MXPA97008493A

MXPA97008493A - Factor 15 of fibroblas growth

Info

Publication number: MXPA97008493A
Application number: MXPA/A/1997/008493A
Authority: MX
Inventors: A Rosen Craig; M Greene John
Original assignee: M Greene John; Human Genome Sciences Inc; A Rosen Craig
Filing date: 1997-11-04
Publication date: 1998-01-01

Abstract

A polypeptide of human fibroblast growth factor and DNA (RNA) encoding such a polypeptide is disclosed. A method for producing such polypeptide by recombinant techniques is also provided. Methods for using such polypeptides to stimulate revascularization, to treat wounds and to prevent neuronal damage are also described. Antagonists are also described against such polypeptides and their use as a therapeutic substance to prevent abnormal cell proliferation, hypervascular damage and proliferation of epithelial lens cells. Diagnostic methods are also described for detecting mutations in the coding sequence and alterations in the concentration of the polypeptides in a sample derived from a host.

Description

FACTOR 15 OE FIBROBLASTOS GROWTH DESCRIPTION DB IA INVENCTQW This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides and the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention has been putatively identified as a fibroblast growth factor / heparin binding growth factor, hereinafter referred to as "FGF-15". The invention also relates to the inhibition of the action of such polypeptides. Fibroblast growth factors are a family of proteins that are characteristic of heparin binding and therefore are also referred to as heparin-binding growth factors (HBGF). The expression of different amounts of these proteins are found in various tissues and are under particular temporal and spatial control. These proteins are powerful mitogens for various cells of mesodermal, ectodermal and endodermal origin, including fibroblasts, cornea and vascular endothelial cells, granulocytes, cortical cells REP: 25845 adrenal, chondrocytes, myoblasts, vascular smooth muscle cells, crystalline lens cells, melanocytes, keratinocytes, oligodendrocytes, astrocytes, osteoblasts and hematopoietic cells. Each member has functions overlapping with others and also has its own unique spectrum of functions. In addition to the ability to stimulate the proliferation of vascular endothelial cells, both FGF-1 and 2 are chemotactic for endothelial cells and it has been shown that FGF-2 is able to allow endothelial cells to penetrate the basement membrane. Consistent with these properties, both FGF-1 and 2 have the ability to stimulate angiogenesis. Another important feature of these growth factors is their ability to promote wound healing. Many other members of the FGF family share similar activities with FGF-1 and 2, such as angiogenesis and wound healing. It has been shown that several members of the FGF family induce the formation of mesoderm and modulate the differentiation of neuronal cells, adipocytes and skeletal muscle cells. In addition to these biological activities in normal tissues, FGF proteins have been indicated in the promotion of your origin in carcinomas and sarcoma by promoting the vascularization of tumors and as transforming proteins when their expression is deregulated. The FGF family currently consists of eight structurally related polypeptides: basic FGF, acid FGF, int 2, hst 1 / -FGF, FGF-5, FGF-6, keratinocyte growth factor, AIGF (FGF-8) and recently has shown that a glia activation factor is a novel heparin binding growth factor which has been purified from the culture supernatant of a human glioma cell line (Miyamoto, M. et al., Mol. and Cell. Biol., 13 (7): 4251-4259 (1993) The genes for each have been cloned and sequenced, and two of the members, FGF-1 and FGF-2, have been characterized under many names, but they are more commonly known as the growth factor of acidic and basic fibroblasts, respectively.The products of the normal gene influence the overall proliferation capacity of most of the mesoderm and cells derived from neuroectoderm.They are able to induce angiogenesis in vivo and can play important roles in the development the early (Burgess, .H. and Maciag, T., Annu. Rev. Biochem. , 58: 575-606, (1989)). Many of the members identified in the above of the FGF family also join the same receptors that induce a second message through these receptors.

A eukaryotic expression vector encoding a secreted form of FGF-1 has been introduced by gene transfer in porcine bacteria. This model defines the function of the gene in the arterial wall in vivo. The expression of FGF-1 induces thickening of the intima in porcine bacteria 21 days after the transfer of the gene (Nabel, E.G., et al., Nature, 362: 844-6 (1993)). It has been further demonstrated that the basic fibroblast growth factor can regulate the growth and progression of glioma independent of its role in tumor angiogenesis and that the release or secretion of the basic fibroblast growth factor may be required for these actions (Morrison , RS, et al., J. Neurosci. Res., 34: 502-9 (1993)). Fibroblast growth factors, such as basic FGF, have been further implicated in the growth of Kaposi's sarcoma cells in vitro (Huang, YQ et al., J. Clin. Invest., 91: 1191-7 (1993) ). In addition, the cDNA sequence encoding the human basic fibroblast growth factor has been cloned per tooth down from a transcription promoter recognized by the bacteriophage T7 RNA polymerase. The growth factors of basic fibroblasts obtained in this way have been shown to have biological activity that is not differentiable from human placental fibroblast growth factor in terms of mitogenicity, plasminogen activator synthesis and angiogenesis assays (Squires, CH, et al. al., J. Biol. Chem., 263: 16297-302 (1988)). U.S. Patent No. 5,155,214 describes growth factors of substantially pure mammalian basic fibroblasts and their production. The amino acid sequences of human basic fibroblast growth factor are described again, as well as the DNA sequences encoding the polypeptides of the bovine species. The newly discovered FGF-9 has approximately 30% sequence similarity to other members of the FGF family. Two cysteine residues and other consensus sequences in the family members are also conserved in the sequence of FGF-9. It has been found that FGF does not have a typical signal sequence in its N-terminal part as well as acidic and basic FGF. However, it has been found that FGF-9 is secreted from cells after synthesis despite its lack of a typical signal sequence for FGF (Miyamoto, M. et al., Mol. And Cell. Biol., 13 (7): 4251-4259 (1993) In addition it has been found that FGF-9 stimulates the cell growth of the progenitor cells of type 2 astrocytes of oligodendrocytes, BALB / c3T3 and PC-12 cells, but of endothelial cells of the vein human umbilical (Naruo, K., et al., J. Biol. Chem., 268: 2857-2864 (1993).) Basic FGF and acid FGF are powerful modulators of cell proliferation, cell motility, differentiation and survival and act on the cell types of ectoderm, mesoderm and endoderm.These two FGFs together with KGF and AIGF have been identified by protein purification.However, the other four members are isolated as oncogenes, the expression of which embryogenesis is restricted and certain types of cancers, it has been shown that FGF -9 is a mitogen against glia cells. Members of the FGF family have been reported to have oncogenic potency. The transforming potency of FGF-9 has been demonstrated when transformed into BALB / c3T3 cells (Miyamoto, M. et al., Mol Cell. Biol., 13 (7): 4251-4259 (1993). induced by androgens (AIGF), also known as FGF-8, has been purified from a conditioned medium of mouse mammary carcinoma cells (SC-3) stimulated with testosterone. AIGF is different from the growth factor similar to FGF, has a putative signal peptide and shares 30-40% homology with known members of the FGF family. Mammalian cells transformed with AIGF show a remarkable stimulatory effect on the growth of SC-3 cells in the absence of androgen. Therefore, AIGF mediates the growth of SC-3 cells induced by androgens, and possibly other cells, since it is secreted by the tumor cells themselves. The polypeptide of the present invention has been putatively identified as a member of the FGF family as a result of the homology of the amino acid sequence with other members of the FGF family. In accordance with one aspect of the present invention, novel mature polypeptides as well as biologically active fragments and useful in diagnosis or therapy, analogs and derivatives thereof are provided. The polypeptides of the present invention are of human origin. In accordance with another aspect of the present invention, isolated nucleic acid molecules encoding polypeptides of the present invention are provided, including mRNA, DNA, cDNA, genomic DNA, as well as antisense analogs thereof and biologically active and useful fragments. in terms of diagnosis or treatment of them. According to yet another aspect of the present invention, processes are provided for producing such polypeptides by recombinant techniques by the use of recombinant vectors, such as cloning and expression plasmids useful as reagents in the recombinant production of the polypeptides of the present invention. , as well as recombinant prokaryotic and / or eukaryotic host cells comprising a nucleic acid sequence encoding a polypeptide of the present invention. According to a further aspect of the present invention, there is provided a process for using such polypeptides, or polynucleotides encoding such polypeptides, to perform tests in search of agonists and antagonists therefor and for therapeutic purposes, for example, to promote the healing of wounds, for example, as a result of burns and ulcers, to prevent neuronal damage due to neuronal disorders and to promote neuronal growth and prevent skin aging and hair loss, to stimulate angiogenesis, mesodermal induction in embryos early and regeneration of limbs. In accordance with a further aspect of the present invention, antibodies against such polypeptides are provided. According to yet another aspect of the present invention, antagonists are provided against such polypeptides and processes for their use to inhibit the action of such polypeptides, for example, in the treatment of cellular transformation, e.g., tumors, to reduce scarring and treat hypervascular diseases. According to another aspect of the present invention, nucleic acid probes are provided which comprise nucleic acid molecules of sufficient length to hybridize specifically with a polynucleotide that codes for a polypeptide of the present invention. According to a further aspect of the present invention, diagnostic assays are provided to determine diseases or susceptibility to diseases related to mutations in a nucleic acid sequence of the present invention and to detect overexpression of the polypeptides encoded by such sequences. According to another aspect of the present invention, there is provided a process for providing such polypeptides, or polynucleotides encoding such polypeptides, for in vitro purposes related to scientific research, DNA synthesis and manufacture of DNA vectors.

