AU2002301539B2 - Fatty acid desaturases and mutant sequences thereof - Google Patents

Description

P/00/011 Regulation 3.2

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION FOR A DIVISIONAL PATENT

ORIGINAL

TO BE COMPLETED BY APPLICANT Name of Applicant: CARGILL, INCORPORATED Actual Inventors: DeBONTE, Lorin, ZHEGONG, Fan; and MIAO, Guo-Hua Address for Service: CALLINAN LAWRIE, 711 High Street, Kew, Victoria 3101, Australia Invention Title: FATTY ACID DESATURASES AND MUTANT SEQUENCES THEREOF The following statement is a full description of this invention, including the best method of performing it known to us:- 18/10/02,jb12995.cov,1 -2- FATTY ACID DESATURASES AND MUTANT SEQUENCES THEREOF Technical Field This invention relates to fatty, acid desaturases and nucleic acids encoding desaturase proteins. More particularly, the invention relates to nucleic acids encoding delta-12 and delta-15 fatty acid desaturase proteins that affect fatty acid composition in plants, polypeptides produced from such nucleic acids and plants expressing such nucleic acids.

Background of the Invention Many breeding studies have been conducted to improve the fatty acid profile of Brassica varieties. Pleines and Freidt, Fat Sci. Technol., 90(5), 167-171 (1988) describe plant lines with reduced C 18 3 levels combined with high oleic content Rakow and McGregor, J. Amer. Oil Chem. Soc., 50, 400-403 (Oct. 1973) discuss problems associated with selecting mutants for linoleic and linolenic acids. In. Can.

J. Plant Sci., 68, 509-511 (Apr. 1988) Stellar summer rape producing seed oil with 3% linolenic acid and 28% linoleic acid is disclosed. Roy and Tarr, Z. Pflanzenzuchtg, 95(3), 201-209 (1985) teaches transfer of genes through an interspecific cross from Brassica juncea into Brassica napus resulting in a reconstituted line combining high linoleic with low linolenic acid content. Roy and Tarr, Plant Breeding, 98, 89-96 (1987) discuss prospects for development of B. napus L. having improved linolenic and linolenic acid content. European Patent application 323,753 published July 12, 1989 discloses seeds and oils having greater than 79% oleic acid combined with less than 3.5% linolenic acid.

Canvin, Can. J. Botany, 43, 63-69 (1965) discusses the effect of temperature on the fatty acid composition of oils from several seed crops including rapeseed.

Mutations typically are induced with extremely high doses of radiation and/or chemical mutagens (Gaul, H. Radiation Botany (1964) 4:155-232). High dose levels which exceed LD50, and typically reach LD90, led to maximum achievable mutation rates. In mutation breeding of Brassica varieties high levels of chemical mutagens alone or combined with radiation have induced a limited number of fatty acid mutations (Rakow, G.Z. Pflanzenzuchtg (1973) 69:62-82). The low a-linolenic acid mutation derived from the Rakow mutation breeding program did not have direct commercial application because of low seed yield. The first commercial cultivar using the low a-linolenic acid mutation derived in 1973 was released in 1988 as the variety Stellar (Scarth, R. et al., Can. J. Plant Sci. (1988) 68:509-511). Stellar was 20% lower yielding than commercial cultivars at the time of its release.

18/10/02jbl2995.spe,2 30/08 '05 14:01 FAX 61 3 9859 1588 CALLINAN LAWRIE MELB AUS 4 PATENT OFFICE [1007 -3- 0 Alterations in fatty acid composition of vegetable oils is desirable for meeting Sspecific food and industrial uses. For example, Brassica varieties with increased monounsaturate levels (oleic acid) in the seed oil, and products derived from such eC oil, would improve lipid nutrition. Canola lines which are low in polyunsaturated fatty acids and high in oleic acid tend to have higher oxidative stability, which is a °C useful trait for the retail food industry.

t Delta-12 fatty acid desaturase (also known as oleic desaturase) is involved in O the enzymatic conversion of oleic acid to linoleic acid. Delta-15 fatty acid desaturase 1 (also known as linoleic acid desaturase) is involved in the enzymatic conversion of O 10 linoleic acid to a-linolenic acid. A microsomal delta-12 desaturase has been cloned C and characterized using T-DNA tagging. Okuley, et al., Plant Cell 6:147-158 (1994).

The nucleotide sequences of higher plant genes encoding microsomal delta-2 fatty acid desaturase are described in Lightner et al., W094/11516. Sequences of higher plant genes encoding microsomal and plastid delta-15 fatty acid desaturases are disclosed in Yadav, et al., Plant Physiol., 103:467-476 (1993), WO 93/11245 and Arondel, V. et al., Science, 258:1353-1355 (1992). However, there are no teachings that disclose mutations in delta-12 or delta-15 fatty acid desaturase coding sequences from plants. There is a need in the art for more efficient methods to develop plant lines that contain delta-12 or delta-15 fatty acid desaturase gene sequence mutations effective for altering the fatty acid composition of seeds.

Summary of the Invention The invention comprises Brassicaceae or Helianthus seeds, plants and plant lines having at least one mutation that controls the levels ofunsaturated fatty acids in plants. One embodiment of the invention is an isolated nucleic acid fragment comprising a nucleotide sequence encoding a mutation from a mutant delta-12 fatty acid desaturase conferring altered fatty composition in seeds when the fragment is present in a plant. In particular, the invention provides an isolated nucleic acid fragment comprising a full-length coding sequence of a Brassicaceae or Helianthus delta-12 fatty acid desaturase gene, said coding sequence having at least one mutation in a region of said desaturase gene encoding a His-Glu-Cys-Gly-His amino acid motif, wherein said at least one mutation in said motif comprises a codon encoding Lys in place of a codon encoding Glu, and wherein said at least one COMS ID No: SBMI-01454997 Received by IP Australia: Time 14:05 Date 2005-08-30 3 /08 '05 14:01 FAX 61 3 9859 1588 CALLINAN LAWRIE MELB AUS PATENT OFFICE oo00 0 -4- 0 Smutation renders the product of said desaturase gene non-functional. A preferred Ssequence comprises a mutant sequence as shown in Fig. 2. Another embodiment of O the invention is an isolated nucleic acid fragment comprising a nucleotide sequence c encoding a mutation from a mutant delta-15 fatty acid desaturase. In particular, the invention provides a Brassicaceae plant containing a full-length coding sequence of e a delta-15 fatty acid desaturase gene, said coding sequence having at least one non- Snaturally occurring mutation in a region encoding a His-Asp-Cys-Gly-His amino Sacid motif, wherein said at least one mutation in said motif comprises a codon encoding Lys in place of a codon encoding Asp, and wherein said mutation confers O to an altered fatty acid composition in seeds obtained from said plant cell. A plant may be soybean, oilseed Brassica species, sunflower, castor bean or corn. The mutant sequence may be derived from, for example, a Brassica napus, Brassica rapa, Brassicajuncea or Helianthus delta-12 or delta-15 desaturase gene.

Another embodiment of the invention involves a method for producing a Brassicaceae or Helianthus plant line, comprising the steps of: inducing mutagenesis in cells of a starting variety of a Brassicaceae or Helianthus species; (b) obtaining one or more progeny plants from said cells; identifying at least one of said progeny plants that contains a delta-12 fatty acid desaturase gene having at least one mutation in a region encoding a His-Glu-Cys-Gly-His amino acid motif, wherein said at least one mutation in said motif comprises a codon encoding Lys in place of a codon encoding Glu, and wherein said delta-12 gene mutation renders the product of said delta-12 desaturase gene non-functional; and producing said plant line from said at least one progeny plant by self-or cross-pollination, said plant line having said at least one delta-12 gene mutation. In another embodiment, the invention provides a method for producing a Brassicaceae plant line, comprising the steps of: (a) inducing mutagenesis in cells of a starting variety of a Brassicaceae species; (b) obtaining one or more progeny plants from said cells; identifying at least one of said progeny plants that contains a delta-15 fatty acid desaturase gene having at least one mutation, said at least one mutation in a region encoding a His-Asp-Cys-Gly-His amino acid motif, wherein said at least one mutation in said motif comprises a codon encoding Lys in place of a codon encoding Asp, and wherein said at least one mutation renders the product of said delta-15 desaturase gene non-functional; and COMS ID No: SBMI-01454997 Received by IP Australia: Time 14:05 Date 2005-08-30 30/08 '05 14:01 FA4X 61 3 9859 1588 CALLINAN LAWRIE MELB AUS PATENT OFFICE a0oo09 4a- 0 O(d) producing said plant line from said at least one progeny plant by self- or crosspollination, said plant line having said delta-15 gene mutation.

O Yet another embodiment of the invention involves a method of producing plant c lines containing altered fatty acid composition comprising: crossing a first plant with a second plant having a mutant delta-12 or delta-15 fatty acid desaturase; (b) c obtaining seeds from the cross of step growing fertile plants from such seeds; t n obtaining progeny seed from the plants of step and identifying those seeds o among the progeny that have altered fatty acid composition. Suitable plants are soybean, rapeseed, sunflower, safflower, castor bean and corn. Preferred plants are S 10 rapeseed and sunflower.

C The invention also provides a method for identifying a mutation in a Brassicaceae plant, comprising: providing a Brassicaceae plant having a decreased a-linolenic acid content as compared with a corresponding control Brassicaceae plant; and identifying at least one mutation in a delta-15 fatty acid desaturase gene of said plant, said at least one mutation in a region encoding a His- Asp-Cys-Gly-His amino acid motif, wherein said at least one mutation in said motif comprises a codon encoding Lys in place of a codon encoding Asp, and wherein said mutation renders the product of said delta-15 fatty acid desaturase gene nonfunctional.

The invention further provides a method for identifying a mutation in a Brassicaceae or Helianthus plant, comprising: providing a Brassicaceae or Helianthus plant having an increased oleic acid content as compared with a corresponding control Brassicaceae or Helianthus and plant; identifying at least one mutation in a delta-12 fatty acid desaturase gene of said plant, said at least one mutation in a region encoding a His-Glu-Cys-Gly-His amino acid motif, wherein said at least one mutation in said motif comprises a codon encoding Lys in place of a codon encoding Glu, and wherein said mutation renders the product of said delta-12 fatty acid desaturase gene non-functional.

The invention is also embodied in vegetable oil obtained from plants disclosed herein, which vegetable oil has an altered fatty acid composition.

The present application is a divisional application of Australian patent applications No. 80715/98 (750363) and 23030/01, the specifications of which are herein incorporated by reference.

COMS ID No: SBMI-01454997 Received by IP Australia: Time 14:05 Date 2005-08-30 30/08 '05 14:02 FAX 61 3 9859 1588 CALLINAN LAWRIE MELB AUS 4 PATENT OFFICE oio -4b o Brief Description of the Sequence Listings SSEQ ID NO: 1 shows a hypothetical DNA sequence of a Brassica Fad2 gene.

O SEQ ID NO:2 is the deduced amino acid sequence of SEQ ID NO: 1.

C

c SEQ ID NO:3 shows a hypothetical DNA sequence ofa Brassica Fad2 gene having a mutation at nucleotide 316. SEQ ID NO:4 is the deduced amino acid 0" sequence of SEQ ID NO: 3.

t n SEQ ID NO:5 shows a hypothetical DNA sequence of aBrassica Fad2 gene.

SSEQ ID NO:6 is the deduced amino acid sequence of SEQ ID Cl SEQ ID NO:7 shows a hypothetical DNA sequence of a Brassica Fad2 gene o 10 having a mutation at nucleotide 515. SEQ ID NO:8 is the deduced amino acid sequence of SEQ ID NO:7.

SEQ ID NO:9 shows the DNA sequence for the coding region of a wild type Brassica Fad2-D gene. SEQ ID NO:10 is the deduced amino acid sequence for SEQ ID NO:9.

SEQ ID NO: 11 shows the DNA sequence for the coding region of the IMC 129 mutant Brassica Fad2-D gene. SEQ ID NO:12 is the deduced amino acid sequence for SEQ ID NO:11.

COMS ID No: SBMI-01454997 Received by IP Australia: Time 14:05 Date 2005-08-30 SEQ ID NO:13 shows the DNA sequence for the coding region of a wild type Brassica Fad2-F gene. SEQ ID NO: 14 is the deduced amino acid sequence for SEQ ID NO:13.

SEQ ID NO: 15 shows the DNA sequence for the coding region of the Q508 mutant Brassica Fad2-F gene. SEQ ID NO: 16 is the deduced amino acid sequence for SEQ ID NO: SEQ ID NO: 17 shows the DNA sequence for the coding region of the Q4275 mutant Brassica Fad2-F gene. SEQ ID NO:18 is the deduced amino acid sequence for SEQ ID NO:17.

SEQ ID NOS: 19-27 show oligonucleotide sequences.

SEQ ID NO:28 shows the genomic DNA sequence for the Fad2-U gene from Brassica.

SEQ ID NOS:30-31 show genomic sequences located upstream from the start codon of Brassica Fad2-D genes.

Brief Description of the Figures Figure 1 is a histogram showing the frequency distribution of seed oil oleic acid

(C

18 content in a segregating population of a Q508 X Westar cross. The bar labeled WSGA 1A represents the C 18 :I content of the Westar parent. The bar labeled Q508 represents the C 18 s: content of the Q508 parent.

Figure 2 shows the nucleotide sequences for a Brassica Fad2-D wild type gene (Fad2-D wt), IMC129 mutant gene (Fad2-D GA316 IMC129), Fad2-F wild type gene (Fad2-F wt), Q508 mutant gene (Fad2-F TA515 Q508) and Q4275 mutant gene (Fad2-F GA908 Q4275).

Figure 3 shows the deduced amino acid sequences for the polynucleotides of Figure 2.

Description of the Preferred Embodiments All percent fatty acids herein are percent by weight of the oil of which the fatty acid is a component.

As used herein, a "line" is a group of plants that display little or no genetic variation between individuals for at least one trait. Such lines may be created by several generations of self-pollination and selection, or vegetative propagation from a single parent using tissue or cell culture techniques. As used herein, the term "variety" refers to a line which is used for commercial production.

18/10/02jb12995.spc,5 The term "mutagenesis" refers to the use of a mutagenic agent to induce random genetic mutations within a population of individuals. The treated population, or a subsequent generation of that population, is then screened for usable trait(s) that result from the mutations. A "population" is any group of individuals that share a common gene pool. As used herein "Mo" is untreated seed. As used herein, "Mi" is the seed (and resulting plants) exposed to a mutagenic agent, while "M 2 is the progeny (seeds and plants) of selfpollinated MI plants, "M 3 is the progeny of self-pollinated M 2 plants, and "M 4 is the progeny of self-pollinated M 3 plants. "M 5 is the progeny of self-pollinated M 4 plants.

"M

6

"M

7 etc. are each the progeny of self-pollinated plants of the previous generation.

The term "selfed" as used herein means self-pollinated.

"Stability" or "stable" as used herein means that with respect to a given fatty acid component, the component is maintained from generation to generation for at least two generations and preferably at least three generations at substantially the same level, e.g., preferably The method of invention is capable of creating lines with improved fatty acid compositions stable up to from generation to generation. The above stability may be affected by temperature, location, stress and time of planting. Thus, comparison of fatty acid profiles should be made from seeds produced under similar growing conditions.

Stability may be measured based on knowledge of prior generation.

.Intensive breeding has produced Brassica plants whose seed oil contains less than 2% erucic acid. The same varieties have also been bred so that the defatted meal contains less than 30 lpmol glucosinolates/gram. "Canola" as used herein refers to plant variety seed or oil which contains less than 2% erucic acid (Q22:1), and meal with less than 30 imol glucosinolates/gram.

Applicants have discovered plants with mutations in a delta-12 fatty acid desaturase gene. Such plants have useful alterations in the fatty acid compositions of the seed oil.

Such mutations confer, for example, an elevated oleic acid content, a decreased, stabilized linoleic acid content, or both elevated oleic acid and decreased, stabilized linoleic acid content.

Applicants have further discovered plants with mutations in a delta-15 fatty acid desaturase gene. Such plants have useful alterations in the fatty acid composition of the seed oil, a decreased, stabilized level of a-linolenic acid.

Applicants have further discovered isolated nucleic acid fragments polynucleotides) comprising sequences that carry mutations within the coding sequence of delta-12 or fatty acid desaturases. The mutations confer desirable alterations in fatty acid 18/10/02jb12995.spe.6 levels in the seed oil of plants carrying such mutations. Delta-12 fatty acid desaturase is also known as omega-6 fatty acid desaturase and is sometimes referred to herein as Fad2 or 12-DES. Delta-15 fatty acid desaturase is also known on omega-3 fatty acid desaturase and is sometimes referred to herein as Fad3 or A nucleic acid fragment of the invention may be in the form of RNA or in the form of DNA, including cDNA, synthetic DNA or genomic DNA. The DNA may be double-stranded or single-stranded, and if single-stranded, can be either the coding strand or non-coding strand. An RNA analog may be, for example, mRNA or a combination of ribo- and deoxyribonucleotides. Illustrative examples of a nucleic acid fragment of the invention are the mutant sequences shown in Fig. 3.

A nucleic acid fragment of the invention contains a mutation in a microsomal delta-12 fatty acid desaturase coding sequence or a mutation in a microsomal delta-15 fatty acid desaturase coding sequence. Such a mutation renders the resulting desaturase gene product nonfunctional in plants, relative to the function of the gene product encoded by the wild-type sequence. The nonfunctionality of the delta-12 desaturase gene product can be inferred from the decreased level of reaction product (linoleic acid) and increased level of substrate (oleic acid) in plant tissues expressing the mutant sequence, compared to the corresponding levels in plant tissues expressing the wild-type sequence. The nonfunctionality of the delta-15 desaturase gene product can be inferred from the decreased level of reaction product (a-linolenic acid) and the increased level of substrate (linoleic acid) in plant tissues expressing the mutant sequence, compared to the corresponding levels in plant tissues expressing the wild-type sequence.

A nucleic acid fragment of the invention may comprise a portion of the coding sequence, at least about 10 nucleotides, provided that the fragment contains at least one mutation in the coding sequence. The length of a desired fragment depends upon the purpose for which the fragment will be used, PCR primer, site directed mutagenesis and the like. In one embodiment, a nucleic acid fragment of the invention comprises the full length coding sequence of a mutant delta-12 or mutant delta-15 fatty acid desaturase, the mutant sequences of Fig. 3. In other embodiments, a nucleic acid fragment is about 20 to about 50 nucleotides (or base pairs, bp), or about 50 to about 500 nucleotides, or about 500 to about 1200 nucleotides in length.

In another embodiment, the invention relates to an isolated nucleic acid fragment of at least 50 nucleotides in length that has at least 70% sequence identity to the nucleotide sequences of SEQ ID NO:30 or SEQ ID NO:31. In some embodiments, such nucleic acid 18/10/02jb 2995.spc, 7 fragments have at least 80% or 90% sequence identity to SEQ ID NO:30 or SEQ ID NO:31. Sequence identity for these and other nucleic acids disclosed herein can be determined, for example, using Blast. 2.0.4 (Feb. 24, 1998) to search the nr database (nonredundant GenBank, EMBL, DDBT and PDB). BLAST 2.0.4 is provided by the National Center for Biotechnology (http://www.ncbi.nlm.nih.gov). Altschul, S.F. et al., Nucleic Acids Res., 25:3389-3402 (1997). Alternatively, MEGALIGN® (DNASTAR, Madison, WI) sequence alignment software can be used to determine sequence identity by the Clustal algorithm. In this method, sequences are grouped into clusters by examining the distance between all pairs. Clusters are aligned pairwise, then as groups. The Jotun Hein algorithm is also available in MEGALIGN®. The nucleotide sequences of SEQ ID and NO:31 are about 85% identical using the Clustal algorithm with default parameters.

The nucleotide sequences of SEQ ID NO:30 and SEQ ID NO:31 are located upstream of the ATG start codon for the fad2-D gene and can be isolated from Bridger and Westar canola plants, respectively. These upstream elements contain intron-like features.

The invention also relates to an isolated nucleic acid fragment that includes a sequence of at least 200 nucleotides. The fragment has at least 70% identity to nucleotides 1 to about 1012 of SEQ ID NO:28. In some embodiments, the fragment has 80% or at least sequence identity to nucleotides 1 to about 1012 of SEQ ID NO:28. This portion of SEQ ID NO:28 is located upstream of the ATG start codon and has intron-like features.

A mutation in a nucleic acid fragment of the invention may be in any portion of the coding sequence that renders the resulting gene product non-functional. Suitable types of mutations include, without limitation, insertions of nucleotides, deletions of nucleotides, or transitions and transversions in the wild-type coding sequence. Such mutations result in insertions of one or more amino acids, deletions of one or more amino acids, and nonconservative amino acid substitutions in the corresponding gene product. In some embodiments, the sequence of a nucleic acid fragment may comprise more than one mutation or more than one type of mutation.

Insertion or deletion of amino acids in a coding sequence may, for example, disrupt the conformation of essential alpha-helical or beta-pleated sheet regions of the resulting gene product. Amino acid insertions or deletions may also disrupt binding or catalytic sites important for gene product activity. It is known in the art that the insertion or deletion of a larger number of contiguous amino acids is more likely to render the gene product nonfunctional, compared to a smaller number of inserted or deleted amino acids.

18/10/02jb 2995.spe.8 -9- Non-conservative amino acid substitutions may replace an amino acid of one class with an amino acid of a different class. Non-conservative substitutions may make a substantial change in the charge or hydrophobicity of the gene product. Non-conservative amino acid substitutions may also make a substantial change in the bulk of the residue side chain, substituting an alanyl residue for a isoleucyl residue.

Examples of non-conservative substitutions include the substitution of a basic amino acid for a non-polar amino acid, or a polar amino acid for an acidic amino acid.

Because there are only 20 amino acids encoded in a gene, substitutions that result in a nonfunctional gene product may be determined by routine experimentation, incorporating amino acids of a different class in the region of the gene product targeted for mutation.

Preferred mutations are in a region of the nucleic acid encoding an amino acid sequence motif that is conserved among delta-12 fatty acid desaturases or delta-15 fatty acid desaturases, such as a His-Xaa-Xaa-Xaa-His motif (Tables An example of a suitable region has a conserved HECGH motif that is found, for example, in nucleotides corresponding to amino acids 105 to 109 of the Arabidopsis and Brassica delta-12 desaturase sequences, in nucleotides corresponding to amino acids 101 to 105 of the soybean delta-12 desaturase sequence and in nucleotides corresponding to amino acids 111 to 115 of the maize delta-12 desaturase sequence. See WO 94/115116; Okuley et al., Plant Cell 6:147-158 (1994). The one letter amino acid designations used herein are described in Alberts, B. et al., Molecular Biology of the Cell, 3rd edition, Garland Publishing, New York, 1994. Amino acids flanking this motif are also highly conserved among delta-12 and delta-15 desaturases and are also suitable candidates for mutations in fragments of the invention.

An illustrative embodiment of a mutation in a nucleic acid fragment of the invention is a Glu to Lys substitution in the HECGH motif of a Brassica microsomal delta-12 desaturase sequence, either the D form or the F form. This mutation results in the sequence HECGH being changed to HKCGH as seen by comparing SEQ ID NO: (wildtype D form) to SEQ ID NO:12 (mutant D form). A similar mutation in other Fad-2 sequences is contemplated to result in a non-functional gene product. (Compare SEQ ID NO:2 to SEQ ID NO:4).

A similar motif may be found at amino acids 101 to 105 of the Arabidopsis microsomal delta-15 fatty acid desaturase, as well as in the corresponding rape and soybean desaturases (Table See, WO 93/11245; Arondel, V. et al., Science, 18/10/02jb 12 9 9 5.spc,9 258:1153-1155 (1992); Yadav, N. et al., Plant Physiol., 103:467-476 (1993). Plastid fatty acids have a similar motif (Table Among the types of mutations in an HECGH motif that render the resulting gene product non-functional are non-conservative substitutions. An illustrative example of a non-conservative substitution is substitution of a glycine residue for either the first or second histidine. Such a substitution replaces a charged residue (histidine) with a non-polar residue (glycine). Another type of mutation that renders the resulting gene product nonfunctional is an insertion mutation, insertion of a glycine between the cysteine and glutamic acid residues in the HECGH motif.

