition in the seeds when the fragment is present in a plant . A preferred sequence comprises a sequence of mutants as shown in Figure 2. Another embodiment of the invention is an isolated nucleic acid fragment comprising a nucleotide sequence encoding a mutation of a delta-15 mutant fatty acid desaturase. A plant in this modality can be soybean, oilseed species of Brassica, sunflower, castor oil and corn. The sequence of mutants can be derived from, for example, a delta-12 or delta-1 5 desaturase gene from Brassica napus, Brassica rapa, Brassica júncea or Helianthus.

Another embodiment of the invention involves a method for producing a line of Brassicaceae or Helianthus plants comprising the steps of: (a) inducing mutagenesis in cells of a starting variety of a Brassicaceae or Helianthus species; (b) obtain progeny plants from the mutagenized cells; (c) identifying progeny plants containing a mutation in a delta-12 or delta-15 fatty acid desaturase gene; and (d) produce a line of autonomous or crossed plants. The resulting plant line can be mutagenized in order to obtain a line having both the delta-12 desaturase mutation and the delta-15 desaturase mutation. Yet another embodiment of the invention involves a method for producing plant lines containing the altered fatty acid composition comprising: (a) crossing a first plant with a second plant having a delta-12 or delta-12 fatty acid desaturase; (b) obtain seeds of the cross of step (a); (c) develop fertile plants of said seeds; (d) obtain the seed of progeny of the plants of step (c), and (e) identify those seeds among the progeny that have altered the composition of fatty acids. Suitable plants are soy, rapeseed, sunflower, safflower, castor oil and corn. The preferred plants are rapeseed and sunflower seeds. The invention also encompasses a vegetable oil obtained from plants described herein, which vegetable oils have an altered fatty acid composition.

Brief description of the Sequence List SEQ ID NO: 1, shows a hypothetical DNA sequence of a Brassica Fad2 gene. SEQ ID NO: 2 is the deduced amino acid sequence of SEQ ID NO: 1. SEQ ID NO: 3, shows a hypothetical DNA sequence of a Brassica Fad2 gene having a mutation of 316 nucleotides. SEQ ID NO: 4 is the deduced amino acid sequence of SEQ ID NO: 3 SEQ ID NO: 5, shows a hypothetical DNA sequence of a Brassica Fad2 gene. SEQ ID NO: 6 is the deduced amino acid sequence of SEQ ID NO: 5. SEQ ID NO: 7, shows a hypothetical DNA sequence of a Brassica Fad2 gene having a mutation of 515 nucleotides. SEQ ID NO: 8 is the deduced amino acid sequence of SEQ ID NO: 7. SEQ ID NO: 9, shows the DNA sequence for the coding region of a wild-type Brassica Fad2-D gene. SEQ ID NO: 10 is the amino acid sequence deduced for SEQ ID NO: 9. SEQ ID NO: 11, shows the DNA sequence for the coding region of a mutant Brassica Fad2-D gene of IMC 129. SEQ ID NO: 12 is the deduced amino acid sequence for SEQ ID NO: 11. SEQ ID NO: 13 shows the DNA sequence for the coding region of a wild-type Brassica Fad2-D gene.

SEQ ID NO: 14 is the amino acid sequence deduced for SEQ ID NO: 13. SEQ ID NO: 15 shows the DNA sequence for the coding region of a mutant Fad2-D gene of Q508. SEQ ID NO: 16 is the amino acid sequence deduced for SEQ ID NO: 15. SEQ ID NO: 17, shows the DNA sequence for the coding region of a mutant Fad2-D gene of Q4275. SEQ ID NO: 18 is the amino acid sequence deduced for SEQ ID NO: 17. SEQ ID NOS: 19-27 show the oligonucleotide sequences. SEQ ID NO: 28 shows the genomic DNA sequence for the Brassica Fad2-U gene. SEQ ID NOS: 30-31 show the genomic sequences located upstream of the start codon of the Brassica Fad2-D genes. Brief Description of the Figures Figure 1 is a histogram showing the frequency distribution of the oleic acid content of seed oil (C18 :.) in a segregation population of a W508 X Westar junction. The bar marked with WSGA 1A represents the content of C? 8 :? of Westar mother. The bar marked with Q508 represents the content of C? 8; i of Q508 mother. Figure 2 shows the nucleotide sequences for the wild-type Fad2-D gene from Brassica (Fad2-D by weight), the mutant gene from IMC129 (Fad2-D GA316 IMC129), the wild-type Fad2-F gene (Fad2 -F in weight), the mutant gene of Q508 (Fad2-F TA515 Q508) and the mutant gene of Q4275 (Fad2-F GA908 Q4275). Figure 3 shows the amino acid sequences deduced for the polynucleotides of Figure 2. Description of Preferred Modalities All percentages of fatty acids herein are percentages by weight of the oil of which the fatty acid is a component. As used herein, a "line" is a group of plants that exhibit little or no genetic variation among individuals of at least one characteristic. Such lines can be created by several generations of self-pollination and selection, or vegetative propagation of a single prpgenie using tissue or cell culture techniques. As used herein, the term "variety" refers to a line that is used for commercial production. The term "mutagenesis" refers to the use of a mutagenic agent to induce random genetic mutations within a population of individuals. The treated population, or a subsequent generation of the population, is then sifted for the useful traits that result from the mutations. A "population" is any group of individuals that make up a section of common genes. As used herein, "M0" is an untreated seed. As used herein, "Mi" is the seed (and resulting plants) exposed to a mutagenic agent, while "M2" is the progeny (seeds and plants) of My self-pollinated plants and "M4" is the progeny of self-pollinated M3 plants. "M5" is the progeny of the self-pollinated M4 plants. "M6", "M7", etc. , each one is the progeny of the self-pollinated plants of the previous generation. The term "autonomous" as used herein means self-pollination. "Stability" or "stable" as used herein, means that, with respect to a given fatty acid component, the component is maintained from generation to generation for at least two generations and preferably at least three generations substantially at same level, v.gr. , preferably + 5%. The method of the invention is capable of creating lines with improved fatty acid compositions stable up to 5% from generation to generation. The above stability can be affected by temperature, location, tension and time of planting. Therefore, the comparison of the fatty acid profiles can be made from seeds produced under similar development conditions. Stability can be measured based on the knowledge of the previous generation. Intensive breeding has produced Brassica plants whose seed oil contains at least 2% erucic acid. The same varieties have been reproduced so that the defatted food contains less than 30 μmoles of glucosinolates / gram. The "canola" as used in the present, refers to a seed of a variety of plants or oil that contains less than 2% erucic acid (C22:?), and flour with less than 30 .mu.mol of glucosinolates / gram. Applicants have discovered plants with mutations in the delta-12 fatty acid desaturase gene. Said plants have useful alterations in the fatty acid compositions of the seed oil. Such mutations confer, for example, a high content of oleic acid, a decreased content of linoleic acid and stabilized, or a high and decreased content of oleic acid, a stabilized linolenic acid content. Applicants have also discovered plants with mutations in a delta-15 fatty acid desaturase gene. Said plants have useful alterations in the fatty acid composition of the seed oil, e.g., a decreased and stabilized level of a-linolenic acid. Applicants have also discovered isolated nucleic acid fragments (polynucleotides) comprising sequences that carry the mutations within the coding sequence of delta-12 or delta-15 fatty acid desaturases. Mutations confer convenient alterations in levels of fatty acid in the seed oil of plants that carry such mutations. The delta-12 fatty acid desaturase is also known as omega-6 fatty acid desaturase and is sometimes referred to herein as Fad2 or 12-DES. The delta-15 fatty acid desaturase is also known as omega-3 fatty acid desaturase and is sometimes referred to herein as Fad3 or 15-DES. A nucleic acid fragment of the invention may be in the form of RNA or in the form of DNA, including cDNA, synthetic DNA or genomic DNA. The DNA can be double-stranded with a single thread, and if the DNA of a single thread, it can be the coding thread or the thread without coding. An RNA analog can be, for example, mRNA or a combination of ribo- and deoxyribonucleotides. Illustrative examples of the nucleic acid fragment of the invention are the mutant sequences shown in Figure 3. A nucleic acid fragment of the invention contains a mutation in a delta-12 fatty acid desaturase coding sequence or a mutation in a microsomal delta-15 fatty acid desaturase coding sequence. Said mutation translates the resulting non-functional desaturase gene product into plants, in relation to the function of the gene product encoded by the wild-type sequence. The lack of functionality of the delta-12 desaturase gene product can be deduced from the decreased level of the reaction product (linoleic acid) and the increased level of substrate (oleic acid) in plant tissues expressing the mutant sequence, compared to corresponding levels in plant tissues expressing the wild-type sequence. The lack of functionality of the delta-desaturase gene product can be deduced from the increased level of the reaction product (α-linolenic acid) and the increased level of substrate (linoleic acid) in plant tissues expressing the mutant sequence compared to the corresponding levels in plant tissues expressing the wild-type sequence. A fragment of nucleic acids of the invention may comprise a portion of the coding sequence, e.g., at least about 10 nucleotides, provided with the fragments containing at least one mutation in the coding sequence. The length of a desired fragment depends on the purpose for which the fragment could be used, e.g., PCR primer, site-directed mutagenesis and seeds. In one embodiment, a nucleic acid fragment of the invention comprises the full length coding sequence of a mutant delta-12 or mutant delta-15 fatty acid desaturase, e.g., mutant sequences of Figure 3. In other embodiments, a fragment of nucleic acids is from about 20 to about 50 nucleotides (base pairs, pb), or about 20 to about 500 nucleotides, or about 500 to about 1200 nucleotides in length. In another embodiment, the invention relates to an isolated nucleic acid fragment of at least 50 nucleic lengths having at least 70% sequence identity in the nucleotide sequences of SEQ ID NO: 30 or SEQ ID NO: 31 In some embodiments, the nucleic acid fragments have at least 80% or 90% sequence identity in SEQ ID NO: 30 or SEQ ID NO: 31. The identity of sequences of these and other acids described herein can be determined, for example, using Blast 2.0.4 (February 24, 1998) to teach the nr database (Non-redundant Gene Bank, EMBL; DDBT and PDB). BLAST 2.0.4 is provided by the National Center for Biotechnology (http: // www. ncbi. nlm.nih.gov). Altschul, S. F. et al., Nucleic Acids Res., 25: 3389-3402 (1997). Alternatively, the MEGALI N® sequence alignment software (DNASTAR, Madison, Wl) can be used to determine the sequence identity by the Clustal algorithm. In this method, the sequences were grouped into groups by examining distance between all the pairs. The groupings are groups in aligned pairs. The Jotun Hein algorithm is also available in MEGALI N®. The nucleotide sequences of SEQ I D NO: 30 and NO: 31 are approximately 85% identical using the Clustal algorithm with difficult parameters. The nucleotide sequences of SEQ I D NO: 30 and SEQ I D NO: 32 are located upstream of the ATG start codon for the fad2-D gene and can be isolated from the Bridger and Westar canola plants, respectively. These upstream elements contain aspects similar to introns. The invention also relates to an isolated nucleic acid fragment that includes a sequence of at least 200 nucleotides. The fragment has at least 70% identity in the nucleotides from 1 to about 1012 of SEQ I D NO: 28. In some embodiments, the fragment has 80% or at least 90% sequence identity for nucleotides from 1 to about 1012 of SEQ I D NO: 28. This portion of SEQ I D NO: 28 is located upstream of the ATG start codon and has introns-like characteristics. A mutation in a nucleic acid fragment of the invention can be any portion of the coding sequence that is derived from the resulting non-functional gene product. Suitable types of mutations include, without limitation, nucleotide insertions, nucleotide deletions, or transitions and transversions in the wild-type coding sequence. Said mutations result in the insertions of one or more amino acids, deletions of one or more amino acids, and substitutions of non-conservative amino acids in the corresponding gene product. In some embodiments, the sequence of a nucleic acid fragment may comprise more than one mutation or more than one type of mutation. The insertion or deletion of amino acids in a coding sequence can, for example, disrupt the conformation of essential alpha-helical or beta-linked sheet regions of the resulting gene product. Amino acid insertions or deletions can also alter the binding or catalytic sites important for the activity of gene products. It is known in the art that the insertion or deletion of a larger number of contiguous amino acids is more likely to render the gene product non-functional compared to a smaller number of inserted or deleted amino acids. Substitutions of non-conservative amino acids can be replaced with an amino acid of a class with an amino acid of a different class. Non-conservative substitutions can make a substantial change in the load or hydrophobicity of the gene product. Substitutions of non-conservative amino acids can also make a substantial change in the volume of the side chain of the residue, e.g. , replacing an alanyl residue with an isoleucyl residue. Examples of non-conservative substitutions include the substitution of a basic amino acid for a non-polar amino acid, or a polar amino acid for an acidic amino acid. Because only 20 amino acids are encoded in a gene, the substitutions resulting from the non-functional gene product can be determined by routine experimentation, incorporating an amino acid of a different class of the gene product directed to the mutation. Preferred mutations are in a region of nucleic acids encoding a sequence motif of amino acids that are conserved between the delta-12 fatty acid desaturases or the delta-15 fatty acid desaturases, such as a His-Xaa-Xaa-motif. Xaa-H is (Tables 1 -3). An example of a suitable region has a conserved H ECG H motif found, for example, in the corresponding nucleotides of amino acids 105 to 109 of the delta-12 desaturase sequences of Arabidopsis and Brassica, in the nucleotides corresponding to amino acids 101 to 105 of the soy delta-12 desaturase sequence and in the nucleotides corresponding to amino acids 1 11 to 15 of the corn delta-12 desaturase sequence. See for example WO 94/1 151 16; Okuley et al., Plant Cell 6: 147-158 (1994). The one-letter amino acid designations used herein are described in Alberts, B, et al., Molecular Biology of the Cell, 3rd edition, Gerland Publishing, New York, 1994. The amino acids that flank this motif are also highly conserved among delta-12 and delta-15 desaturases and are also suitable candidates for mutations and fragments of the invention. An exemplary embodiment of a mutation in a nucleic acid fragment of the invention is a substitution of Glu to Lys in the HECGH motif of a Brassica delta-12 microsomal desaturase sequence, either in the form of D or in the form of F. This mutation results in the sequence H ECGH which is changed to H KCG H as seen by the comparison in SEQ ID NO: 10 (wild type D form) to SEQ ID NO: 12 (mutant form). It is observed that a similar mutation in other Fad-2 sequences results in a non-functional gene product (compare SEQ I D NO: 2 with SEQ I D NO: 4). A similar motif can be found in amino acids 101 to 105 of the microsomal delta-15 fatty acid desaturase from Arabidopsis, as well as in the corresponding rapeseed and soy desaturases (Table 5). See, for example, WO 93/1 1245; Arondel, V. et al., Science, 258: 1 153-1 155 (1992); Yadav, N. and others, Plant Physiol., 103: 467-476 (1993). The delta-15 fatty acids of plastids have a similar motif (Table 5). Among the types of mutations in the H ECGH motif that result in the non-functional gene product, are the non-conservative substitutions. An illustrative example of a non-conservative substitution is a substitution of a glycine residue for the first or second histidine. Said substitution replaces a charge residue (histidine) with a non-polar residue (glycine). Another type of mutation that results in the non-functional gene product is an insertion mutation, e.g. , the insertion of a glycine between the residues of cysteine and glutamic acid in the motif of H ECGH. Other regions having conservative amino acid motifs include the H HR H motif shown in Tables 2, the H RTH H motif shown in Table 6, and the HVAH H motif shown in Table 3. See, for example WO 94 / 1 151 16; Hitz, W. and others, Physiol Plant. , 105: 635-641 (1994); Okuley, J. , and others, supra; and Yadav, N. and others, supra. An illustrative example of a mutation in the region shown in Table 3 is a mutation of nucleotides corresponding to the codon for glycine (amino acid 330 of B. napus). A substitution of non-conservative Gly to Glu results from the amino acid sequence DRDYGI LN KV being changed to the sequence DRDYEJLNKV (compare wild type F form of SEQ ID NO: 14 with mutant Q4275 of SEQ ID NO: 18, Figure 3). Another region suitable for a mutation in a delta-12 desaturase sequence contains the KYLNNP motif in the nucleic acids corresponding to amino acids 171 to 175 of the Brassica desaturase sequence. An illustrative example of a mutation is the region of the Leu a His subtraction, resulting in the amino acid sequence (Table 4) KYJH.NN (compare Wild type Fad2-F of SEQ ID NO: 14 with the SEQ ID mutant). NO: 16). A similar mutation in other Fad-2 amino acid sequences is contemplated to result in a non-functional gene product. (Compare SEQ ID NO: 6 with SEQ ID NO: 8). TABLE 1 Alignment of Amino Acid Sequences of Desaturases of Fatty Acid Delta-12 Microsomal Species Position Amino Acid Sequence Arabidopsis thaliana 100-129 IWVIAHECGH HAFSDYQWLD DTVGLIFHSF Glycine max 96-125 VWVIAHECGH HAFSKYQWVD DVVGLTLHST Zea mays 106-135 VWVIAHECGH HAFSDYSLLD DVVGLVLHSS Ricinus communisa 1-29 WVMAHDCGH HAFSDYQLLD DVVGLYLHSC Brassica napus D 100-128 VWVIAHECGH HAFSDYWLD DTVGLYFHS Brassica napus F 100-128 VWVIAHECGH HAFSDYQWLD DTVGLIFHS of plasmid pRF2-1C TABLE 2 Alignment of Amino Acid Sequences of Fatty Acid Desaturases Delta-12 Microsomal Species Position Sequence of Amino Acids Arabidopsis thaliana 130-158 LLVDPYFSWKY SHRRHHSNTG SLERDEVFV Glycine max 126-154 LLVDPYFSWKI SHRRHHSNTG SLDRDEVFV Zea mays 136-164 LMVPYFSWKY SHRRHHSNTG SLERDEVFV Ricinus communis3 30-58 LLVPYFSWKH SHRRHHSNTG SLERDEVFV Brassica napus D 130-158 LLVPYFSWKY SHRRHHSNTG SLERDEVFV Brassica napus F 130-158 LLVPYFSWKY SHRRHHSNTG SLERDEVFV from plasmid pRF2-1 C TABLE 3 Alignment of Amic Acid Sequences of Desaturases of Gaseous Delta-12 Microsomal Acid Position species Arabidopsis thaliana Amino Acid Sequence 298-333 DRDYGILNKV FHNITDTHVA HHLFSTMPHY NAMEAT Glycine max 294-329 DRDYGILNKV FHHITDTHVA HHLFSTMPHY HAMEAT Zea mays 305-340 DRDYGILNRV FHNITDTHVA HHLFSTMPHY HAMEAT Ricinus communis3 198-224 DRDYGILNKV FHNITDTQVA HHLF TMP Brassica napus D 299-334 DRDYGILNKV FHNITDTHVA HHLFSTMPHY HAMEAT Brassica napus F 299-334 DRDYGILNKV FHNITDTHVA HHLFSTMPHY HAMEAT a of the plasmid gone pRF2- 1 C TABLE 4 Alignment of Conserved Amino Acids of Desaturases of Microsomal Delta-12 Fatty Acid Species Position Amino Acid Sequence Arabidopsis thaliana 165-180 IKWYGKYLNN PLGRIM Glycine max 161-176 VAWFSLYLNN PLGRAV Zea mays 172-187 PWYTPYVYNN PVGRVV Ricinus communis3 65-80 IRWYSKYLNN PPGRIM Brassica napus D 165-180 IKWYGKYLNN PLGRTV Brassica napus F 165-180 IKWYGKYLNN PLGRTV of plasmid pR F2- 1 C TABLE 5 Alignment of Conserved Amino Acids of Desaturases of Delta-12 Fatty Acid of Plastids v Microsomales Species Position Amino Acid Sequence Arabidopsis thaliana3 156-177 WALFVLGHD CGHGSFSNDP KLN Brassica napus3 115-135 WALFVLGHD CGHGSFSNDP RLN Glycine max3 164-185 WALFVLGHD CGHGSFSNNS KLN Arabidopsisi thaliana 94-115 WAIFVLGHD CGHGSFSDIP LLN Bnassica napus 87-109 WALFVLGHD CGHGSFSNDP RLN Glycine max 93-114 WALFVLGHD CGHGSFSDSP PLN Sequences of Plastids TABLE 6 Alignment of Conserved Amino Acids of Delta-12 Fatty Acid Desaturases of Plastids and Microsomal Species Position Amino Acid Sequence A. thaliana3 188-216 ILVPYHGWRY SHTHHQNHG HVENDESWH B. Napus3 146-174 ILVPYHGWRY SHTHHQNHG HVENDESWH Glycine max3 196-224 A. thaliana ILVPYHGWRY SHTHHQHHG HAENDESWH 126-154 ILVPYHGWRY SHTHHQNHG HVENDESWV Brassica napus 117-145 ILVPYHGWRY SHTHHQNHG HVENDESWV Glycine max 125-153 ILVPYHGWRY SHTHHQNHG HIEKDESWV Plastid Sequences The conservation of the amino acid motifs and their relative positions indicate that the regions of a delta-12 or delta-15 fatty acid desaturase that are mutated in a species to generate a non-functional desaturase can be mutated in the corresponding region of other species to generate a delta-12 non-functional desaturase or product of delta-15 desaturase genes in these species. Mutations in any of the regions of Tables 1-6 are specifically included within the scope of the invention and are substantially identical to those mutations exemplified herein, which provide such mutation (or mutations) that result in the gene product. of non-functional desaturase, as described above. A fragment of nucleic acids containing a sequence of mutants can be generated by techniques known to the skilled artisan. Such techniques include, without limitation, site-directed mutagenesis of wild-type sequences and direct synthesis using automated DNA synthesizers. A fragment of nucleic acids containing a mutant sequence can also be generated by the mutagenesis of plant seeds or tissue of regenerable plants by, for example, ethyl methane sulfate, X-rays or other mutagens. With mutagenesis, mutant plants having the desired fatty acid phenotype in the seeds are identified by known techniques and an n-nucleic acid fragment containing the desired mutation is isolated from the genomic DNA or RNA of the mutant line. The site of the specific mutation is then determined by sequencing the coding region of the delta-12 desaturase gene or the delta-15 desaturase gene. Alternatively, labeled nucleic acid probes that are specific for desired mutational events can be used to rapidly screen a mutagenized population. This described method can be applied in all Brassica species of seed oil, and in types of maturation in Spring and Winter within each species. Physical mutagens, including but not limited to X-rays, UV rays and other physical treatments that cause damage to chromosomes, and other chemical mutagens, including but not limited to ethidium bromide, nitrosoguanidine, diepoxybutane, etc. , they can also be used to induce mutations. The mutagenesis treatment can also be applied to other stages of plant development, including but not limited to cell cultures, embryos, micropores and root apices. "Stable mutations", as used herein, are defined as M5 more advanced lines that maintain a profile of altered fatty acid selected for a minimum of three generations, including a minimum of two generations under field conditions, and exceeding the thresholds for a minimum of two generations, as determined by the gas chromatographic analysis of a minimum of 10 randomly selected voluminous seeds together. Alternatively, stability can be measured in the same way by comparing subsequent generations. In subsequent generations, stability is defined by having similar fatty acid profiles in the seed so that the previous or subsequent generation develops under substantially similar conditions. The reproduction of mutation has traditionally produced plants transported, in addition to the characteristic of interest, multiple characteristics and suppression, eg. , Reduced plant vigor and reduced fertility. These characteristics can indirectly affect the composition of fatty acids, producing an unstable mutation; and / or reduced performance, thus decreasing the commercial utility of the invention. To eliminate the presence of deletion mutations and reduce the load of mutations transported by the plant, a low mutagen dose is used in seed treatments to create a LD30 population. This allows the rapid selection of mutations of a single gene for the characteristics of fatty acid in agronomic backgrounds that produce acceptable yields. The seeds of several different plant lines have been deposited with American Type Culture Collecton and have the following access numbers.