These and other aspects of the present invention will be apparent to those familiar with the art from the teachings herein. The following drawings are only illustrations of specific embodiments of the present invention and do not signify limitations in any way. Figure 1 shows a corresponding cDNA sequence and deduced amino acid sequence of FGF-15. Figure 2 illustrates the homology of the amino acid sequence between FGF-15 and other members of the FGF family. The conserved amino acids are easily discernible. According to another aspect of the present invention, isolated nucleic acid molecules (polynucleotides) are provided which code for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NOS .: 2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC, deposit No. 97146 on May 12, 1995. The polynucleotide encoding FGF-15 of this invention was initially discovered in a library of CDNA derived from human adrenal tumor tissue. It is structurally related to all members of the fibroblast growth factor family and contains an open reading frame encoding a 252 amino acid polypeptide. Among the major coincidences are: 1) 41% identity and 66% sequence similarity with human FGF-9 over a sequence of 129 amino acids; and 2) 37% identity and 59% similarity to human KGF over a region of 88 amino acids. The signature of the FGF / HBGF family, GXLX (S, T, A, G) X6 (D, E) CXFXE is conserved in the polypeptide of the present invention (X means any amino acid residue, (D, E) means any of residues B or E; X6 means any of 6 amino acid residues). The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA and synthetic DNA. DNA can be double-stranded or single-stranded. The coding sequence which codes for the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID NO: 1) or the deposited clone or may be a different encoded sequence, as a result of redundancy or degeneracy of the genetic code, which codes for the same mature polypeptide as the DNA of Figure 1 (SEQ ID NO: 1) or of the deposited cDNA. The polynucleotides which encode the mature polypeptide of Figure 1 (SEQ ID NO: 2) or for the mature polypeptides encoded by the deposited cDNAs may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and the additional coding sequence such as a leader or leader sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally the additional coding sequence), and the non-coding sequence, such as introns or non-coding sequence 5 'and / or 3' to the coding sequence for the mature polypeptide. Therefore, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only the coding sequence for the polypeptide as well as a polynucleotide which includes an additional coding and / or non-coding sequence. The present invention further relates to variants of the polynucleotides described above which encode fragments, analogs and derivatives of the polypeptides having an amino acid sequence deduced from Figure 1 (SEQ ID NO: 2) or for the polypeptides encoded by the cDNAs of the deposited clones. The polynucleotide variants can be a naturally occurring allelic variant of the polynucleotide or a variant that does not naturally represent the polynucleotide.

Therefore, the present invention includes polynucleotides that encode the same mature polypeptide that is presented in Figure 1 (SEQ ID NO: 2) or the same mature polypeptides encoded by the cDNAs of the deposited clones as well as variants of such polynucleotides, variants which code for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO: 2), or for the polypeptides encoded by the cDNAs of the deposited clones. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants. As indicated in the above, the polynucleotide can have a coding sequence which is an allelic variant that occurs naturally of the coding sequence shown in Figure 1 (SEQ ID NO: 1), or of the coding sequence of the deposited clones. As is known in the art, an allelic variant is an alternative form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which do not substantially alter the function of the encoded polypeptides. The present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptides can be fused in the same reading frame to a polynucleotide sequence which assists in the expression and secretion of a polypeptide from a host cell, for example , a leader sequence which functions as a secretory sequence to control the transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader sequence released by the host cell to produce the mature form of the polypeptide. The polynucleotides can also code for a proprotein which is the mature protein plus additional 5 'amino acid residues. A mature protein that has a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is separated, the active mature protein remains. Thus, for example, the polynucleotides of the present invention may code for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence). The polynucleotides of the present invention may also have a coding sequence fused in frame to a marker sequence which allows purification of the polypeptide of the present invention. The marker sequence may be a hexahistidine tag supplied by a pQE-9 vector to provide for the purification of the mature fused label polypeptide in the case of a bacterial host or, for example, the marker sequence may be a brand of haemagglutinin (HA) when used a mammalian host, e.g., COS-7 cells. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (ilson, I., et al., Cell, 37: 767 (1984)). The term "gene" means the segment of DNA involved in the production of a polypeptide chain; it includes regions preceding and following the coding region (leader and subsequent) as well as intervening sequences (introns) between individual coding segments (exons). The full-length fragments of the gene for FGF-15 can be used as a hybridization probe for a cDNA library to isolate the full-length gene and to isolate other genes which have high sequence similarity to the gene or similar biological activity. Probes of this type preferably have at least 30 bases which may contain, for example, 50 or more bases. The probe can also be used to identify a cDNA clone that corresponds to a full-length transcript and a genomic clone or clones containing the complete FGF-15 gene that includes promoter regulatory regions, exons, and introns. An example of an examination comprises the isolation of a coding region of the gene for FGF-15 by using a known DNA sequence to synthesize an oligonucleotide probe. The labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to examine a library of human cDNA, genomic DNA or mRNA to determine which members of the library hybridize the probe. The present invention also relates to polynucleotides which hybridize to the sequence described in the above if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequences . The present invention relates particularly to polynucleotides which are used under restriction conditions for the polynucleotides described in the foregoing. As used herein, the term "restriction conditions" means that the hybridization will occur only if there is at least 95%, and preferably at least 97% identity between the sequences. The polynucleotides which hybridize with the polynucleotides described above in a preferred embodiment code for polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SEQ ID NO. : 1) or the deposited cDNAs. Alternatively, the polynucleotide may have at least 20 bases, preferably 30 bases, and more preferably at least 50 bases which hybridize with a polynucleotide of the present invention, and which have an identity therewith. , as described in the foregoing, and which may or may not retain activity. For example, such polynucleotides can be used as probes for the polynucleotide of SEQ. FROM IDENT. DO NOT. : 1, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer or primer. Therefore, the present invention is directed to polynucleotides having at least 70% identity, preferably at least 90% and more preferably at least 95% identity with a polynucleotide which encodes the polypeptide of the SEC. FROM IDENT. NO .: 2, as well as fragments thereof, fragments which have at least 30 bases and more preferably at least 50 bases, and with polypeptides encoded by such polynucleotides. The deposits referred to herein will remain under the Budapest Treaty with respect to the international recognition of the Microorganisms Deposit for purposes of patent procedure. These deposits are provided solely for convenience and are not an admission that the deposit is required under 35 U.S.C. § 112. The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded herein are hereby incorporated by reference and are controlled in the event of any conflict with the description or sequences in the I presented. A permit may be required to use or sell the deposited materials, and this permission is not granted. The present invention further relates to a FGF polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID NO: 2) or which has the amino acid sequence encoded by the deposited cDNA., as well as fragments, analogues and derivatives of such polypeptides. The terms "fragment", "derivative" and "analogs", when referring to the polypeptide of Figure 1 (SEQ ID NO: 2) or to those qualified by the deposited ANDc, mean polypeptides which essentially retain the same biological function or activity as such polypeptides. Therefore, an analog includes a proprotein which can be activated by separation of the proprotein portion to produce a mature active polypeptide. The polypeptides of the present invention can be recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides. The fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO: 2) or that encoded by the deposited cDNAs can be (i) one in which one or more of the amino acid residues are substituted with residues conserved or non-conserved amino acids (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be encoded by the genetic code, or (ii) one in which one or more amino acid residues include a substituent group, or (iii) ) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (eg, polyethylene glycol), or (iv) one in which additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is used for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and the like are considered within the scope by those familiar with the art of the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an inflated form and preferably are purified to homogeneity. The term "isolated" means that the material is separated from its original environment (for example, the natural environment if they occur naturally). For example, a polynucleotide that occurs naturally or polypeptide present in a living animal is not isolated, but the same polynucleotide or DNA or polypeptide, separated from part or all of the materials coexisting in the natural system, is isolated. Such a polynucleotide can be part of a vector and / or such a polynucleotide or polypeptide can be part of a composition, and still be isolated insofar as the vector or composition is not part of its natural environment. The polypeptides of the present invention include the polypeptide of SEQ. FROM IDENT. DO NOT. : 2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of SEQ. FROM IDENT. DO NOT. : 2 and more preferably at least 90% similarity (more preferably at least 90% identity) to the SEC polypeptide. FROM IDENT. NO .: 2, and still more preferably at least 95% similarity (most preferably 95% identity) to the SEC polypeptide. FROM IDENT. DO NOT . : 2, and also includes portions of such polypeptides when such a portion of the polypeptide generally contains at least 30 amino acids, and more preferably at least 50 amino acids. As is known in the art, "similarity" between two polypeptides is determined by comparing the amino acid sequence and its amino acid substitutes conserved in a polypeptide, in the sequence of a second polypeptide. The fragments or portions of the polypeptides of the present invention can be used to produce the complex length polypeptide by peptide synthesis; therefore, the fragments can be used as intermediates to produce the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention can be used to synthesize full-length polynucleotides of the present invention. The present invention also relates to vectors which include polynucleotides of the present invention, host cells which have been engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.