Other regions having suitable conserved amino acid motifs include the HRRHH motif shown in Table 2, the HRTHH motif shown in Table 6 and the HVAHH motif shown in Table 3. See, WO 94/115116; Hitz, W. et al., Plant Physiol., 105:635-641 (1994); Okuley, et al., supra; and Yadav, N. et al., supra. An illustrative example of a mutation in the region shown in Table 3 is a mutation at nucleotides corresponding to the codon for glycine (amino acid 303 of B. napus) A non-conservative Gly to Glu substitution results in the amino acid sequence DRDYGILNKV being changed to sequence DRDYEILNKV (compare wild-type F form SEQ ID NO: 14 to mutant Q4275 SEQ ID NO: 18, Fig. 3).

Another region suitable for a mutation in a delta-12 desaturase sequence contains the motif KYLNNP at nucleotides corresponding to amino acids 171 to 175 of the Brassica desaturase sequence. An illustrative example of a mutation is this region is a Leu to His substitution, resulting in the amino acid sequence (Table 4) KYHNN (compare wild-type Fad2-F SEQ ID NO: 14 to mutant SEQ ID NO:16). A similar mutation in other Fad-2 amino acid sequences is contemplated to result in a non-functional gene product. (Compare SEQ ID NO:6 to SEQ ID NO:8).

18/10/02jbl2995.spe, -11 I- TABLE 1 Alignment of Amino Acid Sequences from Microsomal Delta- 12 Fatty Acid Desaturases Position Amino Acid Sequence Species Arab idopsis thaliana Glycine max Zea mays Ricinus communisa Brassica napus D Brassica napus F 100-129 96-125 106-135 1- 29 100-128 100-128 IWVIAHECGH HAFSDYQWLD DTVGLIFHSF VWVIAHECGH HAFSKYQWVD DVVGLTLHST VWVIAHECGH HAFSDYSLLD DVVGLVLHSS WVMAHDCGH HAFSDYQLLD DVVGLILHSC VWVIAI-ECGH HAFSDYQWLD DTVGLIFHS VWVIAHECGH HAFSDYQWLD DTVGLIFHS a from plasmid pRF2-1 C TABLE 2 Alignment of Amino Acid Sequences from Micro somal Delta- 12 Fatty Acid Desaturases Species Position Amino Acid Sequence Arabidopsis thaliana Glycine max Zea mays Ricinus communisa Brassica napus D Brassica napus F 130-158 LLVPYFSWKY SHRRHHSNTG SLERDEVFV 126-154 LLVPYFSWKI SHRRHHSNTG SLDRDEVFV 136-164 LMVPYFSWKY SHRRHHSNTG SLFRDEVFV 30- 58 LLVPYFSWK- SHRRHHSNTG-SLERDEVFV 130-158 LLVPYFSWrKY SHRSHHSNTG SLERDEVFV 130-158 LLVPYFSWvKY SHRRHHSNTG SLERDEVFV from plasmid pRF2-1 C 18/10/02jb I2995.spc,l II 12- TABLE 3 Alignment of Amino Acid Sequences from Microsomal Delta- 12 Fatty Acid Desaturases Position Amino Acid Sequence Species Arabidopsis thaliana io NAMEAT Glycine max

HAMEAT

Zea mays

HAMEAT

Ricinus communisa Brassica napus D

HAMEAT

Brassica napus F

HAMEAT

298-333 DRDYGILNKV FHNITDTHVA HHLFSTMPHY 294-329 DRDYGILNKV FHHITDTHVA HHLFSTMPHY 305-340 DRDYGILNRV FHNITDTHVA HHLFSTMPHY 198-224 DRDYGILNKV FH-NITDTQVA 1-IHLF TMP 299-334 DRDYGILNKV FHNITDTHVA HHPFSTMPHY 299-334 DRDYGILNKV FHMITDTHVA HHLFSTMPHY a from plasmid pRF2-1 C TABLE 4 Alignment of Conserved Amino Acids from Microsomal Delta- 12 Fatty Acid Desaturases Species Position Amino Acid Sequence Arabidopsis thaliana Glycine max Zea mays Ricinus communisa Brassica napus D Brassica napus F 165-180 161-176 172-187 65- 80 165-180 165-180 IKWYGKYLNN PLGRIM VAWFSLYLNN PLGRAV PWYTPYVYNN PVGRVV IRWYSKYLNN PPGRIM IKWYGKYLNN PLGRTV IKWYGKYLNN PLGRTV a from plasmid pRF2-l C 18/iO/02jbl2995.spe, 12 13- TABLE Alignment of Conserved Amino Acids from Plastid and Microsomal Fatty Acid Desaturases Position Amino Acid Sequence Species Arabidopsis thalianaa Brassica napus a Glycine maxa Arabidopsis thaliana Brassica napus Glycine max 156-177 114-135 164-185 94-115 87-109 93-114 WALFVLGHD CGHGSFSNDP KLN WALFVLGHD CGHGSFSNDP RLN WALFVLGHD CGHGSFSNNS KLN WAIFVLGHD CGHGSFSDIP LLN WALFVLGHD CGHGSFSNDP RLN WALFVLGHD CGHGSFSDSP PLN a Plastid sequences TABLE 6 Alignment of Conserved Amino Acids from Plastid and Microsomal Fatty Acid Desaturases Species Position Amino Acid Sequence A. thalianaa B. napus a Glycine maxa A. thaliana Brassica napus Glycine max 188-216 146-174 196-224 126-154 117-145 125-153 ILVPYHGWRI SHRTHHQNHG HVENDESWH ILVPYHGWRI SHRTHHQNHG HVENDESWH ILVPYHGWRI SHRTHHQNHG HAENDESWH ILVPYHGWRI SHRTHHQNHG HVENDESWV ILVPYHGWRI SHRTHHQNHG HVENDESWV ILVPYHGWRI SHRTHHQNHG HIEKDESWV a Plastid sequences The conservation of amino acid motifs and their relative positions indicates that regions of a delta-12 or delta-15 fatty acid desaturase that can be mutated in one species to generate a non-functional desaturase can be mutated in the corresponding region from other species to generate a non-functional delta-12 desaturase or delta-15 desaturase gene product in that species.

Mutations in any of the regions of Tables 1-6 are specifically included within the scope of the invention and are substantially identical to those mutations exemplified 18/10/02jb12995.spe,13 -14herein, provided that such mutation (or mutations) renders the resulting desaturase gene product non-functional, as discussed hereinabove.

A nucleic acid fragment containing a mutant sequence can be generated by techniques known to the skilled artisan. Such techniques include, without limitation, sitedirected mutagenesis of wild-type sequences and direct synthesis using automated DNA synthesizers.

A nucleic acid fragment containing a mutant sequence can also be generated by mutagenesis of plant seeds or regenerable plant tissue by, ethyl methane sulfonate, X-rays or other mutagens. With mutagenesis, mutant plants having the desired fatty acid io phenotype in seeds are identified by known techniques and a nucleic acid fragment containing the desired mutation is isolated from genomic DNA or RNA of the mutant line.

The site of the specific mutation is then determined by sequencing the coding region of the delta-12 desaturase or delta-15 desaturase gene. Alternatively, labeled nucleic acid probes that are specific for desired mutational events can be used to rapidly screen a mutagenized population.

The disclosed method may be applied to all oil seed Brassica species, and to both Spring and Winter maturing types within each species. Physical mutagens, including but not limited to X-rays, W rays, and other physical treatments which cause chromosome damage, and other chemical mutagens, including but not limited to ethidium bromide, nitrosoguanidine, diepoxybutane etc. may also be used to induce mutations. The mutagenesis treatment may also be applied to other stages of plant development, including but not limited to cell cultures, embryos, microspores and shoot apices.

"Stable mutations" as used herein are defined as M 5 or more advanced lines which maintain a selected altered fatty acid profile for a minimum of three generations, including a minimum of two generations under field conditions, and exceeding established statistical thresholds for a minimum of two generations, as determined by gas chromatographic analysis of a minimum of 10 randomly selected seeds bulked together. Alternatively, stability may be measured in the same way by comparing to subsequent generations. In subsequent generations, stability is defined as having similar fatty acid profiles in the seed as that of the prior or subsequent generation when grown under substantially similar conditions.

Mutation breeding has traditionally produced plants carrying, in addition to the trait of interest, multiple, deleterious traits, reduced plant vigor and reduced fertility. Such traits may indirectly affect fatty acid composition, producing an unstable mutation; and/or 18110/02jb12995.spe 14 reduced yield, thereby reducing the commercial utility of the invention. To eliminate the occurrence of deleterious mutations and reduce the load of mutations carried by the plant, a low mutagen dose is used in the seed treatments to create an LD30 population. This allows for the rapid selection of single gene mutations for fatty acid traits in agronomic backgrounds which produce acceptable yields.

The seeds of several different plant lines have been deposited with the American Type Culture Collection and have the following accession numbers.

Line Accession No. Deposit Date A129.5 40811 May 25, 1990 A133.1 40812 May 25, 1990 M3032.1 75021 June 7, 1991 M3062.8 75025 June 7, 1991 M3028.10 75026 -June 7, 1991 IMC130 75446 April 16, 1993 Q4275 97569 May 10, 1996 In some plant species or varieties more than one form of endogenous microsomal delta-12 desaturase may be found. In amphidiploids, each form may be derived from one of the parent genomes making up the species under consideration. Plants with mutations in both forms have a fatty acid profile that differs from plants with a mutation in only one form. An example of such a plant is Brassica napus line Q508, a doubly-mutagenized line containing a mutant D-form of delta-12 desaturase (SEQ ID NO:11) and a mutant F-form of delta-12 desaturase (SEQ ID NO:15). Another example is line Q4275, which contains a mutant D-form of delta-12 desaturase (SEQ ID NO:11) and a mutant F-form of delta-12 desaturase (SEQ ID NO:17). See Figs. 2-3.

Preferred host or recipient organisms for introduction of a nucleic acid fragment of the invention are the oil-producing species, such as soybean (Glycine max), rapeseed Brassica napus, B. rapa and B. juncea) sunflower (Helianthus annus), castor bean (Ricinus communis), corn (Zea mays), and safflower (Carthamus tinctorius).

A nucleic acid fragment of the invention may further comprise additional nucleic acids. For example, a nucleic acid encoding a secretory or leader amino acid sequence can be linked to a mutant desaturase nucleic acid fragment such that the secretory or leader sequence is fused in-frame to the amino terminal end of a mutant delta-12 or desaturase polypeptide. Other nucleic acid fragments are known in the art that encode amino acid sequences useful for fusing in-frame to the mutant desaturase polypeptides 18/10/02jb12995.spe,15 -16disclosed herein. See, U.S. 5,629,193 incorporated herein by reference. A nucleic acid fragment may also have one or more regulatory elements operably linked thereto.

The present invention also comprises nucleic acid fragments that selectively hybridize to mutant desaturase sequences. Such a nucleic acid fragment typically is at least 15 nucleotides in length. Hybridization typically involves Southern analysis (Southern blotting), a method by which the presence of DNA sequences in a target nucleic acid mixture are identified by hybridization to a labeled oligonucleotide or DNA fragment probe. Southern analysis typically involves electrophoretic separation of DNA digests on agarose gels, denaturation of the DNA after electrophoretic separation, and transfer of the DNA to nitrocellulose, nylon, or another suitable membrane support for analysis with a radiolabeled, biotinylated, or enzyme-labeled probe as described in sections 9.37-9.52 of Sambrook et al., (1989) Molecular Cloning, second edition, Cold Spring Harbor aboratory, Plainview; NY.

A nucleic acid fragment can hybridize under moderate stringency conditions or, preferably, under high stringency conditions to a mutant desaturase sequence. High stringency conditions are used to identify nucleic acids that have a high degree of homology to the probe. High stringency conditions can include the use of low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate (0.1X SSC); 0.1% sodium lauryl sulfate (SDS) at 50-65 0 C. Alternatively, a denaturing agent such as formamide can be employed during hybridization, formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% mM sodium phosphate buffer at pH 6.5 with 750 mM NaC1, 75 mM sodium citrate at 42 0 C. Another example is the use of 50% formamide, 5 x SSC (0.75 M NaCI, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 utg/ml), 0.1% SDS, and dextran sulfate at 42 0 C, with washes at 42 0 C in 0.2 x SSC and 0.1% SDS.

Moderate stringency conditions refers to hybridization conditions used to identify nucleic acids that have a lower degree of identity to the probe than do nucleic acids identified under high stringency conditions. Moderate stringency conditions can include the use of higher ionic strength and/or lower temperatures for washing of the hybridization membrane, compared to the ionic strength and temperatures used for high stringency hybridization. For example, a wash solution comprising 0.060 M NaCl/0.0060 M sodium citrate (4X SSC) and 0.1% sodium lauryl sulfate (SDS) can be used at 50 0 C, with a last 18/10/02jb12995.spe,16 -17wash in 1X SSC, at 65 0 C. Alternatively, a hybridization wash in IX SSC at 37 0 C can be used.

Hybridization can also be done by Northern analysis (Northern blotting), a method used to identify RNAs that hybridize to a known probe such as an oligonucleotide, DNA fragment, cDNA or fragment thereof, or RNA fragment. The probe is labeled with a radioisotope such as 32 P, by biotinylation or with an enzyme. The RNA to be analyzed can be usually electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon, or other suitable membrane, and hybridized with the probe, using standard techniques well known in the art such as those described in sections 7.39-7.52 of Sambrook et al., supra.

A polypeptide of the invention comprises an isolated polypeptide having a mutant amino acid sequence, as well as derivatives and analogs thereof. See, the mutant amino acid sequences of Fig. 3. By "isolated" is meant a polypeptide that is expressed and produced in an environment other than the environment in which the polypeptide is naturally expressed and produced. For example, a plant polypeptide is isolated when expressed and produced in bacteria or fungi. A polypeptide of the invention also comprises variants of the mutant desaturase polypeptides disclosed herein, as discussed above.

In one embodiment of the claimed invention, a plant contains both a delta-12 desaturase mutation and a delta-15 desaturase mutation. Such plants can have a fatty acid composition comprising very high oleic acid and very low alpha-linolenic acid levels.

Mutations in delta-12 desaturase and delta-15 desaturase may be combined in a plant by making a genetic cross between delta-12 desaturase and delta-15 desaturase single mutant lines. A plant having a mutation in delta-12 fatty acid desaturase is crossed or mated with a Ssecond plant having a mutation in delta-15 fatty acid desaturase. Seeds produced from the cross are planted and the resulting plants are selfed in order to obtain progeny seeds. These progeny seeds are then screened in order to identify those seeds carrying both mutant genes.

Alternatively, a line possessing either a delta-12 desaturase or a delta-15 desaturase mutation can be subjected to mutagenesis to generate a plant or plant line having mutations in both delta-12 desaturase and delta-15 desaturase. For example, the IMC 129 line has a mutation in the coding region (Glulo 6 to Lys10 6 of the D form of the microsomal delta-12 desaturase structural gene. Cells seeds) of this line can be mutagenized to induce a mutation in a delta-15 desaturase gene, resulting in a plant or plant line carrying a mutation 18/10/02jb 2995.spe, 17 -18in a delta-12 fatty acid desaturase gene and a mutation in a delta-15 fatty acid desaturase gene.

Progeny includes descendants of a particular plant or plant line, seeds developed on an instant plant are descendants. Progeny of ar instant plant include seeds formed on FI, F 2

F

3 and subsequent generation plants, or seeds formed on BC 1

BC

2

BC

3 and subsequent generation plants.

Plants according to the invention preferably contain an altered fatty acid composition. For example, oil obtained from seeds of such plants may have from about 69 to about 90% oleic acid, based on the total fatty acid composition of the seed. Such oil preferably has from about 74 to about 90% oleic acid, more preferably from about 80 to about 90% oleic acid. In some embodiments, oil obtained from seeds produced by plants of the invention may have from about 2.0% to about 5.0% saturated fatty acids, based on total fatty acid composition of the seeds. In some embodiments, oil obtained from seeds of the invention may have from about 1.0% to about 14.0% linoleic acid, or from about 0.5% to about 10.0% t-linolenic acid.

Oil composition typically is analyzed by crushing and extracting fatty acids from bulk seed samples 10 seeds). Fatty acid triglycerides in the seed are hydrolyzed and converted to fatty acid methyl esters. Those seeds having an altered fatty acid composition may be identified by techniques known to the skilled artisan, gas-liquid chromatography (GLC) analysis of a bulked seed sample or of a single half-seed. Half-seed analysis is well known in the art to be useful because the viability of the embryo is maintained and thus those seeds having a desired fatty acid profile may be planted to from the next generation. However, half-seed analysis is also known to be an inaccurate representation of genotype of the seed being analyzed. Bulk seed analysis typically yields a more accurate representation of the fatty acid profile of a given genotype. Fatty acid composition can also be determined on larger samples, oil obtained by pilot plant or commercial scale refining, bleaching and deodorizing of endogenous oil in the seeds.

The nucleic acid fragments of the invention can be used as markers in plant genetic mapping and plant breeding programs. Such markers may include restriction fragment length polymorphism (RFLP), random amplification polymorphism detection (RAPD), polymerase chain reaction (PCR) or self-sustained sequence replication (3SR) markers, for example. Marker-assisted breeding techniques may be used to identify and follow a desired fatty acid composition during the breeding process. Marker-assisted breeding techniques may be used in addition to, or as an alternative to, other sorts of identification techniques.

18/10/02jb12995.spc, 18 19- An example of marker-assisted breeding is the use of PCR primers that specifically amplify a sequence containing a desired mutation in delta-12 desaturase or desaturase.

Methods according to the invention are useful in that the resulting plants and plant lines have desirable seed fatty acid compositions as well as superior agronomic properties compared to known lines having altered seed fatty acid composition. Superior agronomic characteristics include, for example, increased seed germination percentage, increased seedling vigor, increased resistance to seedling fungal diseases (damping off, root rot and the like), increased yield, and improved standability.

While the invention is susceptible to various modifications and alternative forms, certain specific embodiments thereof are described in the general methods and examples set forth below. For example the invention may be applied to all Brassica species, including B. rapa, B. juncea, and B. hirta, to produce substantially similar results. It should be understood, however, that these examples are not intended to limit the invention to the particular forms disclosed but, instead the invention is to cover all modifications, equivalents and alternatives falling within the scope of the invention. This includes the use of somaclonal variation; physical or chemical mutagenesis of plant parts; anther, microspore or ovary culture followed by chromosome doubling; or self- or cross-pollination to transmit the fatty acid trait, alone or in combination with other traits, to develop new Brassica lines.

EXAMPLE 1 Mutaqenesis Seeds of Westar, a Canadian (Brassica napus) spring canola variety, were subjected to chemical mutagenesis. Westar is a registered Canadian spring variety with canola quality. The fatty acid composition of field-grown Westar, 3.9% c16:, 1.9% C1s:o, 67.5% c18:i, 17.6% C 18 2 7.4% Cs: 3 2% C20:1 C 22 1 has remained stable under commercial production, with 10% deviation, since 1982.

Prior to mutagenesis, 30,000 seeds of B. napus cv. Westar seeds were preimbibed in 300-seed lots for two hours on wet filter paper to soften the seed coat. The preimbibed seeds were placed in 80 mM ethylmethanesulfonate (EMS) for four hours. Following mutagenesis, the seeds were rinsed three times in distilled water. The seeds were sown in 48-well flats containing Pro-Mix. Sixty-eight percent of the mutagenized seed germinated.

The plants were maintained at 25 0 C/15 0 C, 14/10 hr day/night conditions in the greenhouse.

At flowering, each plant was individually self-pollinated.

18/10/02jb 2995.spe,19

M

2 seed from individual plants were individually catalogued and stored, approximately 15,000 M 2 lines was planted in a summer nursery in Carman, Manitoba.

The seed from each selfed plant were planted in 3-meter rows with 6-inch row spacing.

Westar was planted as the check variety. Selected lines in the field were selfed by bagging the main raceme of each plant. At maturity, the selfed plants were individually harvested and seeds were catalogued and stored to ensure that the source of the seed was known.

Self-pollinated M 3 seed and Westar controls were analyzed in 10-seed bulk samples for fatty acid composition via gas chromatography. Statistical thresholds for each fatty acid component were established using a Z-distribution with a stringency level of 1 in 10,000.

Mean and standard deviation values were determined from the non-mutagenized Westar control population in the field. The upper and lower statistical thresholds for each fatty acid were determined from the mean value of the population the standard deviation, multiplied by the Z-distribution. Based on a population size of 10,000, the confidence interval is 99.99%.

The selected M 3 seeds were planted in the greenhouse along with Westar controls.

The seed was sown in 4-inch pots containing Pro-Mix soil and the plants were maintained at 25°C/15-C, 14/10 hr day/night cycle in the greenhouse. At flowering, the terminal raceme was self-pollinated by bagging. At maturity, selfed M 4 seed was individually harvested from each plant, labelled, and stored to ensure that the source of the seed was known.

The M 4 seed was analyzed in 10-seed bulk samples. Statistical thresholds for each fatty acid component were established from 259 control samples using a Zdistribution of 1 in 800. Selected M 4 lines were planted in a field trial in Carman, Manitoba in 3-meter rows with 6-inch spacing. Ten M 4 plants in each row were bagged for self-pollination. At maturity, the selfed plants were individually harvested and the open pollinated plants in the row were bulk harvested. The M 5 seed from single plant selections was analyzed in seed bulk samples and the bulk row harvest in 50-seed bulk samples.

Selected M 5 lines were planted in the greenhouse along with Westar controls. The seed was grown as previously described. At flowering the terminal raceme was selfpollinated by bagging. At maturity, selfed M 6 seed was individually harvested from each plant and analyzed in 0-seed bulk samples for fatty acid composition.

Selected M 8 lines were entered into field trials in Eastern Idaho. The four trial locations were selected for the wide variability in growing conditions. The locations included Burley, Tetonia, Lamont and Shelley (Table The lines were planted in four 3- 18/I0/02jb12995.spe,20 -21 meter rows with an 8-inch spacing, each plot was replicated four times. The planting design was determined using a Randomized Complete Block Designed. The commercial cultivar Westar was used as a check cultivar. At maturity the plots were harvested to determine yield. Yield of the entries in the trial was determined by taking the statistical average of the four replications. The Least Significant Difference Test was used to rank the entries in the randomized complete block design.

TABLE7 Trial Locations for Selected Fatty Acid Mutants LOCATION SITE CHARACTERIZATIONS BURLEY Irrigated. Long season. High temperatures during flowering.

TETONIA Dryland. Short season. Cool temperatures.

LAMONT Dryland. Short season. Cool temperatures.

SHELLEY Irrigated. Medium season. High temperatures during flowering.

To determine the fatty acid profile of entries, plants in each plot were bagged for self-pollination. The M7 seed from single plants was analyzed for fatty acids in ten-seed bulk samples.

To determine the genetic relationships of the selected fatty acid mutants crosses were made. Flowers of M 6 or later generation mutations were used in crossing. F, seed was harvested and analyzed for fatty acid composition to determine the mode of gene action.

The F 1 progeny were planted in the greenhouse. The resulting plants were self-pollinated, the F 2 seed harvested and analyzed for fatty acid composition for allelism studies. The F 2 seed and parent line seed was planted in the greenhouse, individual plants were selfpollinated. The F 3 seed of individual plants was tested for fatty acid composition using seed bulk samples as described previously.

In the analysis of some genetic relationships dihaploid populations were made from the microspores of the F, hybrids. Self-pollinated seed from dihaploid plants were analyzed for fatty acid analysis using methods described previously.

For chemical analysis, 10-seed bulk samples were hand ground with a glass rod in a polypropylene tube and extracted in 1.2 mL 0.25 N KOH in 1:1 ether/methanol.

The sample was vortexed for 30 sec. and heated for 60 see. in a 60'C water bath. Four mL of saturated NaCl and 2.4 mL of iso-octane were added, and the mixture was vortexed 18/10/02jb12995.spe,21 -22again. After phase separation, 600 pL of the upper organic phase were pipetted into individual vials and stored under nitrogen at -5 0 C. One pLL samples were injected into a Supelco SP-2330 fused silica capillary column (0.25 mm ID, 30 M length, 0.20 p.m df).