Line Access No. Deposit Date A129.5 4081 1 May 25, 1990 A133.1 40812 May 25, 1990 M3032.1 75021 June 7, 1991 M3062.8 75025 June 7, 1991 M3028.10 75025 June 7, 1991 IMC130 75446 April 16, 1993 Q4275 97569 May 10, 1996 In some plant species or varieties of more than one form of endogenous microsomal delta-12 desaturase can be found. In the amfidiploids, each form can be derived from one of the mother genomes by making the species under consideration. The switching plants in both forms have a fatty acid profile that differs from the plants with a mutation in a single form. An example of such a plant is the Brassica napus Q508 line, a dually mutagenized line containing the mutant of Form D delta-12 desaturase (SEQ ID NO: 1 1) and a mutant F-form of delta-12 desaturase (SEQ. ID NO: 15) Another example is line Q4275, which contain a mutant D-form of delta-12 desaturase (SEQ ID NO: 1 1) and an F-form of delta-12 desaturase (SEQ ID NO: 17). See Figures 2-3. A preferred host or container organism for the introduction of a nucleic acid fragment of the invention are specific to oil production, such as alone (Glycine max), rapeseed oil (e.g., Brassica napus B. rapa and B. júncea), beaver (Helianthus annus), castor oil (Ricinus communis), corn (Zea mays) and safflower (Carthamus tinctorius). A nucleic acid fragment of the invention further comprises the additional nucleic acids. For example, the nucleic acid encoding a secretory or reader amino acid sequence that can be ligated to a mutant desaturase nucleic acid fragment such as the secretory and reading sequence is fused in a frame at the amino terminus of a polypeptide of delta-12 or delta-15 mutant desaturase. Nucleic acid fragments are known in the art that encode amino acid sequences useful for fusing in frame with the mutant desaturase polypeptides described therein. See, for example, U .S. 5,629, 193 incorporated herein by reference. A fragment of nucleic acids also has one or more regulatory elements operably linked therein. The present invention also comprises fragments of nucleic acids that selectively hybridize the mutant desaturase sequences. Said nucleic acid fragment is normally at least 15 nucleotides in length. Hybridization typically involves Southern analysis (Southern blots), a method whereby the presence of DNA sequences in a pool of nucleic acid are identified by hybridization to a labeled oligonucleotide or DNA fragment probe. Southern analysis usually involves the electrophoretic separation of DNA digestions on agarose gels, denaturation of DNA after electrophoretic separation, and transfer of DNA to nitrocellulose, nylon or other suitable membrane supports for analysis with a radiolabelled, biotinylated probe or enzyme labeled as described in sections 9.37-9.52 of Sambrook et al. (1989) Molecular Cloning, second edition, Cold Spring Harbor Laboratoy, Plainview; NY. A fragment of nucleic acids can be hybridized under conditions of moderate resistance or, preferably, under conditions of high resistance in a mutant desaturase sequence. High resistance conditions are used to identify nucleic acids that have a degree of homology in the probe. High strength conditions may include the use of low ionic strength and high temperature for washing, for example, 0.015 M NaCI / 0.0015 M sodium citrate (0.1 X SSC); 0.1% sodium lauryl sulfate (SDS) at 50-65 ° C. Alternatively, a denaturing agent such as formamide can be employed during hybridization, e.g. , 50% formamide with 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 45 ° C. Another example is the use of 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Den hardt solution, salmon sperm DNA treated with sound (50 μg / ml), 0.1% SDS and 10% dextran sulfate at 42 ° C, washed at 42 ° C in 0.2 x SSC and 0.1% of SDS. The conditions of moderate resistance for the hybridization conditions used to identify nucleic acids having a lower degree to identify the probe so that the nucleic acids are identified under high resistance conditions. The conditions of moderate resistance may include the use of superior ionic strength and / or lower temperatures to wash the hybridization membrane, compared to the ionic strength and temperatures used for high strength hybridization. For example, a wash solution comprising 0.060 M NaCl / 0.0060 M sodium citrate (4X SSC) and 0.1% sodium lauryl sulfate (SDS) can be used at 50 ° C, with at least one wash in 1X of SSC at 65 ° C. Alternatively, a hybridization wash in 1 x SSC at 37DC can be used. Hybridization can also be done by Northern analysis (Northern blots), a method used to identify RNAs that hybridize to a known probe such as an oligonucleotide, DNA fragment, cDNA or fragment thereof or an RNA fragment. The probe is labeled with a radioisotope tai as 32P, by biotinylation or with an enzyme. The AR N can be analyzed electrophoretically in a conventional manner separately on an agarose or polyacrylamide gel, transferred into nitrocellulose, nylon, or another suitable membrane hybridized with the probe, using standard techniques well known in the art such as those described in sections 7.39- 7.52 by Sambrook et al., Supra. A polypeptide of the invention comprises an isolated polypeptide having a mutant amino acid sequence as well as derivatives and analogs thereof. See, for example, the mutant amino acid sequences of Figure 3. By "isolated" is meant a polypeptide that is expressed and produced in an environment different from the environment in which it is naturally expressed and produced in polypeptide. For example, a plant polypeptide is isolated when it is expressed and produced in bacteria or fungi. A polypeptide of the invention also comprises variants of the mutant desaturase polypeptides described herein, as described above. In one embodiment of the claimed invention, a plant containing the delta-12 desaturase mutation and a delta-15 desaturase mutation. Said plants may have a fatty acid composition comprising very high levels of oleic acid and alpha acid levels. -linolenic very low. Mutations in delta-12 desaturase and delta-15 desaturase can be combined in one plant to form a genetic cross between the single mutant lines of delta-12 desaturase and delta-15 desaturase. A plant that has a mutation in the delta-12 fatty acid desaturase is crossed or is helped by a second plant that has a mutation in the delta-15 fatty acid desaturase. The seeds produced from the cross are planted and the resulting plants self-controlled in order to obtain progeny seeds. These progeny seeds are then protected in order to identify those seeds transported in mutant genes. Alternatively, a line having a delta-12 desaturase or delta-15 desaturase mutation may be subjected to mutagenesis to generate a plant or plant line having mutations in delta-12 desaturase and delta-12 desaturase. For example, the IMC 129 line had a mutation in the coding region (Glu106 to Lys10β) of the D form of the microsomal delta-12 desaturase structural gene (e.g., seeds) of this line can be mutagenized to induce the mutation in a delta-15 desaturase gene. Resulting in a plant or plant line transported in a mutation in a delta-12 fatty acid desaturase gene and a mutation in a delta-15 fatty acid desaturase gene. Progeny includes descenders of a particular plant or plant line, v.gr. , seeds developed in an immediate plant are descendants. The progeny of an immediate plant includes seeds formed with F1 t F2, F3, and subsequent generation plants, or seeds formed in BCi, BC2, BC3 and plants of subsequent generation. The plants according to the invention preferably contain an altered fatty acid composition. For example, oil obtained from seeds of said plants having from about 69 to about 90% oleic acid, based on the total fatty acid composition of the seed. The oil preferably has from about 74 to about 90% oleic acid, more preferably from about 80 to about 90% oleic acid. In some embodiments, the oil obtained from seeds produced by the plants of the invention have from about 2.0% to about 5.0% saturated fatty acids, based on the total fatty acid composition of the seeds. In some embodiments, the oil obtained from seeds of the invention may have from about 1.0% to about 14.0% linolenic acid, or from about 0.5% to about 10.0% a-linolenic acid. The oily composition is usually analyzed by pressing fatty acids and extracting large seed samples (e.g., 10 seeds). The triglycerides of fatty acid in the seed are hydrolyzed and converted into methyl esters of fatty acid. Those seeds having an altered fatty acid composition can be identified by techniques known to the artisan skilled in the art, e.g. , liquid gas chromatography (LCL) analysis of a bulk seed sample or a half of a soybean seed. Seed analysis in half is well known in the art for being useful due to the availability of the embryo that is maintained and therefore those seeds having the desired fatty acid profile can be planted in the next generation. However, seed analysis in half is also known to be a misrepresentation of the seed genotype that will be analyzed. Bulky seed analysis usually gives a more accurate representation of the fatty acid profile of a given genotype. The fatty acid composition can also be determined on larger samples, eg. , oil obtained from a pilot plant or refining, discoloration and deodorization on a commercial scale, of endogenous oil in the seeds. The nucleic acid fragments of the invention can be used as markers in the genetic mapping of plants and plant breeding programs. Such labels may include restriction fragment length polymorphism (RFLP), random amplification polymorphism detection (RAPD), polymerase chain reaction (PCR) or sequence replication markers. self-sustained (3SR), for example, isolated reproduction techniques by the marker can be used to identify and track a desired fatty acid composition during the reproduction process. The techniques of reproduction assisted by the marker can be used in the action of, or as an alternative to, other types of identification techniques. An example of marker-assisted reproduction is the use of PCR primers that specifically amplify a sequence containing a desired mutation in a delta-12 or desaturase delta-15 desaturase. The methods according to the invention are useful in resulting plants and plant lines having suitable seed fatty acid compositions as well as superior agronomic properties compared to known lines having fatty acid composition of altered seed. Agronomic characteristics include, for example, percentage of increased seed germination, increased plant vigor, increased resistance in fungal diseases of the plant (moisture, root rot and the like), increased yield and improved normality. While the invention is susceptible to various modifications and alternative forms, certain specific embodiments thereof are described in methods and general examples in accordance with the following. For example, the invention can be applied to all Brassica species, including B. rapa, B. júncea and B. hirta, to produce substantially similar results. It should be understood, however, that these examples are not intended to limit the invention to particles in the ways described, but, instead, the invention covers all modifications, equivalents and alternatives that fail without departing from the scope of the invention. This includes the use of semi-clonal variation; physical and chemical mutagenesis of parts of plants; anther, microrospore or ovarian culture followed by the double chromosome; or self-control or cross-pollination to transmit the fatty acid characteristics, only in combination with other characteristics, to develop new Brassica lines.

EXAMPLE 1 Mutagenesis The Westar Seeds, a variety of cañola in spring (Brassica napus) of Canada, underwent chemical mutagenesis. Westar is a record of a variety in Canadian Spring with cane quality. The composition of fatty acids of Westar developed in field, 3.0% of C? 6.o, 1.9% of C18.o, 67.5% of C? 8 :? , 17.6% C? 8: 2, 7.4% C18: 3; < 2% of C20:. + C22:? , remain stable under commercial production, with < + .10% deviation, since 1982. Before mutagenesis, 30,000 seeds of B. napus cv. The Westar seeds were pre-soaked in 300 batches of seeds for two hours on wet filter paper to soften the seed coat. The pre-soaked seeds were placed in 80 mM ethylmethanesulfonate (EMS) for four hours. After mutagenesis, the seeds were raised three times in distilled water. The seeds were planted in 48 well trays containing the Pre-Mix. Sixteen-eight percent of mutagenized seed germination. The plants were kept at 25 ° C / 15 ° C, 14/10 hours day / night in the greenhouse. The flowering of each plant self-pollinated individually. The M2 seeds of individual plants were individually cataloged and stored, approximately 15,000 M2 lines were plants in nurseries in Carman, Manitoba. The seed of each plant was planted in rows of 3 meters with a row space of 15.24 cm. Westar was planted as the control variety. The lines selected in the field were planted by themselves in bags of the main cluster of each plant. The maturity of the self-control plants was individually cultivated and the seeds were cataloged and stored to ensure that the source of the seed is known. The self-pollinated M3 seeds and Westar controls were analyzed in volume samples of 20 seeds for the composition of fatty acids via gas chromatography. The statistical thresholds for each fatty acid component were established using a Z distribution with a resistance level of 1 in 10,000. The mean and normal deviation were determined from the Westar control population not mutagenized in the field. The upper and lower statistical thresholds of each fatty acid were determined from the mean value of the population + the normal deviation, multiplied by the Z distribution. Based on a "population size of 10,000, the confidential range is 99.99%. Selected M3 were planted in the greenhouse along the Westar controls.The seed was planted on 10.16 cm plots containing the Pro-Mix soil and the plants were kept at 25 ° C / 15 ° C, 14/10 day / night cycles in the greenhouse Flowering, the terminal cluster self-pollinated into bags The maturity of the self-control M4 was individually cultivated in each plant, marked and stored to ensure that the seed source was known The M4 seed was analyzed in bulky samples of 10 seeds. The statistical thresholds for each fatty acid component were established from 259 control samples using a Z distribution of 1 in 800. The selected M4 lines were planted in a trial field of Carman, Manitoba in 3 meter rows with 15.24 cm space. Ten M plants in each row are placed in a bag for self-pollination. Maturity, self-control plants in the row were harvested by volume. Ms seed from single-plant selections was analyzed in volume samples of 10 seeds and row cultivation in volume in volume samples of 50 seeds. The selected M5 lines were planted in the greenhouse along the Westar controls. The seed was developed as previously described. The flowering in the terminal cluster self-pollinated in bags. The maturity of the M6 self-control seeds were cultivated individually in each plant and analyzed in volume samples of 10 seeds for the composition of fatty acids. The selected M6 lines are within field characteristics in Eastern Idaho. The four feature locations were selected from a wide variety of development conditions. Locations include Buley, Tetonia, Lamont and Shelley (Table 7). The lines were planted in four rows of 3 meters with a space of 15.24 cm. Each plot was replicated four times. The plantation design was determined using a Complete Block Design in Random form. The commercial Westar culture was used as a control culture. The maturity of the plots was harvested to determine the yield. The performance of the entries in the characteristics was determined by taking the statistical average of four replications. The Last Significant Difference was used to randomly classify the entries in the complete block design Table 7 Characteristic Locations for Selected Fatty Acid Mutants LOCATION SITE FEATURES BURLEY Irrigated. Short season High temperatures during flowering TETON IA Dry land. Short season Cold temperatures. LEMONT Dry land. Short season Cold Temperature. SH ELLEY Irrigated. Mid season Atlas temperatures during flowering.