The host cells can be engineered (transduced or transformed or transfected) with the vectors of this invention which can be, for example, a cloning vector or an expression vector. The vector can be, for example, in the form of a plasmid, a viral particle, a phage, etc. Engineered host cells can be cultured in a modified conventional nutrient medium as appropriate to activate promoters, select transformants or amplify the genes for FGF. The culture conditions, such as temperature, pH and the like are those previously used with the host cell selected for expression, and will be apparent to a person usually familiar with the art. The polynucleotide of the present invention can be used to produce a polypeptide by recombinant techniques. Thus, for example, the polynucleotide sequence can be included in any of a variety of expression vehicles, in particular vectors or plasmids to express a polypeptide. Such vectors include chromosomal, non-chromosomal and synthetic DNA sequences, for example, SV40 derivatives; bacterial plasmids; Phage DNA; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, variola virus and pseudorabies. Nevertheless, any other vector or plasmid can be used insofar as it is replicable and viable in the host. The appropriate DNA sequence can be inserted into the vector by various methods. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site by methods known in the art. Such procedures and others are considered within the reach of those familiar with the art. The DNA sequence in the expression vector is operably linked to appropriate expression control sequences (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoters, the lac or trp promoter of E. coli, the PL phage lambda promoter and other known promoters for controlling the expression of genes in prokaryotic or eukaryotic cells or in their virus. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include sequences appropriate for expression amplification. In addition, the expression vectors preferably contain a gene to provide a phenotypic trait for selection of transformed host cells such as reductase dihydrofolate or neomycin resistance for a culture of eukaryotic cells, or such as resistance to tetracycline or ampicillin in E coli. The vector containing the appropriate DNA sequence as described hereinbefore, as well as an appropriate promoter or control sequence can be used to transform an appropriate host to allow the host to express the protein. Representative examples of appropriate hosts may be mentioned: bacterial cells such as E. coli. salmonella. t.yphimurium, StreptQmyces; fungal cells such as yeast; insect cells such as Drosophila £. and Spodoptera Sf9: animal cells such as CHO, COS, or Bowes melanoma; adenovirus, plant cells, etc. The selection of an appropriate host is considered to be within the reach of those familiar with the technique from the teachings herein. More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described in the foregoing. The constructs comprise a vector, such as a plasmid or viral vector, in which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct additionally comprises regulatory sequences that include, for example, a promoter operably linked to the sequence. Large amounts of suitable vectors and promoters are known to those familiar with the art, and are commercially available. The following vectors are provided by way of example. Bacterials: pQE70, pQE60, pQE-9 (Qiagen), pBS, phagescript, psiX174, pBluescript, SK, pBsKS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene); pTRC99A, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLneo, pSV2cat, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector can be used to the extent that it is replicable and viable in the host. Promoter regions can be selected from any desired gene using CAT vectors (chloramphenicol transferase) or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. The particular bacterial promoters mentioned include lacl, lacZ, T3, T7, gpt, PR lambda, PL and trp. Eukaryotic promoters include the CMV immediate early promoter, HSV thymidine kinase, early and late SV40, retrovirus LTR, and mouse metallothionein I. The selection of the appropriate vector and promoter is within the level of a person usually familiar with the art.

In a further embodiment, the present invention relates to host cells that contain the construct described above. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell such as a bacterial cell. The introduction of the construct into the host cell can be carried out by calcium phosphate transfection, DEAE-Dextran-mediated transfection or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, 1986)). The constructs in the host cells can be used in a conventional manner to produce the gene product encoded with the recombinant sequence. Alternatively, the polypeptides of the invention can be produced synthetically by conventional peptide synthesizers. Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be used to produce such proteins using RNA derived from the DNA construct of the present invention. Suitable cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, (Cold Spring Harbor, NY, 1989) the description of which is incorporated in the present as a reference. The transcription of a DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an elongation or enhancer sequence into the vector. The extenders are elements that act on the DNA, usually about 10 to 300 bp, that act on a promoter to increase its transcription. Examples include the SV40 extender on the late side of the replication origin (bp 100 to 270), an early cytomegalovirus promoter extender, a polyoma extender on the late side of the replication origin, and adenovirus extenders. Generally, recombinant expression vectors will include origins of replication and selectable markers that allow the transformation of the host cell, for example, the gene for ampicillin resistance of E. coli and the TRP1 gene of S. cerevisiae and a promoter derived from a highly expressed gene to direct the transcription of a downstream structural sequence. Such promoters can be derived from operons that code for glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), o-factor, acid phosphatase or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation, initiation and termination sequences, and preferably, a leader sequence capable of directing the secretion of the translated protein in the periplasmic space or in the extracellular medium. Optionally, the heterologous sequence can encode a fusion protein that includes an N-terminal identification peptide that imparts the desired characteristics, for example, stabilization or simplified purification of the expressed recombinant product. Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding the desired protein together with suitable translation, initiation and termination signals in operable reading phase with a functional producer. The vector will comprise one or more selectable phenotypic markers and an origin of replication to ensure maintenance of the vector and to provide, if desired, amplification within the host. Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may be used, as desired.

As a representative but not limiting example, expression vectors useful for bacterial use may comprise a selectable marker and a bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well-known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example, pKK223-3 (Pharamcia Fine Chemicals, Uppsala, Sweden) and GEMI (Promega Biotec, Madison, Wl, United States of America). These "main structure" sections of pBR322 are combined with an appropriate promoter and the structural sequence to be expressed. After transformation of an appropriate host strain and growth of the host strain to an appropriate cell density, the selected promoter is derepressed by appropriate means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period. The cells are typically harvested by centrifugation, broken by physical or chemical means and the resulting crude extract is retained for further purification. The microbial cells used in the expression of proteins can be broken by any convenient method that includes cycles of freezing-reheating, sonication, mechanical disruption or use of cellular usable agents. Various mammalian cell culture systems can also be used to express the recombinant protein. Examples of mammalian expression systems include COS-7 monkey kidney fibroblast lines, described by Gluzman, Cell, 23: 175 (1981), and other cell lines capable of expressing a compatible vector, e.g. cellular C127, 3T3, CHO, HeLa and BHK. The mammalian expression vectors will comprise a suitable origin of replication, a promoter and extender, and also, if necessary, ribosome binding sites, polyadenylation sites, donor and splice acceptor sites, transcriptional termination sequences. and 5 'non-transcribed sequences. DNA sequences derived from the SV40 viral genome, for example, the SV40 origin, the early promoter, the extender, the splice and the polyadenylation sites can be used to provide the required non-transcribed genetic elements. The polypeptide of the present invention can be recovered and purified from recombinant cell cultures by methods used hitherto, including ammonium sulfate or ethanol precipitation, acid extraction, ion exchange or cation chromatography, phosphocellulose chromatography, hydrophobic interaction, affinity chromatography, hydroxyapatite chromatography and lectin chromatography. Renaturation or protein refolding steps may be used, as necessary, to complete the mature protein configuration. Finally, high-performance liquid chromatography (CLAP) can be used for the final purification steps. The polypeptide of the present invention can be a naturally purified product, or a product of synthetic chemical processes, or it can be produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast cells, of higher plants, insects and mammals in culture). Based on the host used in a recombinant production method, the polypeptides of the present invention may be glycosylated with mammalian carbohydrates or other eukaryote carbohydrates or may not be glycosylated. The polypeptides of the invention also include an initial methionine amino acid residue. The polypeptide of the present invention, as a result of the ability to stimulate the growth of vascular endothelial cells, can be used in treatment to stimulate revascularization of ischemic tissues due to various morbid conditions such as thrombosis., arteriosclerosis and other cardiovascular conditions. This polypeptide can also be used to stimulate angiogenesis and limb regeneration. The polypeptide can also be used to treat wounds due to damage, burns, repair of postoperative tissue and ulcers since it is mitogenic for various cells of different origins, such as fibroblast cells and skeletal muscle cells, and therefore facilitates repair or replacement of damaged or diseased tissue. The polypeptide of the present invention can also be used to stimulate neuronal growth and to treat and prevent neuronal damage which occurs in certain neuronal disorders or neurodegenerative conditions such as Alzheimer's disease, Parkinson's disease and AIDS-related complex. FGF-15 has the ability to stimulate the growth of chondrocytes, therefore, it can be used to improve bone and periodontal regeneration and to aid in tissue transplants or bone grafts. The polypeptide of the present invention can also be used to prevent skin aging due to sunburn by stimulating the growth of keratinocytes. The FGF-15 polypeptide can also be used to prevent hair loss, since members of the FGF family activate hair-forming cells and promote the growth of melanocytes. On these same lines, the polypeptides of the present invention can be used to stimulate the growth and differentiation of hematopoietic cells and bone marrow cells when used in combination with other cytokines. The FGF-15 polypeptide can also be used to maintain organs before transplantation or to support cell culture of primary tissues. The polypeptide of the present invention can also be used to induce tissue of mesodermal origin for differentiation in early embryos. According to a further aspect of the present invention, there is provided a process for using such polypeptides, or polynucleotides encoding such polypeptides, for in vi tro purposes related to scientific research, DNA synthesis, manufacture of DNA vectors and with the purpose of providing diagnostic and therapeutic elements for the treatment of human diseases.