The gas chromatograph was set at 180 0 C for 5.5 minutes, then programmed for a 2 0 C/minute increase to 212 0 C, and held at this temperature for 1.5 minutes. Total run time was 23 minutes. Chromatography settings were: Column head pressure 15 psi, Column flow (He) 0.7 mL/min., Auxiliary and Column flow 33 mL/min., Hydrogen flow 33 mL/min., Air flow 400 mL/min., Injector temperature 250 0 C, Detector temperature 300 0 C, Split vent 1/15.

Table 8 describes the upper and lower statistical thresholds for each fatty acid of interest.

TABLE 8 Statistical Thresholds for Specific Fatty Acids Derived from Control Westar Plantings Percent Fatty Acids Genotype C 16 :o C 1 8 :0 C 18 :1 C 1 8 :2 C 1 8:3 Sats*

M

3 Generation (1 in 10,000 rejection rate) Lower 3.3 1.4 13.2 5.3 Upper 4.3 2.5 71.0 21.6 9.9 8.3

M

4 Generation (1 in 800 rejection rate) Lower 3.6 0.8 12.2 3.2 5.3 Upper 6.3 3.1 76.0 32.4 9.9 11.2

M

5 Generation (1 in 755 rejection rate) Lower 2.7 0.9 9.6 2.6 Upper 5.7 2.7 80.3 26.7 9.6 10.0 Sats Total Saturate Content EXAMPLE 2 High Oleic Acid Canola Lines In the studies of Example 1, at the M 3 generation, 31 lines exceeded the upper statistical threshold for oleic acid Line W7608.3 had 71.2% oleic acid. At the

M

4 generation, its selfed progeny (W7608.3.5, since designated A129.5) continued to exceed the upper statistical threshold for Cls:l with 78.8% oleic acid. Ms seed of five self- 18/10/02jb12995.spe,22 -23 pollinated plants of line A129.5 (ATCC 40811) averaged 75.0% oleic acid. A single plant selection, A129.5.3 had 75.6% oleic acid. The fatty acid composition of this high oleic acid mutant, which was stable under both field and greenhouse conditions to the M 7 generation, is summarized in Table 9. This line also stably maintained its mutant fatty acid composition to the M 7 generation in field trials in multiple locations. Over all locations the self-pollinated plants (A129) averaged 78.3% oleic acid. The fatty acid composition of the A129 for each Idaho trial location are summarized in Table 10. In multiple location replicated yield trials, A129 was not significantly different in yield from the parent cultivar Westar.

The canola oil of A129, after commercial processing, was found to have superior oxidative stability compared to Westar when measured by the Accelerated Oxygen Method (AOM), American Oil Chemists' Society Official Method Cd 12-57 for fat stability; Active Oxygen Method (revised 1989). The AOM of Westar was 18 AOM hours and for A129 was 30 AOM hours.

TABLE 9 Fatty Acid Composition of a High Oleic Acid Canola Line Produced by Seed Mutagenesis Percent Fatty Acids Genotype C 1 6: 0

C

18 :0 C 18 :1 C 1 8: 2

C

1 8: 3 Sats Westar 3.9 1.9 67.5 17.6 7.4 W7608.3 (M 3 3.9 2.4 71.2 12.7 6.1 7.6 W7608.3.5 (M 4 3.9 2.0 78.8 7.7 3.9 7.3 A129.5.3 (M 5 3.8 2.3 75.6 9.5 4.9 7.6 Sats Total Saturate Content 18/10/02jb 12995.spe,23 -24- TABLE Fatty Acid Composition of a Mutant High Oleic Acid Line at Different Field Locations in Idaho Location

C

1 6:0 Burley 3.3 Tetonia 3.5 Lamont 3.4 Shelley 3.3 Sats Total Saturate Content

C

1 8:0 2.1 3.4 1.9 2.6 Percent Fatty Acids

C

18 :1 C 18 :2 77.5 8.1 77.8 6.5 77.8 7.4 80.0 5.7

C

1 8:3- 6.0 4.7 6.5 4.5 Sats 6.3 7.7 The genetic relationship of the high oleic acid mutation A129 to other oleic desaturases was demonstrated in crosses made to commercial canola cultivars and a low linolenic acid mutation. A129 was crossed to the commercial cultivar Global (C16:0 Ci 8 0

C

18 :i 62.9%, C 1 8 2 20.0%, C 183 Approximately 200 F 2 individuals were analyzed for fatty acid composition. The results are summarized in Table 11. The segregation fit 1:2:1 ratio suggesting a single co-dominant gene controlled the inheritance of the high oleic acid phenotype.

TABLE 11 Genetic Studies of A129 X Global Frequency Genotype od-odod-od+ od+od+

C

1 Content 77.3 71.7 66.1 Observed Expected A cross between A129 and IMC 01, a low linolenic acid variety (Ci 6 :0 4.1%, Ci8:o C 18 :1 66.4%, CI8: 2 18.1%, C 183 was made to determine the inheritance of the oleic acid desaturase and linoleic acid desaturase. In the Fi hybrids both 18/10/02jb12995.spe,24 the oleic acid and linoleic acid desaturase genes approached the mid-parent values indicating a co-dominant gene actions. Fatty acid analysis of the F 2 individuals confirmed a 1:2:1:2:4:2:1:2:1 segregation of two independent, codominant genes (Table 12). A line was selected from the cross of A129 and IMC01 and designated as IMC 130 (ATCC deposit no.

75446) as described in U.S. Patent Application No. 08/425,108, incorporated herein by reference.

TABLE 12 Genetic Studies of A129 X IMC 01 Frequency Genotype Ratio Observed Expected od-od-ld-ld- 1 11 12 od-od-ld-ld+ 2 30 24 od-od-ld+ld+ 1 10 12 od-od+ld-ld- 2 25 24 od-od+ld-ld+ 4 54 47 od-od+ld+ld+ 2 18 24 od+od+ld-ld- 1 7 12 od+od+ld-ld+ 2 25 24 od+od+ld+ld+ 1 8 12 An additional high oleic acid line, designated A128.3, was also produced by the disclosed method. A 50-seed bulk analysis of this line showed the following fatty acid composition: C 1 6: 0

C

18 :o Ci8:1 77.3%, C 18 2

C

1 8: 3 FDA Sats Total Sats This line also stably maintained its mutant fatty acid composition to the M 7 generation. In multiple locations replicated yield trials, A128 was not significantly different in yield from the parent cultivar Westar.

A129 was crossed to A128.3 for allelism studies. Fatty acid composition of the F 2 seed showed the two lines to be allelic. The mutational events in A129 and A128.3 although different in origin were in the same gene.

1810/I02jb12995.spe,25 -26- An additional high oleic acid line, designated M3028.-10 (ATCC 75026), was also produced by the disclosed method in Example 1. A 10-seed bulk analysis of this line showed the following fatty acid composition: C 1 6: 0 C18: 0

C

18 :i 77.3%,

C

18 :2 C 1 8: 3 FDA Saturates Total Saturates In a single location replicated yield trial M3028.10 was not significantly different in yield from the parent cultivar Westar.

EXAMPLE 3 Low Linoleic Acid Canola In the studies of Example 1, at the M 3 generation, 80 lines exceeded the lower statistical threshold for linoleic acid Line W12638.8 had 9.4% linoleic acid. At the M 4 and M 5 generations, its selfed progenies [W12638.8, since designated A133.1 (ATCC 40812)] continued to exceed the statistical threshold for low C 1 8: 2 with linoleic acid levels of 10.2% and respectively. The fatty acid composition of this low linoleic acid mutant, which was stable to the M 7 generation under both field and greenhouse conditions, is summarized in Table 13. In multiple location replicated yield trials, A133 was not significantly different in yield from the parent cultivar Westar. An additional low linoleic acid line, designated M3062.8 (ATCC 75025), was also produced by the disclosed method.

A 10-seed bulk analysis of this line showed the following fatty acid composition:

C

1 6: 0 Ci8: 0

C

18 :i 77.1%, C 1 8: 2

C

1 8 3 FDA Sats-6.1%. This line has also stably maintained its mutant fatty acid composition in the field and greenhouse.

TABLE 13 Fatty Acid Composition of a Low Linoleic Acid Canola Line Produced by Seed Mutagenesis Percent Fatty Acids Genotype C 1 6: 0

C

1 8: 0

C

1 8: 1

C

1 8:2 C 1 8: 3 Sats b Westar 3.9 1.9 67.5 17.6 7.4 W12638.8 (M 3 3.9 2.3 75.0 9.4 6.1 W12638.8.1 (M 4 4.1 1.7 74.6 10.2 5.9 7.1 A133.1.8 (M 5 3.8 2.0 77.7 8.4 5.0 a Letter and numbers up to a second decimal point indicate the plant line. Number after second decimal point indicates an individual plant.

b Sats Total Saturate Content 18/10/02jb12995.spe,26 -27- EXAMPLE 4 Low Linolenic and Linoleic Acid Canola In the studies of Example 1, at the M 3 generation, 57 lines exceeded the lower statistical threshold for linolenic acid Line W14749.8 had 5.3% linolenic acid and 15.0% linoleic acid. At the M 4 and Ms generations, its selfed progenies [W14749.8, since designated M3032 (ATCC 75021)] continued to exceed the statistical threshold for low Cl8: 3 with linolenic acid levels of 2.7% and respectively, and for a low sum of linolenic and linoleic acids with totals of 11.8% and 12.5% respectively. The fatty acid composition of this low linolenic acid plus linoleic acid mutant, which was stable to the Ms generation under both field and greenhouse conditions, is summarized in Table 14. In a single location replicated yield trial M3032 was not significantly different in yield from the parent cultivar (Westar).

TABLE 14 Fatty Acid Composition of a Low Linoleic Acid Canola Line Produced by Seed Mutagenesis Percent Fatty Acids Genotype C 1 6:0 C 18 :0 C 18 :1 C 18 2

C

1 8: 3 Sats Westar 3.9 1.9 67.5 17.6 7.4 W14749.8 (M 3 4.0- 2.5 69.4 15.0 5.3 W3032.8 (M 4 3.9 2.4 77.9 9.1 2.7 6.4 M3032.1 (Ms) 3.5 2.8 80.0 10.2 2.3 Sats Total Saturate Content EXAMPLE Canola Lines 0508 and 04275 Seeds of the B. napus line IMC-129 were mutagenized with methyl N-nitrosoguanidine (MNNG). The MNNG treatment consisted of three parts: pre-soak, mutagen application, and wash. A 0.05M Sorenson's phosphate buffer was used to maintain pre-soak and mutagen treatment pH at 6.1. Two hundred seeds were treated at one time on filter paper (Whatman #3M) in a petri dish (100mm x 15mm). The seeds were pre-soaked in 15 mls of 0.05M Sorenson's buffer, pH 6.1, under continued agitation for two hours. At the end of the pre-soak period, the buffer was removed from the plate.

18/10/02jb12995.spe,27 -28- A 10mM concentration of MNNG in 0.05M Sorenson's buffer, pH 6.1, was prepared prior to use. Fifteen ml of 10m MNNG was added to the seeds in each plate. The seeds were incubated at 22 0 C+3 0 C in the dark under constant agitation for four hours.

At the end of the incubation period, the mutagen solution was removed.

The seeds were washed with three changes of distilled water at 10 minute intervals.

The fourth wash was for thirty minutes. This treatment regime produced an population.

Treated seeds were planted in standard greenhouse potting soil and placed into an environmentally controlled greenhouse. The plants were grown under sixteen hours of light. At flowering, the racemes were bagged to produce selfed seed. At maturity, the M2 seed was harvested. Each M2 line was given an identifying number. The entire MNNGtreated seed population was designated as the Q series.

Harvested M2 seeds was planted in the greenhouse. The growth conditions were maintained as previously described. The racemes were bagged at flowering for selfing. At maturity, the selfed M3 seed was harvested and analyzed for fatty acid composition. For each M3 seed line, approximately 10-15 seeds were analyzed in bulk as described in Example 1.

High oleic-low linoleic M3 lines were selected from the M3 population using a cutoff of 82% oleic acid and 5.0% linoleic. From the first 1600 M3 lines screened for fatty acid composition, Q508 was identified. The Q508 M3 generation was advanced to the M4 generation in the greenhouse. Table 15 shows the fatty acid composition of Q508 and IMC 129. The M4 selfed seed maintained the selected high oleic-low linoleic acid phenotype (Table 16).

TABLE Fatty Acid Composition of A129 and High Oleic Acid M3 Mutant 0508 Line 16:0 18:0 18:1 18:2 18:3 A129* 4.0 2.4 77.7 7.8 4.2 Q508 3.9 2.1 84.9 2.4 2.9 Fatty acid composition of A129 is the average of 50 self-pollinated plant grown with the M3 population

M

4 generation Q508 plants had poor agronomic qualities in the field compared to Westar. Typical plants were slow growing relative to Westar, lacked early vegetative 18/10/02jb12995.spe,28 -29vigor, were short in stature, tended to be chlorotic and had short pods. The yield of Q508 was very low compared to Westar.

The M 4 generation Q508 plants in the greenhouse tended to be reduced in vigor compared to Westar. However, Q508 yields in the greenhouse were greater than Q508 yields in the field.

TABLE 16 Fatty Acid Composition of Seed Oil from Greenhouse-Grown 0508, IMC 129 and Westar Line 16:0 18:0 18:1 18:2 18:3 FDA Sats IMC 129a 4.0 2.4 77.7 7.8 4.2 6.4 Westarb 3.9 1.9 67.5 17.6 7.4 >5.8 Q508 c 3.9 2.1 84.9 2.4 2.9 a Average of 50 self-pollinated plants b Data from Example 1 c Average of 50 self-pollinated plants Nine other M4 high-oleic low-linoleic lines were also identified: Q3603, Q3733, Q4249, Q6284, Q6601, Q6761, Q7415, Q4275, and Q6676. Some of these lines had good agronomic characteristics and an elevated oleic acid level in seeds of about 80% to about 84%.

Q4275 was crossed to the variety Cyclone. After selfing for seven generations, mature seed was harvested from 93GS34-179, a progeny line of the Q4275 Cyclone cross.

Referring to Table 17, fatty acid composition of a bulk seed sample shows that 93GS34 retained the seed fatty acid composition of Q4275. 93GS34-179 also maintained agronomically desirable characteristics.

After more than seven generations of selfing of Q4275, plants of Q4275, IMC 129 and 93GS34 were field grown during the summer season. The selections were tested in 4 replicated plots (5 feet X 20 feet) in a randomized block design. Plants were open pollinated. No selfed seed was produced. Each plot was harvested at maturity, and a sample of the bulk harvested seed from each line was analyzed for fatty acid composition as described above. The fatty acid compositions of the selected lines are shown in Table 17.

18/10/02jb 2995.spe,29 TABLE 17 Fatty Acid Composition of Field Grown IMC 129, 04275 and 73GS34 Seeds Line Fatty Acid Composition

C

1 6: 0

C

18 :o C 18 :1 C 1 8: 2

C

18 3 FDA Sats IMC 129 3.3 2.4 76.7 8.7 5.2 5.7 Q4275 3.7 3.1 82.1 4.0 3.5 6.8 93GS34-179 2.6 2.7 85.0 2.8 3.3 5.3 The results shown in Table 17 show that Q4275 maintained the selected high oleic low linoleic acid phenotype under field conditions. The agronomic characteristics of Q4275 plants were superior to those of Q508.

M

4 generation Q508 plants were crossed to a dihaploid selection of Westar, with Westar serving as the female parent. The resulting F seed was termed the 92EF population. About 126 Fl individuals that appeared to have better agronomic characteristics than the Q508 parent were selected for selfing. A portion of the F 2 seed from such individuals was replanted in the field. Each F2 plant was selfed and a portion of the resulting F3 seed was analyzed for fatty acid composition. The content of oleic acid in F3 seed ranged from 59 to 79%. No high oleic 80%) individuals were recovered with good agronomic type.

A portion of the F 2 seed of the 92EF population was planted in the greenhouse to analyze the genetics of the Q508 line. F 3 seed was analyzed from 380 F2 individuals. The Cis8: levels of F 3 seed from the greenhouse experiment is depicted in Figure 1. The data were tested against the hypothesis that Q508 contains two mutant genes that are semidominant and additive: the original IMC 129 mutation as well as one additional mutation.

The hypothesis also assumes that homozygous Q508 has greater than 85% oleic acid and homozygous Westar has 62-67% oleic acid. The possible genotypes at each gene in a cross of Q508 by Westar may be designated as: AA Westar Fad2 a BB Westar Fad2b aa Q508 Fad2a" bb Q508 Fad2b- 18/10/02jb 12995.spc,30 -31 Assuming independent segregation, a 1:4:6:4:1 ratio of phenotypes is expected. The phenotypes of heterozygous plants are assumed to be indistinguishable and, thus, the data were tested for fit to a 1:14:1 ratio of homozygous Westar: heterozygous plants: homozygous Q508.

Phenotvpic Ratio 1 4 6 4 1 of Westar Alleles 4 3 2 1 0 Genotype AABB(Westar) AABb,AaBB,AABb,AaBB AaBb,AAbb,AaBb,AaBb,aaBB,AaBb Aabb,aaBb,Aabb,aaBb aabb (Q508) Using Chi-square analysis, the oleic acid data fit a 1:14:1 ratio. It was concluded that Q508 differs from Westar by two major genes that are semi-dominant and additive and that segregate independently. By comparison, the genotype of IMC 129 is aaBB.

The fatty acid composition of representative F3 individuals having greater than oleic acid in seed oil is shown in Table 18. The levels of saturated fatty acids are seen to be decreased in such plants, compared to Westar.

TABLE 18 92EF F 3 Individuals with >85% C 1 8 in Seed Oil F3 Plant Fatty Acid Composition Identifier C16:0 C18:0 C18:1 C18:2 C18:3 FDASA +38068 3.401 1.582 85.452 2.134 3.615 4.983 +38156 3.388 1.379 85.434 2.143 3.701 4.767 +38171 3.588 1.511 85.289 2.367 3.425 5.099 +38181 3.75 1.16 85.312 2.968 3.819 4.977 +38182 3.529 0.985 85.905 2.614 3.926 4.56 +38191 3.364 1.039 85.737 2.869 4.039 4.459 +38196 3.557 1.182 85.054 2.962 4.252 4.739 +38202 3.554 1.105 86.091 2.651 3.721 4.713 +38220 3.093 1.16 86.421 1.931 3.514 4.314 +38236 3.308 1.349 85.425 2.37 3.605 4.718 +38408 3.617 1.607 85.34 2.33 3.562 5.224 +38427 3.494 1.454 85.924 2.206 3.289 4.948 +38533 3.64 1.319 85.962 2.715 3.516 4.959 18/10/02jb 2995.spc,31 -32- EXAMPLE 6 Leaf and Root Fatty Acid Profiles of Canola Lines IMC-129, 0508, and Westar Plants of Q508, IMC 129 and Westar were grown in the greenhouse. Mature leaves, primary expanding leaves, petioles and roots were harvested at the 6-8 leaf stage, frozen in liquid nitrogen and stored at -70 0 C. Lipid extracts were analyzed by GLC as described in Example 1. The fatty acid profile data are shown in Table 19.

The data in Table 19 indicate that total leaf lipids in Q508 are higher in C 1 8: 1 content than the C 18 2 plus C 1 8 3 content. The reverse is true for Westar and IMC 129. The difference in total leaf lipids between Q508 and IMC 129 is consistent with the hypothesis that a second Fad2 gene is mutated in Q508.

The C 1 6 3 content in the total lipid fraction was about the same for all three lines, suggesting that the plastid FadC gene product was not affected by the Q508 mutations. To confirm that the FadC gene was not mutated, chloroplast lipids were separated and analyzed. No changes in chloroplast C 1 6

C

16 2 or C 1 6: 3 fatty acids were detected in the three lines. The similarity in plastid leaf lipids among Q508, Westar and IMC 129 is consistent with the hypothesis that the second mutation in Q508 affects a microsomal Fad2 gene and not a plastid FadC gene.

TABLE 19 MATURE LEAF EXPANDING LEAF PETIOLE ROOT West. 129 3Q508 West. 129 3Q508 West. 129 3Q508 West. 129 3Q508 16:0 12.1 11.9 10.1 16.4 16.1 11.3 21.7 23.5 11.9 21.1 21.9 12.0 16:1 0.8 0.6 1.1 0.7 0.6 1.1 1.0 1.3 1.4 16:2 2.3 2.2 2.0 2.8 3.1 2.8 1.8 2.2 1.8 16:3 14.7 15.0 14.0 6.3 5.4 6.9 5.7 4.6 5.7 18:0 2.2 1.6 1.2 2.5 2.8 1.5 3.7 4.0 1.6 3.6 2.9 18:1 2.8 4.9 16.7 3.8 8.3 38.0 4.9 12.9 46.9 3.5 6.1 68.8 18:2 12.6 11.5 6.8 13.3 13.8 4.9 20.7 18.3 5.2 28.0 30.4 4.4 18:3 50.6 50.3 46.0 54.2 50.0 33.5 40.4 33.2 25.3 43.8 38.7 12.3 EXAMPLE 7 Sequences of Mutant and Wild-Type Delta-12 Fatty Acid Desaturases from B. napes Primers specific for the FAD2 structural gene were used to clone the entire open reading frame (ORF) of the D and F delta-12 desaturase genes by reverse transcriptase 18/10/02jb12995.spe,32 -33polymerase chain reaction (RT-PCR). RNA from seeds of IMC 129, Q508 and Westar plants was isolated by standard methods and was used as template. The RT-amplified fragments were used for nucleotide sequence determination. The DNA sequence of each gene from each line was determined from both strands by standard dideoxy sequencing methods.

Sequence analysis revealed a G to A transversion at nucleotide 316 (from the translation initiation codon) of the D gene in both IMC 129 and Q508, compared to the sequence of Westar. The transversion changes the codon at this position from GAG to AAG and results in a nonconservative substitution of glutamic acid, an acidic residue, for lysine a basic residue. The presence of the same mutation in both lines was expected since the Q508 line was derived from IMC 129. The same base change was also detected in Q508 and IMC 129 when RNA from leaf tissue was used as template.

The G to A mutation at nucleotide 316 was confirmed by sequencing several independent clones containing fragments amplified directly from genomic DNA of IMC 129 and Westar. These results eliminated the possibility of a rare mutation introduced during reverse transcription and PCR in the RT-PCR protocol. It was concluded that the IMC 129 mutant is due to a single base transversion at nucleotide 316 in the coding region of the D gene of rapeseed microsomal delta 12-desaturase.

A single base transition from T to A at nucleotide 515 of the F gene was detected in Q508 compared to the Westar sequence. The mutation changes the codon at this position from CTC to CAC, resulting in the non-conservative substitution of a non-polar residue, leucine, for a polar residue, histidine, in the resulting gene product. No mutations were found in the F gene sequence of IMC 129 compared to the F gene sequence of Westar.

These data support the conclusion that a mutation in a delta-12 desaturase gene sequence results in alterations in the fatty acid profile of plants containing such a mutated gene. Moreover, the data show that when a plant line or species contains two delta-12 desaturase loci, the fatty acid profile of an individual having two mutated loci differs from the fatty acid profile of an individual having one mutated locus.

The mutation in the D gene of IMC 129 and Q508 mapped to a region having a conserved amino acid motif (His-Xaa-Xaa-Xaa-His) found in cloned delta-12 and membrane bound-desaturases (Table 18/I1/02jb 2995.spe,33 -34- TABLE Alignment of Amino Acid Sequences of Cloned Canola Membrane Bound-Desaturases Desaturase Gene Sequencea Position Canola fad2 D (mutant) AHKCGH 109 114 Canola Fad2 D AHECGH 109 114 Canola- Fad2-F AHECGH 109- 114 Canola FadC GHDCAH 170- 175 Canola- fad3 (mutant) GHKCGH 94 99 Canola- Fad3 GHDCGH 94-99 Canola FadD GHDCGH 125- 130 (FadD Plastid delta 15, Fad3 Microsomal delta (FadC Plastid delta 12, Fad2 Microsomal delta 12) a One letter amino acid code; conservative substitutions are underlined; non-conservative substitutions are in bold.