To determine the fatty acid profile of the plant entries in each plot, it was placed in bags for self-pollination. The M7 seed of single plants was analyzed for fatty acids in samples of ten seed volume.

To determine the genetic relationships of the selected fatty acid mutants were made. The flowers of M6 or the situations of the last generation were used in the crossing. The F-seed was cultured and analyzed for fatty acid composition to determine the mode of gene action. The progeny of F were planted in the greenhouse. The resulting plants were self-pollinated, the seeds of F2 were cultured and analyzed for fatty acid composition for alelism studies. The seed of F2 and the seed of mother line was planted in the greenhouse, the individual plants were self-pollinated. The F3 seed of individual plants was tested for fatty acid composition using 10-seed volume samples as previously described. In the analysis of some generic relationships, the dihaploid populations were made from the micropores of the Fi hybrids. The self-pollinated seed of dihaploid plants was analyzed for fatty acid analysis using the previously described methods. For chemical analysis, the volume samples of 10 seeds were developed in a hard way with a glass rod in a polypropylene tube of 15 μL and extracted in 1.2 mL of 0.25 N KOH in 1: 1 ether / methanol. . The sample was stirred for 30 seconds and heated for 60 seconds in a water bath at 60 ° C. Four mL of saturated NaCl and 2.4 mL of iso-octane were added, and the mixture was stirred again. The 600 μl phase separation of the upper organic phase was pipetted into individual flasks and stored under nitrogen at -5 ° C. The samples of 1 μL were injected into a capillary column of fused silica Supelco SP-2330 (0.25 mM I D, 30 M length, 0.20 μm df). Gas chromatography was 180 ° C for 5.5 minutes, then it was programmed for an increase of 2 ° C / minute at 212 ° C and held at this temperature for 1.5 minutes. The total turnaround time was 23 minutes. The chromatography graduation was: head pressure of the column - 1.05 kg / cm2, column flow (He) - 0.7 mL / min. Auxiliary and Column Flow - 33 mL / min. , Hydrogen flow - 33 mL / min. , Air flow - 400 mL / min. , Injector temperature -250 ° C, Detector temperature - 300 ° C, Opening ventilation -1/15. Table 8 describes the upper and lower statistical thresholds for each fatty acid of interest.

Table 8 Statistical Thresholds for Specific Fatty Acids Derived from Westar Control Plants Percentage of Fatty Acids Genotype Ci 6.0 '18.0' 1 8.1 C-18; C i 8.3 Sats. * Generation M3 (rejection rate 1 in 10, 000) Inferior 3.3 1 .4 - 13.2 5.3 6.3 Superior 4.3 2.5 71 .0 21 .6 9.9 8.3 Generation M4 (rejection rate 1 in 800) Inferior 3.6 0.8 - 12.2 3.2 5.3 Superior 6.3 3.1 76.0 32.4 9.9 1 1 .2 Generation M5 (rejection rate 1 in 755) Inferior 2.7 0.9 - 9.6 2.6 4.5 Superior 5.7 2.7 80.3 26.7 9.6 10.0 * Sats. = Total Saturated Content EJ EM PLO 2 High Oleic Acid Cañola Lines In the studies of Example 1, in the M3 generation, 31 lines exceeded the upper statistical threshold for oleic acid (> 71 .0%). Line W7608.3 has 71.2% oleic acid. In generation M4, its same progeny (W7608.3.5, given its designation A129.5) continues to exceed the upper statistical threshold for C18:? with 78.8% oleic acid. The M5 seeds of five self-pollinated plants of line A19.5 (ATCC 4081 1) averaged with 75.0% oleic acid. A single-plant selection, A129.5.3 has 75.6% oleic acid. The fatty acid composition of this mutant of high oleic acid, which was stable under field and greenhouse conditions in the M7 generation in the field features at multiple locations. All locations of self-pollinated plants (A129) 78.3% average oleic acid. The fatty acid compositions of A129 for each location characteristic of Idaho are summarized in Table 10. In the multiple replicon location for performance characteristics A129 were not significantly different in the Westar culture yield of the mother. Canola oil from A 129, after commercial processing, was found to have superior oxidative stability compared to Westar when measured by the Accelerated Oxygen Method (AOM), American Oil Chemists' Society Official Method Cd 12-57 for stability of fat; the Active Oxygen Method (revised in 1989). The Westar AOM was 18 hours from AOM and for A 129 it was 30 hours from AOM.

TABLE 9 Fatty Acid Composition of Cañala Flax with High Oleic Acid Content Produced by Seed Mutagenesis Fatty Acid Percentage Genotype Ci 6.0 Ci 8.0 d 8.1 Ci 8.2 Ci 8.3 Sats.

Westar 3.9 1.9 67.5 17.6 7.4 7.0 W7608.3 3.9 2.4 71.2 12.7 6.1 7.6 (M3) W7608.3.5 3.9 2.0 78.8 7.7 3.9 7.3 (M4) A129.5.3 3.8 2.3 75.6 9.5 4.9 7.6 (M5) Sats. = Total Saturated Content TABLE 10 Fatty Acid Composition of a Mutant Top Oleic Acid Flax at Different Field Locations in Idaho • Fatty Acid Percentage Location C-16.0 Cl ß.O C? 8.? Cl8.2 Cl 8.3 Sats. * Burley 3.3 2. 1 77.5 8. 1 6.0 6.5 Tetonia 3.5 3.4 77.8 6.5 4.7 8.5 10 Lamont 3.4 1 .9 77.8 7.4 6.5 6.3 Shelley 3.3 2.6 80.0 5.7 4.5 1.1 Sats. = Total Saturated Content The generic relation of the higher oleic acid mutation A129 in other desaturases of oleic acid was demonstrated in crosses • facts for commercial cane crops and a mutation of low linoleic acid. A129 crossed with the commercial crop Global (C? 6: o - 4.5%, C18: 0 - 1.5%, c18: 1 -62.9%, C? 8: 2 - 20.0%, C? 8: 3 - 7.3%) . approximately 200 individual F2 were analyzed for composition of fatty acids. The results are summarized in Table 1 1. The form of segregation of the 1: 2: 1 ratio suggests a simple co-dominant gene that controls the inheritance of the high oleic acid phenotype.

TABLE 1 1 Genetic Studies of A129 X Global Frequency Genotype Content C-is.o (%) Observed Expected od-od- 77.3 43 47 od-od + 71 .7 106 94 od + od + 66.1 49 47 A cross between A129 and IMC 01, a variety with a low content of linolenic acid (C? 6: o - 4.1%, C? 8: 0 - 1.9, C? 8: - 66.4%, C? 8: 2 - 18 : 1%, C? 8: 3 - 5.7%), was done to determine the inheritance of the oleic acid desaturase and linoleic acid desaturase. If Fi hybrids both the oleic acid desaturase and the linoleic acid genes are focused on the mean stock values indicating the actions of a co-dominant gene. The fatty acid analysis of the individual F2 confirmed a segregation of 1: 2: 1: 2: 4: 2: 1: 2: 1 of two independent co-dominant genes (Table 12). One line is selected from the cross of A129 and IMC01 and is designed as IMC130 (ATCC deposit No. 75446) as described in Patent Application No. 08/425, 108, incorporated herein by reference.

TABLE 12 Genetic Studies of A129 X IMC 01 Frequency Genotype Relation Observed Expected od-od-ld-ld- 1 11 12 od-od-ld-ld + 2 30 24 od-od-ld + ld- 1 10 12 od-od + ld-ld- 2 25 24 od -od + ld-ld + 4 54 47 od-od + ld + ld + 2 18 24 od + od + ld-ld- 1 7 12 od + od + ld-Id - * - 2 25 24 od - * - od + ld + ld + 1 8 12 An additional high oleic acid line, designed A128.3, was also produced by the method described. A volume analysis of 50 seeds of this line was shown after fatty acid composition: C16: 0 - 3.5%, C? 8: 0 - 1.8%, C? 8: 1 - 77.3%, C18; 2 - 9.0 %, C18: 3 - 5.6%. Sats. FDA 5-3%, Sats. Total 6-4%. This line also stably maintained its mutant fatty acid composition in the M7 generation. In multiple locations replicated in performance characteristics, A128 was not significantly different in the performance of the Westar mother crop.

A129 crossed with A128.3 for studies of allelism. The fatty acid composition of the F2 seed was shown in two lines to be allelic. Mutational events in A129 and A128.3 although they differed in origin were in the same gene. A line with a high content of additional oleic acid, designated M3028.-10 (ATCC 75026), was also produced by the method described in Example 1. The volume analysis of 10 seeds of this line showed the following fatty acid composition: C16: o - 3.5%, C18: o - 1.8%, C18:? - 77.3%, C? 8: 2 - 9.0%, C? 8: 3 -5.6%, Saturated by FDA - 5.3%, Total Saturated - 6.4%. In a single-location replicated performance feature M3028.10 was not significantly different in performance with the Westar mother culture. EX EMPLO 3 Cañola with low content of Linoleic Acid In the studies of Example 1, in the M3 generation, 80 lines exceeded the lower statistical threshold for linoleic acid (<; .13.2%). Line W12638.8 had 9.4% linoleic acid. In generations M4 and M5, their self-control progenies [W12638.8, designated A133.1 (ATCC 40812)] continued to exceed the statistical threshold for low C? 8: 2 with linoleic acid levels of 10.2% and 8.4% , respectively. The fatty acid composition of this low linoleic acid moiety, which was stable in the M7 generation under field and greenhouse conditions, is summarized in Table 12. In the multiplied location that replicates the performance characteristics, A133 was not significantly different in the yield of the mother Westar Culture. A line of low linoleic acid, designated M3062.8 (ATCC 75025), was also produced by the method described. A volume analysis of 10 seeds of this line showed the following fatty acid composition: C? 6: o - 3.8%, C? 8: 0 - 2.3%, Ciß: i - 77.1%, C? 8: 2 - 8.9 %, C? 8: 3 -4.3%, Sats. of FDA 6.1%. This line also remained stable in its composition of fatty acids in the field and greenhouse. TABLE 13 Fatty Acid Composition of a Cañola Flax with High Content of Linoleic Acid Produced by Seed Mutagenesis Percentage of Fatty Acids Genotype '16 .0 '18 .0 18.1 C 8.2 '18 .3 Sats1 Westar 3.9 1.9 67.5 17.6 7.4 7.0 W7638.8 3.9 2.3 75.0 9.4 6.1 7.5 (M3) W12638.8.1 4.1 1.7 74.6 10.2 5.9 7.1 (M4) A133.1.8 3.8 2.0 77.7 8.4 5.0 7.0 (M5) aLets and numbers of the second decimal point that indicate the plant line. The Number after the second decimal point indicates an individual plant Sats. = Total Saturated Content EXAMPLE 4 Cañola of Linoleic Acid and Low Linoleic In the studies of Example 1, in generation M3, 57 lines exceeded the lower statistical threshold for linolenic acid (< 5.3%). Line W14749 has 5.3% linolenic acid and 15.0% linoleic acid. In generation M and M5, their self-control progenies [W14749.8, given that it is designated M3032 (ATCC 75021)] continue to exceed the statistical threshold for C18: 3 with linolenic acid levels of 2.7% and 2.3%, respectively, and for a lower amount of linolenic and linoleic acids with totals of 1 1 .8% and 12. 5% respectively. The fatty acid composition of this low linoleic acid plus the linoleic acid mutant, which was stable in the M5 generation under field and greenhouse conditions, is summarized in Table 4. In a single location that replicates the performance characteristic M3032 was not significantly different in the yield of the mother crop (Westar).

TABLE 14 Fatty Acid Composition of a Linaza de Cañóla with Low Linolenic Acid Content Produced by Seed Mutagenesis Percentage of Fatty Acids Genotype C 16.0 Cl8.0 C 8.1 C18.2 C18.3 Sats * Westar 3.9 1.9 67.5 17.6 7.4 7.0 W14749.8 4.0 2.5 69.4 15.0 5.3 6.5 (M3) M3032.8 3.9 2.4 77.9 9.1 2.7 6.4 (M4) M3032.1 3.5 2.8 80.0 10.2 2.3 6.5 (M5) Sats = Total Saturated Content EXAMPLE 5 Cañola lines Q508 v Q4275 The seeds of the IMC-129 line of B. napus were mutagenized with methyl N-nitrosoguanidine (MNNG). The MNNG treatment consists of three parts: pre-soaking, mutagens and washing. A buffer solution of Sorenson 0.05M phosphate was used to maintain the pre-soaking and treatment of mutagens from pH to 6.1. Two hundred seeds were treated at one time on filter paper (Whatman # 3M) in a petri dish (100mm x 15 mm). The seed was pre-soaked in 15 ml of Sorenson buffer solution 0.05M, pH 6.1, under continuous stirring for two hours. At the end of the pre-soaking period, the solution was removed from the plate. A concentration of 10 mM MNNG in Sorenson 0.05M buffer, pH 6.1, was prepared before use. Fifteen ml of MN NG of 10 mm were added to the seeds in each plate. The seeds were incubated at 22 ° C + 3 ° C in the dark under constant agitation for four (4) hours. At the end of the incubation period, the mutagen solution was removed. The seeds were washed with three changes of distilled water at 10 minute intervals. The fourth wash was for thirty minutes. This treatment regimen produced in the LD60 population. The treated seeds were planted in normal plant and greenhouse soil and were clocated in an environmentally controlled greenhouse. The plants developed under the light for sixteen hours. At flowering, the bunches were placed in bags to produce the seed of the mass. Upon maturity, the M2 seed was grown. Each line M2 gave an identification number. The seed population treated with total MNNG was designated as the Q series. Cultivated M2 seeds were planted in the greenhouse. The conditions of development were maintained as described precisely. The racemates were placed in bags in flowering for self-control. Upon maturation, the M3 seed of self-control was cultured and analyzed for the composition of fatty acids. For each M3 seed line, approximately 10-15 seeds were analyzed by volume as described in Example 1. The M3 lines of low high linoleic oleic acid were selected from the M3 population using a >limit82% oleic acid and < 5.05 of linoleic. Since the first 1600 M3 lines were plugged for the fatty acid composition, Q508 was identified. The M3 generation of Q508 was advanced in the M4 generation in the greenhouse. Table 15 shows the fatty acid composition of Q508 and BMI 129. The M4 seed of self-control maintained the phenotype with high content of oleic acid and low content of linoleic acid (Table 16). TABLE 15 Composition of Fatty Acids of A129 and Mutant W508 of High Oleic Acid Line # 16: 0 1 8: 0 1 8: 1 1 8: 2 1 8: 3 A 129 * 4.0 2.4 77.7 7.8 4.2 Q508 3.9 2. 1 84.9 2.4 2.9 * Fatty acid composition of A129 is the average growth of 50 self-pollinated plants with the M3 population.

The Q508 plants of generation M have poor agronomic qualities in the field compared with Westar. Normal plants were allowed to develop in relation to Westar, lacked vegetative vigor, were short in stature, have to be chlorotic and have short shells. The performance of Q508 was very little compared to Westar. Q508 plants of generation M in greenhouse tend to be reduced in vigor compared to Westar. However, the Q508 yields in the greenhouse were greater than the 40 Q508 yields in the field. TABLE 16 Fatty Acid Composition of Seed Oil, IMC 129 and Westar Q508 Development in Greenhouse Average of 50 self-pollinated plants Data of Example 1 cAverage of 50 self-pollinated plants No other lines with M4 with high oleic acid content and low linoleic acid content were also identified: Q3603, Q3733, Q4249, Q6284, Q6601, Q6761, Q7415, Q4275 and Q6676. Some of these lines have good agronomic characteristics and a high oleic acid level in seeds of about 80% to about 84%. Q4275 was crossed with the variety of Cyclones. After autonomy for seven generations mature seeds were grown from 93GS34-179, a progeny line from the Cyclones crossing of Q4275. Referring to Table 17, the fatty acid composition of a seed sample by volume showed that 93GS34 retained the seed of the fatty acid composition of Q4275. 93GS34-179 also maintains agronomically desirable characteristics. After more than seven generations of self-control of Q4275, the plants of Q4275, IMC 129 and 93GS34 were developed in the field during the summer season. The selections were tested on 4 replicate plots (5 feet X 20 feet) in a random block design. Each plot was harvested at maturity, and a sample of the volume of cultivated seeds of each line was analyzed for the composition of fatty acids as described above. The fatty acid compositions of the selected lines are shown in Table 17.