This invention provides a method for identification of the receptors for the polypeptides of the present invention. The genes encoding the receptor can be identified by numerous methods known to those familiar with the art, for example, panning of ligand and FACS classification (Coligan, et al., Current Protocols in Immun., 1 (2), Chapter 5, (1991)). Preferably, expression cloning will be used when the polyadenylated RNA is prepared from a cell sensitive to the polypeptides, for example, NIH3T3 cells which are known to contain multiple receptors for the FGF family proteins, and SC- cells. 3, and a cDNA library is produced from this RNA and divided into pools and used to transfect COS cells or other cells that are not sensitive to the polypeptides. Transfected cells which are grown on glass plates are exposed to the polypeptide of the present invention, after they have been labeled. The polypeptides can be labeled by various means including iodination or inclusion of a recognition site for a site-specific protein kinase. After fixation and incubation, the plates are subjected to autoradiographic analysis. Positive accumulations are identified and repaired under-accumulated and re-transfected using an interactive process of under-accumulation and reexamination, which ultimately provides unique clones that encode the putative receptor. As an alternative approach for receptor identification, the tagged polypeptides may be photoaffinity bound with cell membrane or extract preparation expressing the receptor molecule. The cross-linked material is separated by PAGE analysis and exposed to X-ray film. The labeled complex containing the polypeptide receptors can be cut, separated into peptide fragments and subjected to protein microsequencing. The amino acid sequence obtained by the micro-sequencing can be used to design a set of degenerate oligonucleotide probes to examine a cDNA library to identify the genes encoding the putative receptors. This invention provides a method for screening compounds to identify those which regulate the action of the polypeptide of the present invention. An example of such an assay comprises combining a mammalian fibroblast cell, the polypeptide of the present invention, the compound to be examined and 3 [H] -thymidine under cell culture conditions wherein the fibroblast cells would normally proliferate. A control assay can be carried out in the absence of compound to be examined and can be compared to the amount of proliferation of fibroblasts in the presence of the compound to determine whether the compound stimulates proliferation by determining the uptake of 3 [H] -thymidine in each case. The amount of proliferation of fibroblast cells is measured by liquid chilling chromatography which measures the incorporation of 3 [H] -thymidine. By this method both agonist and antagonist compounds can be identified. In another method, a mammalian cell or membrane preparation that expresses a receptor for a polypeptide of the present invention is incubated with a labeled polypeptide of the present invention in the presence of the compound. The ability of the compound to improve or block this interaction can then be measured. Alternatively, the response of a known second messenger system following the interaction of a compound to be examined and the FGF-15 receptor is measured, and the ability of the compound to bind to the receptor and induce the response of the receptor is measured. second messenger to determine if the compound is a potential agonist or antagonist. Such second messenger systems, include but are not limited to cAMP guanylate kinase, ion channels or hydrolysis of phosphoinositide. Examples of antagonist compounds include antibodies, or in some cases oligonucleotides, which bind to the repellant for the polypeptide of the present invention but do not induce a second messenger response or bind to the FGF-15 polypeptide itself. Alternatively, a potential antagonist may be a mutant form of the polypeptide which binds to the receptors, however, a second messenger response is not induced, and therefore, the action of the polypeptide is effectively blocked. Another gene antagonist compound for FGF-15 and the gene product is a separate antisense construct using antisense technology. The antisense technology can be used to control the expression of the gene by triple helix formation or DNA or antisense RNA, both methods which are based on the binding of a polynucleotide to DNA or RNA. For example, the 5 'coding portion of the polynucleotide sequence, which codes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix - see Lee et al., Nucí.

Acids Res., 6: 3073 (1979); Cooney et al. , Science, 241: 456 (1988); and Dervan et al., Science, 251: 1360 (1991)), whereby transcription and production of the polypeptides of the present invention are avoided. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks the translation of the mRNA molecule into the polypeptide (Antisense-Okano, J. Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Ratón, FL (1988)). The oligonucleotides described above can also be delivered to cells so that the antisense RNA or DNA can be expressed in vivo to inhibit the production of the polypeptide. Potential antagonist compounds may also include small molecules which bind to and copy the receptor binding site to thereby render the receptor inaccessible to their polypeptide so that normal biological activity is avoided. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules. Antagonist compounds can be used to inhibit the growth and cell proliferation effects of the polypeptides of the present invention in neoplastic cells and tissues, i.e., the stimulation of tumor angiogenesis, and therefore, the retardation or prevention of growth and proliferation. abnormal cellular, for example, in the formation or growth of tumors.

Antagonists can also be used to prevent hypervascular diseases and prevent the proliferation of lens-like hepitelial cells after extracapsular cataract surgery. The prevention of mitogenic activity of the polypeptides of the present invention may also be desirable in cases such as restenosis after balloon angioplasty. Antagonists can also be used to prevent the growth of scar tissue during wound healing. Antagonists can be used in a composition with a pharmaceutically acceptable carrier, for example, as described in the following. The polypeptides, agonists and antagonists of the present invention can be used in combination with a suitable pharmaceutical carrier to comprise a pharmaceutical composition for parenteral administration. Such compositions comprise a therapeutically effective amount of the polypeptide, agonist or antagonist and a pharmaceutically acceptable carrier or excipient. Such a carrier includes, but is not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation must adapt to the mode of administration.

The invention also provides a pharmaceutical package or kit (kit) comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such containers may be a note in the form prescribed by a governmental agency that regulates the manufacture, use or sale of pharmaceutical or biological products, note which reflects the approval of the agency for the manufacture, use or sale for administration in humans . In addition, the polypeptides, agonists and antagonists of the present invention can be used in conjunction with other therapeutic compounds. The pharmaceutical compositions can be administered in a convenient manner such as orally, topically, intravenously, intraperitoneally, intramuscularly, subcutaneously, intranasally or intradermally. The pharmaceutical compositions are administered in an amount which is effective for treatment and / or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 μg / kg of body weight, and in most cases, they will be administered in an amount not to exceed about 8 mg / kg of body weight per day. In most cases, the dosage will be between approximately 10 μg / kg to approximately 1 mg / kg of body weight daily, considering the routes of administration, symptoms, etc. In the specific case of topical administration, dosages will preferably be administered from about 0.1 μg to 9 mg per cm2. The polypeptide of the invention and the agonist and antagonist compounds which are polypeptides, can also be used according to the present invention by expression of such a polypeptide in vivo, which is often referred to as "gene therapy". Thus, for example, the cells can be engineered with a polynucleotide (DNA or RNA) that codes for the polypeptide ex vivo, the engineered cells are then provided to a patient to be treated with the polypeptide. Such methods are well known in the art. For example, cells can be engineered by methods known in the art by the use of a retroviral particle containing RNA encoding the polypeptide of the present invention. Similarly, the cells can be engineered in vivo for expression of the vivo polypeptide, for example, by methods known in the art. As is known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention.