EXAMPLE 8 Transcription and Translation of Microsomal Delta-12 Fatty Acid Desaturases Transcription in vivo was analyzed by RT-PCR analysis of stage II and stage III developing seeds and leaf tissue. The primers used to specifically amplify delta-12 desaturase F gene RNA from the indicated tissues were sense primer 5'-GGATATGATGATGGTGAAAGA-3' and antisense primer 5'-TCTTTCACCATCATCATATCC-3'. The primers used to specifically amplify delta-12 desaturase D gene RNA from the indicated tissues were sense primer 5'-GTTATGAAGCAAAGAAGAAAC-3' and antisense primer 5'-GTTTCTTCTTTGCTTCATAAC-3'. The results indicated that mRNA of both the D and F gene was expressed in seed and leaf tissues of IMC 129, Q508 and wild type Westar plants.

In vitro transcription and translation analysis showed that a peptide of about 46 kD was made. This is the expected size of both the D gene product and the F gene product, 18/10/02jb12995.spe,34 based on sum of the deduced amino acid sequence of each gene and the cotranslational addition of a microsomal membrane peptide.

These results rule out the possibility that non-sense or frameshift mutations, resulting in a truncated polypeptide gene product, are present in either the mutant D gene or the mutant F gene. The data, in conjunction with the data of Example 7, support the conclusion that the mutations in Q508 and IMC 129 are in delta-12 fatty acid desaturase structural genes encoding desaturase enzymes, rather than in regulatory genes.

EXAMPLE 9 Development of Gene-Specific PCR Markers Based on the single base change in the mutant D gene of IMC 129 described in above, two 5' PCR primers were designed. The nucleotide sequence of the primers differed only in the base (G for Westar and A for IMC 129) at the 3' end. The primers allow one to distinguish between mutant fad2-D and wild-type Fad2-D alleles in a DNA-based PCR assay. Since there is only a single base difference in the 5' PCR primers, the PCR assay is very sensitive to the PCR conditions such as annealing temperature, cycle number, amount, and purity of DNA templates used. Assay conditions have been established that distinguish between the mutant gene and the wild type gene using genomic DNA from IMC 129 and wild type plants as templates. Conditions may be further optimized by varying PCR parameters, particularly with variable crude DNA samples. A PCR assay distinguishing the single base mutation in IMC 129 from the wild type gene along with fatty acid composition analysis provides a means to simplify segregation and selection analysis of genetic crosses involving plants having a delta-12 fatty acid desaturase mutation.

EXAMPLE Transformation with Mutant and Wild Type Fad3 Genes B. napus cultivar Westar was transformed with mutant and wild type Fad3 genes to demonstrate that the mutant Fad3 gene for canola cytoplasmic linoleic desaturase desaturase is nonfunctional. Transformation and regeneration were performed using disarmed Agrobacterium tumefaciens essentially following the procedure described in WO 94/11516.

Two disarmed Agrobacterium strains were engineered, each containing a Ti plasmid having the appropriate gene linked to a seed-specific promoter and a corresponding termination sequence. The first plasmid, pIMC 110, was prepared by inserting into a disarmed Ti vector the full length wild type Fad3 gene in sense orientation (nucleotides 208 to 1336 of SEQ ID 6 in WO 93/11245), flanked by a napin promoter 18/10/02jb12995.spc,35 -36sequence positioned 5' to the Fad3 gene and a napin termination sequence positioned 3' to the Fad3 gene. The rapeseed napin promoter is described in EP 0255378.

The second plasmid, pIMC205, was prepared by inserting a mutated Fad3 gene in sense orientation into a disarmed Ti vector. The mutant sequence contained mutations at nucleotides 411 and 413 of the microsomal Fad3 gene described in WO 93/11245, thus changing the sequence for codon 96 from GAC to AAG. The amino acid at codon 96 of the gene product was thereby changed from aspartic acid to lysine. See Table 20. A bean (Phaseolus vulgaris) phaseolin (7S seed storage protein) promoter fragment of 495 base pairs, starting with 5' TGGTCTTTTGGT-3', was placed 5' to the mutant Fad3 gene and a phaseolin termination sequence was placed 3' to the mutant Fad3 gene. The phaseolin sequence is described in Doyle et al., (1986) J. Biol. Chem. 261:9228-9238) and Slightom et al., (1983) Proc. Natl. Acad. Sci. USA 80:1897-1901.

The appropriate plasmids were engineered and transferred separately to Agrobacterium strain LBA4404. Each engineered strain was used to infect 5 mm segments of hypocotyl explants from Westar seeds by cocultivation. Infected hypocotyls were transferred to callus medium and, subsequently, to regeneration medium. Once discemable stems formed from the callus, shoots were excised and transferred to elongation medium.

The elongated shoots were cut, dipped in Rootone T M rooted on an agar medium and transplanted to potting soil to obtain fertile T1 plants. T2 seeds were obtained by selfing the resulting TI plants.

Fatty acid analysis of T2 seeds was carried out as described above. The results are summarized in Table 21. Of the 40 transformants obtained using the pIMC 110 plasmid, 17 plants demonstrated wild type fatty acid profiles and 16 demonstrated overexpression. A proportion of the transformants are expected to display an overexpression phenotype when a functioning gene is transformed in sense orientation into plants.

Of the 307 transformed plants having the pIMC205 gene, none exhibited a fatty acid composition indicative of overexpression. This result indicates that the mutant fad3 gene product is non-functional, since some of the transformants would have exhibited an overexpression phenotype if the gene product were functional.

18/10/02jb12995.spe,36 -37 TABLE 21 Overexpression and Co-Suppression Events in Westar Populations Transformed with pIMC205 or pIMC 110 Construct Number of a Linolenic Overexpression Co-Suppression Wild Transformers Acid Range Events Events Type linolenic) linolenic) Events pIMC110 40 2.4-20.6 16 7 17 pIMC205 307 4.6- 10.4 0 0 307 Fatty acid compositions of representative transformed plants are presented in Table 22. Lines 652-09 and 663-40 are representative of plants containing pIMCl 10 and exhibiting an overexpression and a cosuppression phenotype, respectively. Line 205-284 is representative of plants containing pIMC205 and having the mutant fad3 gene.

TABLE 22 Fatty Acid Composition of T2 Seed From Westar Transformed with pIMC205 or plMCl 10 Seeds Line Fatty Acid Composition

C

1 6: 0

C

1 8: 0 CI8: 1

C

1 8: 2

C

1 8:3 652 09 pIMC110 4.7 3.3 65.6 8.1 14.8 overexpression 663 40 pIMC 10 4.9 2.1 62.5 23.2 3.6 co-suppression 205 -284 pIMC205 3.7 1.8 68.8 15.9 6.7 EXAMPLE 11 Sequences of Wild Type and Mutant Fad2-D and Fad2-F High molecular weight genomic DNA was isolated from leaves of Q4275 plants (Example 5) and from Westar and Bridger canola plants. This DNA was used as template for amplification of Fad2-D and Fad2-F genes by polymerase chain reaction (PCR). PCR amplifications were carried out in a total volume of 100 tl and contained 0.3 ptg genomic DNA, 200 pM deoxyribonucleoside triphosphates, 3 mM MgSO 4 1-2 Units DNA 18/10/02jb12995.spe,37 -38polymerase and IX Buffer (supplied by the DNA polymerase manufacturer). Cycle conditions were: 1 cycle for 1 min at 95°C, followed by 30 cycles of 1 min at 94 0 C, 2 min at 55 0 C and 3 min at 73 0

C.

The Fad2-D gene was amplified once using Elongase® (Gibco-BRL). PCR primers were: CAUCAUCAUCAUCTTCTTCGTAGGGTTCATCG (SEQ ID NO:23) and CUACUACUACUATCATAGAAGAGAAAGGTTCAG (SEQ ID NO:24) for the 5' and 3' ends of the gene, respectively.

The Fad2-F gene was independently amplified 4 times, twice with Elongase® and twice with Taq polymerase (Boehringer Mannheim). The PCR primers used were: 5'CAUCAUCAUCAUCATGGGTGCACGTGGAAGAA3' (SEQ ID NO:25) and 5'CUACUACUACUATCTTTCACCATCATCATATCC3' (SEQ ID NO:26) for the 5' and 3' ends of the gene, respectively.

Amplified DNA products were resolved on an agarose gel, purified by JetSorb® and then annealed into pAMP 1 (Gibco-BRL) via the (CAU) 4 and (CUA) 4 sequences at the ends of the primers, and transformed into E. coli The Fad2-D and Fad2-F inserts were sequenced on both strands with an ABI PRISM 310 automated sequencer (Perkin-Elmer) following the manufacturer's directions, using synthetic primers, AmpliTaq® DNA polymerase and dye terminator.

The Fad2-D gene was found to have intron-like sequences upstream of the ATG start codon (SEQ ID NO:30 and SEQ ID NO:31). As expected, the coding sequence of the gene derived from IMC 129 contained a G to A mutation at nucleotide 316 (Fig. 2).

A single base transversion from G to A at nucleotide 908 was detected in the F gene sequence of the Q4275 amplified products, compared to the wild type F gene sequence (Fig. This mutation changes the codon at amino acid 303 from GGA to GAA, resulting in the nonconservative substitution of a glutamic acid residue for a glycine residue (Table 3 and Fig. Expression of the mutant Q4275 Fad2-F delta-12 desaturase gene in plants alters the fatty acid composition, as described hereinabove.

EXAMPLE 12 Sequence of Wild Type Fad2-U High molecular weight genomic DNA was isolated from the leaves of Bridger and Westar Brassica plants by standard methods. The Fad2-U gene was amplified in a 100 .tl total reaction containing 1 jiM of each primer, 0.3 tg genomic DNA, 200 jiM dNTP, 3 mM 18/10/02jb 12995.spe,38 -39- MgSO 4 lx Buffer (supplied by the manufacturer of the DNA polymerase), and 1-2 units of Elongase DNA polymerase (BRL). The amplification conditions included one cycle for 1 min at 95 0 C, 30 cycles of denaturation at 94 0 C for 1 min, annealing at 55 0 C for 2 min, and elongation at 72 0 C for 3 min. Subsequently, the reaction was incubated at 72 0 C for an additional 10 min. Fad2U gene was amplified twice from Westar and twice from Bridger genomic DNAs using the following primers: end primer 5' (CAU) 4 CTTCTTCGTAGGGTTCATCG3' (SEQ ID NO:23) 3' end primer 5' (CUA) 4 CATAACTTATTGTTGTACCAG3' (SEQ ID NO:27) Amplified DNA products were purified and sequenced as described in Example 11.

The Fad2-U sequence contains an intron-like sequence upstream of the ATG start codon (SEQ ID NO:28).

To the extent not already indicated, it will be understood by those of ordinary skill in the art that any one of the various specific embodiments herein described and illustrated may be further modified to incorporate features shown in other of the specific embodiments.

The foregoing detailed description has been provided for a better understanding of the invention only and no unnecessary limitation should be understood therefrom as some modifications will be apparent to those skilled in the art without deviating from the spirit and scope of the appended claims.

18/10/02jb 12995.spe,39 SEQUENCE LISTING GENERAL INFORMATION APPLICANT: CARGILL, INCORPORATED (ii) TITLE OF THE INVENTION: FATTY ACID DESATURASES AND MUTANT SEQUENCES THEREOF (iii) NUMBER OF SEQUENCES: 31 (iv) CORRESPONDENCE ADDRESS: ADDRESSEE: Fish Richardson P.A.

STREET: 60 South Sixth Street, Suite 3300 CITY: Minneapolis STATE: MN COUNTRY: USA ZIP: 55402 COMPUTER READABLE FORM: MEDIUM TYPE: Diskette COMPUTER: IBM Compatible OPERATING SYSTEM: DOS SOFTWARE: FastSEQ for Windows Version (vi) CURRENT APPLICATION DATA: APPLICATION NUMBER: FILING DATE: 11-JUN-97

CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION: NAME: Lundquist, Ronald C REGISTRATION NUMBER: 37,875 REFERENCE/DOCKET NUMBER: 07148/067W01 (ix) TELECOMMUNICATION INFORMATION: TELEPHONE: 612-335-5070 TELEFAX: 612-288-9696

TELEX:

INFORMATION FOR SEQ ID NO:1: SEQUENCE CHARACTERISTICS: LENGTH: 1155 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (iii) HYPOTHETICAL: YES (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: -41 ORGANISM: Brassica napus (ix) FEATURE: OTHER INFORMATION: Wild type Fad2.

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAG AAG TCT met Gly Ala Gly Gly Arg Met Gin Vai Ser Pro Pro Ser Lys Lys Ser 1 5 10 GAA ACC GAC Glu Thr Asp GTC GGA GAA Val Gly Glu ATC AAG CGC GTA Ile Lys Arg Val CCC TGC GAG ACA CCG CCC TTC ACT Pro Cys Giu Thr Pro ProPhe Thr 25 CTC AAG AAA GCA ATC OCA CCG CAC TGT Leu Lys Lys Ala Ile Pro Pro His Cys 40

TTC

Phe AAA CGC TCG Lys Arg Ser ATC CCT CGC TCT TTC TCC TAC CTC ATC TGG GAC ATC Ile Pro Arg Ser Phe Ser Tyr Leu Ile Trp Asp Ile 55 ATC ATA GCC TCC Ile Ile Ala Ser 192

TGC

Cys TTC TAC TAC NTC Phe Tyr Tyr Xaa ACC ACT TAC TTC Thr Thr Tyr Phe

CCT

Pro 75 CTC CTC CCT CAC Leu Leu Pro His

CCT

Pro 00 CTC TCC TAC TTC Leu Ser Tyr Phe TGG CCT CTC TAC Trp Pro Leu Tyr

TG

Trp 90 GCC TGC CAA Ala Cys Gin CTA ACC GGC Leu Thr Gly AGC GAC TAC Ser Asp Tyr 115

GTC

Val 100 TGG GTC ATA CC Trp Val Ile Ala

CAC

His 105 GAA TGC GGC CAC Giu Cys Gly His GGG TOC GTC Gly Cys Val CAC GCC TTC His Ala Phe 110 TTC CAC TCC Phe His Ser 288 336 384 CAG TGG CTT GAC Gin Trp LeU Asp

GAC

Asp 120 ACC GTC GGT CTC Thr Val Gly Leu

ATC

Ile 125 TTC CTC Phe Leu 130 CTC GTC CCT TAC Leu Vai Pro Tyr

TTC

Phe 135 TCC TGG AAG TAC Ser Trp Lys Tyr

AGT

Ser 140 CAT CCC AGC CAC His Arg Ser His

CAT

His 145 TCC AAC ACT GGC Ser Asn Thr Gly CTC GAG AGA GAC Leu Giu Arg Asp

GAA

Clu 155 GTG TTT GTC CCC Val Phe Val Pro

AAG

Lys 160 AAG AAG TCA GAC Lys Lys Ser Asp ATC AAG TGG TAC GGC AAG TAC CTC AAC AAC CCT TTG Ile Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 GGA CGC ACC Gly Arg Thr TAC TTA GCC Tyr Leu Ala 195

GTG

Val 180 ATG TTA ACG GTT Met Leu Thr Val TTC ACT CTC GGC Phe Thr Leu Gly TGG CCG TTG Trp Pro Leu 190 GGC TTC COT Gly Phe Arg TTC AAC GTC TCG Phe Asn Val Ser

GGA

Gly 200 AGA CCT TAC GAC Arg Pro Tyr Asp

GGC

Giy 205 TGC CAT Cys His 210 TTC CAC CCC AAC Phe His Pro Asn

GCT

Ala 215 CCC ATC TAC AAC Pro IleTyr Asn GAC CGC GAG COT CTC AspArg Giu'Arg-Leu 220 672 42

CAG

Gin 225 ATA TAC ATC TCC Ile Tyr Ile Ser

GAO

Asp 230 GOT GGC ATC CTC Ala Gly Ile Leu

GC

Ala 235 GTO TGC TAC GGT Val Cys Tyr Gly

CTC

Leu 240 TTC CGT TAC CO Phe Arg Tyr Ala GGO CAG GGA GTG Gly Gin Gly Val

GCC

Ala 250 TOG ATG GTC TGC Ser Met Val Cys TTC TAO Phe Tyr 255 GGA GTC CCG Gly Val Pro TTG CAG CAC Leu Gin His 275

OTT

Leu 260 CTG ATT GTC AAT Leu Ile Val Asn

GGT

Gly 265 TTC OTO GTG TTG Phe Leu Val Leu ATO ACT TAO Ile Thr Tyr 270 TOO GAG TGG Ser Giu Trp, 816 864 ACG OAT OCT TCO Thr His Pro Ser

OTG,

Leu 280 CCT CAC TAO GAT Pro His Tyr Asp

TCG

Ser 285 GAT TG Asp Trp 290 TTC AGG GGA GOT Phe Arg Giy Ala

TTG

Leu 295 GOT ACC GTT GAO Ala Thr Val Asp GAO TAO GGA ATO Asp Tyr Gly Ile

TTG

Leu 305 AAO AAG GTO TTO Asn Lys Val Phe

CAC

His 310 AAT ATT ACC GAO Asn Ile Thr Asp CAC GTG CO OAT His Val Ala His COG TTO TOO ACG Pro Phe Ser Thr

ATG

Met 325 COG OAT TAT CAC GOG ATG, GAA GOT ACC Pro His Tyr His Ala Met Glu Ala Thr 330 AAG CG Lys Ala 335 ATA AAG COG Ile Lys Pro OTT AAG GOG Val Lys Ala 355

ATA

Ile 340 CTG GGA GAG TAT Leu Giy Oiu Tyr TAT CAG TTO GAT GGG AOG COG GTC Tyr Gin Phe Asp Oly Thr Pro Val 345 350 1008 1056 1104 ATG TGG AGG GAG Met Trp Arg Giu AAG GAG TGT ATO Lys Giu Cys Ile

TAT

Tyr 365 GTG GAA COG Val Giu Pro GAO AGG Asp Arg 370 CAA GGT GAG AAG Gin Gly Giu Lys AAA GOT GTG TTC TGG TAO AAC AAT AAG TTA T 1i53 Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 375 380 1155 INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS: LENGTH: 384 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Met Gly Ala Gly Gly Arg Met Gin Vai Ser Pro Pro Ser Lys Lys Ser 10 Giu Thr Asp Thr Ile Lys Arg Val Pro Cys Giu Thr 25 Val Gly Giu Leu Lys Lys Ala Ile Pro Pro His Cys Phe Lys Arg Ser -43- Ile i Cys Leu Leu Ser Phe His 145 Lys Gly Tyr Cys Gin 225 Phe Gly Leu Asp Leu 305 Pro Ile Val Pro Phe Ser Thr Asp Leu 130 Ser Lys Arg Leu His 210 Ile Arg Val Gin Trp 290 Asn Phe Lys Lys Arg Tyr Tyr Gly Tyr 115 Leu Asn Ser Thr Ala 195 Phe Tyr Tyr Pro His 275 Phe Lys Ser Pro Ala Ser Tyr Phe Val 100 Gin Val Thr Asp Val 180 Phe His Ile Ala Leu 260 Thr Arg Val Thr Ile 340 Met Phe Xaa Ala Trp Trp Pro Gly Ile 165 Met Asn Pro Ser Ala 245 Leu His Gly Phe Met 325 Leu Trp Ser J Ala 70 Trp Vai Leu Tyr Ser 150 Lys Leu Val Asn Asp 230 Gly Ile Pro Ala His 310 Pro Gly Arg yr [hr Pro Ile %sp Phe 135 [Leu Trp Thr Ser Ala 215 Ala Gin Vai Ser Leu 295 Asn His Glu Glu Leu Thr Leu Ala Asp 120 Ser Glu Tyr Vai Gly 200 Pro Gly Gly Asn Leu 280 Ala Ile Tyr Tyr Ala 360 rle [yr Tyr His 105 Thr Trp Arg Gly Gin 185 Arg Ile Ile Val Gly 265 Pro Thr Thr His Tyr 345 Lys rrp Asp Ile Ile Ile Ala Ser Phe Trp 90 Glu Vai Lys Asp Lys 170 Phe Pro Tyr Leu Ala 250 Phe His Val Asp Ala 330 Gin Glu Pro 75 Ala Cys Gly Tyr Glu 155 Tyr Thr Tyr Asn Ala 235 Ser Leu Tyr Asp Thr 315 Met Phe LCyE Leu Cys Gly Leu Ser 140 Val Leu Leu Asp Asp 220 Val Met Val Asp Arg 300 His Glu Asp Ile LIeu

I

His Ile 125 His Phe Asn Gly Gly 205 Arg Cys Val Leu Ser 285 Asp Vai Ala Gly Tyr 365 Pro I Gly His 110 Phe Arg Val Asn Trp 190 Gly Glu Tyr Cys Ile 270 Ser Tyr Ala Thr Thr 350 Val iis :ys kla His Ser Pro Pro 175 Pro Phe Arg Gly Phe 255 Thr Glu Gly His Lys 335 Pro Git Pro Vai Phe Ser His Lys 160 Leu Leu Arg Leu Leu 240 Tyr Tyr Trp Ile His 320 Ala Vai Pro 355 Asp Arg Gin Gly Giu Lys 370 Lys Gly Val Phe Trp 375 Tyr AsnAsn Lys Leu 380 INFORMATION FOR SEQ ID NO:3: SEQUENCE CHARACTERISTICS: LENGTH: 1155 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (iii) HYPOTHETICAL: YES (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Brassica napus (ix) FEATURE: OTHER INFORMATION: mutation at nucleotide 316.

G to A transversion (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

ATG

Met

I

GGT GCA GGT Gly Ala Gly AGA ATG CAA GTG Arg Met Gin Val CCT CCC TCC AAG AAG, TCT Pro Pro Ser Lys Lys Ser GAA ACC GAC Glu. Thr Asp.

GTC GGA GAA Val Gly Giu ATC AAG CGC GTA Ile Lys Arg Val

CCC

Pro TGC GAG ACA CCG Cys Glu Thr Pro CCC TTC ACT Pro Phe Thr AAA CGC TCG Lys Arg Ser CTC AAG AAA GCA Leu.Lys Lys Ala CCA CCG CAC Pro Pro His TOT_ TTC Cys Phe ATC CCT Ile Pro CGC TCT TTC TCC Arg Ser Phe Ser CTC ATC TOG GAC Leu Ile Trp Asp ATC ATC ATA GCC TCC Ile Ile Ile Ala Ser CTC CTC CCT CAC CCT Leu Leu Pro His Pro

TGC

Cys TTC TAC TAC NTC Phe Tyr Tyr Xaa ACC ACT TAC TTC Thr Thr Tyr Phe 192 240 288 336 CTC TCC TAC TTC Leu Ser Tyr Phe TGG CCT CTC TAC Trp, Pro Leu Tyr

TG

Trp GCC TGC CAA G Ala Cys Gin Gly TGC GTC Cys Val CTA ACC GCC Leu Thr Ciy AGC GAC TAC Ser Asp Tyr 115

GTC

Val 100 TGO GTC ATA CC Trp Val Ile Ala CAC AAG TGC GGC CAC CAC CCC TTC His Lys Cys Gly His His Ala Phe 105 110 CAG TGG CTT CAC Gin Trp Leu Asp

GAC

Asp 120 ACC GTC GGT CTC Thr Val Cly Leu

ATC

Ile 125 TTC CAC TCC Phe His Ser TTC CTC Phe Leu 130 CTC GTC CCT TAC Leu Vai Pro Tyr

TTC

Phe 135 TCC TOO AAG TAC Ser Trp Lys Tyr

AGT

Ser 140 CAT CGC AGC CAC His Arg Ser His.