TABLE 17 Fatty Acid Composition of Seeds of IM 129. Q4275 and 93GS34 of Field Development The results shown in Table 17 show that Q4265 maintains the phenotype with high oleic content and low linoleic content selected under field conditions. The agronomic characteristics of plants Q4275 were superior to those of Q508. The Q508 plants of generation M were crossed in a dihaploid selection of Westar, with Westar serving as the female kin. The resulting F1 seed was called the 92EF population. Approximately 126 F 1 individuals that appear to have agronomic characteristics better than the mother Q508 were selected for self-monitoring. A portion of the F2 seed of said individual were replanted in the field. Each plant F2 was self-controlled and a portion of the resulting F3 seed was analyzed for the fatty acid composition. The content of oleic acid in the F3 seed varies from 59 to 79%. Individuals without higher oleic acid (> 80%) recovered with good agronomic type. A portion of the F2 seed from the 92EF population was planted in the greenhouse to analyze the genetics of line Q508. The F3 seed was analyzed from the individual 380 F2. The levels of C? 8 :? of the F3 seed of the greenhouse experiment is described in Figure 1. The data were tested against the hypothesis that Q508 contains two mutant genes that are semi-dominant and additive: the original IMC 129 mutation as well as an additional mutation. The hypothesis also assumes that Q508 homozygous have more than 85% oleic acid and homozygous Westar having 62-67% oleic acid. The possible genotypes of each gene in a crossing of Q508 by Westar can be designated as follows: AA = Westar Fad2a BB = Westar Fa2b aa = Q508 Fad2a bb = Q508 Fad2b Assuming independent segregation, a 1: 4: 6: 4: 1 ratio of the phenotypes is expected. The phenotypes of heterozygous plants are assumed to be indistinguishable and, therefore, the data were tested for the form of a 1: 14: 1 ratio of Westar homozygous: Heterozygous plants: homozygous Q508.

Relation # of Fenotypic Alleles Westar Genotype 1 4 AABB (Westar) 4 3 AABb, AaBB, AABb, AaBB 6 2 AaBb, Aabb, AaBb, AaBb, aaBB, AaBb 4 1 Aabb, aaBb, Aabb, aaBb 1 0 aabb (Q508) 0 Using the Xi-square analysis, the oleic acid data in the form of a 1: 14 ratio: 1. It was concluded that Q508 differs from Westar by two major genes that are semi-dominant and additive and independently segregated. By comparison, the BMI 129 genotype is aaBB. The representative individual F3 fatty acid composition has more than 85% oleic acid in the seed oil, as shown in Table 18. Saturated fatty acid levels are observed to decrease in said plants, compared to Westar.

TABLE 18 92EF F3 Individuals with > 85% Ciaren Seed Oil EXAMPLE 6 Fatty Acid Profiles of Leaves and Roots of Cañola Lines IMC-129, Q508 and Westar The plants of Q508, IMC 129 and Westar were grown in greenhouses. The mature leaves, primary expansion leaves, petioles and roots were grown in the middle stage of 6-8 were frozen in liquid nitrogen and stored at -70 ° C. The lipid extracts were analyzed by CGL as described in Example 1. The fatty acid profile data are shown in Table 19. The data in Table 19 indicate that the total leaf lipids in Q508 are superior in content of C? 8:? that the contents of C? 8: 2 plus C? 8: 3. The inverse is true for Westar and BMI 129. The difference in total leaf lipids between Q508 and BMI 129 is consistent with the hypothesis that a second Fad2 gene is mutated with Q508. The content of C? 6.-3 is the fraction of total lipids of approximately the same three lines, suggesting that the FadC gene product of plastids that is not affected by mutations with Q508. To confirm that the FadC gene was not mutated, the chloroplast lipids were separated and analyzed. There were no changes in the fatty acids of C? 6 :? , C? 6: 2 or C16: 3 chloroplasts were detected in all three lines. The similarity in the lipids of plastid leaves between Q508, Westar and IMC 129 is consistent with the hypothesis that the second mutation in Q508 affects a microsomal Fad2 gene and not a FadC gene of plastids.

Table 1 9 EJ EM PLO 7 Sequences of Delta-1 2 Mutant and Wild-type Desaturases of B. napus The specific primers for the structural gene FAD2 were used to clone the total open reading frame (ORF) of the delta-12 D and F desaturase genes by reverse transcriptase polymerase chain reaction (RCP-TI). ). The RNA from the seeds of IMC 129, Q508 and Westar plants was isolated by normal methods and used as the standard. Fragments of amplified with TI were used for the determination of nucleotide sequence. The DNA sequence of each gene of each line was determined by both strands by the methods of normal dose sequences. The sequence analysis revealed a transversion from G to A in the 316 nucleotides (from the translation of the initiation codon) of the gene in IMC 129 and Q508. Compared with the Westar sequences. The transversion changes of the codon in the position of GAG to AAG and the results in a conservative subtraction of glutamic acid, an acidic residue, for lysine of a basic residue. The presence of the same mutation in both lines was expected because the Q508 line was derived from BMI 129. The same base change was also detected in Q508 and BMI 129 when the RNA from the leaf tissue was used as a standard. The mutation from G to A in the 316 nucleotides was confirmed by the sequencing of independent clones containing directly amplified fragments of genomic DNA from IMC 129 and Westar. These results eliminated the possibility of a rare mutation introduced during reverse transcription and PCR in the PCR-TI protocol. It was concluded that the mutant of I MC 129 is due to a single base transversion in the 316 nucleotides in the coding region of the D gene of the rapeseed delta-12 microsomal desaturase. A single base transition from T to A in the 51 5 nucleotides of the F gene was detected in Q508 compared to the Westar sequence. Mutation changes of the codon in this position from CTC to CAC, resulted in the non-conservative substitution of a non-polar residue, leucine, for a polar residue, histidine, in the resulting gene product. Mutations were placed in the sequence of the F gene of IMC 129 compadro with the sequence of the F gene of Westar. These support data conclude that a mutation in a sequence of the delta-12 desaturase gene results in alterations in the fatty acid profile of plants containing said mutated gene. In addition, the data shown that when a plant or species line contains two delta-12 desaturase sites, the fatty acid profile of an individual having two mutated sites different from the fatty acid profile of an individual having a mutated site . The mutation in gene D of IMC 129 and Q508 was mapped to a region that has a conserved amino acid motif (His-Xaa-Xaa-Xaa-His) found a desaturases bound to delta 12 and delta-15 membrane (Table 20 ).

TABLE 20 Alignment of the Amino Acid Sequences of the Desaturases Linked to the Cloned Cañóla Membrane (FadD = Delta 15 of Plastids, Fad3 = Delta-15 Microsomal), (FadC = Delta-12 of Plastids, Fad2 = Delta-12 Microsomal) a One letter of the amino acid code; conservative substitutions are underlined; the non-conservative substitutions are in bold type.

EJ EM PLO 8 Transcription and Translation of Desaturases of Delta-12 Fatty Acid Microsomal In vivo transcription was analyzed by PCR-TI analysis of stage I and stage II development seeds and leaf tissue. The primers were used to specifically amplify the delta-12 desaturase F gene RNA from the indicated tissues wherein the primer sense 5'-GGATATGATGATGGTGAAAGA-3 'and the primer counter-sense S'-TCTTTCACCATCATCATATCC-S'. The primers used to specifically amplify the delta-12 desaturase D gene RNA of the indicated tissues was the sense of the primer 5'-GTTATGAAGCAAAGAAGAAAC-3 'and the counter-sense of the initiator 50-GTTTCTTCTTTGCTTCATAAC-3'. The results indicated that the mRNA of the D and F genes were expressed in the seed and tissues of hours of BMI 129, Q508 and Westar wild type plants. In vitro transcription and translation analysis showed that a peptide of approximately 46 kD was made. This is the expected size of the D gene product and the F gene product, based on the sum of the deduced amino acid sequence of each gene and the co-translational addition of the microsomal membrane peptide. These results ruled out the possibility of nonsense or tag change mutations, which result from a truncated polypeptide gene product, are present in the mutant D gene or mutant F gene. The data, in conjunction with the data of Example 7, support the conclusion that the mutations in Q508 and I MC 129 are in the delta-12 fatty acid desaturase structural genes that encode the desaturase enzyme, rather than the regulatory genes .

EXAMPLE 9 Development of Gene-Specific PCR Markers Based on the single-base changes in the IMC 129 mutant D gene described above, two PCR 50 primers were designated. The nucleotide sequence of the primers differentiated only at the base (G for Westar and A for IMC 129) at end 30. The primers allow one to distinguish between the mutant fad2-D and wild-type Fad2-D alleles in a DNA-based PCR analysis. There is only a single base difference in the PCR primers 50, the PCR analysis is very sensitive to the PCR conditions such as the tempered temperature, cycle number, amount and purity of the DNA plants used. The conditions of analysis have been established to distinguish between the mutant gene and the wild-type gene using the genomic DNA of IMC 129 and the wild-type plants as standards. The conditions can be further optimized by varying the relationships of PCR, particularly with variable curd DNA samples. A PCR analysis that distinguishes the single-base mutation in IMC 129 from the wild-type gene together with an analysis of the fatty acid composition that provides a means to simplify the segregation and selection of genetic cross-analysis involving the plants that it has a delta-12 fatty acid desaturase mutation.

Example 10 Transformation with Mutant and Wild-type Fad3 Genes The Westar culture of B. napus was transformed with the mutant and wild-type Fad3 genes to demonstrate that the mutant Fad3 gene for the cytoplasmic linoleic acid desaturase of canola delta 15 is not functional. Transformation and regeneration were carried out using unarmored Agrobacterium tumefaciens essentially after the procedure described in WO 94/11516. Two strains of disarmed Agrobacterium were treated, each containing a Ti plastid having an appropriate gene linked to a seed-specific promoter and corresponding termination sequences. The first plasmid, plMC110, was prepared by inserting it into a disassembled Ti vector of the full-length wild type Fad3 gene in sense of orientation (nucleotides 208 to 1336 of SEQ ID 6, in WO 93/11245), flanked by a placed napin promoter sequence in 5 'of the Fad3 gene and a napin termination sequence placed in 3' of the Fad3 gene. The rapeseed napkin promoter is described in EP 0255378. The second plasmid, plMC205, was prepared by inserting a mutated Fad3 gene in sense orientation into the disassembled Ti vector. The mutant sequence containing the mutations at nuclei 411 and 413 of the microsomal Fad3 gene described in WO93 / 11245, thus changing the sequence for codon 96 from GAC to AAG. The amino acid in codon 96 of the gene product was thus changed from aspartic acid to lisian. See Table 20. A bean Phaseolus (Phaseolus vulgaris) (stored protein of the 7S seed) the promoter fragment of 495 patient pairs, starting with 5'-TGGTCTTTTGGT-3 \ slipped into 50 in the mutant Fad3 5 gene and a phaseolin termination sequence was placed in 30 in the mutant Fad3 gene. The phaseolin sequence is described in Doyle et al., (1986) J. Biol. Chem. 261: 9228-9238) and Slightom et al. (1983) Proc. Nati Acad. Sci. USA 80: 1897-1901. The appropriate plasmids were treated and transferred by • 10 separated to strain LBA4404 of Agrobacterium. Each treated strain was used to infect 5mm segments of hypocotyle explants from Westar seeds by co-cultivation. The infected hypocotyledons were transferred to callus media and, subsequently, to regeneration medium. One times the stems discernible formed from the calluses, the buds were removed and • transferred to a medium of elongation. The elongated shoots were cut, put into Rootone ™, rooted in an agar medium and transplanted into a potted soil to obtain fertile T1 plants. The T2 seeds were obtained by self-control of the resulting T1 plants. The fatty acid analysis of the T2 seeds was carried out as described above. The results are summarized in Table 21. From the 40 transformants obtained using plasmid plMC1 10, 17 plants demonstrated the fatty acid profiles type wild and 16 showed over-expression. A proportion of the transformants was expected to exhibit an over-expression phenotype when a functioning gene was transformed into sense orientation in plants. Of the 307 transformed plants that have the plMC205 gene, no one exhibits a fatty acid composition indicative of overexpression. This result indicates the product of the mutant Fad3 gene is not functional, because one of the transformants could be exhibited in an over-expression phenotype if the gene product is functional. TABLE 21 Events of Overexpression and Co-suppression in Westar Populations Transformed with PIMC205 or PIMC110.

The fatty acid compositions of representative transformed plants are presented in Table 22. Lines 652-09 and 663-40 are representative of plants containing plMC1 and exhibit an over-expression and co-deletion genotype, respectively, line 205-284 are representative of plants containing pl MC205 and having the mutant Fad3 gene.

TABLE 22 Fatty Acid Composition of Westar T2 Seed Transformed with plMC205 or plMC110.

EXAMPLE 11 Sequences of Fad2-D and Fad2-F Wild Types and Mutants High molecular weight genomic DNA was isolated from the leaves of plants Q4275 (Example 5) and plants from canola Westar and Bridger. This DNA was used as a standard for the amplification of the Fad2-D and Fad2-F genes by the polymerase chain reaction (PCR). The PCR amplifications were carried out in a total volume of 100 μl and contained 0.3 μ of genomic DNA, 200 μM of deoxyribonucleoside triphosphate, 3 mM of MgSO4, 1-2 DNA polymerase units and 1X Regulatory Solution (supplied by the manufacturer of DNA polymerase). The cycle conditions were: 1 cycle for 1 minute at 95 ° C, followed by 30 cycles of 1 minute at 94 ° C, 2 minutes at 55 ° C and 3 minutes at 73 ° C.

The Fad2-D gene was amplified once using Elongasa® (Gibco-BRL). The PCR initiators were: CAUCAUCUCUCTTCTTCGTAGGGTTCATCG (SEQ ID NO: 23) and CUACUACUACUATCATAGAAGAGAAAGGTTCAG (SEQ ID NO: 24) for the 5 'and 3' ends of the gene, respectively. The Fad2-F gene was independently amplified 4 times, two with Elongasa® and two with Taq polymerase (Boehringer Mannheim). The PCR primers used were: CAUCAUCAUCAUCATGGGTGGGTGCACGTGGAAGAAS '(SEQ ID NO: 25) and 5'CUACUACUCUATCTTTCACCATCATCATATCC3' (SEQ ID NO: 26) for the 5 'and 3' ends of the gene, respectively. The amplified DNA products were resolved on an agarose gel, purified by JetSorb® and then annealed in pAMP1 (Gibco-BRL) via the sequences (CAU) and (CUA) 4 at the ends of the primers, and transformed into DH5a from E. coli. The inserts of Fad2-D and Fad2-F were sequenced on both threads with an ABL PRISM 310 automatic sequencer (Perkin-Elmer) following the directions of the manufacturer, using the synthetic primers, the AmpliTaq® DNA polymerase and the color terminator.

The Fad2-D gene was found in the introns-like sequences upstream of the ATG start codon (SEQ ID NO: 30 and SEQ ID NO: 31). As expected, the coding sequence of the gene derived from IMC 129 that contains a mutation from G to A in nucleotide 316 (Figure 2).

A single-base transversion from G to A at nucleotide 908 was detected in the sequence of the F gene of the products amplified with Q4275, in comparison with the wild-type F gene sequence (Figure 2). These change of codon mutation to amino acid 303 from GGA to GAA, results in the non-conservative substitution of a glutamic acid residue for a glycine residue (Table 3 and Figure 3). The expression of the mutant Q4275 Fad2-F delta-12 desaturase gene in plants that alter the fatty acid composition, as described above. EXAMPLE 12 Wild-type Fad2-U Sequence A high molecular weight genomic DNA was isolated from the leaves of the Brassica Bridger and Westar plants by normal methods. The Fad2-U gene was amplified in a total reaction of 100 μL containing 1 μM of each primer, 0.3 μg of genomic DNA, 200 μM of dNTP, 3 mM of MgSO, 1x of Regulatory Solution (supplied by the manufacturer of the DNA polymerase), and 1-2 units of DNA elongase polymerase (BRL). The amplification conditions include a cycle for 1 minute at 95 ° C, 30 cycles of denaturation at 94 ° C for 1 minute, annealing at 55 ° C for 2 minutes, and elongation at 72 ° C for 3 minutes. Subsequently, the reaction was incubated at 72 ° C for an additional 10 minutes. The Fad2U gene was amplified twice from Westar and twice with Bridger genomic DNA using the following primers: 5 '5' end primer (CAU) 4CTTCTTCGTAGGGTTCATCG3 '(SEQ ID NO: 23) 3' 5 'end primer (CUA ) 4CATAACTTATTGTTGTACCAG3 '(SEQ ID NO: 27) The amplified DNA products were purified and sequenced as described in Example 11. The Fad2-U sequence containing an introns-like sequence upstream of the ATG start codon (SEQ ID NO: 28). To the extent that it is not yet indicated, it should be understood by those with ordinary experience in the field that any of the variations of the specific embodiments described and illustrated herein may be further modified to incorporate aspects shown in other specific modalities. The above detailed description has been provided only for a better understanding of the invention and should not be unnecessarily understood as a limitation thereof since some modifications will be apparent to those skilled in the art without departing from the spirit and scope of the appended claims.