It can be administered to a patient for cells undergoing in vivo engineering and expression of the polypeptide in vivo. This and other methods for administering a polypeptide of the present invention by such methods will be apparent to those familiar with the art from the teachings of the present invention. For example, the expression vehicle for engineered cells can be different from that of retroviral particles, for example, an adenovirus, which can be used to engineer cells in vivo after combination with a suitable delivery vehicle. Retroviruses from which retroviral plasmid vectors mentioned in the foregoing may be derived include, but are not limited to, Moloney mouse leukemia virus, vessel necrosis virus, retroviruses such as Rous sarcoma virus, sarcoma virus Harvey, avian leukosis virus, gibbon monkey leukemia virus, human immunodeficiency virus, adenovirus, myeloproliferative sarcoma virus and mammary tumor virus. In one embodiment, the retroviral plasmid vector is supplied from the Moloney mouse leukemia virus. The vector includes one or more promoters. Suitable promoters which may be used include, but are not limited to retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller et al., Biotechniqnes. Vol. 7, No. 9, 980-990 (1989), or any other promoter (eg, cellular promoters such as eukaryotic cell promoters including, but not limited to, histone, pol III, and β-actin promoters) . Other viral promoters which may be used include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters and parvovirus B19 promoters. The selection of a suitable promoter will be apparent to those familiar with the art from the teachings contained herein. The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter. Suitable promoters which may be used include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters such as the herpes simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs described above); the β-actin promoter; and the promoters of human growth hormone. The promoter can also be a native promoter which controls the gene encoding the polypeptide. The retroviral plasmid vector is used to transduce packed cell lines to form producer cell lines. Examples of packed cells which can be transfected include, but are not limited to, cell lines PE501, PA317,? -2,? -AM, PA12, T19-14X, VT-19-17-H2,? CRE,? CRIP, GP + E-86, GP + envAml2, and DAN, as described in Miller, Human Gene Thgrapy. Vol. 1, pages 5-14 (1990), which is incorporated herein by reference in its entirety. The vector can transduce the packed cells by any means known in the art. Such means include, but are not limited to electroporation, the use of liposomes and precipitation with CaP04. In an alternative, the retroviral plasmid vector can be encapsulated in a liposome or coupled to a lipid, and then administered to a host. The producer cell line generates infectious retroviral vectors which include the sequence or nucleic acid sequences encoding the polypeptides. The retroviral vector particles can then be used to transduce aukaryotic cells, either in vi tro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequences encoding the polypeptide. Eukaryotic cells which can be transduced include, but are not limited to embryonic pluripotent cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells and bronchial hepitelial cells. This invention is also related to the use of genes of the present invention as part of a diagnostic assay for detecting diseases or susceptibility to diseases related to the presence of mutations in the nucleic acid sequence encoding the polypeptide of the present invention. Individuals that present mutation in a gene of the present invention can detect DNA level by various techniques. Nucleic acids for diagnostics can be obtained from patient cells such as blood, urine, saliva, tissue biopsy and autopsy material. Genomic DNA can be used directly for detection or can be amplified enzymatically by using PCR (Saiki et al., Nature, 324: 163-166 (1986)) before analysis. RNA or cDNA can also be used for the same purpose. As an example, PCR primers or primers complementary to the nucleic acid encoding a polypeptide of the present invention can be used to identify and analyze mutations. For example, deletions and insertions can be detected by changing the size of the amplified product compared to the normal genotype. Known mutations can be identified by DNA amplified by hybridization to radiolabeled RNA, or alternatively, with radiolabelled antisense DNA sequences. The perfectly varied sequences can be differentiated from the mismatched duplexes by digestion with RNase A or by differences in denaturation temperatures. Genetic tests based on differences in the DNA sequence can be carried out by detecting alteration in the electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small deletions and insertions in the sequence can be visualized by high resolution gel electrophoresis. DNA fragments of different sequence can be differentiated by denaturing bound gradient gels in which the mobilities of different DNA fragments are delayed in the gel at different positions, according to their denaturation or specific partial denaturation temperatures ( see, for example, Myers et al., Science, 230: 1242 (1985)). Sequence changes at specific positions can also be shown by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (eg, Cotton et al., PNAS, United States of America, 85: 4397-4401 (1985)). Therefore, the detection of a specific DNA sequence can be carried out by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes (for example, polymorphisms of restriction fragment (RFLP)) and Southern blot of genomic DNA. In addition to gel electrophoresis and more conventional DNA sequencing, mutations can also be detected by in situ analysis. The present invention also relates to a diagnostic assay for detecting altered concentrations of FGF-15 proteins in various tissues since an overexpression of the proteins compared to normal control tissue samples can detect the presence of abnormal cell proliferation, for example , A tumor. Assays used to detect protein concentrations in a sample derived from a host are well known to those familiar with the art and include radioimmunoassays, competitive binding assays, Western blot analysis, ELISA assays and "sandwich" assays. An ELISA assay (Coligan, et al., Current Protocols in immunology, 1 (2), chapter 6, (1991)) initially comprises preparing an antibody specific for an antigen for the polypeptides of the present invention, preferably a monoclonal antibody . In addition, an indicator antibody against the monoclonal antibody is prepared. The indicator antibody is attached to a detectable reagent such as radioactivity, fluorescence or, in this example, a horseradish peroxidase enzyme. A sample of a host is removed and incubated on a solid support, for example, a polystyrene container, which binds the proteins in the sample. Any free protein binding site in the container after coating by incubating it with a non-specific protein such as bovine serum albumin. Then, the monoclonal antibody incubates in the container for a time in which the monoclonal antibodies bind to any polypeptide of the present invention attached to the polystyrene container. Any unbound monoclonal antibody is removed by washing with buffer. The indicator antibody bound to horseradish peroxidase is now placed in the recipient resulting in the binding of the reporter antibody to any monoclonal antibody bound to the protein of interest. The unbound reporter antibody is removed by washing. The peroxidase substrates are then added to the container and the amount of color developed in a given period of time is a measurement of the amount of a polypeptide of the present invention that is in a given volume of patient sample when compared to a standard curve. A competition assay can be used in which antibodies specific for a polypeptide of the present invention are bound to a solid support and FGF-13 and a sample derived from the host are passed over the solid support and the amount of label detected, for example, by liquid chilling chromatography, it can be correlated with an amount of a polypeptide of the present invention in the sample. An "interposition" (sandwich) test is similar to an ELISA assay. In an "interposition" assay, a polypeptide of the present invention is passed on a solid support and bound to an antibody bound to the solid support. A second antibody is then attached to the polypeptide of interest. A third antibody, which is labeled and is specific for the second antibody, is subsequently passed over the solid support and is bound to the second antibody and the amount can then be quantified. The sequences of the present invention are also valuable for identification of chromosomes. The sequence is especially targeted and can hybridize to any particular position on an individual human chromosome. further, currently there is a need to identify particular sites in the chromosomes. Some chromosome marker reagents based on current sequence data (repeat polymorphism) are currently available for chromosomal labeling. The mapping of DNA to chromosomes according to the present invention is an important first step to correlate those sequences with genes associated with the disease. Briefly, the sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from cDNA. Computer analysis of the 3 'untranslated region is used to quickly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification processes. These primers are then used to screen hybridized somatic cell PCRs containing individual human chromosomes. Only those hybrids that contain the human gene that corresponds to the initiator will produce an amplified fragment.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Using the present invention with the same oligonucleotide primers, the sublocalization can be carried out with panels of fragments of specific or accumulated chromosomes of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map your chromosome include hybridization in itself, pre-examination with labeled flux-labeled chromosomes, and pre-selection by hybridization to construct chromosome-specific cDNA libraries. Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosome dispersion can be used to provide a chromosomal position in one step. This technique can be used with cDNA as short as 50 or 60 bases. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988). Once the sequence has been mapped to a precise chromosomal position, the physical position of the sequence on the chromosome can be correlated with genetic map data. (Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available online through the Johns Hopkins University Welch Medical Library.) The relationship between genes and diseases that have been mapped in the same chromosomal region. Then, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals, if a mutation is observed in some or all of the affected individuals but not in any normal individual, then it is likely that the mutation is the causal agent of the disease.With the current resolution capacity of physical mapping and genetic mapping techniques, a cDNA located precisely in a chromosomal region associated with a disease can be one of between 50 and 500 potential causal genes (this establishes an assumption of a resolution of mapping one megabase and one gene per 20 kb). The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies therefor. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain and humanized antibodies, as well as Fab fragments or the product of an Fab expression library. Any of the various methods known in the art can be used for the production of such antibodies and fragments. The antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection into the polypeptides in an animal or by administration of the polypeptides to an animal, preferably non-human. The antibody obtained in this manner will then bind to the polypeptides themselves. In this way, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies that bind to all of the native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide. For the preparation of monoclonal antibodies, any technique which provides antibodies produced by cultures of continuous cell lines can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256: 495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72) and the EBV-hybridoma technique to produce human monoclonal antibodies (Colé, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).

The techniques described for the production of single chain antibodies (U.S. Patent No. 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Transgenic mice can also be used to express humanized antibodies to immunogenic polypeptide products of this invention. The present invention will be further described with reference to the following examples; however, it should be understood that the present invention is not limited to such examples. All parts or quantities, unless otherwise indicated, are by weight. In order to facilitate the understanding of the following examples, certain methods and / or terms that are presented frequently will be described. The term "plasmids" is written with a lowercase p preceded and / or followed by uppercase letters and / or numbers. The initial plasmids herein are commercially available, are available publicly or on an unrestricted basis, or can be constructed from available plasmids according to published procedures. In addition, plasmids equivalent to those described are known in the art and will be apparent to those usually familiar with the art.

"Digestion" of DNA refers to the breakdown or catalytic separation of DNA with a restriction enzyme that acts only on certain sequences in DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements are used as known to a person usually familiar with the art. For analytical purposes, typically 1 μg of the plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer. For the purpose of isolating DNA fragments for construction of a plasmid, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. The amounts of buffers and substrate appropriate for the particular restriction enzymes are specified by the manufacturer. Incubation times of approximately 1 hour at 37 ° C are usually used, but may vary according to the supplier's instructions. After digestion, the reaction is subjected to electrophoresis directly on a polyacrylamide gel to isolate the desired fragment. The separation by size of the separated fragments is carried out using 8 percent polyacrylamide gel described by Goeddel, D. et al., Nucleic Acids Res., 8: 4057 (1980). The term "oligonucleotides" refers to a strand of single-stranded polydeoxynucleotide or to two strands of complementary polydeoxynucleotides which can be chemically synthesized. Such synthetic oligonucleotides do not have a 5 'phosphate and therefore will not ligate another oligonucleotide without adding a phosphate with ATP in the presence of a kinase. A synthetic oligonucleotide will bind to a fragment that has not been dephosphorylated. The term "ligation" refers to the process of formation of phosphodiester bonds between two double-stranded nucleic acid fragments (Maniatis, T, et al., Id., P.146). Unless indicated otherwise, ligation can be carried out using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amounts of DNA fragments to be ligated. Unless indicated otherwise, the transformation is performed as described by the method of Graham, F. and Van der Eb, A., Virology, 52: 456-457 (1973).