CAT TCC AAC ACT CGC-TCC CTC GAG AGA GAC GAA His Ser Asn Thr Gly Ser Leu Giu Arg Asp Giu 145 150 155 OTO TTT GTC CCC Val Phe Val Pro

AAG

Lys 160 480 AAG AAG TCA GAC Lys Lys Ser Asp ATC AAG TGG TAO GGC Ile Lys Trp Tyr Gly 165 AAG TAC CTC AAC AAC CCT TTG Lys Tyr Leu Asn Asn Pro Leu 170 1 175 GGA CGC ACC Gly Arg Thr TAC TTA GCC Tyr Leu Ala 195

GTG

Val 180 ATG TTA ACG GTT Met Leu Thr Vai

CAG

Gin 185 TTC ACT CTC GGC Phe Thr Leu Gly TGG CCG TTG Trp Pro Leu 190 GGC TTC CGT Gly Phe Arg TTC AAC GTC TCG Phe Asn Vai Ser

GGA

Gly 200 AGA CCT TAC GAC Arg Pro Tyr Asp

GGC

Gly 205 TGC CAT Cys His 210 TTC CAC CCC AAC Phe His Pro Asn

GCT

Ala 215 CCC ATC TAC AAC Pro Ile Tyr Asn

GAC

Asp 220 CGC GAG CGT CTC Arg Giu Arg Leu

CAG

Gin 225 ATA TAC ATC TCC Ile Tyr Ile Ser GCT GGC ATC CTC Ala Gly Ile Leu

GCC

Ala 235 GTC TGC TAC GGT Val Cys Tyr Gly 672 720 768 TTC CGT TAC GCC Phe Arg Tyr Ala

GCC

Ala 245 GGC CAG GGA GTG Gly Gin Gly Val TCG ATG GTC TGC Ser Met Vai Cys TTC TAC Phe Tyr 255 GGA GTC CCG Gly Val Pro TTG CAG CAC Leu Gin His 275

CTT

Leu 260 CTG ATT GTC AAT Leu Ile Val Asn

GGT

Gly 265 TTC CTC GTG TTG Phe Leu Vai Leu ATC ACT TAC Ile Thr Tyr 270 TCC GAG TGG Ser Glu Trp ACG CAT CCT TCC Thr His Pro Ser

CTG

Leu 280 CCT CAC TAC Pro His Tyr GAT TCG Asp Ser 285 CAT TGG Asp Trp 290 TTO AGG GGA GCT Phe Arg Gly Ala

TTG

Leu 295 GCT ACC GTT GAC Ala Thr Val Asp

AGA

Arg 300 GAC TAC GGA ATC Asp Tyr Giy lie

TTG

Leu 305 AAC AAG GTC TTO Asn Lys Val Phe

CAC

His 310 AAT ATT ACO GAC Asn Ile Thr Asp

ACG

Thr 315 CAC GTG 0CC CAT His Val Ala His

CAT

His 320 CCG TTC TCC ACG Pro Phe Ser Thr

ATG

Met 325 CCG CAT TAT CAC Pro His Tyr His

GCG

Ala 330 ATG GAA GOT ACC Met Glu Ala Thr AAG GCG Lys Ala 335 912 960 1008 1056, 1104 ATA AAG CCG Ile Lys Pro GTT AAG GCG Val Lys Ala 355

ATA

Ile 340 CTG GGA GAG TAT Leu Gly Giu Tyr

TAT

Tyr 345 CAG TTC GAT GGG Gin Phe Asp Gly ACG COG GTG Thr Pro Val 350 GTG CAA CCG Val Giu Pro ATG TGG AGG GAG Met Trp Arg Glu AAG GAG TOT ATO Lye Giu Cys Ile

TAT

Tyr 365 GAC AGG Asp Arg 370 CAA GGT GAG AAG Gin Gly Clu Lye GGT GTG TTO TGG Gly Val Phe Trp

TAO

Tyr .380 AAC AAT AAG TTA T 1153 Asn Asn Lys Leu 1155 INFORMATION FOR SEQ ID NO:4: SEQUENCE CHARACTERISTICS: LENGTH: 384 amino acids TYPE: amino acid 46 TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: Met Gly Ala Gly 1 Arg Met Gin Val Ser Pro Pro Ser Lys Lys Ser 10 Glu IJ ValC Ile Cys Leu Leu Ser Phe His 145 Lys Gly Tyr Cys Gin 225 Phe Gly Leu Ehr ;iy Pro Phe Ser Thr Asp Leu 130 Ser Lys Arg Leu His 210 Ile Ar Val Gix Asp Thr IleI Giu Leu Lys Arg Ser Phe Tyr Tyr Xaa Tyr Phe Ala Gly Val Trp 100 Tyr Gin Trp 115 Leu Val Pro Asn Thr Gly Ser Asp Ile 165 Thr Val Met 180 Ala Phe Asn 195 Phe His Pro Tyr Ile Ser Tyr Ala Ala 245 Pro Leu Leu 260 i His Thr His .Iys 3er 70 rrp VIal Leu.

Tyr Ser 150 Lys Leu Val Asn Asp 230 Gly Ile krg kia Tyr 55 rhr Pro Ile Asp Phe 135 Leu Trp, Thr Ser Ala 215 Vai Ile 40 Leu Thr Leu Ala Asp 120 Ser Giu Tyr Val Gly 200 Pro Pro 25 Pro Ile Tyr Tyr His 105 Thr Trp, Arg Gly Gin 185 Arg Ile Cys Pro Trp Phe Trp 90 Lys Val Lys Asp Lys 170 Phe Pro Tyr Leu Ala 250 rPhe 1,u iis Pro 75 Ala Cys Gly Tyr Glu Tyr Thr Tyr Asn Ala 235E Sex Let Thr Pro Cys Phe Ile Ile Leu Leu Cys Gin Giy His Leu Ile 125 Ser-His 140- Val Phe Leu Asn Leu Gly Asp Gly 205 Asp Arg 220 Pro 1476.

Ile Pro Gly His Phe Arg Val Asn Trp 190 Giy Giu Tyr Cys Ile 270 Phe IJ Arg I Ala His Cys Ala His Ser Pro Pro 175 Pro Phe Arg Gly Phe 255 Thr Ehr ~er 'er Pro iJal Phe Ser His Lys 160 Leu Leu Arg Leu Leu 240 Tyr Tyr Ala Gly Ile Gly Asn Val Gil 26! 1 Val Met Val Cys Val Leu Pro Ser Leu Pro His Tyr Asp Ser Ser Giu Trp, 285 275 280 Asp Trp Phe Arg Gly Ala 290 Leu Ala Thr Val Asp 295 Arg Asp Tyr Gly Ile 300 -47- Leu Asn Lys Val Phe His Asn Ile Thr Asp Thr His Val Ala His His 305 310 315 320 Pro Phe Ser Thr Met Pro His Tyr His Ala Met Glu Ala Thr Lys Ala 325 330 335 Ile Lys Pro Ile Leu Gly Glu Tyr Tyr Gin Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys Ile Tyr Val Glu Pro 355 360 365 Asp Arg Gin Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn, Lys Leu 370 375 380 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 1155 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (iii) HYPOTHETICAL: YES (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Brassica napus (ix) FEATURE: OTHER INFORMATION: Wild type Fad2.

(xi) SEQUENCE DESCRIPTION: SEQ ID ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAA AAG TCT 48 Met Gly Ala Gly Gly Arg Met Gin Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 GAA ACC GAC AAC ATC AAG CGC GTA CCC TGC GAG-ACA CCG CCC TTC ACT 96 Glu Thr Asp Asn Ile Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 25 GTC GGA GAA Val Gly Giu CTC AAG AAA GCA Leu Lys Lys Ala ATC CCA Ile-Pro CCG CAC TGT Pro His Cys

TTC

Phe AAA CGC TCG Lys Arg Ser ATC CCT Ile Pro CGC TCT TTC TCC Arg Ser Phe Ser CTC ATC TGG GAC Leu Ile Trp Asp ATC ATA GCC TCC Ile Ile Ala Ser

TGC

Cys TTC TAC TAC GTC Phe Tyr Tyr Val ACC ACT TAC TTC Thr Thr Tyr Phe CTC CTC CCT CAC Leu Leu Pro His CTC TCC TAC TTC Leu Ser Tyr Phe

GCC

Ala TGG CCT CTC TAC Trp Pro Leu Tyr

TGG

Trp 90 GCC TGC CAG GGC Ala Cys Gin Giy TGC GTC Cys Val CTA ACC GGC Leu Thr Gly AGC GAC TAC Ser Asp Tyr 115

GTC

Vai 100 TGG GTC ATA GCC Trp Val Ile Ala CAC GAG His Glu 105 TGC dGC CAC Cys Gly His CAC GCC TTC His Ala Phe 110 TTO CAC TCC Phe His Ser 336 384 CAG TGG CTG GAC Gin Trp Leu Asp ACC GTC GGC CTC Thr Val Gly Leu

ATC

Ile 125 TTC CTC Phe Leu 130 CTC GTC CCT TAC Leu Val Pro Tyr

TTC

Phe 135 TCC TGG AAG TAC Ser Trp Lys Tyr

AGT

Ser 140 CAT CGA CGC CAC His Arg Arg His

CAT

His 145 TCC AAC ACT GGC Ser Asn Thr Gly

TCC

Ser 150 CTC GAG AGA GAC Leu Giu Arg Asp

GAA

Giu 155 GTG TTT GTC CCC Val Phe Val Pro AAG AAG TCA GAC Lys Lys Ser Asp

ATC

Ile 165 AAG TGG TAC GGC Lys Trp Tyr Gly

AAG

Lys 170 TAC CTC AAC AAC Tyr Leu Asn Asn CCT TTG Pro Leu 175 GGA CGC ACC Gly Arg Thr TAC TTA GCC Tyr Leu Ala 195

GTG

Val 180 ATG TTA ACG GTT Met Leu Thr Val

CAG

Gin 185 TTC ACT CTC GGC Phe Thr Leu Giy TGG CCT TTG Trp Pro Leu 190 GGC TTC GCT Gly Phe Ala 576 624 TTC AAC GTC TCG Phe Asn Val Ser

GGG

Giy 200 AGA CCT TAO GAC Arg Pro Tyr Asp

GGC

Giy 205 TGC CAT CyS His .210 TTC CAC CCC AAC Phe His Pro Asn

GCT

Ala 215 CCC ATC TAO AAC Pro Ile Tyr Asn

GAO

Asp 220 CGC GAG CGT CTC Arg Glu Arg Leu

CAG

Gin 225 ATA TAC ATC TC Ile Tyr Ile Ser

GAC

Asp 230 GCT GGC ATC CTC Ala Gly Ile Leu

GCC

Ala 235 GTC TGC TAC GGT Val Cys Tyr Gly TAC OGC TAC GCT Tyr Arg Tyr Ala

GCT

Ala 245 GTC CAA GGA GTT Val Gin Giy Val

GCC

Ala 250 TCG ATG GTC TGO Ser Met Val Cys TTC TAC Phe Tyr 255 672 720 768 816 864 OGA GTT COG Giy Val Pro TTG CAG CAC Leu Gin His 275

CTT

Leu 260 CTG ATT GTC AAT Leu Ile Val Asn

GGG

Gly 265 TTC TTA GTT TTG Phe Leu Val Leu ATC ACT TAC Ile Thr Tyr 270 TCT GAG TGG Ser Giti Trp ACG CAT OCT Thr His Pro TOO CTG COT CAC TAT GAC TOG Ser Leu -Pro His- -Tyr Asp Ser- 280 285 49

GAT

Asp

TTG

Leu 305

CTG

Leu

ATA

Ile

GTT

Val

GAC

Asp

GA

TGG

Trp 290

AAC

Asn

TTC

Phe

AAG

Lys

AAG

Lys

AGG

Arg 370

TTG

Leu

AAG

Lys

TCG

Ser

CCG

Pro

GCG

Ala 355

CAA

Gin

AGG,

Arg

GTC

Val

ACC

Thr

ATA

Ile 340

ATG

Met

GGT

Gly

GGA

Gly

TTC

Phe

ATG

Met 325

CTG

Leu

TGG

Trp

GAG

Glu

GCT

Ala

CAC

His 310

CCG

Pro

GGA

Gly

AGG

Arg

AAG,

Lys

TTG

Leu 295

AAT

Asn

CAT

His

GAG

Giu

GAG

Giu

AAA

Lys 375

ACC

Thr

ACG

Thr

CAT

His

TAT

Tyr 345

AAG

Lys

GTG

Val

GTT

Val

GAC

Asp

GCG

Ala 330

CAG

Gin

GAG

Glu

TTC

Phe

GAC

Asp

ACG

Thr 315

ATG

Met

TTG

Leu

TGT

Cys

TGG

Trp

AGA

Arg 300

CAC

His

GAA

Glu

CAT

His

ATC

Ile

TAC

Tyr 380

GAC

Asp

GTG

Val

GCT

Ala

GGG

Gly

TAT

Tyr 365

AAC

Asn

TAC

Tyr

C

Ala

ACG

Thr

ACG.

Thr 350

GTG

Val

AAT

Asn

GGA

Gly

CAT

His

AAG

Lys 335

CCG

Pro

GAA

Glu

AAG

Lys ATC 912 Ile CAC 960 His 320 GCG 1008 Al a GTG 1056 Val CCG 1104 Pro TTA T 1153 Leu 1155 INFORMATION FOR SEQ ID 110:6: Wi SEQUENCE CHARACTERISTICS: LENGTH: 384 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein Met Giu Val Ile Cys Leu Leu Ser Phe (xi) SEQUENCE Gly Ala Gly Gly Thr Asp Asn Ile Gly Glu Leu Lys Pro Arg Ser Phe s0 Phe Tyr Tyr Val Ser Tyr Phe Ala Thr Gly Val Trp 100 Asp Tyr Gin Trp 115 Leu Leu Val Pro 130 DESCRIPTION: SEQ ID Arg Met Gin Val Ser Lys Axg Val Pro Cys 25 Lys Ala Ile Pro Pro 40 Ser Tyr Leu Ile Trp 55 Ala Thr Thr Tyr Phe 70 Trp Pro Leu Tyr Trp 90 Val Ile Ala His Giu 105 Leu Asp Asp Thr Val 120 Tyr Phe Ser Trp Lys 135 NO: 6: Pro Pro Glu Thr His Cys Asp Ile Pro Leu 75 Ala Cys Cys Gly Gly Leu Tyr Ser 140 Ser Pro Phe Ile Leu Gin His Ile 125 His Lys Pro Lys Ile Pro Gly His 110 Phe Arg Lye Phe Arg Ala His Cys Ala His Arg Ser Thr Ser Ser Pro Val Phe Ser His His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp Ile Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gin Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Ala Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Ala 195 200 205 Cys His Phe His Pro Asn Ala Pro Ile Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gin Ile Tyr Ile Ser Asp Ala Gly Ile Leu Ala Val Cys Tyr Gly Leu 225 230 235 240 Tyr Arg Tyr Ala Ala Val Gin Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu Ile Val Asn Gly Phe Leu Val Leu Ile Thr Tyr 260 265 270 Leu Gin His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly Ile 290 295 300 Leu Asn Lys Val Phe His Asn Ile Thr Asp Thr His--Val Ala His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr His Ala Met Glu Ala Thr Lys Ala 325 330 335 Ile Lys Pro Ile Leu Gly Glu Tyr Tyr Gin Leu His Gly Thr Pro Val 340 345 350 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys Ile Tyr Val Glu Pro 355 360 365 Asp Arg Gin Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 INFORMATION FOR SEQ ID NO:7: SEQUENCE CHARACTERISTICS: LENGTH: 1155 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (iii) HYPOTHETICAL: YES (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Brassica napus (ix) FEATURE: 51 OTHER INFORMATION: T to A transversion mutation at nucleotide 515.

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: ATG CGT GCA CGT Met Gly Ala Gly 1

GGA

Gily 5 AGA ATG CAA GTG TCT CCT CCC TCC AAA Arg Met Gin Val Ser Pro Pro Ser Lys 10 AAG TCT Lys Ser GAA ACC GAC Giu Thr Asp GTC GGA GAA Val Gly Giu ATC AAG CGC OTA Ile Lys Arg Val TGC GAG ACA CCG Cys Glu Thr Pro CCC TTC ACT Pro Phe Thr AAA CCC TCG Lys Arg Ser CTC AAG AAA GCA Leu Lys Lys Ala

ATC

Ile CCA CCG CAC TGT Pro Pro His Cys ATC CCT Ile Pro so CGC TCT TTC TCC Arg Ser Phe Ser CTC ATC TGG GAC Leu Ile Trp Asp

ATC

Ile ATC ATA GCC TCC Ile Ile Ala Ser

TGC

Cys TTC TAC TAC GTC Phe Tyr Tyr Val ACC ACT TAC TTC Thr Thr Tyr Phe

CCT

Pro CTC CTC CCT CAC Leu Leu Pro His CTC TCC TAC TTC Leu Ser Tyr Phe

GCC

Ala TGG CCT CTC TAC Trp Pro Leu Tyr CCC TCC CAG GCC Ala Cys Gin Gly TGC CTC Cl's Val CTA ACC CGC Leu Thr Gly ACC GAC TAC Ser Asp Tyr 115

GTC

Val 100 TGG GTC ATA GCC Trp Val Ile Ala

CAC

His 105 GAG TGC CCGC CAC Giu Cys Giy XHis CAC GCC TTC His Ala Phe 110 TTC CAC TCC Phe His Ser CAG TGG CTG GAC Gin Trp Leu Asp

GAC

Asp 120 ACC GTC GGC CTC Thr Val Cly Leu

ATC

Ile 125 TrC CTC Phe Leu 130 CTC GTC COT TAC Leu Val Pro Tyr TCC TCG AAG TAC Ser Trp Lys Tyr

ACT

Ser 140 CAT CCA CGC CAC His Arg Arg His

CAT

His 14 5 TCC AAC ACT GC Ser Asn Thr Gly

TCC

Ser 150 CTC GAG AGA GAC Leu Giu Arg Asp

GAA

Ciu 155 GTG TTT GTC CCC Val Phe Val Pro

AAG

Lys 160 AAG AAG TCA GAC Lys Lys Ser Asp

ATC

Ile 165 AAG TCC TAC GCC Lys Trp Tyr Gly

AAG

Lys 170 TAC CAC AAC AAC Tyr His Asn Asn CCT TTG Pro Leu 175 432 480 528 576 624 GGA CCC ACC Cly Arg Thr TAC TTA CC Tyr Leu Ala 195 ATG TTA ACG GTT Met Leu Thr Val

CAG

Gin 185 TTC ACT CTC GC Phe Thr Leu Gly TGGCOCT TTC Trp Pro Leu 190 CCC TTC CCT Gly Phe Aia TTC AAC CTC TCG Phe Asn Val Ser

GGG

Gly 200 AGA CCT TAC GAC Arg Pro Tyr Asp

GCC

Gly 205 TGC CAT Cys His 210 TTC CAC CCC AAC Phe His Pro Asn

GCT

Ala 215 CCC ATC TAC AAC Pro Ile Tyr Asn

GAC

Asp 220 CCC GAG CCT CTC Arg Clu Arg Leu -52-

CAG

Gin 225 ATA TAC ATC TCC Ile Tyr Ile Ser

GAC

Asp 230 GCT GGC ATC CTC Ala Gly.Ile Leu

GCC

Ala 235 GTC TGC TAC GGT Val Cys Tyr Gly

CTC

Leu 240 720 768 TAC CGC TAC GCT Tyr Arg Tyr Ala

GCT

Ala 245 GTC CAA GGA GTT Val Gin Gly Val

GCC

Ala 250 TCG ATG GTC TGC Ser Met Val Cys TTC TAC Phe Tyr 255 GGA GTT CCG Gly Val Pro TTG CAG CAC Leu Gin His 275

CTT

Leu 260 CTG ATT GTC AAT Leu Ile Val Asn

GGG

Gly 265 TTC TTA GTT TTG Phe Leu Val Leu ATC ACT TAC Ile Thr Tyr 270 TCT GAG TGG Ser biu Trp, ACG CAT CCT TCC Thr His Pro Ser

CTG

Leu 280 CCT CAC TAT GAC Pro His Tyr Asp GAT TGG Asp Trp, 290 TTG AGG GGA GCT Leu Arg Gly Ala

TTG

Leu 295 GCC ACC GTT GAC Ala Thr Val Asp

AGA

Arg 300 GAC TAC GGA ATC Asp Tyr Gly Ile

TTG

Leu 305 AAC AAG GTC TTC Asn Lys Val Phe AAT ATC ACG GAO Asn Ile Thr Asp

ACG

Thr 315 CAC GTG GCG CAT His Val Ala His

CAC

His 320 CTG TTC TCG ACC Laeu Phe Ser Thr CCG CAT TAT CAT Pro His Tyr His

C

Ala 330 ATG GAA GCT ACG Met Glu Ala Thr AAG C Lys Ala 335 912 960 1008 1056 1104 ATA AAG CCG Ile Lys Pro GTT AAG GCG Val Lys Ala 355

ATA

Ile 340 CTG GGA GAG TAT Leu Gly Glu Tyr TAT CAG TTG Tyr Gin Leu 345 CAT GOG ACG CCG GTG His Gly Thr Pro Val 350 ATG TGG AGG GAG Met Trp Arg Glu GCG AAG GAG TGT ATC TAT GTG GAA CCG Ala Lys Glu Cys Ile Tyr Val Glu Pro 360 365 GAC AGG Asp Arg 370

GA

CAA GGT GAG AAG Gin Gly Giu Lys

AAA

Lys 375 GGT GTG TTC TGG Gly Val Phe Trp AAC AAT AAG TTA T 1153 Asn Asn Lys Leu 1155 INFORMATION FOR SEQ ID NO:8: SEQUENCE CHARACTERISTICS: LENGTH: 384 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO0:8: Met Gly Ala Gly Gly Arg.Met Gin Vai Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Giu Thr Asp Asn Ile Lys Arg Val Pro Cys Giu Thr Pro Pro Phe Thr 25 Val Gly Ciu Leu Lys-Lys Ala Ile Pro Pro His Cys Phe Lys Arg Ser 40 -53 Ile Pro Arg so Ser Phe Ser Tyr 55 Leu Ile Trp Asp Ile Ile Ile Ala Ser Cys Leu Leu Ser Phe His 145 Lys Gly Tyr Cys Gin 225 Tyr Gly Leu Asp Leu 305 Leu Ile Val Phe Ser Thr Asp Leu 130 Ser Lys Arg Leu His 210 Ile Arg Val Gin Trp 290 Asn Phe Lys Lys Tyr Tyr Gly Tyr 115 Leu Asn Ser Thr Ala 195 Phe Tyr Tyr Pro His 275 Leu Lye Ser Prc i AlE 351 Tyr Phe Vai 100 Gin Val Thr Asp Vai 180 Phe His Ile Ala Leu 260 Thr Arg Vai Thr, Ile 340 Met Lral Ala rrp rrp Pro Gly Ile 165 Met Asn Pro Ser Ala 245 Leu His Gly Phe Met 325 Leu Trp Ala 70 Trp I Val Leu Tyr Ser 150 Lys Leu Val Asn Asp 230 Val Ile Pro Ala His 310 Pro Gly Arg [hr Pro Ile ksp Phe 135 rrp Thr Ser Ala 215 Ala Gin Val Ser Leu 295 Asn His Glu Glu rhr Leu Ala Asp 120 Ser Glu Tyr Val Gly 200 Pro Gly Gly Asn Leu 280 Ala Ile Tyr Tyx Al Tyr I Tyr His 105 Thr' Trp Arg Gly Gin 185 Arg Ile Ile Val Gly 265 Pro Thr Thr His Tyr 345 Lye The rrp 90 Glu Val Lys Asp Lys 170 Phe Pro Tyr Leu Ala 250 Phe His Vai Asp Ala 330 Gin Glu Pro Leu Leu 75 Ala Cys Gin Cys Giy His Gly Leu Ile 125 Tyr Ser His 140 Glu Val Phe 155 Tyr His Asn Thr Leu Gly Tyr Asp Gly 205 Asn Asp Arg 220 Ala Val Cys' 235 Ser Met Val Leu Val Leu Tyr Asp Ser 285 Asp Arg Asp 300 Thr His Val 315 Met Giu Ala Leu His Gly Cys Ile Tyr 365 Pro Gly His 110 Phe Arg Val Asn Trp 190 Gly Glu Tyr Cys Ile 270 Ser Tyr Ala Thr Thr 350 Val His I Cys Ala I His Arg I Pro Pro 175 Pro Phe Arg Gly Phe 255 Thr Glu Gly His Lys 335 Pro Glu ?ro lal ?he 3er iis Lys 160 [eu Leu Ala Leu Leu 240 Tyr Tyr Trp Ile His 320 Ala Val Pro 360 Asp Arg Gin Gly Giu Lys 370 Lys Gly Val Phe Trp'Tyr 375 380 Asn Asn*Lys Leu INFORMATION FOR SEQ ID NO:9: Wi SEQUENCE CHARACTERISTICS: LENGTH: 1155 base pairs TYPE: nucleic acid STRANflEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Genomic DNA (ix) FEATURE: NAME/KEY: Coding Sequence LOCATION: .1152 OTHER INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: ATO GGT GCA GGT GGA AGA ATG CAR GTG TCT Met Gly Ala Gly Gly Arg Met Gln Val Ser 1 5 10 CCT CCC TCC Pro Pro Ser AAA AAG TCT Lys Lys Ser is GAA ACC GAC Glu Thr Asp GTC GCA GAA Val Gly Glu