LIST OF SEQUENCES (1) GENERAL INFORMATION (i) APPLICANT: CARGILL, INCORPORATED (ii) TITLE OF THE INVENTION: FATTY ACID DISATURANCES AND MUTATING SEQUENCES THEREOF (iii) NUMBER OF SEQUENCES: 31 (iv) CORRESPONDING ADDRESS: (A) ) RECIPIENT: Fish & Richardson P.C., P.A. (B) STREET: 60 South Sixth Street, Suite 3300 (C) CITY: Minneapolis (D) STATE: MN (E) COUNTRY: USA (F) C.P. 55402 (v) COMPUTER LEADABLE FORM: (A) TYPE OF MEDIA: Disk (B) COMPUTER: Compatible with IBM (D) OPERATING SYSTEM: DOS (D) SOFTWARE: FastSEQ for Windows Version 2.0 (vi) APPLICATION DATA CURRENT: (A) NUMBER OF APPLICATION: (B) DATE OF SUBMISSION: 11-JUN1O-97 (C) CLASSIFICATION: (vii) INFORMATION OF POWDER / AGENT: (A) NAME: Lundquist, Ronald c (B) REGISTRATION NUMBER : 37,875 (C) REFERENCE NUMBER / CASE: 07148 / 067WOI (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 612-335-5070 (B) TELEFAX: 612-288-9696 (C) TELEX: (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1155 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE : DNA (iii) HYPOTHETICAL: YES (iv) CONTRASTING: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Brassica napus (ix) CHARACTERISTICS: (D) OTHER INFORMATION: Fad2 Wild type. (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1 ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAG AAG TCT 48 Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 GAA ACC GAC ACC ATC AAG CGC GTA CCC TGC GAG AC CCG CCC TTC ACT 96 Glu Thr Asp Thr lie Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 GTC GGA GAA CTC AAA GCA ATC CCA CCG CAC TGT TTC AAA CGC TCG 144 Val Gly Glu Leu Lys Lye Ala lie Pro Pro His Cys Phe Lys Arg Ser 35 40 45 ATC CCT CGC TCT TTC TCC TAC CTC ATC TGG GAC ATC ATC ATA GCC TCC 192 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Ser 50 55 60 TGC TTC TAC TAC NTC GCC ACC ACT TAC TTC CCT CTC CTC CCT CAC CCT 240 Cys Phe Tyr Tyr Xaa Ala Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 CTC TCC TAC TTC GCC TGG CCT CTC TAC TGG GCC TGC CAG GGG TGC GTC 288 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 CTA ACC GGC GTC TGG GTC ATA GCC CAC GAA TGC GGC CAC CAC GCC TTC 336 Leu Thr Gly Val Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 AGC GAC TAC CAG TGG CTT GAC GAC ACC GTC GGT CTC ATC TTC CAC TCC 384 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 TTC CTC CTC GTC CCT TAC TTC TCC TGG AAG TAC AGT CAT CGC AGC CAC 432 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Ser His 130 X35 140 CAT TCC AAC ACT GGC TCC CTC GAG AGA GAC GAA GTG TTT GTC CCC AAG 480 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 AAG AAG TCA GAC ATC AAG TGG TAC GGC AAG TAC CTC AAC AAC CCT TTG 528 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 GGA CGC ACC GTG ATG TTA ACG GTT CAG TTC ACT CTC GGC TGG CCG TTG 576 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 TAC TTA GCC TTC AAC GTC TCG GGA AGA CCT TAC GAC GGC GGC TTC CGT 62 Tyr Leu Wing Phe Aen Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Arg 195 200 205 TGC CAT TTC CAC CCC AAC GCT CCC ATC TAC AAC GAC CGC GAG CGT CTC 672 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 CAG ATA TAC ATC CC GAC GCT GGC ATC CTC GTC GTC TGC TAC GGT CTC 720 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 TTC CGT TAC GCC GCC GGC CAG GGA GTG GCC TCG ATG GTC TGC TC TAC 768 Phe Arg Tyr Ala Ala Gly Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 GGA GTC CCG CTT CTG ATT GTC AAT GGT TC CTC GTG TTG ATC ACT TAC 816 Gly Val Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 TTG CAG CAC ACG CAT CCT TCC CTG CCT CAC TAC GAT TCG TCC GAG TGG 864 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Glu Trp 275 280 285 GAT TGG TTC AGG GGA GCT TTG GCT ACC GTT GAC AGA GAC TAC GGA ATC 912 Asp Trp Phe Arg Gly Wing Leu Wing Thr Val Asp Arg Asp Tyr Gly He 290 295 300 TTG AAC AAG GTC TC CAC AAT ATT ACC GAC ACG CAC GTG GCC CAT CAT 960 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 CCG TTC TCC ACG ATG CCG CAT TAT CAC GCG ATG GAA GCT ACC AAG GCG 1008 Pro Phe Ser Thr Met Pro His Tyr His Wing Met Glu Ala Thr Lys Wing 325 330 335 ATA AAG CCG ATA CTG GGA GAG TAT TAT CAG TC GAT GGG ACG CCG GTG 1056 He Lys Pro He Leu Gly Glu Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 GTT AAG GCG ATG TGG AGG GAG GCG AAG GAG TGT ATC TAT GTG GAA CCG 1104 Val Lys Ala Met Trp Arg Glu Ala Xys Glu Cys He Tyr Val Glu Pro 355 360 365 GAC AGG CAA GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA T 1153 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 GA 1155 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 384 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: Protein (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 2 Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Glu Thr Asp Thr He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 Val Gly Glu Leu Lys Lys Wing Pro Pro His Cys Phe Lys Arg Ser 35 40 45 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Be 50 55 60 Cys Phe Tyr Tyr Xaa Wing Thr Thr Tyr Phe Pro Leu Pro His Pro 65 70 75 80 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Val Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Ser His 130 135 140 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp lie Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Arg 195 200 205 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 Phe Arg Tyr Ala Ala Gly Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Va1 Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Phe Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly He 290 295 300 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Ala His His 305 310 315 320 Pro Phe Ser Thr Met Pro His Tyr His Wing Met Glu Wing Thr Lys Wing 325 330 335 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys He Tyr Val Glu Pro 355 360 365 Asp Arg Gln Gly Glu Lys Lys Gly val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1155 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: single (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (iii) HYPOTHETICAL: YES (iv) CONTRASTING: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Brassica napus (ix) CHARACTERISTICS: (D) OTHER INFORMATION: transversion mutation from G to A in nucleotide 316. (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3 ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAG AAG TCT 48 Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 GAA ACC GAC ACC ATC AAG CGC GTA CCC TGC GAG ACÁ CCG CCC TTC ACT 96 Glu Thr Asp Tfar He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 GTC GGA GAA CTC AAA GCA ATC CCA CCG CAC TGT TTC AAA CGC TCG 144 Val Gly Glu Leu Lys Lys Ala He Pro Pro His Cys Phe Lys Arg Ser 35 40 45 ATC CCT CGC TCT TTC TCC TAC CTC ATC TGG GAC ATC ATC ATA GCC TCC 192 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Ser 50 55 60 TGC TTC TAC TAC NTC GCC ACC ACT TAC TTC CCT CTC CTC CCT CAC CCT 240 Cys Phe Tyr Tyr Xaa Ala Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 CTC TCC TAC TTC GCC TGG CCT CTC TAC TGG GCC TGC CAG GGG TGC GTC 288 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 CTA ACC GGC GTC TGG GTC ATA GCC CAC AAG TGC GGC CAC CAC GCC TTC 336 Leu Thr Gly Val Trp Val He Wing His Lvs Cys Gly His His Wing Phe 100 105 110 AGC GAC TAC CAG TGG CTT GAC GAC ACC GTC GGT CTC ATC TTC CAC TCC 384 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 TTC CTC CTC GTC CCT TAC TTC TCC TGG AAG TAC AGT CAT CGC AGC CAC 432 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Ser His 130 135 140 CAT TCC AAC ACT GGC TCC CTC GAG AGA GAC GAA GTG TTT GTC CCC AAG 480 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 AAG AAG TCA GAC ATC AAG TGG TAC GGC AAG TAC CTC AAC AAC CCT TTG 528 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 GGA CGC ACC GTG ATG TTA ACG GTT CAG TTC ACT CTC GGC TGG CCG TTG 576 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 TAC TTA GCC TTC AAC GTC TCG GGA AGA CCT TAC GAC GGC GGC TTC CGT 624 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Arg 195 200 205 TGC CAT TTC CAC CCC AAC GCT CCC ATC TAC AAC GAC CGC GAG CGT CTC 672 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 CAG ATA TAC ATC TCC GAC GCT GGC ATC CTC GCC GTC TGC TAC GGT CTC 720 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 TTC CGT TAC GCC GCC GGC CAG GGA GTG GCC TCG ATG GTC TGC TTC TAC 768 Phe Arg Tyr Wing Wing Gly Gln Gly Val Wing Wing Met Val Cye Phe Tyr 245 250 255 GGA GTC CCG CTT CTG ATT GTC AAT GGT TTC CTC GTG TTG ATC ACT TAC 816 Gly Val Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 TTG CAG CAC ACG CAT CCT TCC CTG CCT CAC TAC GAT TCG TCC GAG TGG 864 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 GAT TGG TTC AGG GGT GCT TTG GCT ACC GTT GAC AGA GAC TGA GGA ATC 912 Asp Trp Phe Arg Gly Wing Leu Wing Thr Val Asp Arg Asp Tyr Gly He 290 295 300 TTG AAC AAG GTC TTC CAC AAT ATT ACC GAC ACG CAC GTG GCC CAT CAT 960 Leu Asn Lys Val Pbe His Asn lie Thr Asp Thr His Val Wing His His 305 310 315 320 CCG TTC TCC ACG ATG CCG CAT TAT CAC GCG ATG GAA GCT ACC AAG GCG 1008 Pro Phe Ser Thr Met Pro His Tyr His Ala Met Glu Ala Thr Lys Ala 325 330 335 ATA AAG CCG ATA CTG GGA GAG TAT TAT CAG TTC GAT GGG ACG CCG GTG 1056 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Aep Gly Thr Pro Val 340 345 350 GTT AAG GCG ATG TGG AGG GAG GCG AAG GAG TGT ATC TAT GTG GAA CCG 1104 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys He Tyr Val Glu Pro 355 360 365 GAC AGG CAA GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA T 1153 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 GA 1155 (2) IN TRAINING FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 384 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TI PO DE MOLÉCU LA: Protein ( Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Glu Thr Asp Thr He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 Val Gly Glu Leu Lys Lys Wing Pro Pro His Cys Phe Lys Arg Ser 35 40 45 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Ser 50 55 60 Cys Phe Tyr Tyr Xaa Wing Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70. 75 80 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Val Trp Val He Wing His Lys Cys Gly His His Wing Phe 100 105 110 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Ser His 130 135 140 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Arg 195 200 205 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 Phe Arg Tyr Ala Ala Gly Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Phe Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly lie 290 295 300 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 Pro Phe Ser Thr Met Pro His Tyr His Wing Met Glu Wing Thr Lys Wing 325 330 335 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys He Tyr Val Glu Pro 355 360 365 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1155 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: single (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (iii) HYPOTHETICAL: YES (iv) CONTRASTING: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Brassica napus (ix) CHARACTERISTIC: (D) OTHER INFORMATION: Fad2 Wild type. (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAA AAG TCT 48 Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 GAA ACC GAC AAC ATC AAG CGC GTA CCC TGC GAG ACÁ CCG CCC TTC ACT 96 Glu Thr Asp Asn He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 GTC GGA GAA CTC AAA GCA ATC CCA CCG CAC TGT TTC AAA CGC TCG 144 Val Gly Glu Leu Lys Lys Ala He Pro Pro His Cys Phe Lys Arg Ser 35 40 45 ATC CCT CGC TCT TTC TCC TAC CTC ATC TGG GAC ATC ATC ATA GCC TCC 192 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Ser 50 55 60 TGC TTC TAC TAC GTC GCC ACC ACT TAC TTC CCT CTC CTC CCT CAC CCT 240 Cys Phe Tyr Tyr Val Wing Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 CTC TCC TAC TTC GCC TGG CCT CTC TAC TGG GCC TGC CAG GGC TGC GTC 288 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 CTA ACC GGC GTC TGG GTC ATA GCC CAC GAG TGC GGC CAC CAC GCC TTC 336 Leu Thr Gly Val Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 AGC GAC TAC CAG TGG CTG GAC GAC ACC GTC GGC CTC ATC TTC CAC TCC 384 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 TTC CTC CTC GTC CCT TAC TTC TCC TGG AAG TAC AGT CAT CGA CGC CAC 432 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 CAT TCC AAC ACT GGC TCC CTC GAG AGA GAC GAA GTG TTT GTC CCC AAG 480 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 AAG AAG TCA GAC ATC AAG TGG TAC GGC AAG TAC CTC AAC AAC CCT TTG 528 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 GGA CGC ACC GTG ATG TTA ACG GTT CAG TTC ACT CTC GGC TGG CCT TTG 576 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 TAC TTA GCC TTC AAC GTC TCG GGG AGA CCT TAC GAC GGC GGC TTC GCT 624 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 195 200 205 TGC CAT TTC CAC CCC AAC GCT CCC ATC TA C AAC GAC CGC GAG CGT CTC 672 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 CAG ATA TAC ATC TCC GAC GCT GGC ATC CTC GTC GTC TGC TAC GGT CTC 720 Gln lie Tyr lie Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 TAC CGC TAC GCT GCT GTC CAA GGA GTT GCC TCG ATG GTC TGC TTC TAC 768 Tyr Arg Tyr Ala Wing Val Gln Gly Val Wing Ser Met Val Cys Phe Tyr 245 250 255 GGA GTT CCG CTT CTG ATT GTC AAT GGG TTC TTA GTT TTG ATC ACT TAC 816 Gly Val Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 TTG CAG CAC ACG CAT CCT TCC CTG CCT CAC TAT GAC TCG TCT GAG TGG 864 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 GAT TGG TTG AGG GGA GCT TTG GCC ACC GTT GAC AGA GAC TAC GGA ATC 912 Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly He 290 295 300 TTG AAC AAG GTC TTC CAC AAT ATC ACG GAC ACG CAC GTG GCG CAT CAC 960 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 CTG TTC TCG ACC ATG CCG CAT TAT CAT GCG ATG GAA GCT ACG AAG GCG 1008 Leu Phe Ser Thr Met Pro His Tyr His Wing Met Glu Ala Thr Lys Wing 325 330 335 ATA AAG CCG ATA CTG GGA GAT TAT TAT CAG TTG CAT GGG ACG CCG GTG 1056 He Lys Pro lie Leu Gly Glu Tyr Tyr Gln Leu His Gly Thr Pro Val 340 345 350 GTT AAG GCG ATG TGG AGG GAG GCG AAG GAG TGT ATC TAT GTG GAA CCG 1104 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys He Tyr Val Glu Pro 355 360 365 GAC AGG CAA GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA T 1153 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 GA 1155 (2) IN TRAINING FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 384 amino acids (B) TI PO: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (Xi) SEQUENCE DESCRITION: SEQ ID NO: 6: Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Glu Thr Asp Asn He Lys Axg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 Val Gly Glu Leu Lys Lys Wing Pro Pro His Cys Phe Lys Arg Ser 35 40 45 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He Wing Be 50 55 60 Cys Phe Tyr Tyr Val Wing Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Val Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Aep Gly Gly Phe Wing 195 200 205 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 Tyr Arg Tyr Ala Ala Val Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly He 290 295 300 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr His Wing Met Glu Ala Thr Lys Ala 325 330 335 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Leu His Gly Thr Pro Val 340 345 350 Val Lys Wing Met Trp Arg Glu Wing Lys Glu Cys He Tyr Val Glu Pro 355 360 365 Asp Arg Gln Gly Glu Lye Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 (2) ID N O R T IM ID EMOTION FOCUS: 7: (i) S ECU ENCE CHARACTERISTICS: (A) LON G ITU D: 1 1 55 base pairs (B) TI PO: n ucleic acid (C) HI LO form: simple (D) TOPOLOGY: linear (ii) TI PO DE MOLÉCU LA: A DN (iii) HI POTÉTICA: YES (iv) CONTRASENTIDO: NO (vi) FU E ORIGINAL NTE: (A) ORGAN ISMO: Brassica napus (ix) CHARACTERISTICS: (D) ANOTHER IN FORMATION: transversion mutation from T to A in nucleotide 51 5. (Xi) DESCR ITION OF SEQUENCE: SEQ ID NO: 7: ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAA AAG TCT 48 Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 GAA ACC GAC AAC ATC AAG CGC GTA CCC TGC GAG ACÁ CCG CCC TTC ACT 96 Glu Thr Asp Asn He Lye Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 GTC GGA GAA CTC AAG AAA GCA ATC CCA CCG CAC TGT TTC AAA CGC TCG 144 Val Gly Glu Leu Lys Lys Wing Pro Pro His Cys Phe Lys Arg Ser 35 40 45 ATC CCT CGC TCT TTC TCC TAC CTC ATC TGG GAC ATC ATC ATA GCC TCC 192 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Be 50 55 60 TGC TTC TAC TAC TCC TCC TCC TCC TCC CTC CTC CTC CCT CCT CCT 240 Cys Phe Tyr Tyr Wing Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 CTC TCC TAC TTC GCC TGG CCT CTC TAC TGG GCC TGC CAG GGC TGC GTC 288 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 CTA ACC GGC GTC TGG GTC ATA GCC CAC GAG TGC GGC CAC CAC GCC TTC 336 Leu Thr Gly Val Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 AGC GAC TAC CAG TGG CTG GAC GAC ACC GTC GGC CTC ATC TTC CAC TCC 384 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 TTC CTC CTC GTC CCT TAC TTC TCC TGG AAG TAC AGT CAT CGA CGC CAC 432 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser H is Arg Arg His 130 135 140 CAT TCC AAC ACT GGC TCC CTC GAG AGA GAC GAA GTG TTT GTC CCC AAG 480 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 AAG AAG TCA GAC ATC AAG TGG TAC GGC AAG TAC CAC AAC AAC CCT TTG 528 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr His Asn Asn Pro Leu 165 170 175 GGA CGC ACC GTG ATG TTA ACG GTT CAG TTC ACT CTC GGC TGG CCT TTG 576 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 TAC TTA GCC TTC AAC GTC TCG GGG AGA CCT TAC GAC GGC GGC TTC GCT 624 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 195 200 205 TGC CAT TTC CAC CCC AAC GCT CCC ATC TAC AAC GAC CGC GAG CGT CTC 672 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 CAG ATA TAC ATC TCC GAC GCT GGC ATC CTC GTC GTC TGC TAC GGT CTC 720 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 TAC CGC TAC GCT GCT GTC CAG GGA GTT GCC TCG ATG GTC TGC TTC TAC 768 Tyr Arg Tyr Wing Wing Val Gln Gly Val Wing Val Met Val Cys Phe Tyr 245 250 255 GGA GTT CCG CTT CTG ATT GTC AAT GGG TTC TTA GTT TTG ATC ACT TAC 816 Gly Val Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 TTG CAG CAC ACG CAT CCT TCC CTG CCT CAC TAT GAC TCG TCT GAG TGG 864 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 GAT TGG TTG AGG GGA GCT TTG GCC ACC GTT GAC AGA GAC TAC GGA ATC 912 Asp Trp Leu Arg Gly Wing Leu Wing Thr Val Asp Arg Asp Tyr Gly He 290 295 300 TTG AAC AAG GTC TTC CAC AAT ATC ACG GAC ACG CAC GTG GCG CAT CAC 960 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 CTG TTC TCG ACC ATG CCG CAT TAT CAT GCG ATG GAA GCT ACG AAG GCG 1008 Leu Phe Ser Thr Met Pro His Tyr His Wing Met Glu Ala Thr L ys Ala 325 330 335 ATA AAG CCG ATA CTG GGA GAG TAT TAT CAG TTG CAT GGG ACG CCG GTG 1056 l. Lys Pro He Leu Gly Glu Tyr Tyr Gln Leu His Gly Thr Pro Val 340 345 350 GTT AAG GCG ATG TGG AGG GAG GCG AAG GAG TGT ATC TAT GTG GAA CCG 1104 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys He Tyr Val Glu Pro 355 360 365 GAC AGG CAA GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA T 1153 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 GA 1155 (2) N ATRO IMAGING S EQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 384 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECY LA: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Glu Thr Asp Asn He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 Val Gly Glu Leu Lys Lys Wing Pro Pro Hie Cys Phe Lys Arg Ser 35 40 45 lie Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Ser 50 55 60 Cys Phe Tyr Tyr Val Wing Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Val Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 His Ser Aen Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr His Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 195 200 205 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 Tyr Arg Tyr Ala Ala Val Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Leu Arg Gly Wing Leu Wing Thr Val Aep Arg Asp Tyr Gly He 290 295 300 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr His Wing Met Glu Wing Thr Lys Wing 325 330 335 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Leu His Gly Thr Pro Val 340 345 350 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys He Tyr Val Glu Pro 355 360 365 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1155 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (ix) CHARACTERISTICS: (A) NAME / KEY: Coding sequence (B) LOCATION: 1 ... 