Example 1 Bacterial Expression v Purification s the FftF-tñ Protein The DNA sequence encoding FGF-15, ATCC # 97146, is initially amplified using oligonucleotide primers by PCR corresponding to the 5 'sequences of the processed protein (minus the linear peptide sequence) and the vector sequences relative to the gene. Additional nucleotides corresponding to the gene are added to the 5 'and 3' sequences. The 5 'oligonucleotide primer has the sequence 5' GCCAGACCATGGTAAAACCGGTGCCCCTC 3 '(SEQ ID NO: 3) and contains a Ncol restriction enzyme site (in bold). The 3 'sequence, 5 'GGCAGGAGATCTTGTTGTCTTACTCTTGTTGAC 3' (SEQ ID NO: 4) contains sequences complementary to the BglII site (in bold) and is followed by 21 nucleotides of the coding sequence for FGF-15. The restriction enzyme sites correspond to the restriction enzyme sites in the bacterial expression vector pQE60 (Qiagen, Inc. Chatswort, CA 91311). pQE-60 codes for resistance to antibiotics (Ampr), a bacterial origin of replication (ori), a promoter operator that can be regulated by IPTG (P / O), a ribosome binding site (RBS), a 6-His tag or label and restriction enzyme sites. The vector pQE-60 is then digested with Ncol and BglII. The amplified sequences are ligated into pQE-60 and inserted in frame with the coding sequence for the histidine tag and the ribosome binding site (RBS). The ligation mixture is then used to transform E. coli to M15 / rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J., et al., Molecular Cloning; A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15 / rep 4 contains multiple copies of plasmid pREP4, which expresses the lacl repressor and also confers resistance to kanamycin (Kan '). Transformants are identified by their ability to grow on LB plates and colonies resistant to ampicillin / kanamycin are selected. Plasmid DNA is isolated and confirmed by restriction analysis. The clones containing the desired constructs are grown overnight (O / N) in liquid culture in LB medium supplemented with Amp (100 μg / ml) and Kan (25 μg / ml). The O / N culture is used to inoculate a large crop in a ratio of 1: 100 to 1: 250. The cells are grown to an optical density 600 (O.D.600) of between 0.4 and 0.6. After adding IPTG ("isopropyl-B-D-thiogalactopyranosides") to a final concentration of 1 mM. IPTG is induced by inactivation of the lacl repressor, clearing P / O which leads to increased gene expression. The cells are grown for an additional 3 to 4 hours. The cells are then harvested by centrifugation. The cell pellet is solubilized in the chaotropic agent 6 molar guanidine HCl. After clarification, solubilized FGF-15 is purified from this solution by chromatography on a nickel-chelate column under conditions that allow close binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411: 177-184 (1984)). The proteins are eluted from the column in 6 molar guanidine hydrochloride, pH 5.0 and for the purpose of renaturation, they are adjusted to 3 molar guanidine hydrochloride, 100 mM sodium phosphate, 10 (reduced) glutathione and glutathione (oxidized) 2 mmolar. After incubation in this solution for 12 hours the proteins are dialyzed to 10 mmolar sodium phosphate.

Example 2 Cloning and Expression of FGF-15 Using the Baculovirus Expression System The DNA sequence encoding the full-length FGF-15 protein, ATCC # 97146, is amplified using oligonucleotide primers for PCR corresponding to the 5 'and 3' sequences of the gene: The 5 'FGF-15 primer has the sequence 5' CTAGTGGATCCGCCATCAIGGTAAAACCGGTGCCC 3 '(SEQ ID NO: 5) and contains a BamH1 restriction enzyme site (in bold) followed by 4 nucleotides reminiscent of an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M., J. Mol. Biol., 196: 947-950 (1987) which is just behind the first 18 nucleotides of the gene (the start codon for translation "ATG" is underlined.) Initiator 3"has the sequence 5 ' CGACTGGTACCAGCCACGGAGCAGGAATGTCT 3 '(SEQ ID NO: 6) and contains the cleavage site for the restriction endonuclease Asp718 (in bold) and 21 nucleotides complementary to the 3' untranslated sequence of the gene. The exemplified sequences are isolated from the 1% agarose gel using commercially available equipment ("Geneclean" BIO 101 Inc., La Jolla, Ca). The fragment is then digested with the respective endonucleases and purified again on a 1% agarose gel. This fragment is called F2. The vector pA2 (modifications of vector pVL941, described below) is used for the expression of proteins using the baculovirus expression system (for a review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expression vector contains the strong polyhedrin promoter of the nuclear polyhedrosis virus of Autosrapha cad fornica (AcMNPV) followed by the recognition sites for the restriction endonucleases BamHl and Xbal. The polyadenylation site of the simian virus (SV) 40 is used for efficient polyadenylation. For an easy selection of the recombinant virus, the gene for beta-galactosidase from E. coli is inserted in the same orientation as the polyhedrin promoter followed by the signal polyadenylation of the gene for polyhedrin. The sequences for polyhedrin are flanked on both sides by viral sequences for cell-mediated homologous recombination of the cotransfected wild-type viral DNA. Many other baculovirus vectors can be used in place of pA2 such as pRGl, pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170: 31-39). The plasmid is digested with restriction enzymes and dephosphorylated using bovine intestinal phosphatase by procedures known in the art. The DNA is then isolated from 1% agarose gel using commercially available equipment ("Geneclean" BIO 101 Inc., La Jolla, Ca). This vector DNA is called V2.

The F2 fragment and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase. E.coli DH5a cells are then transformed and the bacteria containing the plasmid (pBacFGF-15) are identified using the respective restriction enzymes. The sequence of the cloned fragment is confirmed by DNA sequencing. 5 μg of plasmid pBacFGF-15 is cotransfected with 1.0 μg of a commercially available linearized baculovirus ("BaculoGold Baculovirus DNA", Pharmigen, San Diego, CA) using the lipofection method (Felgner et al., Proc. Nati. Acad Sci, United States of America, 84: 7413-7417 (1987).) 1 μg of BaculoGold- "1 * 1 virus and 5 μg of the plasmid DNA are mixed in a sterile well of microtitre plates containing 50 μl. μl of serum-free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Subsequently, 10 μl of lipofectin plus 90 μl of Grace medium are added and incubated for 15 minutes at room temperature. Subsequently, the transfection mixture is added dropwise to Sf9 insect cells (ATCC CRL 1711) seeded in 35 mm tissue culture plates with 1 ml with serum-free Grace's medium. The plates are kept in oscillation back and forth to mix the newly added solution. Subsequently the plates are incubated for 5 hours at 27 ° C. After 5 hours, the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal bovine serum is added. Plates are placed back in an incubator and incubation is continued at 27 ° C for 4 days. After 4 days, the supernatant is harvested and similar plate tests are performed in those described by Summers and Smith (supra). As a modification, an agar gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used which allows easy isolation of blue-stained plates. (A detailed description of a "plate assay" can also be found in the user guide for insect cell cultures and baculovirology distributed by Life Technologies Inc., Gaithersburg, pages 9-10). Four days after the serial dilution, the virus is added to the cell and the plates stained blue are taken with the tip of an Eppendorf pipette. The agar containing the recombinant virus is then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar is separated by brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm wells. Four days later, the supernatants of these culture vessels are harvested and then sown at 4 ° C.

Sf9 cells are grown in Grace's medium supplemented with 10% FBS inactivated by heat. The cells are infected with the recombinant baculovirus V-FGF-15 at a multiplicity of infection (MOI) of 2. Six hours later, the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg ). 42 hours later, 5 μCi of 35S-methionine and 5 μCi of 35S-cysteine (Amersham) are added. The cells are further incubated for 16 hours before they are harvested by centrifugation and the labeled proteins are visualized by SDS-PAGE and autoradiography.

Example 4 Expression of Recombinant FGF-15 in Cells COFI Plasmid expression, FGF-15-HA derived from a pcDNA3 / Amp vector (Invitrogen) contains: 1) the SV40 origin of replication, 2) the ampicillin resistance gene, 3) the origin of E. coli replication. 4) the CMV promoter followed by a polylinker region, an SV40 intron and a polyadenylation site. The DNA fragments encoding the complete FGF-15 precursor and an HA tag fused in frame to the 3 'end are cloned into a polylinker region of the vector, then the expression of the recombinant protein is directed under the CMV promoter. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37: 767, (1984)). The infusion of the HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope. The plasmid construction strategy is described as follows: The DNA sequence encoding FGF-15, ATCC # 97146, is constructed by PCR using two primers: the 5 ', 5' primer CTAGTGGATCCGCCATCATJ = GTAAAACCGGTGCCC 3 '(SEC DE IDENT NO .: 7) which contains a BamHl site followed by 18 nucleotides of the coding sequence from the start codon; the 3 ', 5' sequence GTCGACCTCGAGTGTGTGCTTACTCTTGTT 3 '(SEQ ID NO: 8) containing sequences complementary to an XhoI site, translation detection codon, HA tag and the last 18 nucleotides of the coding sequence for FGF-15 (does not include the detection codon). Therefore, the PCR product contains a BamH1 site, a coding sequence followed by an HA mark fused in frame, a translation stop codon labeled HA, and an Xhol site.