AAC

Asn ATC AAG CGC GTA Ile Lys Arg Val TGC GAG ACA CCG Cys Glu Thr Pro CCC TTC ACT Pro Phe Thr AAA CCC TCG Lys Arg Ser CTC ARC AAA CCA Leu Lys Lys Ala

ATC

Ile 40 CCA CCG CAC TCT Pro Pro His Cys

TTC

Phe ATC CCT Ile Pro CCC TCT TTC TCC Arg Ser Phe Ser

TAC

Tyr 55 CTC ATC TGG GAC Leu Ile Trp Asp

ATC

Ile '6 0 ATC ATA GCC TCC Ile Ile Ala Ser 96 144 192 240 288

TGC

Cys TTC TAC TAC GTC Phe Tyr Tyr Val

CC

Ala 70 ACC ACT TAC TTC Thr Thr Tyr Phe

CCT

Pro CTC CTC CCT CAC Leu Leu Pro His CTC TCC TAC TTC Leu Ser Tyr Phe

CC

Ala TGG CCT CTC TAC Trp Pro Leu Tyr

TGG

Trp 90 CCC TGC CAG GCC Ala Cys Gln Cly TGC GTC Cys Val CTA ACC GCC Leu. Thr Cly AGC GAC TAC Ser Asp Tyr 115

GTC

Val 100 TGG GTC ATA CC Trp, Val Ile Ala

CAC

His 105 GAG TGC CCC CAC Clu Cys Gly His CAC CCC 'FTC His Ala Phe 110 TTC CAC TCC Phe His Ser 336 384 CAG TGG CTG CAC Gin Trp Leu Asp ACC CTC CCC CTC Thr Val Cly Leu

ATC

Ile 125 TTC CTC Phe Leu 130 CTC GTC CYT TAC Leu Val Xaa Tyr TCC TGG ARC TAC Ser Trp Lys Tyr CAT CGA CCC CAC His Arg Arg His

CAT

His 145 TCC AAC ACT GC Ser Asn Thr Gly CTC GAG AGA GAC Leu Clu Arg Asp

CAA

G-l u 155 GTG TTT GTC CCC Val Phe Val Pro 432 480 528 ARC ARC TCA GAC Lys Lys Ser Asp

ATC-

Ile 165 ARC TGG TAC GC Lys Trp Tyr Cly ARC TAC CTC ARC Lys Tyr Leu Asn 170 ARC CCT TTG Asn Pro Leu 175 GGA CGC ACC Gly Arg Thr TAC TTR GCC Tyr Leu Ala 195

GTG

Val 180 ATG TTA ACG GTT Met Leu Thr Val

CAG

Gin 185 TTC ACT CTC GGC TGG CCT TTG Phe Thr Leu Gly Trp Pro Leu 190 TTC AAC GTC TCG Phe Asn Val Ser

GGG

Gly 200 AGA CCT TAC GAC Arg Pro Tyr Asp

GGC

Gly 205 GGC TTC GCT Gly Phe Ala TGC CAT Cys His 210 TTC CAC CCC AAC Phe His Pro Asn

GCT

Ala 215 CCC ATC TAC AAC Pro Ile Tyr Asn

GAC

Asp 220 CGT GAG CGT CTC Arg Glu Arg Leu

CAG

Gin 225 ATA TAC ATC TCC Ile Tyr Ile Ser

GAC

Asp 230 GCT GGC ATC CTC Ala Gly Ile Leu

GCC

Ala 235 GTC TGC TAC.GGT Val Cys Tyr Gly

CTC

Leu 240 TAC CGC TAC GCT Tyr Arg Tyr Ala

GCT

Ala 245 RTC CAA GGA GTT Xaa Gin Gly Val TCG ATG GTC TGC Ser Met Val Cys TTC TAC Phe Tyr 255 GGA GTT CCT Gly Val Pro TTG CAG CAC Leu Gin His 275

CTT

Leu 260 CTG RTT GTC AAC Leu Xaa Val Asn

GGG

Gly 265 TTC TTA GTT TTG Phe Leu Val Leu ATC ACT TAC Ile Thr Tyr 270 TCT GAG TGG Ser Glu Trp 576 624 672 720 768 816 864 912 960 1008 1056 1104 ACG CAT CCT TCC Thr His Pro Ser CTG CCT Leu Pro 280 CAC TAT GAC His Tyr Asp

TCG

Ser 285 GAT TGG Asp Trp 290 TTG AGG GGA GCT Leu Arg Gly Ala

TTG

Leu 295 GCC ACC GTT GAC Ala Thr Val Asp

AGA

Arg 300 GAC TAC GGA ATC Asp Tyr Gly Ile

TTG

Leu 305 AAC AAG GTC TTC Asn Lys Val Phe

CAC

His 310 AAT ATC ACG GAC Asn Ile Thr Asp

ACG

Thr 315 CAC GTG GCG CAT His Val Ala His

CAC

His 320 CTG TTC TCG ACC Leu Phe Ser Thr

ATG

Met 325 CCG CAT TAT CAT Pro His Tyr His ATG GAA GCT ACG Met Glu Ala Thr AAG GCG Lys Ala 335 ATA AAG CCG Ile Lys Pro GTT AAG GCG Val Lys Ala 355

ATA

Ile 340 CTG GGA GAG TAT Leu Gly Glu Tyr CAG TTC GAT GGG Gin Phe Asp Gly ACG CCG GTG Thr Pro Val 350 GTG GAA CCG Val Glu Pro ATG TGG AGG GAG Met Trp Arg Glu

GCG

Ala 360 AAG GAG TGT ATC Lys Glu Cys Ile

TAT

Tyr 365 GAC AGG Asp Arg 370

GA

CAA GGT GAG AAG Gin Gly Glu Lys

AAA

Lys 375 GGT GTG TTC TGG Gly Val Phe Trp AAC AAT AAG TTA T 1153 Asn Asn Lys Leu 1155 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 384 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein -56- FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID Met Gly Ala Gly 1 Glu Val lle Cys Leu Leu Ser Phe His 145 Lys Gly Tyr Cys Gin 225 Tyr Gly Leu Asp Leu 305 r rhr Asp Asn Gly Glu I Pro Arg S Phe Tyr J Ser Tyr I Thr Gly Asp Tyr 115 Leu Leu 130 Ser Asn Lys Ser Arg Thr Leu Ala 195 His Phe 210 Ile Tyr Arg Tyr Val Pro SGln His 275 Trp Leu 290 SAsn Lys jeu ier ryr Phe Val

LOO

100 31n Val Thr Asp Val 180 Phe His Ile Ala Leu 26C Thi Arc Gly 5 Ile I Lys I Phe Val Ala Trp Trp Xaa Gly Ile 165 Met Asn Pro SSer Ala 245 Leu SHis Lys Lys 3er Ala 70 Trp Val Leu Tyr Ser 150 Lys Leu Val Asn Asp 230 Xaa Xaa Prc Arg Val Pro Cys Glu Thr Pro 25 Ala Ile Pro Pro His Cys Phe 40 Tyr Leu Ile Trp Asp Ile Ile 55 Thr Thr Tyr Phe Pro Leu Leu 75 Pro Leu Tyr Trp Ala Cys Gin 90 Ile Ala His Glu Cys Gly His 105 Asp Asp Thr Val Gly Leu Ile 120 125 Phe Ser Trp Lys Tyr Ser His 135 140 Leu Glu Arg Asp Glu Val Phe 155 Trp Tyr Gly Lys Tyr Leu Asn 170 Thr Val Gin Phe Thr Leu Gly 185 Ser Gly Arg Pro Tyr Asp Gly 200 205 Ala Pro Ile Tyr Asn Asp Arg 215 220 Ala Gly Ile Leu Ala Val Cys 235 Pro Lys Ile Pro Gly His 110 Phe Arg Val Asn Trp 190 Gly Glu Tyi Arg Met Gin Val Ser Pro Pro Ser Lys Lys Ser Phe Thr Arg Ser *Ala Ser His Pro Cys Val Ala Phe His Ser Arg His Pro Lys 160 Pro Leu 175 Pro Leu Phe Ala Arg Leu SGly Leu 240 s Phe Tyr 255 l Gin Gly Val Ala 250 Ser Met Val Cys Val Ser Gly 265 Pro Phe His Val Asp Leu Ser Ile 270 Ser Tyr Trp g 280 285- Gly Ala Leu Val Phe His 310 295 Asn Ala Thr Val Asp Arg Asp 300 Ile Thr Asp Thr His Val 315 Tyr Ala -57- Lieu Ph Ile Ly Val Ly Asp Ar 37 %TG GGT 4et Gly 1 3AA ACC 3lu Thr GTC GGA Val Gly ATC CCI Ile Prc so TGC TTC Cys Phe CTC TCC Leu Sex CTA ACC Leu Thi e Ser Thr Met Pro His Tyr His 325 s Pro Ile Leu Gly Giu Tyr Tyr 340 345 s Ala Met Trp Arg Glu Ala Lys 355 360 g Gin Gly Glu Lys Lys Gly Val 0 375 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 1155 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Genomic Db (ix) FEATURE: NAME/KEY: Coding Sequer LOCATION: 1...1152 OTHER INFORMATION: Ala Met Glu Ala Thr Lys Ala 330 335 Gin Phe Asp Gly Thr Pro Val 350 Glu Gys Ile Tyr Val Glu Pro 365 Phe Trp Tyr Asn Asn Lys Leu 380 NO:11: 2 1 C: Xi)

GCA

Ala

GAC

Asp

GAA

Giu

CG

Arg

TAC

Tyr

TAC

Tyr

GC

Gly SEQUENCE DESCRIPTION: SEQ ID NO:11: GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAA AAG TGT Gly

AAC

Asn 20

CTC

Lieu

TCT

Ser

TAG

Tyr

TTC

Phe

GTC

Val 100

GAG

Gin Gly 5

ATC

Ile

AAG

Lys

TTG

Phe

GTG

Val

GCC

Ala

TG

Trp Arg Met Gin Val

AAG

Lys

AAA

Lys

TC

Ser

GGG

Ala 70

TG

Trp

GTC

Val CG GTA Arg Val OCA. ATG Ala Ile 40 TAG CTC Tyr Lieu 55 AGG ACT Thr Thr CCT CTC Pro Lieu ATA GCG Ile Ala

CCC

Pro 25

CCA

Pro

ATG

Ile

TAG

Tyr

TAG

Tyr

CAG

His 105 Ser 10

TG

Cys

CCG

Pro

TG

Trp

TTC

Phe

TG

Ttp 90

AAG

Lys Pro Pro Ser Lys

GAG

Giu

GAG

His

GAG

Asp

CCT

Pro 75

GCC

Ala

TG

Gys

ACA

Thr

TGT

Cys

ATG

Ile

CTG

Lieu

TGC

C(ys

GC

Gly

CCG

Pro

TTG

Phe

ATG

Ile

GTG

Lieu

GAG

Gin

GAG

His

CCC

Pro

AAA

Lys

ATA

Ile

CGT

Pro

GC

Giy

GAG

His 110 Lys Ser TTC ACT Phe Thr CGC TCG Arg Ser 0CC TCC Ala Ser GAG GGT His Pro TGC GTG Cys Val GGG TTG Ala Phe 48 96 144 192 240 288 336 AGC GAG TAG Ser Asp Tyr 115 TGG CTG GAG GAG ACC GTG GGC CTC ATC TTC GAG TCC Trp Leu Asp Asp Thr Val Gly Lieu 120 Ile Phe His Ser 125 58 TTC CTC Phe Leu 130 CAT TCC His Ser 145 CTC GTC CYT Leu Val Xaa AAC ACT GGC Asn Thr Gly TAC TTC Tyr Phe 135 TCC CTC Ser Leu 150 TCC TGG AAG TAC Ser Trp Lys Tyr AGT CAT CGA CGC CAC Ser His Arg Arg His 140 GAG AGA GAC Glu Arg Asp GAA GTG Glu Val 155 TTT GTC CCC Phe Val Pro

AAG

Lys 160 AAG AAG TCA GAC ATC AAG TGG TAC GGC AAG TAC CTC AAC AAC CCT TTG Lys Lys Ser Asp Ile Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 GGA CGC ACC Gly Arg Thr TAC TTR GCC Tyr Leu Ala 195

GTG

Vai 180 ATG TTA ACG GTT Met Leu Thr Val

CAG

Gin 185 TTC ACT CTC GGC Phe Thr Leu Giy TGG .CCT TTG Trp Pro Leu 190 GGC TTC GCT Gly Phe Ala 432 480 528 576 624 672 720 768 TTC AAC GTC TCG Phe Asn.Vai Ser

GGG

Gly 200 AGA CCT TAC GAC Arg Pro Tyr Asp

GGC

Gly 205 TGC CAT Cys His 210 TTC CAC CCC Phe His Pro

AAC*GCT

Asn Ala 21S CCC ATC TAC AAC Pro Ile Tyr Asn

GAC

Asp 220 CGT GAG COT CTC Arg Giu Arg Leu

CAG

Gin 225 ATA TAC ATC TCC Ile Tyr Ile Ser

GAC

Asp 230 GCT 0CC ATC CTC Ala Gly Ile Leu 0CC Ala 235 GTC TGC TAC GOT Val Cys Tyr Gly

CTC

Leu 240 TAC CGC TAC GCT GCT RTC CAA GGA GTT GCC TCG Tyr Arg Tyr Ala Ala Xaa Gin Gly Val Ala Ser 245 250 ATO GTC TGC TTC TAC Met Val Cys Phe Tyr 255 OGA GTT CCT Gly Vai Pro TTG CAG CAC Leu Gin His 275

CTT

Leu 260 CTG RTT GTC AAC Leu Xaa Val Asn

GGG

Gly 265 TTC TTA GTT TTG Phe Leu Vai Leu ATC ACT TAC Ile Thr Tyr 270 TCT GAG TG Ser Giu Trp, ACG CAT CCT TCC Thr His Pro Ser

CTG

Leu 280 CCT CAC TAT GAC Pro His Tyr Asp GAT TG Asp Trp 290 TTG AGO GGA GCT Leu Arg Gly Ala

TTG

Leu 295 GCC ACC OTT GAC Ala Thr Val Asp GAC TAC GGA ATC Asp Tyr Gly Ile

TTG

Leu 305 AAC AAG GTC TTC Asn Lys Val Phe

CAC

His 310 AAT ATC ACG GAC Asn Ile Thr Asp

ACG

Thr 315 CAC GTG GCG CAT His Val Ala His CTG TTC TCG ACC Leu Phe Ser Thr

ATG

Met 325 CCG CAT TAT CAT Pro His Tyr His

GCG

Ala 330 ATG GAA GCT ACG Met Giu Ala Thr AAG GCC Lys Ala 335 912 960 1008 1056 1104 ATA AAC CCG Ile Lys Pro GTT AAG GCG Val Lys Ala 355

ATA

Ile 340 CTG GGA GAG TAT Leu Gly Giu Tyr

TAY

Tyr 345 CAG TTC GAT Gln Phe Asp GGG ACG CCG GTG Gly Thr Pro Vai 350 TAT GTG GAA CCG Tyr Val Giu Pro 365 ATG TGG AGO GAG Met Trp Arg Ciu

GCG

Ala 360 AAG GAG TOT ATC Lys Oiu Cys Ile -59- GAC AGG CAA GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA T 1153 Asp Arg Gin Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 GA 1155 INFORMATION FOR SEQ ID NO:12: SEQUENCE CHARACTERISTICS: LENGTH: 384 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: Met Gly Ala Gly Gly Arg Met Gin Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 Glu Thr Asp Asn Ile Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 25 Val Gly Glu Leu Lys Lys Ala Ile Pro Pro His Cys Phe Lys Arg Ser 40 Ile Pro Arg Ser Phe Ser Tyr Leu Ile Trp Asp Ile Ile Ile Ala Ser 55 Cys Phe Tyr Tyr Val Ala Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 70 75 Leu Ser Tyr Phe Ala Trp Pro Leu Tyr Trp Ala Cys Gin Gly Cys Val 90 Leu Thr Gly Val Trp Val Ile Ala His Lys Cys Gly His His Ala Phe 100 105 110 Ser Asp Tyr Gin Trp Leu Asp Asp Thr Val Gly Leu Ile Phe His Ser 115 120 125 Phe Leu Leu Val Xaa Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp Ile Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gin Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Ala Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Ala 195 200 205 Cys His Phe His Pro Asn Ala Pro Ile Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gin Ile Tyr Ile Ser Asp Ala Gly Ile Leu Ala Val Cys Tyr Gly Leu 225 230 235 240 Tyr Arg Tyr Ala Ala Xaa Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu Xaa Val Asn Gly Phe Leu Val Leu Ile Thr Tyr 260 265 270 Leu Gin His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly Ile 290 295 300 Leu Asn Lys Val Phe His Asn Ile Thr Asp Thr His Val Ala His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr His Ala Met Glu Ala Thr Lys Ala 325 330 335 Ile Lys Pro Ile Leu Gly Glu Tyr Tyr Gin Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys Ile Tyr Val Glu Pro 355 360 365 Asp Arg Gin Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 INFORMATION FOR SEQ ID NO:13: SEQUENCE CHARACTERISTICS: LENGTH: 1155 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Genomic DNA (ix) FEATURE: NAME/KEY: Coding Sequence LOCATION: 1...1152 OTHER INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAG AAG TCT 48 Met Gly Ala Gly Gly Arg Met Gin Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 GAA ACC GAC ACC ATC AAG CGC GTA CCC TGC GAG ACA CCG CCC TTC ACT 96 Glu Thr Asp Thr Ile Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 25 GTC GGA GAA CTC AAG AAA GCA ATC CCA CCG CAC TGT TTC AAA CGC TCG 144 Val Gly Glu Leu Lys Lys Ala Ile Pro Pro His Cys Phe Lys Arg Ser 40 ATC CCT CGC TCT TTC C T TAC CTC ATC TGG GAC ATC ATC ATA GCC TCC 192 Ile Pro Arg Ser Phe Ser Tyr Leu Ile Trp Asp Ile Ile Ile Ala Ser 55 61

TGC

Cys TTC TAC TAC GTC Phe Tyr Tyr Val

GCC

Ala 70 ACC ACT TAC TTC Thr Thr Tyr Phe CTC CTC CCT CAC Leu Leu Pro His

CCT

Pro CTC TCC TAC TTC Leu Ser Tyr Phe TGG CCT CTC TAC Trp Pro Leu Tyr GCC TGC CAA GG Ala Cys Gin Gly TGC GTC Cys Vai 240 288 336 384 CTA ACC GGC Leu Thr Gly AGC GAC TAC Ser Asp Tyr 115

GTC

Val 100 TGG GTC ATA GCC Trp Val Ile Ala

CAC

His 105 GAG TGC GGC CAC Giu Cys Gly His CAC GCC TTC His Ala Phe 110 TTC CAC TCC Phe His Ser CAG TGG CTT GAC Gin Trp Leu Asp

GAC

Asp 120 ACC GTC GGT CTC Thr Val Gly Leu

ATC

Ile 125 TTC CTC Phe Leu 130 CTC GTC CCT TAC Leu Val Pro Tyr

TTC

Phe 135 TCC TGG AAG TAC Ser Trp Lys Tyr AGT CAT CGA CGC CAC Ser His Arg Arg His 140 GTG TTT GTC CCC AAG Val Phe Vai Pro Lys

CAT

His 145 TCC AAC ACT GGC Ser Asn Thr Giy

TCC

Se r 150 CTC GAG AGA GAC Leu Giu Arg Asp AAG AAG TCA GAC Lys Lys Ser Asp AAG TGG TAG GGC.

Lys Trp Tyr Gly TAC CTC AAC AAC Tyr Leu Asn Asn CCT TTG Pro Leu 175 GGA CGC ACC Gly Arg Thr TAG TTA GCC Tyr Leu Aia 195

GTG

Val 180 ATG TTA AGOTT Met Leu Thr Val

CAG

Gin 185 TTC ACT CTC GGC Phe Thr Leu Gly TOG CCG ITG Trp Pro Leu 190 GGC TTC OCT Gly Phe Ala 576 624 TTC AAC GTC TCG Phe Asn Val Ser

GGA

Gly 200 AGA CCT TAG GAC Arg Pro Tyr Asp

GGC

Gly 205 TGC CAT Cys His 210 TTC CAC CCC AAC Phe His Pro Asn OCT CCC ATC TAC AAC GAC CGC GAG COT CTC Ala Pro Ile Tyr Asn Asp Arg Giu Arg Leu 215 220

CAG

Gin 225 ATA TAC ATC TCC Ile Tyr Ile Ser

GAG

Asp 230 GCT GOC ATC CTC Ala Gly Ile Leu GTC TG TAG GGT Val Cys Tyr Gly

CTC

Leu 240 720 768 TTC CGT TAC GCC Phe Arg Tyr Ala GCG CAG GGA GTG Ala Gin Gly Val TCG ATG GTC TGC Ser Met Val Cys TTC TAC Phe Tyr 255 GGA GTC COG Gly Val Pro TTG GAG CAC Leu Gin His 275

CTT

Leu 260 GTG ATT GTC AAT Leu Ile Val Asn

GGT

Gly 265 TTG CTC GTG TTG Phe Leu Val Leu ATC ACT TAG Ile Thr Tyr 270 TCC GAG TG Ser Giu Trp ACG CAT GCT TCC Thr His Pro Ser COT CAC TAG GAT Pro His Tyr Asp

TCG

Ser 285 OAT TG Asp Trp 290 TTG AGG GGA GCT Leu Arg Gly Ala

TTG

Leu 295 OCT ACC GTT GAG Ala Thr Val Asp AGA GAG TAC GGA Arg Asp Tyr Gly 300 CAC OTO GCC CAT His Val Ala His

ATG

Ile

CAT

His 320 912 960 TTG Leu 305 AAC AAG GTC TTC Asn Lys Val Phe

CAC

His 310 A.AT ATT ACC GAC Asn Ilie Thr Asp

AG

Thr 315 62

CTG

Leu

ATA

Ile

GTT

Val

GAC

Asp

GA

TTC

Phe

AAG

Lys

AAG

Lys

AGG

Arg 370

TCC

Ser

CCG

Pro

GCG

Ala 355

CAA

Gin

CCG

Pro

GGA

Gly

AGG

Arg

AAG

Lys

TAT

Tyr

TAT

Tyr

GCG

Ala 360

GGT

Gly CAC GCG His Ala 330 TAT CAG Tyr Gin 345 AAG GAG Lys Giu GTG TTC Val Phe GAA GCT ACC AAG C 1008 Glu Ala Thr Lys Ala 335 GAT GGG ACG CCG GTG. 1056 Asp Gly Thr Pro Val 350 ATC TAT GTG GAA CCG 1104 Ile Tyr Val Glu Pro 365 TAC AAC AAT AAG TTA T 1153 Tyr Asn.Asn Lys Leu 380 1155 INFORMATION FOR SEQ ID 1'O:14: SEQUENCE CHARACTERISTICS: LENGTH: 384 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: Met Gly Ala Gly Gly Arg Met Gin Val Ser Pro Pro Ser Lys Lys Ser Glu Val Ile Cys Leu Leu Ser Phe His 145 Thr Gly Pro s0 Phe Ser Thr Asp Leu 130 Ser Asp Giu Arg Tyr Tyr Gly Tyr 115 Leu Asn Thr Ile Lys Leu Lys Lys Ser Phe Ser Tyr Val Ala 70 Phe Ala Trp Val Trp Val 100 Gin Trp Leu Val Pro Tyr Thr Gly Ser 150 Arg Ala Tyr 55 Thr Pro Ile Asp Phe 135 Leu Vai Ile 40 Leu Thr Leu Ala Asp 120 Ser Glu Pro 25 Pro Ile Tyr Tyr His 105 Thr Trp Arg Cys Glu Pro His Trp Asp Phe Pro 75 Trp Ala 90 Glu Cys Val Gly Lys Tyr Asp Glu Thr Cys Ile Leu Cys Gly Leu Ser 140 Val Pro Phe Ile Leu Gin His Ile 125 His Phe Pro Lys Ile Pro Gly His 110 Phe Arg Val Phe Arg Ala His Cys Ala His Arg Pro Thr Ser Ser Pro Val Phe Ser His Lys 160 155 Lys Lys Ser Asp Ile 165 Lys Trp, Tyr Gly Lys 170 Tyr Leu Asn Asn Pro Leu 175 -63- Gly Arg Thr Val Met Leu Thr Val Gin Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Ala Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Ala 195 200 205 Cys His Phe His Pro Asn Ala Pro Ile Tyr Asn Asp Arg Glu Arg Leu 210 215 220 Gin Ile Tyr Ile Ser Asp Ala Gly Ile Leu Ala Val Cys Tyr Gly Leu 225 230 235 240 Phe Arg Tyr Ala Ala Ala Gln Gly Val Ala Ser Met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu Ile Val Asn Gly Phe Leu Val Leu Ile Thr Tyr 260 265 270 Leu Gin His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285..

Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly Ile 290 295 300 Leu Asn Lys Val Phe His Asn Ile Thr Asp Thr His Val Ala His His 305 310 315 320 Leu Phe Ser Thr Met Pro His Tyr His Ala Met Glu Ala Thr Lys Ala 325 330 335 Ile Lys Pro Ile Leu Gly Glu Tyr Tyr Gin Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys Ile Tyr Val Glu Pro 355 360 365 Asp Arg Gin Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 1155 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Genomic DNA (ix) FEATURE: NAME/KEY: Coding Sequence LOCATION: 1...1152 OTHER INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQ ID ATG GGT GCA GGT GGA AGA ATG CAA GTG TCT CCT CCC TCC AAG AAG TCT 48 Met Gly Ala Gly Gly Arg Met Gin Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 64- GAA ACC GAC ACC ATC AAG CGC GTA Glu Thr Asp Thr Ile Lys Arg Val

CCC

Pro 25 TGC GAG ACA COG Cys Glu Thr Pro CCC TTC ACT Pro Phe Thr AAA CGC TCG Lys Arg Ser GTC GGA GAA Val Gly Giu CTC AAG AAA GCA Leu Lys Lys Ala

ATC

Ile 40 CCA COG CAC TGT Pro Pro His Cys

TTC

Phe ATO CCT Ile Pro CGO TCT TTC TCC Arg Ser Phe Ser

TAO

Tyr 55 CTC ATC TGG GAO Leu Ile Trp Asp

ATC

Ile ATO ATA GCC TCC Ile Ile Ala Ser

TGC

Cys TTC TAC TAC GTC Phe Tyr Tyr Val ACC ACT TAC TTC Thr Thr Tyr Phe OTC CTC CCT CAC Leu Leu Pro-His

CCT

Pro CTC TCC TAO TTO Leu Ser Tyr Phe TGG CCT OTC TAO Trp Pro Leu Tyr GOC TGC CAA-GGG Ala Cys Gin Gly TGO GTO Cys Vai CTA ACC GGC Leu Thr Gly AGO GAO TAO Ser Asp Tyr 115

GTC

Val 100 TGG GTC ATA GCC Trp Val Ile Ala

CAC

His 105 GAG TGC GGC CAC Giu Cys Gly His CAC GOC TTC His Ala Phe 110 TTC CAO TOO Phe His Ser 192 240 28B 336 384 432 480 528 GAG TGG OTT GAO Gin Trp Leu Asp

GAO

Asp 120 ACC GTO GGT OTO Thr Val Gly Leu

ATO

Ile 125 TTC OTO Phe Leu 130 OTO GTO OCT TAO Leu Val Pro Tyr

TTC

Phe 135 TOO TGG. AAG TAO Ser Trp Lys Tyr

AGT

Ser 140- GAT OGA OGO GAO His Arg Arg His

OAT

His 145 TOO AAO ACT GGO Ser Asn Thr Gly

TOO

Ser 150 OTO GAG AGA GAO Leu Glu Arg Asp

GAA

Giu 155 GTG TTT GTO COO Val Phe Vai Pro

AAG

Lys 160 AAG AAG TGA GAO Lys Lys Ser Asp ATO AAG TGG TAO GCO AAG TAC GAO AAO AAO COT TTG Ile Lys Trp Tyr Giy Lys Tyr His Asn Asn Pro Leu 165 170 175 GGA CGC ACC Gly Arg Thr TAC TTA CC Tyr Leu Ala 195

GTG

Val 180 ATG TTA AOG GTT Met Leu Thr Val TTO ACT OTO GCC Phe Thr Leu Gly TGG COG TTG Trp Pro Leu 190 GGC TTO GOT Gly Phe Ala TTC AAO GTO TOG Phe Asn Val Ser AGA COT TAO GAO Arg Pro Tyr Asp

GO

Gly 205 TGO OAT Cys His 210 TTO CAC 000 AAO Phe His Pro Asn

GOT

Ala 215 COO ATO TAO AAO Pro Ile Tyr Asn

GAO

Asp 220 CGC GAG CT OTO Arg Giu Arg Leu

CAG

Gin 225 ATA TAO ATO TOO Ile Tyr Ile Ser

GAO

Asp 230 CT GCC ATO OTO Ala Gly Ile Leu

CO

Ala 235 OTO TOO TAO COT Val Cys Tyr Cly 672 720 768 816 TTC CT TAO CO Phe Arg Tyr Ala

GC

Ala 245 GOG CAG GGA GTG Ala Gin Cly Val

GC

Ala 250 TOG ATG GTO TOO.

Ser Met Val Cys TTC TAC Phe Tyr 255 GOA OTO COG Gly Val Pro OTT CTC ATT OTO AAT GGT Leu Leu Ile Val Asn:Oly 260 265 TTC OTO GTG TTG Phe Leu Val Leu ATO ACT TAC Ile Thr Tyr 270 TTG CAG CAC ACG CAT CCT TCC CTG CCT CAC TAC GAT TCG TCC GAG TGG 864 Leu Gin His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 GAT TGG TTG AGG GGA GCT TTG GCT ACC GTT GAC AGA GAC TAC GGA ATC 912 Asp Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly Ile 290 295 300 TTG AAC AAG GTC TTC CAC AAT ATT ACC GAC ACG CAC GTG GCG CAT CAT 960 Leu Asn Lys Val Phe His Asn Ile Thr Asp Thr His Val Ala His His 305 310 315 320 CTG TTC TCC ACG ATG CCG CAT TAT CAC GCG ATG GAA GCT ACC. AAG GCG 1008 Leu Phe Ser Thr Met Pro His Tyr His Ala Met Glu Ala Thr Lys Ala 325 330 335 ATA AAG CCG ATA CTG GGA GAG TAT TAT CAG TTC GAT GGG ACG CCG GTG 1056 Ile Lys Pro Ile Leu Gly Glu Tyr Tyr Gin Phe Asp Gly Thr Pro Val 340 345 350 GTT AAG GCG ATG TGG AGG GAG GCG AAG GAG TGT ATC TAT GTG GAA CCG 1104 Val Lys Ala Met Trp Arg Glu Ala Lys Glu Cys Ile Tyr Val Glu Pro 355 360 365 GAC AGG CAA GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA T 1153 Asp Arg Gin Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 GA 1155 INFORMATION FOR SEQ ID NO:16: SEQUENCE CHARACTERISTICS: LENGTH: 384 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: Met Gly Ala Gly Gly Arg Met Gin Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 Glu Thr Asp Thr Ile Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 25 Val Gly Glu Leu Lys Lys Ala Ile Pro Pro His Cys Phe Lys Arg Ser 40 Ile Pro Arg Ser Phe Ser Tyr Leu Ile Trp Asp Ile Ile Ile Ala Ser 55 Cys Phe Tyr Tyr Val Ala Thr Thr Tyr Phe Pro Leu Leu Pro His Pro 70 75 Leu Ser Tyr Phe Ala Trp Pro Leu Tyr Trp Ala Cys Gin Gly Cys Val 90 Leu Thr Gly Val Trp Val Ile Ala His Glu Cys Gly His His Ala Phe 100 105 110 66 Ser Asp Tyr 115 Gin Trp Leu Asp Asp Thr Val Gly Leu Ile Phe His Ser Phe His 145 Lys Gly.

Tyr Cys Gin 225 Phe Gly Leu Asp Leu 305 Leu Ile Val Leu 130 Ser Lays Arg Leu His 210 Ile Arg Val Gin Trp 290 Asn Phe Lys Lys Leu Asn Ser Thr Ala 195 Phe Tyr Tyr Pro His 275 Leu.

Lys Ser Pro Ala 355 Val Thr Asp Val 180 Phe His Ile Ala Leu 260 Thr Arg Vai Thr Ile 340 Met Pro G1y Ile 165 Met Asn Pro Ser Ala 245 Leu His Gly Phe Met 325 Lev Trn Tyr Ser 150 Lys Leu Val Asn Asp.

230 Ala Ile Pro 'Ala His 310 Pro Gly Arg ?he 13 5 Leu rrp, rhr Ser ALa 215 Ala Gin Val Ser Leu 295 Asn His Glu 120 Ser Giu Tyr Val Gly 200 Pro Gly Gly Asn Leu 280 Ala Ile Tyr Tyr Ala 360 Trp Arg Gly Gin 185 Arg Ile Ile Val Giy 265 Pro Thr Thr *His Tyr 345 Lys Asp L~ys 170 Phe Pro Tyr Leu Ala 250 Phe His Val Asp Ala 330 Gin Git 125 Tyr Giu 155 Tyr Thr Tyr Asn Ala 235 Ser Leu Tyr Asp Thr 315 Met Phe Cys Ser 140 Vai His Leu Asp Asp 220 Val Met Val Asrp Arg 300 His 6iu Asp Ile His Phe Asn Gly Gly 205 Arg Cys Val Leu Ser 285 Asp Val Ala Gly Tyr 365 krg Val ksn rrp 190 Giy Glu Tyr Cys Ile 270 Ser Tyr Ala Thr Thr 350 Val krg Pro Pro 175 Pro Phe Arg Gly Phe 255 Thr Giu Gly His Lys 335 Prc Gli.

His Lys 160 Leu Leu Ala Leu Leu 240 Tyr Tyr Trp Ile His 320 Ala Val 1Pro Asp Arg 370 Gin Gly Giu Lys Lys 375 Gly Val Phe Trp Tyr 380 Asn Asn Lys Leu INFORMATION FOR SEQ ID NO: 12: SEQUENCE CHARACTERISTICS: LENGTH: 1155 base pairs TYPE: nucleic acid STRAINDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Genomic DNA (ix) FEATURE: NAME/KEY: Coding Sequence 67 LOCATION: .1152 OTHER INFORMATIO1N: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: ATG GGT GCA GGT Met Gly Ala Gly 1

GGA

Gly 5 AGA ATG CAA GTG Arg Met Gin Val

TCT

Ser 10 COT CCC TCC AAG Pro Pro Ser Lys AAG TCT Lys Ser is GAA ACC GAC Glu Thr Asp GTC GGA GAA Val Giy Glu

ACC

Thr ATC AAG CGC GTA Ile Lys Arg Val TGC GAG ACA Cys Glu Thr CCG CCC TTC ACT Pro Pro.Phe Thr CTC AAG AAA GCA Leu Lys Lys Ala

ATC

Ile 40 CCA CCG CAC TGT Pro Pro His Cys

TTC

Phe AAA CGC TCG Lys Arg Ser ATC CCT Ile Pro CGC TCT TTC TCC Arg Ser Phe Ser CTC ATC TGG GAC Leu Ile Trp Asp

ATC

Ile ATC ATA GCC TCC Ile Ile Ala Ser

TGC

Cys TTC TAC TAC GTC Phe Tyr Tyr Val

GCC

Ala 70 ACC ACT TAC TTC Thr Thr Tyr Phe

CCT

Pro 75 CTC CTC CCT CAC Leu Leu Pro His

CCT

Pro CTC TCC TAC TTC GCC TGG CCT CTC TAC TGG GCC TGC CAA GGG TGC GTC Leu Ser Tyr Phe Ala Trp Pro Leu Tyr Trp Ala Cys Gin Giy Cys Val 90 CTA ACC GGC GTC TGG GTC ATA GCC CAC GAG TGC GGC CAC CAC GCC TTC Leu Thr Gly Val Trp Val Ile Ala His Giu Cys Gly His His Ala Phe 100 105 110 AGC GAO TAC Ser Asp Tyr 115 CAG TOG CTT GAC Gin Trp, Leu Asp

GAC

Asp 120 ACC GTC GGT CTC Thr Val Gly Leu

ATC

Ile 125 TTC CAC TCC Phe His Ser TTC CTC Phe Leu 130 CTC GTC CCT TAC Leu Val Pro Tyr TCC TGG AAG TAC Ser Trp Lys Tyr

AGT

Ser 140 CAT CGA CGC CAC His Arg Arg His

CAT

His 145 TCC AAC ACT GGC Ser Asn Thr Gly CTC GAG AGA GAC Leu Giu Arg Asp

GAA

Glu 155 GTG TTT GTC CCC Vai Phe Val Pro

AAG

Lys 160 AAG AAG TCA GAC Lys Lys Ser Asp ATC AAG TOG TAC GGC AAG TAC CTC--AAC AAC COT TTG Ile Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 432 480 528 576 624 672 GGA CGC ACC Gly Arg Thr TAC TTA GCC Tyr Leu Ala 195

GTG

Val 180 ATG TTA ACG GTT Met Leu Thr Val

CAG

Gin 185 TTC ACT CTC GGC Phe Thr Leu Giy TOG CCG TTG Trp Pro Leu 190 GGC TTC GCT Gly Phe Ala TTC AAC OTC TCG Phe Asn Val Ser

GGA

Giy 200 AGA CCT TAO GAC Arg Pro Tyr Asp

GGC

Gly 205 TOC CAT Cys His 210 TTC CAC CCC AAC Phe His Pro Asri

GCT

Ala 215 CCC ATC TAC AAC Pro Ile Tyr Asn

GAC

Asp 220 CGC GAG CGT C-TC Arg Glu Arg Leu 68

CAG

Gin 225 ATA TAC ATC TCC Ile Tyr Ile Ser GCT GGC ATC Ala Gly Ile CTC GCC Leu Ala 235 GTC TGC TAC GGT Val Cys Tyr Gly TTC CGT TAC GCC Phe Arg Tyr Ala

GCC

Ala 245 GCG CAG GGA GTG Ala Gin Gly Val TCG ATG GTC TGC Ser Met Val Cys TTC TAC Phe Tyr 255 720 768 816 864 GGA GTC CCG Gly Val Pro TTG CAG CAC Leu Gin His 275

CTT

Leu 260 CTG ATT GTC AAT Leu Ile Val Asn TTC CTC GTG TTG Phe Leu Val Leu ATC ACT TAC Ile Thr Tyr 270 TCC GAG TGG SerGiu Trp ACG CAT CCT TCC Thr His Pro Ser CCT CAC TAC GAT Pro His Tyr Asp

TCG

Ser 285 GAT TGG Asp Trp 290 TTG AGG GGA GCT Leu Axg Gly Ala

TTG

Leu 295 GCT ACC GTT GAC Ala Thr Val Asp GAC TAC GAA ATC Asp Tyr Gt Ile

TTG

Leu 305 AAC AAG GTC TTC Asn Lys Val Phe

CAC

His 310 AAT ATT ACC GAC Asn Ile Thr Asp CAC GTG GCG CAT His Val Ala His

CAT

His 320 CTG TTC TCC ACG Leu Phe Ser Thr

ATG

Met 325 COG CAT TAT CAC Pro His Tyr His

GCG

Ala 330 ATG GAA GCT ACC Met Glu Ala Thr AAG GCG Lys Ala 335 912 960 1008 1056 1104 ATA AAG CCG Ile Lys Pro GTT AAG GCG Val Lys Ala 355

ATA

Ile 340 CTG GGA GAG TAT Leu Giy Giu Tyr TAT GAG TTC GAT GOG ACG CCG GTG Tyr Gin Phe Asp Gly Thr Pro Val 345 350 ATG TGG AGG GAG Met Trp Arg Glu AAG GAG TOT ATC Lys Giu Cys Ile

TAT

Tyr 365 GTG GAA CCG Val Glu Pro GAC AGG CAA GGT GAG AAG AAA GOT GTG ~TC TOG TAC. AAC AAT AAG TTA T 1153 Asp Arg Gin Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu .370 375 380 GA 1155 INFORMATION FOR SEQ ID NO:18: SEQUENCE -CHARACTERISTICS: LENGTH: 384 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: Met Gly Ala Giy Gly Axg Met Gin Val Ser Pro Pro Ser'Lys Lys Set 1 5 10 Glu Thr Asp Thr Ile Lys Arg Val Pro Cys Giu Thr Pro Pro Phe Thr 25 Val Gly Oiu Leu Lys Lys Ala Ile Pro Pro Hi s Cy6 Phie Lys Arg Ser' 40 69 Ile Pro Arg Ser Phe Ser Tyr Leu Ile Trp Asp Ile Ile Ile Ala Ser 55 Cys Phe Tyr Tyr Val Ala Thr Thr Tyr Phe Pro Leu Leu Pro-~His Pro 70 75 Leu Ser Tyr Phe Ala Trp Pro Leu Tyr Trp Ala Cys Gln Gly Cys Val 90 Leu Thr Gly Val Trp Val Ile Ala His Glu Cys Gly His His Ala Phe 100 105 110 Ser Asp 'Tyr Gin Trp Leu Asp Asp Thr Val Gly Leu Ile Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135 140 His Ser Asn Thr Gly Ser Leu Giu Arg Asp Giu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp Ile Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gin Phe Thr Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Ala Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Ala 195 200 205 Cys His Phe His Pro Asn Ala Pro Ile Tyr Asn Asp Arg Giu Arg Leu 210 215 220 Gin Ile Tyr Ile Ser Asp Ala Gly Ile Leu Ala Val Cys Tyr Gly Leu 225 230 235 240 Phe Arg Tyr Ala Ala Ala Gin Gly Val Ala Ser met Val Cys Phe Tyr 245 250 255 Gly Val Pro Leu Leu Ile Val Asn Gly Phe Leu Val Leu Ile Thr-Tyr 260 265 270 Leu Gin His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp 275 280 285 Asp Trp, Leu Arg Giy Ala Leu Ala Thr Val Asp Arg Asp Tyr Giu Ile 290 295 300 Leu Asn Lys Val Phe His Asn Ile Thr Asp Thr His Val Ala His His 305 310 315 320 Leu Phe Ser Thr.Met Pro His Tyr His Ala Met Giu Ala Thr Lys Ala 325 330 335- Ile Lys Pro Ile Leu Giy Giu Tyr Tyr Gin Phe Asp Gly Thr Pro Val 340 345 350 Val Lys Ala Met Trp, Arg Giu Ala Lys Giu Cys Ile Tyr Val Glu Pro 355 360 365 Asp Arg Gin'Giy Giu Lys Lye Gly Val Phe Trp Tyr Aen Asn Lys Leu 370 375 380 INFORMATION FOR SEQ ID NO:19: SEQUENCE CHARACTERISTICS: LENGTH: 21 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear- (ii) MOLECULE TYPE: Other Nucleic Acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: GGATATGATG ATGGTGAAAG A 21 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 21 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MbLECULE TYPE: Other Nucleic Acid (xi) SEQUENCE DESCRIPTION: SEQ ID TCTTTCACCA TCATCATATC C 21 INFORMATION FOR SEQ ID NO:21: SEQUENCE CHARACTERISTICS: LENGTH: 21 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Other Nucleic Acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: GTTATGAAGC AAAGAAGAAA C 21 INFORMATION FOR SEQ ID NO:22: SEQUENCE CHARACTERISTICS: LENGTH: 26 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Other Nucleic Acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: GTTTCTTCTT TGCTTTGCTT CATAAC 26 INFORMATION FOR SEQ ID NO:23: SEQUENCE CHARACTERISTICS: LENGTH:- 32 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear -71 (ii) MOLECULE TYPE: Other Nucleic Acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: CAUCAUCAUC AUCTTCTTCG TAGGGTTCAT CG 32 INFORMATION FOR SEQ ID NO:24: SEQUENCE CHARACTERISTICS: LENGTH: 33 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Other Nucleic Acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: CUACUACUAC UATCATAGAA GAGAAAGGTT CAG 33 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 32 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Other (xi) SEQUENCE DESCRIPTION: SEQ ID CAUCAUCAUC AUCATGGGTG CACGTGGAAG AA 32 INFORMATION FOR SEQ ID NO:26: SEQUENCE CHARACTERISTICS: LENGTH: 33 base pairs TYPE: nucleic'acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Other (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: CUACUACUAC UATCTTTCAC CATCATCATA TCC 33 INFORMATION FOR SEQ ID NO:27: SEQUENCE CHARACTERISTICS: LENGTH: 33 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Other (xi) SEQUENCE DESCRIPTION: SEQ ID ND:27: CUACUACUAC UACATAACTT ATTGTTGTAC CAG 33 72 INFORMATION FOR SEQ ID NO:28: Ci) SEQUENCE CHARACTERISTICS: LENGTH: 2168 base pairs TYPE: nucleic acid STRAINDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Genomic DNA (ix) FEATURE: NAME/KEY: Coding Sequence LOCATION: 1014... .2165 OTHER INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:

CTTCTTCGTA

AGCTTTCAGG

CCTGGTCTGT

TAGRTCTGCC

A.ATCTTGTGT

CATATGAAAT

AATAGAAAAG

CTCAAAP.ATT

TTTCAAAATT

GAACCATAAR

TTTAAC 1YTA T1 TGACCTT

TTCAATATAA

CTTGCTACTG

CTTTGTACAA

TTTATAGATT

TCCGTCCTCC

GGGTTCATCG TTATTAACGT GTCCCCTTCT TCTTCTTCTT GTTCACCTCG TCCATCTCTC AGTCTTTATT GCATTCAACT CATGTTTCIT TCATCTCACC GTTGCAACTT TCTATCTATT GTCAAATCTC CAAAATAGCA AAAATGACCA AAATATTATT TGAAATCTTA TCCCCAAAAC CCCTAAACCC TAAACTCTA1 .AACCATAAGT TTGTGACTTT GAGTGCTAGT TTGGGAACAA AAATCACTTA TTGTTGAACC TTATTTCTTA ATAAATGGAA ATAAAACGGA TGATTTAAAG CAAATGCATG AAGAGTTGCA

ATAACATTAT-TATTATTTTT

AAAATCTCTC

CTTCTCATTT

TAGCAGTCTA

AAAGATCTGT

GTTAAATAAT

CAGAAATCTT

ACTTTCTAAG

TTATCTTTTG

CTCATTTCTC

ACCCTAAACC

TGATAAAATA

AAACTTGGTT

TTTGATAGAT

GAACGTTTCA

TAGGTAGGTA

TATACAACTT

TGGTTTTCTC

TCCCCCCACC

TCCTCTTATT

GCATTTGGCA

TCCTCTGTTT

GATTACTGTC

TTTATTCAAT

TTTATATCAC

AAAATTTTAA

AACTCTAAAC

CTAAACCCTA

TTAAGTGATA

TAGTGCTATT

TTGACCGAT

TTdACTTATA

CTTCAGGGTT

TGATTAAAGG

TACAGAAACA

CTACGTCA:GC

TTTATGAATT

TTTAAATCGA

CCATI'TGACA

TAT=GCTAG

AGGTTGGTGA

AAAAATAGCA

TTTTTT

CCTAAACTCT

AACCCCACCC

TTTTTGTGAC

TTTGTTTTTT

CCTACTGGTT

AGCTCATCAA

TAGATGTTCT

ATAAAAAGTC

AAC ATG Met 1 GGC GCA GRT Gly Ala Xaa ACC AAA ACC Thr Lys Thr

GGA

Gly AGA ATG CAA ATC TCT CCT CC.C TCC AGC Arg Met Gin Ile Ser Pro Pro Ser Ser TCC CCC GAA Ser Pro Glu 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1016 1064 1112 1160 1208 12 56 1304 CTC AAA CGC GTC Leu Lys Arg Val CCC TGC GAG ACA CCA CCC TTC ACT CTC Pro Cys Glu Thr Pro Pro Phe Thr Leu 25 GGA GAC Gly Asp CTC GAG AAA GCA Leu Glu Lys Ala