1152 (D) OTHER INFORMATION: (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAA AAG TCT 48 Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 GAA ACC GAC AAC ATC AAG CGC GTA CCC TGC GAG AC CCG CCC TTC ACT 96 Glu Thr Asp Asn He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 GTC GGA GAA CTC AAG AAA GCA ATC CCA CCG CAC TGT TTC AAA CGC TCG 144 Val Gly Glu Leu Lys Lys Wing Pro Pro His Cys Phe Lys Arg Ser 35 40 45 ATC CCT CGC TCT TTC TCC TAC CTC ATC TGG GAC ATC ATC ATA GCC TCC 1 92 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He lie Wing Ser 50 55 60 TGC TTC TAC TAC TAC TCC TCC TCC GTC TCC TTC CTC CTC CTC CTC CCT 240 Cye Phe Tyr Tyr Val Wing Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 CTC TCC TAC TTC GCC TGG CCT CTC TAC TGG GCC TGC CAG GGC TGC GTC 288 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 CTA ACC GGC GTC TGG GTC ATA GCC CAC GAG TGC GGC CAC CAC GCC TTC 336 Leu Thr Gly Val Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 AGC GAC TAC CAG TGG CTG GAC GAC ACC GTC GGC CTC ATC TTC CAC TCC 384 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 TTC CTC CTC GTC CYT TAC TTC TCC TGG AAG TAC AGT CAT CGA CGC CAC 432 Phe Leu Leu Val Xaa Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 CAT TCC AAC ACT GGC TCC CTC GAG AGA GAC GAA GTG TTT GTC CCC AAG 480 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 AAG AAG TCA GAC ATC AAG TGG TAC GGC AAG TAC CTC AAC AAC CCT TTG 528 Lys Lys Ser Asp lie Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 GGA CGC ACC GTG ATG TTA ACG GTT CAG TTC ACT CTC GGC TGG CCT TTG 576 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185"1" 90"TAC TTR GCC TTC AAC GTC TCG GGG AGA CCT TAC GAC GGC GGC TTC GCT 624 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 195 200 205 TGC CAT TTC CAC CCC AAC GCT CCC ATC TAC AAC GAC CGT GAG CGT CTC 672 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 CAG ATA TAC ATC TCC GAC GCT GGC ATC CTC GTC GTC TGC TAC GGT CTC 720 Gl He Tyr He Ser Aep Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 TAC CGC TAC GCT GCT RTC CAA GGA GTT GCC TCG ATG GTC TGC TTC TAC 768 Tyr Arg Tyr Ala Ala Xaa Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 GGA GTT CCT CTT CTG RTT GTC AAC GGG TTC TTA GTT TTG ATC ACT TAC 816 Gly Val Pro Leu Leu Xaa Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 TTG CAG CAC ACG CAT CCT TCC CTG CCT CAC TAT GAC TCG TCT GAG TGG 864 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 GAT TGG TTG AGG GGA GCT TTG GCC ACC GTT GAC AGA GAC TAC GGA ATC 912 Asp Trp Leu Arg Gly Wing Leu Wing Thr Val Asp Arg Asp Tyr Gly He 290 295 300 TTG AAC AAG GTC TTC CAC AAT ATC ACG GAC ACG CAC GTG GCG CAT CAC 960 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 CTG TCG ACC ATG CCG CAT TAT CAT GCG ATG GAA GCT ACG AAG GCG 1008 Leu Phe Be Thr Met Pro His Tyr His Wing Met Glu Wing Thr Lye Wing 325 330 335 ATA AAG CCG ATA CTG GGA GAT TAT TAY CAG TTC GAT GGG ACG CCG GTG 1056 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 GTT AAG GCG ATG TGG AGG GAG GCG AAG GAG TGT ATC TAT GTG GAA CCG 1104 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cye He Tyr Val Glu Pro 355 360 365 GAC AGG CAG GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA T 1153 Aep Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 GA 1155 (2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 384 amino acids (B) TYPE: amino acid (C) THREAD FORM: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (v) TYPE OF FRAGMENT: internal (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Glu Thr Asp Asn He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 Val Gly Glu Leu Lys Lys Wing Pro Pro His Cys Phe Lys Arg Ser 35 40 45 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Be 50 55 60 Cys Phe Tyr Tyr Val Wing Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Val Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 Phe Leu Leu Val Xaa Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lye Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 1915 200 205 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 Tyr Arg Tyr Ala Ala Xaa Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu Xaa Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly He 290 295 300 Leu Asn Lys Val Phe His Asn lie Thr Asp Thr His Val Wing His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr His Wing Met Glu Ala Thr Lys Ala 325 330 335 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Wing Met Trp Arg Glu Wing Lys Glu Cys He Tyr Val Glu Pro 355 360 365 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 (2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1155 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: single (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: genomic DNA (ix) CHARACTERISTICS: (A) NAME / KEY: Coding sequence (B) LOCATION: 1 ... 1152 (D) OTHER INFORMATION: (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11 : ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAA AAG TCT 48 Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lye Lys Ser 1 5 10 15 GAA ACC GAC AAC ATC AAG CGC GTA CCC TGC GAG ACÁ CCG CCC TTC ACT 96 Glu Thr Aep Aen He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 GTC GGA GAA CTC AAA GCA ATC CCA CCG CAC TGT TTC AAA CGC TCG 144 Val Gly Glu Leu Lys Lys Ala He Pro Pro His Cys Phe Lys Arg Ser 35 40 45 ATC CCT CGC TCT TTC TCC TAC CTC ATC TGG GAC ATC ATC ATA GCC TCC 192 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He lie Wing Ser 50 55 60 TGC TTC TAC TAC GTC GCC ACC ACT TAC TTC CCT CTC CTC CCT CAC CCT 240 Cys Phe Tyr Tyr Val Wing Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 CTC TCC TAC TTC GCC TGG CCT CTC TAC TGG GCC TGC CAG GGC TGC GTC 288 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 CTA ACC GGC GTC TGG GTC ATA GCC CAC AAG TGC GGC CAC CAC GCC TTC 336 Leu Thr Gly Val Trp Val He Wing His Lys Cys Gly His His Wing Phe 100 105 lio AGC GAC TAC CAG TGG CTG GAC GAC ACC GTC GGC CTC ATC TTC CAC TCC 384 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 TTC CTC CTC GTC CYT TTC TTC TTC TGG AAG TAC AGC CAT CGA CGC CAC 432 Phe Leu Leu Val Xaa Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 CAT TCC AAC ACT GGC TCC CTC GAG AGA GAC GAA GTG TTT GTC CCC AAG 480 His Ser Asn Thr Gly Ser Leu Glu? Rg Asp Glu Val Phe Val Pro Lys 145 150 155 160 AAG AAG TCA GAC ATC AAG TGG TAC GGC AAG TAC CTC AAC AAC CCT TTG 528 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 10 GGA CGC ACC GTG ATG TTA ACG GTT CAG TTC ACT CTC GGC TGG CCT TTG 576 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 TAC TTR GCC TTC AAC GTC TCG GGG AGA CCT TAC GAC GGC GGC TTC GCT 624 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 195 200 205 TGC CAT TTC C? C CCC AAC GCT CCC ATC TAC AAC GAC CGT GAG CGT CTC 672 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 15 CAG ATA TAC ATC TCC GAC GCT GGC ATC CTC GCC GTC TGC TAC GGT CTC 720 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 TAC CGC TAC GCT GCT RTC CAA GGA GTT GCC TCG ATG GTC TGC TTC TAC 768 Tyr Arg Tyr Ala Ala Xaa Gln Gly Val Ala Ser Met Val Cye Phe Tyr 245 250 255 GGA GTT CCT CTT CTG RTT GTC AAC GGG TTC TTA GTT TTG ATC ACT TAC 816 Gly Val Pro Leu Leu Xaa Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 TTG CAG CAC ACG CAT CCT TCC CTG CCT CAC TAT GAC TCG TCT GAG TGG 864 «Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp U 275 280 285 GAT TGG TTG AGG GGA GCT TTG GCC ACC GTT GAC AGA GAC TAC GGA ATC 912 Asp Trp Leu Arg Gly Wing Leu Wing Thr Val Asp Arg Asp Tyr Gly He 290 295 300 TTG AAC AAG GTC TTC CAC AAT ATC ACG GAC ACG CAC GTG GCG CAT CAC 960 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 CTG TTC TCG ACC ATG CCG CAT TAT CAT G CG ATG GAA GCT ACG AAG GCG 1008 Leu Phe Ser Thr Met Pro His Tyr His Wing Met Glu Wing Thr Lys Wing 325 330 335 25 ATA AAG CCG ATA CTG GGA GAT TAT TAY CAG TTC GAT GGG ACG CCG GTG 1056 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 GTT AAG GCG ATG TGG AGG GAG GCG AAG GAG TGT ATC TAT GTG GAA CCG 1104 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys He Tyr Val Glu Pro 355 360 365 GAC AGG CAG GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA T 1153 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 GA 1155 (2) INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 384 amino acids (B) TYPE: nucleic acid (C) THREAD FORM: amino acid (D) TOPOLOGY: linear (ii) IT PO DE MOLÉCU LA: protein (v) TYPE OF FRAGMENT: internal (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 12: Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Glu Thr Asp Asn He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 Val Gly Glu Leu Lys Lys Wing Pro Pro His Cys Phe Lys Arg Ser 35 40 45 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Ser 50 55 60 Cys Phe Tyr Tyr Val Wing Thr Thr Tyr Phe Pro Leu Pro His Pro 65 70 75 80 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Val Trp Val He Ala His Lys Cys Gly His His Wing Phe 100 105 110 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 Phe Leu Leu Val Xaa Ty Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 His Ser Asn Thr Gl and Ser Leu Glu Arg Asp Glu Val Phe Val ro Lys 145 150 155 160 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Gly Árg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 195 200 205 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gln He Tyr lie Ser Asp Ala Gly He Leu Ala Val Cys Tyr Gly Leu 225 230 235 240 Tyr Arg Tyr Ala Ala Xaa Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu Xaa Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly He 290 295 300 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr His Wing Met Glu Ala Thr Lys Ala 325 330 335 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Wing Met Trp Arg Glu Wing Lys Glu Cys He Tyr Val Glu Pro 355 360 365 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 (2) INFORMATION FOR SEQ ID NO: 13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1155 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: single (D) TOPOLOGY: linear (ii) ) TI PO DE MO LÉCU LA: genomic DNA (¡x) CA RACTERISTIC: (A) NOM BR E / KEY: Coding sequence (B) U BICACIÓN: 1 ... 1 152 (D) OTHER FORMATION: (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 13: ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAG AAG TCT 48 Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 GAA ACC GAC ACC ATC AAG CGC GTA CCC TGC GAG ACA CCG CCC TTC ACT 96 Glu Thr Asp Thr He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 GTC GGA GAA CTC AAG AAA GCA ATC CCA CCG CAC TGT TTC AAA CGC TCG 144 Val Gly Glu Leu Lys Lys Wing Pro Pro His Cys Phe Lys Arg Ser 35 40 45 ATC CCT CGC TCT TTC TCC TAC CTC ATC TGG GAC ATC ATC ATA GCC TCC 192 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Ser 50 55 60 TGC TTC TAC TAC TTC TTC TTC TTC TTC TTC TTC TTC TTC GTC TCC TTC TTC CTC CCT CTC CCT CTC Tyr Tyr Tyr Tyr WTT Pro T Leu Le Pro Pro His Pro 65 70 75 80 CTC TCC TTC TCC TCC TCC TCC GCC TGC TCC GCC TGC CA CA GGG TGC GTC 288 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Txp Wing Cys Gln Gly Cys Val 85 90 95 CTA ACC GGC GTC TGG GTC ATA GCC CAC GAG TGC GGC CAC CAC GCC TTC 336 Leu Thr Gly Val Trp Val He Ala His Glu Cys Gly His His Wing Phe 100 105 110 AGC GAC TAC CAG TGG CTT GAC GAC ACC GTC GGT CTC ATC TTC CAC TCC 384 Ser Asp Tya Gln. Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 TTC CTC CTC GTC CCT TAC TTC TCC TGG AAG TAC AGT CAT CGA CGC CAC 432 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg Hie 130 135 140 CAT TCC AAC ACT GGC TCC CTC GAG AGA GAC GAA GTG TTT GTC CCC AAG 480 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 AAG AAG TCA GAC ATC AAG TGG TAC GGC AAG TAC CTC AAC AAC CCT TTG 528 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 GGA CGC ACC GTG ATG 'TTA ACG GTT CAG TTC ACT CTC GGC TGG CCG TTG 576 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 TAC TTA GCC TTC AAC GTC TCG GGA AGA CCT TAC GAC GGC GGC TTC GCT 624 Tyr Leu Ala. Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 195 200 205 TGC CAT TTC CAC CCC AAC GCT CCC ATC TAC AAC GAC CGC GAG CGT CTC 672 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 CAG ATA TAC ATC TCC GAC GCT GGC ATC CTC GTC GTC TGC TAC GGT CTC 720 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 TTC CGT TAC GCC GCC GCG CAG GGA GTG GCC TCG ATG GTC TGC TTC TAC 768 Phe Arg Tyr Ala Ala Ala Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 GGA GTC CCG CTT CTG ATT GTC AAT GGT TTC CTC GTG TTG ATC ACT TAC 816 Gly Val Pro Leu le He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 TTG CAG CAC ACG CAT CCT TCC CTG CCT CAC TAC GAT TCG TCC GAG TGG 864 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 GAT TGG TTG AGG GGA GCT TTG GCT ACC GTT GAC AGA GAC TAC GGA ATC 912 Asp Trp Leu Arg Gly Wing Leu Wing Thr Val Asp Arg Asp Tyr Gly He 290 295 300 TTG AAC AAG GTC TTC CAC AAT ATT ACC GAC ACG CAC GTG GCG CAT CAT 960 Leu Asn Lys Val Phe His Asn Xle Thr Asp Thr His Val Wing His His 305 310 315 320 CTG TTC TCC ACG ATG CCG CAT TAT CAC GCG ATG GAA GCT ACC AAG GCG 1008 Leu Plie Ser T? Rr Met Pro His Tyr His Wing Met Glu Ala Tlrr Lys Wing 325 330 335 ATA AAG CCG ATA CTG GGA GAT TAT TAT CAG TTC GAT GGG ACG CCG GTG 1056 He JUys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 GTT AAG GCG ATG TGG AGG GAG GCG AAG GAG TGT ATC TAT GTG GAA CCG 1104 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys He Tyr Val Glu Pro 355 360 365 GAC AGG CAG GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA T 1153 Asp Arg Gln. Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 GA 1155 (2) I NFORMATION FOR SEQ ID NO: 14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 384 amino acids (B) TYPE: nucleic acid (C) FORM OF HI LO: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLÉCU LA: protein (v) TI FRAGMENT PO: internal (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Glu Thr Asp Thr He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 Val Gly Glu Leu Lye Lys Wing Pro Pro His Cys Phe Lys Arg Ser 35 40 45 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Ser 50 55 60 Cys Phe Tyr Tyr Val Wing Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Val Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 195 200 205 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 Phe Arg Tyr Ala Ala Ala Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Aep Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly He 290 295 300 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr His Wing Met Glu Wing Thr Lys Wing 325 330 335 lie Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys He Tyr Val Glu Pro 355 360 365 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 (2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1155 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: genomic DNA (ix) CHARACTERISTICS: (A) NAME / KEY: Coding sequence (B) LOCATION: 1 ... 1152 (D) OTHER INFORMATION: (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15 : ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAG AAG TCT 48 Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 GAA ACC GAC ACC ATC AAG CGC GTA CCC TGC GAG ACÁ CCG CCC TTC ACT 96 Glu Thr Asp Thr He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 GTC GGA GAA CTC AAA GCA ATC CCA CCG CAC TGT TTC AAA CGC TCG 144 Val Gly Glu Leu Lys Lys Ala He Pro Pro His Cys Phe Lys Arg Ser 35 40 45 ATC CCT CGC TCT TTC TCC TAC CTC ATC TGG GAC ATC ATC ATA GCC TCC 192 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Be 50 55 60 TGC TTC TAC TAC GTC GCC ACC ACT TAC TTC CCT CTC CTC CCT CAC CTC CCT 240 Cys Phe Tyr Tyr Val Wing Thr Thr Tyr Phe Pro Leu Pro His Pro 65 70 75 80 CTC TCC TAC TTC TCC TCC TGCC CCT CTC TAC TGG TCC GCC TGC CAG GGG TGC TTC 288 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 CTA ACC GGC GTC TGG GTC ATA GCC CAC GAG TGC GGC CAC CAC GCC TTC 336 Leu Thr Gly Val Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 AGC GAC TAC CAG TGG CTT GAC GAC ACC GTC GGT CTC ATC TTC CAC TCC 384 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 TTC CTC CTC GTC CCT TAC TTC TCC TGG AAG TAC AGT CAT CGA CGC CAC 432 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 CAT TCC AAC ACT GGC TCC CTC GAG. AGA GAC GAA GTG TTT GTC CCC AAG 480 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lye 145 150 155 160 AAG AAG TCA GAC ATC AAG TGG TAC GGC AAG TAC CAC AAC AAC CCT TTG 528 Lys Lys Ser Asp lie Lys Trp Tyr Gly Lys Tyr His Asn Asn Pro Leu 165 170 175 GGA CGC ACC GTG ATG TTA ACG GTT CAG TTC ACT CTC GGC TGG CCG TTG 576 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 TAC TTA GCC TTC AAC GTC TCG GGA AGA CCT TAC GAC GGC GTC TTC GCT 624 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 195 200 205 TGC CAT TTC CAC CCC AAC GCT CCC ATC TAC AAC GAC CGC GAG CGT CTC 672 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 CAG ATA TAC ATC TCC GAC GCT GGC ATC CTC GTC GTC TGC TAC GGT CTC 720 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 TTC CGT TAC GCC GCC GCG CAG GGA GTG GCC TCG ATG GTC TGC TTC TAC 768 Phe Arg Tyr Ala Ala Ala Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 GGA GTC CCG CTT CTG ATT GTC AAT GGT TTC CTC GTG TTG ATC ACT TAC 816 Gly Val Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 TTG CAG CAC ACG CAT CCT TCC CTG CCT CAC TAC GAT TCG TCC GAG TGG 864 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 GAT TGG TTG AGG GGA GCT TTG GCT ACC GTT GAC AGA GAC TAC GGA ATC 912 Asp Trp Leu Arg Gly Wing Leu Wing Thr Val Asp Arg Asp Tyr Gly He 290 295 300 TTG AAC AAG GTC TTC CAC AAT ATT ACC GAC ACG CAC GTG GCG CAT CAT 960 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 CTG TTC TCC ACG ATG CCG CAT TAT CAC GCG ATG GAA GCT ACC AAG GCG 1008 Leu Phe Ser Thr Met Pro His Tyr His Ala Met Glu Ala Thr Lys Ala 325 330 335 ATA AAG CCG ATA CTG GGA GAG TAT TAT CAG TTC GAT GGG ACG CCG GTG 1056 He Lys Pro He Leu Gly Glu Tyr Tyr Glp Phe Asp Gly Thr Pro Val 340 345 350 GTT AAG GCG ATG TGG AGG GAG GCG AAG GAG TGT ATC TAT GTG GAA CCG 1104 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys He Tyr Val Glu Pro 355 360 365 GAC AGG CAA GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA T 1153 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 GA 1155 (2) INFORMATION FOR SEQ ID NO: 16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 384 amino acids (B) TYPE: nucleic acid (C) THREAD FORM: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (v) TYPE OF FRAGMENT: internal (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 16: Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Glu Thr Asp Thr He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 Val Gly Glu Leu Lys Lys Wing Pro Pro His Cys Phe Lys Arg Ser 35 40 45 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Be 50 55 60 Cys Phe Tyr Tyr Val Wing Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Val Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 Being Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr His Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 195 200 205 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 Phe Arg Tyr Ala Ala Ala Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly He 290 295 300 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr His Wing Met Glu Ala Thr Lys Ala 325 330 335 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Wing Met Trp Arg Glu Wing Lys Glu Cys He Tyr Val Glu Pro 355 360 365 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 (2) INFORMATION FOR SEQ ID NO: 17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1155 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: single ( D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: genomic DNA (ix) CHARACTERISTICS: (A) NAME / KEY: Coding sequence (B) LOCATION: 1 ... 