The DNA fragments amplified by PCR and the vector, pcDNA3 / Amp, are digested with the respective restriction enzymes and ligated. The ligation mixture is transformed into E. coli SURE strain (available from Stratagene Cloning Systems, La Jolla, CA 92037), the transformed culture is plated on plates of ampicillin medium plates and the resistant colonies are selected. Plasmid DNA is isolated from the transformants and examined by restriction analysis to detect the presence of the correct fragment. For expression of recombinant FGF-15, COS cells are transfected with the expression vector by the DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expression of the FGF-15-HA protein is detected by the radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). The cells are labeled for 8 hours with 3SS-cysteine two days post-transfection. The culture media are then harvested and the cells are used with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.5) (Wilson, I. et al., Id. 37: 767 (1984)) Both the cell lysate and the culture medium are precipitated with monoclonal antibody specific for HA.The precipitated proteins are analyzed on SDS- gels. 15% PAGE Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims, the invention may be practiced otherwise in the particularly described.

LIST OF SEQUENCES (1. GENERAL INFORMATION (i) APPLICANT: Greene, John M Rosen, Craig A (ii) TITLE OF THE INVENTION: Factor Fibroblast Growth Factor 15 (iii) SEQUENCE NUMBER: 23 iiv) ADDRESS OF CORRESPONDENCE: (A) RECIPIENT: Carella, Byrne, Bain, Gilfillan, Cecchi, Stewart and Olstein (B) STREET: 6 Becker Farm Road (C) CITY: Roseland (D) STATUS: NJ (E) COUNTRY: United States of America (F) CP : 07068-1739 10 (v) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIA: Flexible Disk (B) COMPUTER: IBM compatible PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS 15 (D) PROGRAMMING ELEMENT : Patentln Relay # 1.0, Version # 1.30 (vi) CURRENT APPLICATION DATE: 20 (A) APPLICATION NUMBER: US 08 / 462,169 (B) DEPOSIT DATE: JUNE 5, 1995 (C) CLASSIFICATION: (viii) ATTORNEY / AGENT INFORMATION: 25 (A) NAME: Ferraro, Gregory D (B) REGISTRY NUMBER: 36,134 (C) REFERENCE / NO. OF FILE: 325800-441 (ix) INFORMATION BY TELECOMMUNICATION (A) TELEPHONE: 201-994-1700 (B) TELEFAX: 201-994-1744 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 1: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 759 Pairs of bases (B) TYPE: Nucleic acid (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 1.756 (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT.: ATG GTA AAA CCG GTG CCC CTC TTC AGG AGA ACT GAT TTC AAA TTA TTA 48 Met Val Lys Pro Val Pro Leu Phe Arg Arg Thr Asp Phe Lys Leu Leu 1 5 10 15 TTA TGC AAC CAC AAG GAT CTC TTC TTT CTC AGG GTG TCT AAG CTG CTG 96 Leu Cys Asn His Lys Asp Leu Phe Phe Leu Arg Val Ser Lys Leu Leu 20 25 30 GAT TGC TTT TCG CCC AAA TCA ATG TGG TTT CTT TGG AAC ATT TTC AGC 144 Asp Cys Phe Ser Pro Lys Ser Met Trp Phe Leu Trp Asn lie Phe Ser 35 40 45 AAA GGA ACG CAT ATG CTG CAG TGT CTT TGT GGC AAG AGT CTT AAG AAA 192 Lys Gly Thr His Met Leu Gln Cys Leu Cys Gly Lys Ser Leu Lys Lys 50 55 60 AAC AAG AAC CCA ACT GAT CCC CAG CTC AAG GGT ATA GTG ACC AGG TTA 240 Asn Lys Asn Pro Thr Asp Pro Gln Leu Lys Gly lie Val Thr Arg Leu 65 70 75 80 TAT TGC AGG CAA GGC TAC TAC TTG CAA ATG CAC CCC GAT GGA GCT CTC 288 Tyr Cys Arg Gln Gly Tyr Tyr Leu Gln Met His Pro Asp Gly Ala Leu 85 90 95 GAT GGA ACC AAG GGT GAC AGC ACT AAT TCT ACÁ CTC TTC AAC CTC ATA 336 Asp Gly Thr Lys Gly Asp Ser Thr Asn Ser Thr Leu Phe Asn Leu lie 100 105 110 CTA CGT GTT GTT GCC ATC CAG GGA GTG AAA ACA GGG TTG 384 Pro Val Gly Leu Arg Val Val Ala lie Gln Gly Val Lys Thr Gly Leu 115 120 125 TAT ATA ACC ATG AAT GGA GAA GGT TAC CTC TAC CCA TCA GAA CTT TTT 432 Tyr lie Thr Met Asn Gly Glu Gly Tyr Leu Tyr Pro Ser Glu Leu Phe 130 135 140 ACC CCT GAA TGC AAG TTT AAA GAA TCT GTT TTT GAA AAT TAT TAT GTA 480 Thr Pro Glu Cys Lys Phe Lys Glu Ser Val Phe Glu Asn Tyr Tyr Val 145 150 155 160 ATC TAC TCA TCC ATG TTG TAC AGA CAA CAG GAA TCT GGT AGA GCC TGG 528 lie Tyr Ser Ser Met Leu Tyr Arg Gln Gln Glu Ser Gly Arg Wing Trp 165 170 175 TTT TTG GGA TTA AAT AAG GAA GGG CAA GCT ATG AAA GGG AAC AGA GTA 576 Phe Leu Gly Leu Asn Lys Glu Gly Gln Wing Met Lys Gly Asn Arg Val 180 185 190 AAG AAA ACC AAA CCA GCA GCT CAT TTT CTA CCC AAG CCA TTG GAA GTT 624 Lys Lys Thr Lys Pro Wing Wing His Phe Leu Pro Lys Pro Leu Glu Val 195 200 205 GCC ATG TAC CGA GAA CCA TCT TTG CAT GAT GTT GGG GAA ACG GTC CCG 67 Wing Met Tyr Arg Glu Pro Ser Leu His Asp Val Gly Glu Thr Val Pro 210 215 220 AAG CCT GGG GTG ACG CCA AGT AAA AGC ACA AGT GCG TCT GCA ATA ATG 7 Lys Pro Gly Val Thr Pro Ser Lys Ser Thr Ser Ala Ser Ala lie Met 225 230 235 240 AAT GGA GGC AA CCA GTC AAC AAG AGT AAG ACÁ ACÁ TAG_75_Asn Gly Gly Lys Pro Val Asn Lys Ser Lys Thr Thr 245 250 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 2: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 252 Amino Acids (B) TYPE: Amino Acid (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT.: Met Val Lys Pro Val Pro Leu Phe Arg Arg Thr Asp Phe Lys Leu Leu 1 5 10 15 Leu Cys Asn His Lys Asp Leu Phe Phe Leu Arg Val Ser Lys Leu Leu 20 25 30 Asp Cys Phe Ser Pro Lys Ser Met Trp Phe Leu Trp Asn lie Phe Ser 35 40 45 Lys Gly Thr His Met Leu Gln Cys Leu Cys Gly Lys Ser Leu Lys Lys 50 55 60 Asn Lys Asn Pro Thr Asp Pro Gln Leu Lys Gly lie Val Thr Arg Leu 65 70 75 80 Tyr Cys Arg Gln Gly Tyr Tyr Leu Gln Met His Pro Asp Gly Ala Leu 85 90 95 Asp Gly Thr Lys Gly Asp Ser Thr Asn Ser Thr Leu Phe Asn Leu lie 100 105 110 Pro Val Gly Leu Arg Val Val Ala lie Gln Gly Val Lys Thr Gly Leu 115 120 125 Tyr lie Thr Met Asn Gly Glu Gly Tyr Leu Tyr Pro Ser Glu Leu Phe 130 135 - 140 Thr Pro Glu Cys Lys Phe Lys Glu Ser Val Phe Glu Asn Tyr Tyr Val 145 150 155 160 He Tyr Ser Ser Met Leu Tyr Arg Gln Gln Glu Ser Gly Arg Ala Trp 165 170 175 Phe Leu Gly Leu Asn Lys Glu Gly Gln Wing Met Lys Gly Asn Arg Val 180 185 190 Lys Lys Thr Lys Pro Wing Ala His Phe Leu Pro Lys Pro Leu Glu Val 195 200 205 Wing Met Tyr Arg Glu Pro Ser Leu His Asp Val Gly Glu Thr Val Pro 210 215 220 Lys Pro Gly Val Thr Pro Ser Lys Ser Thr Ser Ala Ser Ala He Met 225 230 235 240 Asn Gly Gly Lys Pro Val Asn Lys Ser Lys Thr Thr 245 250 (2) INFORMATION FOR SEC. FROM IDENT. DO NOT. (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 29 Pairs of bases (B) TYPE: Nucleic acid (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT.: GCCAGACCAT GGTAAAACCG GTGCCCCTC (2) INFORMATION FOR SEC. FROM IDENT. NO .: 4 (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 33 Pairs of bases (B) TYPE: Nucleic acid (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear Lii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT.