ATC

Ile CCA CCT CAC TGC Pro Pro His Cys AAA CGC TCC ATC Lys Arg Ser Ile

CCT

Pro

CTC

Leu CGC TCC TTC TICC Arg Ser Pha Ser TAC CAC CTC TCC Tyr His Leu Ser CTC CTC TTC GAC Leu Leu Phe Asp CTC GTC TCC TCC Leu Val Ser Ser

TCC

Ser ACA GCC TAC TTC Thr Ala Tyr Phe

CCT

Pro 7S CTC CTC CCC CAC Leu Leu Pro His CCT CTC Pro Leu CCT TAC CTC GCC TGG CCC CTC TAC Pro Tyr Leu Ala Trp-Pro Leu Tyr

TG

Trp GCC TGC CAA GGC Ala Cys Gin Gly TGC GTC CTA Cys Val Leu 73 ACG CCC CTC Thr Cly Leu 100 TGG GTC ATC GCC Trp Val Ile Ala

CAC

His 105 GAA TGC GGC CAC CAC GCC TTC AGC Giu Cys Gly His His Ala& Phe Ser 110 GAC CAC Asp His 115 CAG TGG CTG GAC Gin Trp Leu Asp GCC GTG CCC CTC Aia Val Gly Leu TTC CAC TCC TTC Phe His Ser Phe

CTC

Leu 130 CTC GTC CCT TAC Leu Val Pro Tyr

TTC

Phe 135S TCC TGG AAG TAC Ser Trp Lys Tyr

AGC

Ser 140 CAT CGA CGC CAC His Arg Arg His TCC AAC ACC CGA Ser Asn Thr Gly

TCC

Ser 150 CTC GAG AGC GAT Leu Ciu Arg Asp

GAA

Giu 155 GTG TTC GTC Val Phe Val AAA TCC GAC Lys Ser Asp CCC ACG GTG Arg Thr Vai 180

ATC

Ile 165 AAG TCC TAC Lys Trp Tyr GGA AAG Cly Lys 170 TAC CTC AAC AAC Tyr Leu Asn Asn CCC.AAG AAG Pro Lys Lys 160 CCC CTA GGA Pro Leu Cly 175 CCG TTG TAC Pro Leu Tyr ATG CTA ACC CTC Met Leu Thr Val

CAG

Gin 185 TTC ACG CTC GCC Phe Thr Leu Cly

TGG

Trp 190 TTA CC Leu Ala 195 TTC AAC CTC TCT Phe Asn Val Ser

CCA

Cly 200 AGA CCT TAC AC Arg Pro Tyr Ser

GAC

Asp 205 GGT TTC GCT TGC Cly Phe Aia Cys

CAT

His 210 rrC CAC CCC AAC Phe His Pro Asn CCC ATC TAC AAC Pro Ile Tyr Asn GAC CCC GAG CCT CTC CAG Asp Arg Giu Arg Leu Gin 220 225 11352 1400 1448 1496 1544 1592 1640 1688 1736 1784 1832 1880 1928 1976 2024 2072 ATA TAC ATC TCT Ile Tyr Ile Ser

GAC

Asp 230 GCT GGC GTC CTC Ala Cly Val Leu

TCC

Ser 235 CTA TGT TAC COT Val Cys Tyr Gly CTC TAC Leu Tyr 240 CCC TAC GCT Arg Tyr Ala GTT CCC CTT Val Pro Leu 260

GOT

Gly 245 TCG CGA CGA CTG Ser Arg Gly Val TCC ATG GTC TGT Ser Met Val Cys CTC TAC GGA Vai Tyr Gly 255 ACT TAC TTG Thr Tyr Leu ATC ATT GTC AAC Met Ile Val Asn

TCT

Cys 265 TTC CTC GTC TTG Phe Leu Val Leu CAG CAC Gin His 275 ACG CAC CCT TCC Thr His Pro Ser

CTG

Leu 280 CCT CAC TAT CAT Pro His Tyr Asp TCG GAG TGG CAT Ser Ciu Trp Asp

TCC

Trp 290 TTG ACA GGA GCT Leu Arg Cly Ala CCT ACT GTG CAT Ala Thr Val Asp ACA GAC TAT GOA ATC TTG Arg Asp Tyr Cly Ile Leu 300 '305 AAC AAG GTG TTT Asn Lys Val Phe

CAT

His 310 AAC ATC ACO GAC Asn Ile Thr Asp

ACG

Thr 315.

CAC GTG C CAT His Vai Ala His CAT CTG His Leu 320 TTC TCG ACG Phe Ser Thr ATG CCG Met Pro 325 CAT TAT AAC C ATO GAA CC ACC His Tyr Asn Ala Met Glu Ala Thr AAG C ATA Lys Ala Ile 335 CCC GTG GTT -Pro Vai Val AAC CCC ATA CTT GGA GAG TAT Lys Pro Ile Leu Cly Giu Tyr

TAC

Tyr 345 CAC TTT CAT GCA Gin Phe Asp Gly 74 AAG GCG ATG TGG AGG GAG GCG AAG GAG TGT ATC TAT GTT GAA CCG GAT 2120 Lys Ala Met Trp Arg Glu Ala Lys. Glu Cys Ile Tyr Val Giu Pro Asp 355 360 365 AGG CAA GGT GAG AAG AAA GGT GTG TTC TGG TAC AAC AAT AAG TTA TGA 21.68 Arg Gin Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn Asn Lys Leu 370 375 380 INFORMATION FOR SEQ ID NO:29: SEQUENCE CHARACTERISTICS: LENGTH: 384 amino acids TYPE: amino acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: protein FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29: Met Gly Ala Xaa Gly Arg Met Gin Ile Ser Pro Pro Ser Ser Ser Pro 10 is Giu Thr Lys Thr Leu Lys Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 25 Leu Gly Asp Leu Glu Lys Ala Ile Pro Pro His Cys Phe Lys Arg Ser 40 Ile Pro Arg Ser Phe Ser Tyr Leu Leu Phe Asp Ilii Leu Val Ser Ser.

55 Ser Leu Tyr His Leu Ser Thr Ala Tyr Phe Pro Leu Leu Pro His Pro 70 75 Leu Pro Tyr Leu Ala Trp Pro Leu Tyr Trp Ala Cys Gin Gly Cys Val 90 Leu Thr Gly Leu Trp, Val Ile Ala His Giu Cys Gly His His Ala Phe 100 105 110 Ser Asp His Gin Trp Leu Asp Asp Ala Val Gly Leu Vai Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Aig His 130 135 Ito.14.

His Ser Asn Thr Gly Ser Leu Glu Arg Asp Giu Val Phe Val Pro Lys 145 150 155 160 Lys Lys Ser Asp Ile Lys Trp Tyr Gly Lys Tyr Leu Asn Asn Pro Leu 165 170 175 Gly Arg Thr Val Met Leu Thr Val Gin Phe Thr Leu Giy Trp, Pro Leu 180 185 190 Tyr Leu Ala Phe Asn Val Ser Gly Arg Pro Tyr Ser Asp Gly Ph6 Ala 195 -200 205 Cys His Phe His Pro Asn Ala Pro Ile Tyr.Asn Asp Arg Giu Arg Leu 210 215 220 Gin 225 Tyr Ile Tyr Ile Ser Arg Tyr Ala Gly 245 Asp 230 Ala Gly Val Leu Ser 235 Val CyS Tyr Giy Leu 240 Ser Arg Gly Val Ala 250 Ser Met Val Cys Val Tyr 255 Gly Val Pro Leu Gin His 275 Leu 260 Met Ile Val Asn Cys 265 Phe Leu Val Leu Ile Thr Tyr 270 Ser Glu Trp Thr His Pro Ser Leu 280 Pro His Tyr Asp Asp Trp 290 Leu Arg G ly Ala Leu 295 Ala Thr Vai Asp Arg 300 Asp Tyr Gly Ile Leu 305 Asn Lys Vai Phe Asn Ile Thr Asp Thr 315 His Val Ala His Leu Phe Ser Thr Met 325 Pro His Tyr Asn Ala Met 330 Glu Ala Thr Lys Aia 335 Ile Lys Pro Val Lys Ala 355 Ile 340 Leu Gly Glu Tyr Tyr 345 Gin Phe Asp Gly Thr Pro Vai 350 Val Glu Pro Met Trp Arg Giu Ala 360 Lys Glu Cys Ile Tyr 365 Asp Arg 370 Gin Gly Giu Lys Lys 375 Giy Val Phe Trp Tyr 380 Asn Asn Lys Leu INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 1i32 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Genomic DNA (xi) SEQUENCE DESCRIPTION: SEQ ID

GCGTAACCCT

TTTCTTCTTC

ATCGCTTTTC

AGTATTTATT

TTGATGCTGT

TTrGCATTTTC

TT'GATGGGTT

ATCCTTCCTA

TAAGTACATA

GGAGATTTGA.

TTCATTTGGC

GATGTCCTTC

CAGTAAAAAA

TAGAGTTGCT

AGACATTGTG

TTGATATCCA

GTATTCTCAA

CTCTTTTGTC

AATTTGTTGG

TATTAACGTT

CATTTCTTCT

TATTCTATCT

GCATTAAACT

CTTTACCATT

ATTTGTCCGA

GGTGGAGTTG

TTCAAAGTTA

F1'TGTTGAAT

CCGATTCCTA

CTATGCTCAC

ATAGATTCAG

GATTGTATTT

CTCAACTGTT

ATTATGACTT

CAAGAAAGAG

CGCTATCGTT

CCACGTACTA

TTTTTTAAC

AAATCTTCAT

CATTTTTACG

ATCATTTTTG

ATAGATCTGG

AATCTGATTA

ATACAAACTG

AAAAATCACC

TATATTTGTT

C'rrTGGGTAA

TTGGCTCTTG

TTCATGCTTA

ATGCAATAGA

r1'GTTTGTTT TCATrAGCT

GTCTTCTCTA

ATGTAAGCTG

TATTTCTTTC

TCCATTTTT

TTTGAGTCTT

CCCCCCCTAC

TTGTTTTCAA

CATTTCAGTC

TCTTGATTCT

TATTGTCTAT

TTTGACTTTC

ATAGCAGTCT

TACTTGTCTT

AAAATTTATG

ATTCTGTAGT

CAAACTTTTC

TTTGCATGAA

GTTTATGTTT

TTTTGTTTTT

ACGTAGTTTA

TAACGTATCA

TTTGGTTTGC

TGAAACTTTA

TGCTTTTGGT

GTCAGCCAGC TCAAGGTCCC TCTTGGTCTG TTCT TTT CTT GATTTAATTC TAGATCTGTT CTGT TTT CAT GTGTGAAATC ACCGTGGAGA ATATGAAATG AATCTTTTT AATGATTTAT CACGTCCTGG, TCTTAGAAAT AGATCTGGAC CTGAGACATG TCTCTG GGTA AAATTTGCTT TACCTAATAC ATGAAAAAGT TTT GCAAATT AATTGGATTA GAAAATAATA GGATTCATGA AAAAGTCTAT ATGTTGACAA GTCAAGTTGC t'TATTCTTAG GTAATAAAAG ACGAAAGAAA AATCTCATTA ATAACTAGTA CACTATATGC CGCTTCTCTG ATAACGTAAC ACTGAATATT TTATGCAGAA AC 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1132 76 INFORMATION FOR SEQ ID 140:31: SEQUENCE CHARACTERISTICS: LENGTH: 1135 base pairs TYPE: nucleic acid STR.ANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: Genomic DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO.31;

TTATTAACGT

CCAT'rrCTTC

CTGTTCTATC

TGCATTAAAC

CTTTACCATT

ATTTGTCCGA

GGGTTGGTGG

TCCTATTCAA

GTACCTATTT

TTTGACCGAT

CTCACGTCAT

ATTCAGATGC

TACAI'rTT'

CTGTTCATT

GACTTGTCGT

AAGAGATGTG

TCGTTTATT

ACTATCCATI!

ATTAATTTGT

TAAATCTTCA

TCATTITTAC

TATCATTT

TACAGATCTG

AATCTGCTTA

ATACAAACTG

AGTTGAAAAA

AGTTATATAT

GTTGAATCTT

TCCTATTGGC

GCTTACAAAC

AATAGATTTG

TGTTTGT7TA

TAGCTTTTTG

CTI'TAACGTA

AGCTGTAGCG

CTTTC~rTG

TTTTTTGTGG

TGGTTTAATT

TCCCCCCCTA

GTTGTTTTCA

GCATTTCAGT

GTCTCGATTC

TATTGTATAT

TTI'GACTTCC

TCACCATAGC

TTIGTTTACTT

TGGGTAAAAT

TCTGGATTCT

TTTTCTTTGC

CATGAAGAAA.

TGTTTAAAAG

TTTCTCAA

GTTTAGTAAT

TATCAAATCT

TTTGCCACTA

TAGTCCATTT

AACTTTGAGT

CGTCAGCCAG

ATCTTGGTCT

CGATTTAATT

TCTGTITCA

ACCGTGGAGA

AATCGTTTT

AGTCTCACGT

TTGTT.TTAGA

TTATGTCTCT

GTATACATGA

AAATTAATTC

ATAATAGGAT

TCTATATGTT

GTTGCTTATT

AAAAGACGAA

CATTAATAAC

TATGCCGCTT

TTTGAAGCT

CTTTGCTTTT

CTCAAGGTCC

GTTCTTTTCT

CTAGATCTGT

TGTGTGAAAT.

ATATGAAATG

AATTATATAT

CCTGGTTTTA

TCTGGACCTG

GGGTAAAATT

AAAAGTTTCA

GATTAGATGC

TCATGATAGT

GACAATAGGG

CTTAGAGACA

AGAAATTGAT

TAGTAGTATT

CTCTCCTCTT

TTAATAACGT

GGTT-TATGCA

cT TTCTrCTT

TATCGCTTTT

TAMTATTTAT

CTGATGCTGT

TTGCATTTTC

ATTTTrTGAT

GAAATATCCT

AGACATGTAA

TGCTGAGAGA

TTGGCCTATG

TCCTTCATAG

AAAAAAATTG

TTGCTATCAA

TTGTGATTAT

ATCCACAAGA

CTCAACGCTA

TATCCCACGT

AACACTGAAT

GAAAC

120 180 240 300 360 420 460 540 600 660 720 780 840 900 960 -1020 1080 113 S Where the terms "comprise", "comprises", "comprised" or "comprising" are used in this specification, they are to be interpreted as specifying the presence of the stated features, integers, steps or components referred to, but not to preclude the presence or addition of one or more other feature, integer, step, component or group thereof.

Except for subject matter specifically claimed in patent application No. 80715/98, the invention is as defined in the claims and as described herein.

Claims (25)

1. 2. The nucleic acid fragment of claim 1, wherein said mutant desaturase gene encodes a microsomal gene product.
2. 3. The nucleic acid fragment of claim 1, wherein said mutant desaturase gene is from a Brassica napus plant.
3. 4. The nucleic acid fragment of claim 1, wherein said gene is the D form of a Brassicaceae microsomal gene.
4. 5. The nucleic acid fragment of claim 1, wherein said nucleic acid fragment is SEQ ID NO: 11.
5. 6. The isolated nucleic acid fragment of claim 1, said coding sequence encoding a polypeptide having the amino acid sequence of SEQ ID NO:12.
6. 7. A plant of the Brassicaceae or Helianthus families other than Brassica napus, said plant containing a full-length coding sequence of a delta-12 fatty acid desaturase gene, said coding sequence having at least one non-naturally occurring mutation in a region encoding a His-Glu-Cys-Gly-His amino acid motif, wherein said at least one mutation in said motif comprises a codon encoding Lys in place of a codon encoding Glu, and wherein said mutation confers an. atered fatty acid composition in seeds obtained from said plant. COMS ID No: SBMI-01454997 Received by IP Australia: Time 14:05 Date 2005-08-30 30/08 '05 14:02 FAX 61 3 9859 1588 CALLINAN LAWRIE MELB AUS PATENT OFFICE @1012 -78- 0
7. 8. The plant of claim 7, wherein said gene is from a Brassica napus plant. O
8. 9. The plant of claim 7, wherein said plant is a Brassica rapa plant.
9. 10. An isolated nucleic acid fragment comprising a full-length coding sequence Sof a Brassicaceae delta-15 fatty acid desaturase gene, said coding sequence having at n least one mutation in a region of said desaturase gene encoding a His-Asp-Cys-Gly- e His amino acid motif, wherein said at least one mutation in said motif comprises a codon encoding Lys in place of a codon encoding Asp, and wherein said at least one mutation renders the product of said desaturase gene non-functional. cl
10. 11. The nucleic acid fragment of claim 10, wherein said mutant desaturase gene is from a Brassica napus plant.
11. 12. A Brassicaceae plant containing a full-length coding sequence of a fatty acid desaturase gene, said coding sequence having at least one non-naturally occurring mutation in a region encoding a His-Asp-Cys-Gly-His amino acid motif wherein said at least one mutation in said motif comprises a codon encoding Lys in place of a codon encoding Asp, and wherein said mutation confers an altered fatty acid composition in seeds obtained from said plant cell.
12. 13. The plant of claim 12, wherein said mutant desaturase gene is from a Brassica napus plant,
13. 14. The plant of claim 12, wherein said plant is a Brassica napus plant A Brassicaceae plant containing: a full-length coding sequence of a delta-12 fatty acid desaturase gene, said coding sequence having at least one non-naturally occurring mutation in a region encoding a His-Glu-Cys-Gly-His amino acid motif, said at least one mutation in said motif comprising a codon encoding Lys in place of a codon encoding Glu; COMS ID No: SBMI-01454997 Received by IP Australia: Time 14:05 Date 2005-08-30 30/08 '05 14:02 FA4X 61 3 9859 1588 CALLINAN LAWRIE MELB AUS PATENT OFFICE io013 -79- 0 a full-length coding sequence of a delta-15 fatty acid desaturase gene Z having at least one mutation, said at least one delta-15 gene mutation in a region Sencoding a His-Xaa-Xaa-Xaa-His amino acid motif, said delta-12 gene mutation and C n said delta-15 gene mutation conferring an altered fatty acid composition in seeds obtained from said plant. Or3
14. 16. A method for producing a Brassicaceae or Helianthus plant line, comprising e the steps of: inducing mutagenesis in cells of a starting variety of a O 10 Brassicaceae or Helianthus species; obtaining one or more progeny plants from said cells; identifying at least one of said progeny plants that contains a delta-12 fatty acid desaturase gene having at least one mutation in a region encoding a His- Glu-Cys-Gly-His amino acid motif, wherein said at least one mutation in said motif comprises a codon encoding Lys in place of a codon encoding Glu, and wherein said delta-12 gene mutation renders the product of said delta-12 desaturase gene non- functional; and producing said plant line from said at least one progeny plant by self-or cross-pollination, said plant line having said at least one delta-12 gene mutation.
15. 17. The method of claim 16, wherein said plant line yields an oil having a stabilized linoleic acid content from about 2.0 to about 12.0
16. 18. The method of claim 16, further comprising the steps of: inducing mutagenesis in cells of said plant line; obtaining one or more progeny plants from said plant line cells; identifying at least one of said plant line progeny plants that contains a delta-15 fatty acid desaturase gene having at least one mutation in a region encoding a His-Xaa-Xaa-Xaa-His amino acid motif, wherein said delta-i gene mutation renders the product of said delta-15 desaturase gene non- functional; and COMS ID No: SBMI-01454997 Received by IP Australia: Time 14:05 Date 2005-08-30 30/08 '05 14:03 FAX 61 3 9859 1588 CALLINAN LAWRIE MELB AUS PATENT OFFICE 1 014 tO f) producing a second plant line from said at least one progeny plant by self-or cross-pollination, said second plant line having said at least one delta- S12 gene mutation and said at least one delta-15 gene mutation.
17. 19. The method of claim 16, wherein said starting variety is a Brassica Mn napus variety. tn e 20. The method of claim 16, further comprising the step of crossing a plant of C said plant line to a plant having a mutation in a different delta-12 fatty acid desaturase gene.
18. 21. The method of claim 20, wherein a second mutation is in a region other than a region encoding a His-Xaa-Xaa-Xaa-His amino acid motif.
19. 22. The method of claim 21, further comprising the steps of: inducing mutagenesis in cells of said plant line; obtaining one or more progeny plants from said plant line cells; identifying at least one of said plant line progeny plants that contains a second delta-12 fatty acid desaturase gene having at least one mutation, said second gene mutation in a region other than a region encoding a His-Xaa-Xaa-Xaa-His amino acid motif; and producing a second plant line from said at least one plant line progeny plant by self-or cross-pollination, said second plant line having said first and second delta-12 gene mutations.
20. 23. The method of claim 22, wherein said identifying step comprises a technique selected from the group consisting of: PCR, 3SR and direct polynucleotide sequencing.
21. 24. A method for producing a Brassicaceae plant line, comprising the steps of: COMS ID No: SBMI-01454997 Received by IP Australia: Time 14:05 Date 2005-08-30 30/08 '05 14:03 FAX 61 3 9859 1588 CALLINAN LAWRIE MELB AUS PATENT OFFICE o -81- O C',l- bJ) inducing mutagenesis in cells of a starting variety of a SBrassicaceae species; O obtaining one or more progeny plants from said cells; identifying at least one of said progeny plants that contains a fatty acid desaturase gene having at least one mutation, said at least one mutation in a C region encoding a His-Asp-Cys-Gly-His amino acid motif, wherein said at least one I mutation in said motif comprises a codon encoding Lys in place of a codon encoding eC Asp, and wherein said at least one mutation renders the product of said Sdesaturase gene non-functional; and O 10 producing said plant line from said at least one progeny plant by self- or cross-pollination, said plant line having said delta-15 gene mutation. The method of claim 24, wherein said identifying step comprises a technique selected from the group consisting of: PCR, 3SR and direct polynucleotide sequencing.
22. 26. A method for identifying a mutation in a Brassicaceae plant, comprising: providing a Brassicaceae plant having a decreased a-linolenic acid content as compared with a corresponding control Brassicaceae plant; and identifying at least one mutation in a delta-15 fatty acid desaturase gene of said plant, said at least one mutation in a region encoding a His-Asp-Cys- Gly-His amino acid motif, wherein said at least one mutation in said motif comprises a codon encoding Lys in place of a codon encoding Asp, and wherein said mutation renders the product of said delta-15 fatty acid desaturase gene non- functional.
23. 27. The method of claim 26, wherein said identifying step comprises a technique selected from the group consisting of: PCR., 3SR and direct polynucleotide sequencing.
24. 28. A method for identifying a mutation in a Brassicaceae or Helianthus plant, comprising: 015 COMS ID No: SBMI-01454997 Received by IP Australia: Time 14:05 Date 2005-08-30 30/08 '05 14:03 FAX 61 3 9859 1588 CALLINAN LAWRIE MELB AUS PATENT OFFICE S016
25. 82- 0 on providing a Brassicaceae or Helianthus plant having an increased Soleic acid content as compared with a corresponding control Brassicaceae or o Helianthus and plant; m identifying at least one mutation in a delta-12 fatty acid desaturase gene of said plant, said at least one mutation in a region encoding a His-Glu-Cys- 'G Oly-His amino acid motif, wherein said at least one mutation in said motif comprises a codon encoding Lys in place of a codon encoding Glu, and wherein said mutation 0 renders the product of said delta-12 fatty acid desaturase gene non-functional. o to 29. The method of claim 28, wherein said identifying step comprises a technique selected from the group consisting of: PCR, 3SR and direct polynucleotide sequencing. An isolated polypeptide having the amino acid sequence of SEQ ID NO:12. 31. An isolated polypeptide having the amino acid sequence of SEQ ID NO: 16. 32. The nucleic acid fragment of claim I or claim 10, the plant of claim 7 or claim 12 or the method of claim 24, substantially as hereinbefore described in any one of the Examples and/or drawings. DATED this 30h day of August, 2005 CARGILL, INCORPORATED By their Patent Attorneys: CALLINAN LAWRIE 9VQf COMS ID No: SBMI-01454997 Received by IP Australia: Time 14:05 Date 2005-08-30