1152 (D) OTHER INFORMATION: (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 17: ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAG AAG TCT 48 Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 GAA ACC GAC ACC ATC AAG CGC GTA CCC TGC GAG ACA CCG CCC TTC ACT 96 Glu Thr Asp Thr He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 GTC GGA GAA CTC AAA GCA ATC CCA CCG CAC TGT TTC AAA CGC TCG 144 Val Gly Glu Leu Lys Lys Wing Pro Pro His Cys Phe Lys Arg Ser 35 40 45 ATC CCT CGC TCT TTC TCC TAC CTC ATC TGG GAC ATC ATC ATA GCC TCC 192 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing 50 55 60 TGC TTC TAC TAC TAC GTC TCC TCC TTC CTC CTC CTC CTC CTC Tyr Tyr TTC TTC TTC TTC TTC TTC WTC Pro T Leu Le Pro Pro His Pro 65 70 75 80 CTC TCC TTC TTC TCC TCC TGCC CCT TTC TGG GCC TGC CAG GGG TGC GTC 288 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly-Cys Val 85 90 95 CTA ACC GGC GTC TGG GTC ATA GCC CAC GAG TGC GGC CAC CAC GCC TTC 336 Leu Thr Gly Val Val Val He Ala His Glu Cys Gly His His Wing Phe 100 105 110 AGC GAC TAC CAG TGG CTT GAC GAC ACC GTC GGT CTC ATC TTC CAC TCC 384 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 TTC CTC CTC GTC CCT TAC TTC TCC TGG AAG TAC AGT CAT CGA CGC CAC 432 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 CAT TCC AAC ACT GGC TCC CTC GAG AGA GAC GAA GTG TTT GTC CCC AAG 480 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 AAG AAG TCA GAC ATC AAG TGG TAC GGC AAG TAC CTC AAC AAC CCT TTG 528 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 GGA CGC ACC GTG ATG TTA ACG GTT CAG TTC ACT CTC GGC TGG CCG TTG 576 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 TAC TTA GCC TTC AAC GTC TCG GGA AGA CCT TAC GAC GGC GGC TTC GCT 624 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 195 200 205 TGC CAT TTC CAC CCC AAC GCT CCC ATC TAC AAC GAC CGC GAG CGT CTC 672 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 CAG ATA TAC ATC TCC GAC GCT GGC ATC CTC GTC GTC TGC TAC GGT CTC 720 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 TTC CGT TAC GCC GCC GCG CAG GGA GTG GCC TCG ATG GTC TGC TTC TAC 768 Phe Arg Tyr Ala Ala Ala Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 GGA GTC CCG CTT CTG ATT GTC AAT GGT TTC CTC GTG TTG ATC ACT TAC 816 Gly Val Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 TTG CAG CAC ACG CAT CCT TCC CTG CCT CAC TAC GAT TCG TCC GAG TGG 864 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 GAT TGG TTG AGG GGA GCT TTG GCT ACC GTT GAC AGA GAC TAC GAA ATC 912 Asp Trp Leu Arg Gly Wing Leu Wing Thr Val Asp Arg Asp Tyr Glu He 290 295 300 TTG AAC AAG GTC TTC CAC AAT ATT ACC GAC ACG CAC GTG GCG CAT CAT 960 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Ala His His 305 310 315 320 CTG TTC TCC ACG ATG CCG CAT TAT CAC GCG ATG GAA GCT ACC AAG GCG 1008 Leu Phe Ser Thr Met Pro His Tyr His Ala Met Glu Ala Thr Lys Wing 325 330 335 ATA AAG CCG ATA CTG GGA GAT TAT TAT CAG TTC GAT GGG ACG CCG GTG 1056 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 GTT AAG GCG ATG TGG AGG GAG GCG AAG GAG TGT ATC TAT GTG GAA CCG 1104 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys lie Tyr Val Glu Pro 355 360 365 GAC AGG CAA GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA T 1153 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 GA 1155 (2) INFORMATION FOR SEQ ID NO: 18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 384 amino acids (B) TYPE: nucleic acid (C) THREAD FORM: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (v) TYPE OF FRAGMENT: internal (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 18: Met Gly Wing Gly Gly Arg Met Gln Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Glu Thr Asp Thr He Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 Val Gly Glu Leu Lys Lys Wing Pro Pro His Cys Phe Lys Arg Ser 35 40 45 He Pro Arg Ser Phe Ser Tyr Leu He Trp Asp He He He Wing Be 50 55 60 Cys Phe Tyr Tyr Val Wing Thr Thr Tyr Phe Pro Leu Pro His Pro 65 70 75 80 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Val Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val Gly Leu He Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Wing 195 200 205 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gln He Tyr He Ser Asp Wing Gly He Leu Wing Val Cys Tyr Gly Leu 225 230 235 240 Phe Arg Tyr Ala Ala Ala Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu He Val Asn Gly Phe Leu Val Leu He Thr Tyr 260 265 270 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Glu He 290 295 300 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr His Wing Met Glu Wing Tfar Lye Wing 325 330 335 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Ala Met Trp Arg Glu Ala Lye Glu Cys He Tyr Val Glu Pro 355 360 365 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 (2) INFORMATION FOR SEQ ID NO: 19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: other nucleic acid (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 19: GGATATGATG ATGGTGAAAG A 21 (2) INFORMATION FOR SEQ ID NO: 20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: other nucleic acid (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 20: TCTTTCACCA TCATCATATC C 21TION FOR SEQ ID NO: 21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (¡) i) TYPE OF MOLECULE: other nucleic acid (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 21 GTTATGAAAGC AAAGAAGAAA C 21 (2) INFORMATION FOR SEQ ID NO: 22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: other nucleic acid (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22: GTTTCTTCTT TGCTTTGCTT CATAAC 26 (2) INFORMATION FOR SEQ ID NO: 23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: other nucleic acid (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 23: CAUCAUCAU AUCTTCTTCG TAGGGTTCAT CG 32 (2) INFORMATION FOR SEQ ID NO: 24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: other nucleic acid (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 24: CUACUACUAC UATCATAGAA GAGAAAGGTT CAG 33 (2) INFORMATION FOR SEQ ID NO: 25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: other (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 25: CAUCAUCAUC AUCATGGGTG CACGTGGAAG AA 32 (2) INFORMATION FOR SEQ ID NO: 26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (¡) i) TYPE OF MOLECULE: other (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 26: CUACUACUA UATCTTTCAC CATCATCATA TCC 33 (2) INFORMATION FOR SEQ ID NO: 27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: other (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 27: CUACUACUAC UACATAACTT ATTGTTGTAC CAG 33 (2) INFORMATION FOR SEQ ID NO: 28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2168 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: single (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: genomic DNA (ix) CHARACTERISTICS: (A) NAME / KEY: Coding sequence (B) LOCATION: 1014 ... 2165 (D) OTHER INFORMATION: (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 28 : CTTCTTCGTA GGGTTCATCG TTATTAACGT AAAATCTCTC TCCCCCCACC CTACGTCAGC 60 AGCTTTCAGG GTCCCCTTCT CTTCTTCTT CTTCTCATTT TCCTCTTATT TTTATGAATT 120 CCTGGTCTGT GTTCACCTCG TCCATCTCTC TAGCAGTCTA GCATTTGGCA TTTAAATCGA 180 TAGRTCTGCC AGTCTTTATT GCATTCAACT AAAGATCTGT TCCTCTGTTT CCATTTGACA 240 AATCTTGTGT CATGTTTCTT TCATCTCACC GTTAAATAAT GATTACTGTC TATGGTCTAG_300_CATATGAAAT GTTGCAACTT TCTATCTATT CAGAAATCTT TTTATTCAAT AGGXTGGTGA 360 AATAGAAAAG GTCAAATCTC CAAAATAGCA ACTTTCTAAG TTTATATCAC AAAAATAGCA 420 CTCAAAAATT AAAATGACCA AAATATTATT TTATCTTTTG AAAATTTTAA TTTTTTTATT 480 TTTCAAAATT TGAAATCTTA TCCCCAAAAC CTCATTTCTC AACTCTAAAC CCTAAACTCT 540 GAACCATAAR CCCTAAACCC TAAACTCTAA ACCCTAAACC CTAAACCCTA AACCCCACCC 600 TTTAACTYTA AACCATAAGT TTGTGACTTT TGATAAAATA TTAAGTGATA TTTTTGTGAC 660 TTTTGACCTT GAGTGCTAGT TTGGGAACAA AAACTTGGTT TAGTGCTATT TTTGTTTTTT 720 TTCAATATAA AAATCACTTA TTGTTGAACC TTTGATAGAT TTGACCGATT CCTACTGGTT 780 CTTGCTACTG TTATTTCTTA ATAAATGGAA GAACGTTTCA TTGACTTATA AGCTCATCAA 840 CTTTGTACAA ATAAAACGGA TGATTTAAAG TAGGTAGGTA CTTCAGGGTT TAGATGTTCT 900 TTTATAGATT CAAATGCATG AAGAGTTGCA TATACAACTT TGATTAAAGG ATAAAAAGTC 960 TCCGTCCTCC ATAACATTAT TATTATTTTT TGGTTTTCTC TACAGAAACA AAC ATG 1016 Met 1 GGC GCA GRT GGA AGA ATG CAA ATC TCT CCT CCC TCC AGC TCC CCC GAA 1064 Gly Ala Xaa Gly Arg Met Gln He Ser Pro Pro Be Ser be Pro Glu 5 10 15 ACC AAA ACC CTC AAA CGC GTC CCC TGC GAG ACA CCA CCC TTC ACT CTC 1112 Thr Lys Thr Leu Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr Leu 20 25 30 GGA GAC CTC GAG AAA GCA ATC CCA CCT CAC TGC TTC AAA CGC TCC ATC 1160 Gly Asp Leu Glu Lys Wing Pro Pro His Cys Phe Lys Arg Ser He 35 40 45 CCT CGC TCC TTC TCC TTC CTC CTC TTC GAC ATC CTC GTC TCC TCC TCC 1208 Pro Arg Ser Phe Ser Tyr Leu Leu Phe Asp He Leu Val Ser Ser Ser 50 55 60 65 CTC TAC CAC CTC TCC ACA GCC TAC TTC CCT CTC CCC CAC CCT CTC 1256 Leu Tyr His Leu Ser Thr Ala Tyr Phe Pro Leu Leu Pro His Pro Leu 70 75 80 CCT TAC CTC GCC TGG CCC CTC TAC TGG GCC TGC CAA GGC TGC GTC CTA 1304 Pro Tyr Leu Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val Leu 85 90 95 ACG GGC CTC TGG GTC ATC GCC CAC GAA TGC GGC CAC CAC GCC TTC AGC 1352 Thr Gly Leu Trp Val He Wing His Glu Cys Gly His His Wing Phe Ser 100 105 110 GAC CAC CAG TGG CTG GAC GAC GCC GTG GGC CTC GTC TTC CAC TCC TTC 1400 Aep His Gln Trp Leu Asp Asp Ala Val Gly Leu Val Phe His Ser Phe 115 120 125 CTC CTC GTC CCT TAC TTC TCC TGG AAG TAC AGC CAT CGA CGC CAC CAT 1448 Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His His 130 135 140 145 TCC AAC ACC GGA TCC CTC GAG AGG GAT GAA GTG TTC GTC CCC AAG AAG 1496 Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys Lys 150 155 160 AAA TCC GAC ATC AAG TGG TAC GGA AAG TAC CTC AAC AAC CCG CTA GGA 1544 Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu Gly 165 170 175 CGC ACG GTG ATG CTA ACC GTC CAG TTC ACG CTC GGC TGG CCG TTG TAC 1592 Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu Tyr 180 185 190 TTA GCC TTC AAC GTC TCT GGA AGA CCT TAC AGC GAC GGT TTC GCT TGC 1640 Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Ser Asp Gly Phe Wing Cys 195 200 205 CAT TTC CAC CCG AAC GCT CCC ATC TAC AAC GAC CGC GAG CGT CTC CAG 1688 His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu Gln 210 215 220 225 ATA TAC ATC TCT GAC GCT GTC GTC CTC TCC GTA TGT TAC GGT CTC TAC 1736 He Tyr He Ser Asp Ala Gly Val Leu Ser Val Cys Tyr Gly Leu Tyr 230 235 240 CGC TAC GCT GGT TCG CGA GGA GTG GCC TCG ATG GTC TGT GTC TAC GGA 1784 Arg Tyr Ala Gly Ser Arg Gly Val Ala Ser Met Val Cys Val Tyr Gly 245 250 255 GTT CCG CTT ATG ATT GTC AAC TGT TTC CTC GTC TTG ATC ACT TAC TTG 1832 Val Pro Leu Met He Val Asn Cys Phe Leu Val Leu He Thr Tyr Leu 260 265 270 CAG CAC ACG CAC CCT TCG CTG CCT CAC TAT GAT TCT TCG GAG TGG GAT 1880 Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp Asp 275 280 285 TGG TTG AGA GGA GCT TTG GCT ACT GTG GAT AGA GAC TAT GGA ATC TTG 1928 Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly He Leu 290 295 300 305 AAC AAG GTG TTT CAT AAC ATC ACG GAC ACG CAC GTG GCG CAT CAT CTG 1976 Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His Leu. 310 315 320 TTC TCG ACG ATG CCG CAT TAT AAC GCG ATG GAA GCG ACC AAG GCG ATA 2024 Phe Ser Thr Met Pro His Tyr Asn Wing Met Glu Wing Thr Lys Ala He 325 330 335 AAG CCG ATA CTT GGA TAG TAC CAG TTT GAT GGA ACG CCG GTG GTT 2072 Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val Val 340 345 350 AAG GCG ATG TGG AGG GAG GCG AAG GAG TGT ATC TAT GTT GAA CCG GAT 2120 Lys Ala Met Trp Arg Glu Ala Lys Glu Cys He Tyr Val Glu Pro Asp 355 360 365 AGG CAG GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA TGA 2168 Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 (2) P ROGRAPHIC P ROD E R ID NO: 29: (i) CA RACTE RISTICS OF S EC U EN CIA: (A) LONGITU D: 384 amino acids (B) TI PO: amino acid (C) FO RMA OF HI LO: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (v) TI PO DE FRAGMENTO: internal (ii) TI PO DE MOLÉCU LA: another nucleic acid (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 29: Met Gly Ala Xaa Gly Arg Met Gln He Ser Pro Pro Ser Ser Ser Pro 1 5 10 15 Glu Thr Lye Thr Leu Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 Leu Gly Asp Leu Glu Lys Wing Pro Pro His Cys Phe Lys Arg Ser 40 45 He Pro Arg Ser Phe Ser Tyr Leu Leu Phe Asp He Leu Val Ser Ser 50 55 60 Ser Leu Tyr His Leu Ser Thr Ala Tyr Phe Pro Leu Leu Pro His Pro 65 70 75 80 Leu Pro Tyr Leu Wing Trp Pro Leu Tyr Trp Wing Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Leu Trp Val He Wing His Glu Cys Gly His His Wing Phe 100 105 110 Ser Asp His Gln Trp Leu Aep Asp Wing Val Gly Leu Val Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp He Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Wing Phe Asn Val Ser Gly Arg Pro Tyr Ser Asp Gly Phe Wing 195 200 205 Cys His Phe His Pro Asn Ala Pro He Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gln He Tyr He Ser Asp Wing Gly Val Leu Ser Val Cys Tyr Gly Leu 225 230 235 240 Ala Gly Ser Arg Gly Val Ala * Ser Met Val Cys Val Tyr 245 250 255 Gly Val Pro Leu Met He Val Asn Cys Phe Leu Val Leu He Thr Tyr 260 265 270 Leu Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly He 290 295 300 Leu Asn Lys Val Phe His Asn He Thr Asp Thr His Val Wing His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr Asn Wing Met Glu Wing Thr Lys Ala 325 330 335 He Lys Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Wing Met Trp Arg Glu Wing Lys Glu Cys He Tyr Val Glu Pro 355 360 365 Asp Arg Gln Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 (2) INFORMATION FOR SEQ ID NO: 30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1132 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (¡) i) TYPE OF MOLECULE: DNA (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 30: GCGTAACCCT TATTAACGTT AAATCTTCAT CCCCCCCTAC GTCAGCCAGC TCAAGGTCCC 60 TTCTTCTTC CATTTCT CT CATTTTTACG TTGTTTTCAA TCTTGGTCTG TCTTTTCTT 120 ATCGCTTTTC TATTCTATCT ATCATTTTTG CATTTCAGTC GATTTAATTC TAGATCTGTT 180 AGTATTTATT GCATTAAACT ATAGATCTGG TCTTGATTCT CTGTTTTCAT GTGTGAAATC 240 TTGATGCTGT CTTTACCATT AATCTGATTA TATTGTCTAT ACCGTGGAGA ATATGAAATG 300 TTGCATTTTC ATTTGTCCGA ATACAAACTG TTTGACTTTC AATCTTTTTT AATGATTTAT 360 TTGATGGGTT GGTGGAGTTG AAAAATCACC ATAGCAGTCT CACGTCCTGG TCTTAGAAAT 420 ATCCTTCCTA TTCAAAGTTA TATATTTGTT TACTTGTCTT AGATCTGGAC CTGAGACATG 480 TAAGTACATA TTTGTTGAAT CTTTGGGTAA AAAATTTATG TCTCTGGGTA AAATTTGCTT 540 GGAGATTTGA CCOATTCCTA TTGGCTCTTG ATTCTGTAGT TACCTAATAC ATGAAAAAGT 600 TTCATTTGGC CTATGCTCAC TTCATGCTTA CAAACTTTTC TTTGCAAATT AATTGGATTA 660 GATGTCCTTC ATAGATTCAG ATGCAATAGA TTTGCATGAA GAAAATAATA GGATTCATGA 720 CAGTAAAAAA GATTGTATTT TTGTTTGTTT GTTTATGTTT AAAAGTCTAT ATGTTGACAA 780 TAGAGTTGCT CTCAACTGTT TCATTTAGCT TTTTGTTTTT GTCAAGTTGC TTATTCTTAG_840_AGACATTGTG ATTATGACTT G TCTTCTCTA ACGTAGTTTA GTAATAAAAG ACGAAAGAAA 900 TTGATATCCA CAAGAAAGAG ATGTAAGCTG TAACGTATCA AATCTCATTA ATAACTAGTA 960 GTATTCTCAA CGCTATCGTT TATTTCTTTC TTTGGTTTGC CACTATATGC CGCTTCTCTG 1020 CTCTTTTGTC CCACGTACTA TCCATTTTTT TGAAACTTTA ATAACGTAAC ACTGAATATT 1080 AATTTGTTGG TTTTTTTAAC TTTGAGTCTT TGCTTTTGGT TTATGCAGAA AC 1132 (2) IN FO RMATION FOR SEQ IDNO: 31: (i) SEQUENCE CHARACTERISTICS: (A) LONG ITU D: 1 1 35 base pairs (B) TI PO: nucleic acid (C) FORM DEHI LO: simple (D) TOPO LOGA: linear (ii) TI TI DE MO LÉC U LA: A DN (Xi) D ESC RI PC IO NDES ECU ENC IA: SEQ IDNO: 31 TTATTAACGT TAAATCTTCA TCCCCCCCTA CGTCAGCCAG CTCAAGGTCC CTTTCTTCTT 60 CCATTTCTTC TCATTTTTAC GTTGTTTTCA ATCTTGGTCT GTTCTTTTCT TATCGCTTTT 120 CTGTTCTATC TATCATTTTT GCATTTCAGT CGATTTAATT CTAGATCTGT TAATATTTAT 180 TGCATTAAAC TACAGATCTG GTCTCGATTC TCTGTTTTCA TGTGTGAAAT. CTGATGCTGT 240 CTTTACCATT AATCTGCTTA TATTGTATAT ACCGTGGAGA ATATGAAATG TTGCATTTTC 300 ATTTGTCCGA ATACAAACTG TTTGACTTCC AATCGTTTTT AATTATATAT ATTTTTTGAT 360 GGGTTGGTGG AGTTGAAAAA TCACCATAGC AGTCTCACGT CCTGGTTTTA GAAATATCCT 420 TCCTATTCAA AGTTATATAT TTGTTTACTT TTGTTTTAGA TCTGGACCTG AGACATGTAA 480 GTACCTATTT GTTGAATCTT TGGGTAAAAT TTATGTCTCT GGGTAAAATT TGCTGAGAGA 540 TTTGACCGAT TCCTATTGGC TCTGGATTCT GTATACATGA AAAAGTTTCA TTGGCCTATG 600 CTCACGTCAT GCTTACAAAC TTTTCTTTGC AATTAATTC GATTAGATGC TCCTTCATAG_660_ATTCAGATGC AATAGATTTG CATGAAGAAA ATAATAGGAT TCATGATAGT AAAAAfiATTG 720 TACATTTTTT TGTTTGTTTA TGTTTAAAAG TCTATATGTT GACAATAGGG TTGCTATCAA 780 CTGTTTCATT TAGCTTTTTG TTTTTCTCAA GTTGCTTATT CTTAGAGACA TTGTGATTAT 840 GACTTGTCGT CTTTAACGTA GTTTAGTAAT AAAAGACGAA AGAAATTGAT ATCCACAAGA 900 AAGAGATGTG AGCTGTAGCG TATCAAATCT CATTAATAAC TAGTAGTATT CTCAACGCTA 960 TCGTTTATTT CTTTCTTTGG TTTGCCACTA TATGCCGCTT CTCTCCTCTT TATCCCACGT 1020 ACTATCCATT TTTTTTGTGG TAGTCCATTT TTTTGAAGCT TTAATAACGT AACACTGAAT 1080 ATT AATTTGT TGGTTTAATT AACTTTGAGT CTTTGCTTTT GGTTTATGCA GAAAC 1135

Claims (38)

1. REVIVAL NAME 1. An isolated nucleic acid fragment comprising a sequence of at least about 10 nucleotides of a delta-12 fatty acid desaturase gene from Brassicaceae or Helianthus having at least one mutation, wherein the gene it is effective to alter the fatty acid composition in Brassicaceae or Helianthus seeds and wherein said sequence includes at least one mutation.
2. 2. The nucleic acid fragment of claim 1, wherein at least one mutation comprises a mutation in a region of the desaturase gene encoding a His-Glu-Cys-Gly-His amino acid motif.
3. 3. A nucleic acid fragment of claim 2, wherein at least one mutation comprises a non-conservative amino acid substitution in said region.
4. 4. An isolated nucleic acid fragment comprising a sequence of at least about 10 nucleotides of a delta-15 fatty acid desaturase gene from Brassicaceae or Helianthus that has at least one mutation wherein the gene is effective to alter the composition of Brassicaceae or Helianthus seeds and wherein the sequence includes at least one mutation.
5. 5. The n-nucleic acid fragment of claim 4, wherein at least one mutation comprises a mutation in a region of the desaturase gene encoding a His-Glu-Cys-Gly-His amino acid motif.
6. 6. A fragment of nucleic acids of claim 4, wherein at least one mutation comprises a non-conservative amino acid substitution in said region.
7. 7. An isolated nucleic acid fragment encoding a polypeptide having an amino acid sequence selected from the group consisting of: a substantially identical amino acid sequence for SEQ ID NO: 12, a substantially identical amino acid sequence for SEQ ID NO: 16 and a substantially identical amino acid sequence for SEQ ID NO: 18.
8. 8. A fragment of nucleic acids of claim 7, wherein the amino acid sequence is SEQ ID NO: 12.
9. 9. A fragment of nucleic acids of claim 7, wherein the amino acid sequence is SEQ ID NO: 16.
10. 10. A nucleic acid fragment of claim 7, wherein the amino acid sequence is SEQ ID NO: 18.
11. 11. An isolated nucleic acid fragment, wherein the nucleic acid fragment is selected from the group consisting of: a) SEQ ID NO: 11; b) SEQ ID NO: 15; c) SEQ ID NO: 17; d) an RNA analogue of SEQ ID NO: 11; e) an RNA analog of SEQ ID NO: 15; f) an RNA analog of SEQ I D NO: 17; g) a fragment of nucleic acids having a nucleic acid sequence complementary to a), b), c), d), e), or f); and h) a nucleic acid fragment of a), b), c), d), e), f), og), ie at least 10 nucleotides in length and which hybridize under conditions of resistance in the genomic DNA encoding the mutation in the polypeptide of SEQ ID NO: 12, SEQ ID NO: 16; or SEQ ID NO: 18.
12. 12. An isolated polypeptide having an amino acid sequence selected from the group consisting of: a substantially identical amino acid sequence for SEQ ID NO: 12, a substantially identical amino acid sequence for SEQ ID NO: 16 and a substantially identical amino acid sequence for SEQ ID NO: 18.
13. 13. The polypeptide of claim 12, wherein the amino acid sequence is SEQ ID NO: 12.
14. 14. The polypeptide of claim 12, wherein the sequence of amino acid is SEQ ID NO: 16.
15. 15. The polypeptide of claim 12, wherein the amino acid sequence is SEQ ID NO: 18.
16. 16. A plant of Brassicaceae or Helianthus, the plant contains the first and second desaturase genes of fatty acid delta-12, each gene having at least one mutation, wherein at least one of said situations is in a region encoding a motif of the amino acids His-Xaa-Xaa-Xaa and wherein each mutant ion confers a fatty acid composition on the seeds of the plant.
17. 17. The plant of claim 16, wherein the motif comprises the His-Glu-Cys-Gly-His sequence.
18. 18. The plant of claim 17, wherein the mutation comprises a non-conservative amino acid substitution in said region.
19. The plant of claim 16, wherein the fatty acid composition comprises, after crossing and extracting the seeds, from about 1% to about 10% linoleic acid based on the total fatty acid composition.
20. 20. A plant of Brassicaceae or Helianthus, which contains a sequence of at least 10 nucleotides of a delta-15 fatty acid desaturase gene, each gene having at least one mutation, wherein at least one of said situations is in a region encoding a His-Xaa-Xaa-Xaa amino acid motif and wherein each mutation confers a fatty acid composition on the seeds of the plant. twenty-one .
21. The plant of claim 20 wherein the motif comprises the sequence H is-Glu-Cys-G ly-His.
22. 22. The plant of claim 21, wherein the mutation comprises a non-conservative amino acid substitution in said region.
23. The plant of claim 20, wherein the fatty acid composition comprises, after crossing and extracting the seeds, from about 0.5% to about 10% a-linolenic acid based on the total fatty acid composition .
24. 24. The Brassicaceae or Helianthus plant that it contains; a) a sequence of at least 10 nucleotides of the delta-12 fatty acid desaturase gene having at least one mutation, at least one mutation of the delta-12 gene in a region encoding the His-amino acid motif Xaa-Xaa-Xaa-His; and b) a sequence of at least 10 nucleotides of the delta-15 fatty acid desaturase gene having at least one mutation, the mutation of the delta-15 gene in a region encoding a motif of the amino acids His-Xaa-Xaa -Xaa-His, the mutation of the delta-12 gene and the mutation of the delta-15 gene that confers an altered fatty acid composition in plant seeds.
25. 25. A Brassicaceae or Helianthus plant that contains a sequence of at least 10 nucleotides of a delta-12 fatty acid desaturase having at least one mutation, at least one mutation in a region encoding an amino acid motif Tyr -Leu-Asn-Asn-Pro and where the mutation confers an altered composition of fatty acids in the seeds of the plant.
26. 26. A method for producing a line of the Brassicaceae or Helianthus plant, comprising the steps of: a) inducing mutagenesis in the cells of a starting variety of a Brassicaceae or Helianthus species; b) obtain one or more plants from the progeny of the cells; c) identifying at least one of the progeny plants containing a delta-12 fatty acid desaturase gene having at least one mutation, at least one mutation in a region encoding the amino acid motif His-Xaa -Xaa-Xaa-His; and d) producing the plant line of at least one progeny plant by auto-crossing or pollination, the plant line having at least one mutation of the delta-12 gene.
27. The method of claim 26, wherein the plant line produces seeds that give an oil having a linoleic acid content of about 1% to about 14%.
28. The method of claim 26, further comprising the steps of: e) inducing mutagenesis in cells of the plant line; f) obtain one or more progeny plants from the cells in plant line; g) identifying at least one of the plant line progeny plants containing a delta-15 fatty acid desaturase gene having at least one mutation of the delta-15 gene, at least one mutation of the delta- 15 in a region encoding a motif of the amino acids His-Xaa-Xaa-Xaa-His; h) producing a second plant line of at least one progeny plant from the plant line by self-pollination or crossing, the second plant line having at least one mutation of the delta-12 gene and at least one mutation of the delta-15 gene
29. 29. The method of claim 26, wherein the starting variety is a variety of Brassica napus.
30. 30. A method for producing the Brassicaceae plant line, comprising the steps of: a) inducing mutagenesis in cells of a starting variety of a Brassicaceae species; b) obtain one or more progeny plants from the cells; c) identifying at least one of the progeny plants containing a delta-12 fatty acid desaturase gene having at least one mutation, at least one mutation in a region encoding the amino acid motif His-Xaa -Xaa-Xaa-His; d) produce the plant line of at least one progeny plant by auto or pollination crossing, the plant line having at least one mutation of the delta-12 gene. e) induce mutagenesis in cells of the first plant line; f) obtain one or more plant progenies from the cells in plant line; g) identifying at least one of the first progeny plants of the plant line containing a second delta-12 fatty acid desaturase gene having at least one mutation, the second gene mutation in a region different from the region encoding the amino acid motif His-Xaa-Xaa-Xaa-His; and h) producing a second plant line of at least one progeny plant from the plant line by self-pollination or crossing, the second plant line having at least one mutation of the delta-12 gene and at least one mutation delta gene 12.
31. 31. A method for producing a plant line of Brassicaceae or Helianthus, comprising the steps of: a) inducing mutagenesis in the cells of a starting variety of a Brassicaceae or Helianthus species; b) obtain one or more progeny plants from the cells; c) identifying at least one of the progeny plants containing a delta-15 fatty acid desaturase gene having at least one mutation, at least one mutation in a region encoding the His-Xaa amino acid motif. -Xaa-Xaa-His; and d) producing the plant line of at least one progeny plant through the auto or pollination of crossing, the plant line having at least one location of the delta-15 gene.
32. 32. A canola seed designated Q4275 and represented by accession number of ATCC 97569.
33. 33. The progeny of the seed of claim 32, the progeny having a mutant delta-12 fatty acid desaturase present in the seed represented by the number ATCC Accession 97569.
34. 34. The progeny of claim 33, wherein the progenies are the Brassica napus plants.
35. 35. An isolated nucleic acid fragment, wherein the isolated nucleic acid fragment is selected from the group consisting of: (a) SEQ ID NO: 30; (b) SEQ I D NO: 31; (c) an RNA analog of SEQ ID NO: 30; (d) an RNA analog of SEQ ID NO: 31; (e) a fragment of nucleic acids having a nucleic acid sequence complementary to a), b), c) or d); and (f) a nucleic acid fragment of a), b), c), d) or e), ie at least 50 nucleotides in length having at least 70% sequence identity in the nucleotide sequence of SEQ ID NO: 30 or SEQ ID NO: 31.
36. 36. An isolated nucleic acid fragment comprising a sequence of at least 200 nucleotides having at least 70% identity for nucleotides 1 to about 1012 of SEQ ID NO: 28.
37. 37. An isolated nucleic acid fragment of claim 36, the sequence having at least 80% identity at nucleotides 1 to about 1012 of SEQ ID NO: 28.
38. 38. The isolated nucleic acid fragment of claim 26, the sequence having at least 90% identity at nucleotides 1 to about 1012 of SEQ ID NO: 28.