GGCAGGAGAT CTTGTTGTCT TACTCTTGTT GAC (2) INFORMATION FOR SEC. FROM IDENT. NO .: 5 (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 35 Pairs of bases (B) TYPE: Nucleic acid (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT.: CTAGTGGATC CGCCATCATG GTAAAACCGG TGCCC (2) INFORMATION FOR SEC. FROM IDENT. NO 6: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 32 Pairs of bases (B) TYPE: Nucleic acid (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT.

CGACTGGTAC CAGCCACGGA GCAGGAATGT CT (2) INFORMATION FOR SEC. FROM IDENT. NO .: 7: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 35 Pairs of bases (B) TYPE: Nucleic acid (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT.: CTAGTGGATC CGCCATCATG GTAAAACCGG TGCCC (2) INFORMATION FOR SEC. FROM IDENT. DO NOT. (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 30 Pairs of bases (B) TYPE: Nucleic acid (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT.: GTCGACCTCG AGTGTGTGCT TACTCTTGTT (2) INFORMATION FOR SEC. FROM IDENT. NO .: 9: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 151 Amino acids (B) TYPE: Amino acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT.: Met Wing Glu Gly Glu He Thr Thr Phe Thr Wing Leu Thr Glu Lys Phe 1 5 10 15 Asn Leu Pro Pro Gly Asn Tyr Lys Lys Pro Lys Leu Leu Tyr Cys Ser 20 25 30 Asn Gly Gly His Phe Leu Arg He Leu Pro Asp Gly Thr Val Asp Gly 35 40 45 Thr Arg Asp Arg Ser Asp Gln His He Gln Leu Gln Leu Ser Wing Glu 50 55 60 Ser Val Gly Glu Val Tyr He Lys Ser Thr Glu Thr Gly Gln Tyr Leu 65 70 75 80 Wing Met Asp Thr Asp Gly Leu Leu Tyr Gly Ser Gln Thr Pro Asn Glu 85 90 95 Glu Cys Leu Phe Leu Glu Arg Leu Glu Glu Asn His Tyr Asn Thr Tyr 100 105 lio He Ser Lys Lys His Wing Glu Lys Asn Trp Phe Val Gly Leu Lys Lys 115 120 125 Asn Gly Ser Cys Lys Arg Gly Pro Arg Thr His Tyr Gly Gln Lys Wing 130 135 140 He Leu Phe Leu Pro Leu Pro Val Ser Ser Asp 145 150 155 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 10: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 155 Amino Acids (B) TYPE: Amino Acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT.: Met Ala Ala Gly Ser He Thr Thu Leu Pro Ala Leu Pro Glu Asp Gly 1 5 10 15 Gly Ser Gly Wing Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu 20 25 30 Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg He His Pro Asp Gly Arg 35 40 45 Val Asp Gly Val Arg Glu Lys Ser Asp Pro His He Lys Leu Gln Leu 50 55 60 Gln Ala Glu Glu Arg Gly Val Val Ser He Lys Gly Val Cys Ala Asn 65 70 75 80 Arg Tyr Leu Wing Met Lys Glu Asp Gly Arg Leu Leu Wing Ser Lys Cys 85 90 95 Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr 100 105 110 Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Wing Leu Lys 115 120 125 Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys 130 135 140 Ala He Leu Phe Leu Pro Met Ser Ala Lys Ser 145 150 155 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 11: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 239 Amino Acids (B) TYPE: Amino Acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) 'DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO .: 1 Met Gly Leu He Trp Leu Leu Leu He Leu Leu Leu Glu Pro He Gly Trp 1 5 10 15 Pro Wing Wing Gly Pro Gly Wing Arg Leu Arg Arg Asp Wing Gly Gly Arg 20 25 30 Gly Gly Val Tyr Glu His Leu Gly Gly Ala Pro Arg Arg Arg Lys Leu 35 40 45 Tyr Cys Ala Thr Lys Tyr His Leu Gln Leu His Pro Ser Gly Arg Val 50 55 60 Asn Gly Ser Leu Glu Asn Be Wing Tyr Ser He Leu Glu He Thr Wing 65 70 75 80 Val Glu Val Gly He Val Wing He Arg Gly Leu Phe Ser Gly Arg Tyr 85 90 95 Leu Ala Met Asn Lys Arg Gly Arg Leu Tyr Ala Ser Glu His Tyr Ser 100 105 110 Wing Glu Cys Glu Phe Val Glu Arg He His Glu Leu Gly Tyr Asn Thr 115 120 125 Tyr Ala Ser Arg Leu Tyr Arg Thr Val Ser Ser Thr Pro Gly Ala Arg 130 135 140 Arg Gln Pro Ser Ala Glu Arg Leu Trp Tyr Val Ser Val Asn Gly Lys 145 • 150 155 160 Gly Arg Pro Arg Arg Gly Phe Lys Thr Arg Arg Thr Gln Lys Ser Ser 165 170 175 Leu Phe Leu Pro Arg Val Leu Asp His Arg Asp His Glu Met Val Arg 180 185 190 Gln Leu Gln Ser Gly Leu Pro Arg Pro Pro Gly Lys Gly Val Gln Pro 195 200 205 Arg Arg Arg Arg Gln Lys Gln Ser Pro Asp Asn Leu Glu Pro Ser His 210 215 220 Val Gln Wing Ser Arg Leu Gly Ser Gln Leu Glu Wing Ser Wing His 225 230 235 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 12: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 206 Amino acids (B) TYPE: Amino acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO .: 1 Met Ser Gly Pro Gly Thr Wing Wing Val Wing Leu Leu Pro Wing Val Leu 1 5 10 15 Leu Ala Leu Leu Ala Pro Trp Ala Gly Arg Gly Gly Ala Ala Ala Pro 20 25 30 Thr Ala Pro Asn Gly Thr Leu Glu Ala Glu Leu Glu Arg Arg Trp Glu 35 40 45 Ser Leu Val Ala Leu Ser Leu Ala Arg Leu Pro Val Ala Ala Gln Pro 50 55 60 Lys Glu Ala Ala Val Gln Ser Gly Ala Gly Asp Tyr Leu Leu Gly He 65 70 75 80 Lys Arg Leu Arg Arg Leu Tyr Cys Asn Val Gly He Gly Phe His Leu 85 90 95 Gln Ala Leu Pro Asp Gly Arg He Gly Gly Wing His Wing Asp Thr Arg 100 105 110 Asp Ser Leu Leu Glu Leu Ser Pro Val Glu Arg Gly Val Val Ser He 115 120 125 Phe Gly Val Ala Ser Arg Phe Phe Val Ala Met Ser Ser Lys Gly Lys 130 135 140 Leu Tyr Gly Ser Pro Phe Phe Thr Asp Glu Cys Thr Phe Lys Glu He 145 150 155 160 Leu Leu Pro Asn Asn Tyr Asn Wing Tyr Glu Ser Tyr Lys Tyr Pro Gly 165 170 175 Met Phe He Wing Leu Ser Lys Asn Gly Lys Thr Lys Lys Gly Asn Arg 180 185 190 Val Ser Pro Thr Met Lys Val Thr His Phe Leu Pro Arg Leu 195 200 205 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 13: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 267 Amino Acids (B) TYPE: Amino Acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT.: Met Ser Leu Ser Phe Leu Leu Leu Leu Phe Phe Ser His Leu Le Leu 1 5 10 15 Be Wing Trp Wing His Gly Glu Lys Arg Leu Wing Pro Lys Gly Gln Pro 20 25 30 Gly Pro Wing Wing Thr Asp Arg Asn Pro Arg Gly Being Being Arg Gln 35 40 45 Being Being Being Wing Met Being Being Being Wing Being Being Pro Wing 50 55 60 Wing Being Leu Gly Being Gln Gly Being Gly Leu Glu Gln Being Being Phe Gln 65 70 75 80 Trp Ser Leu Gly Wing Arg Thr Gly Ser Leu Tyr Cys Arg Val Gly He 85 90 95 Gly Phe His Leu Gln He Tyr Pro Asp Gly Lys Val Asn Gly Ser His 100 105 110 Glu Wing Asn Met Leu Ser Val Leu Glu He Phe Wing Val Ser Gln Gly 115 120 125 He Val Gly He Arg Gly Val Phe Ser Asn Lys Phe Leu Ala Met Ser 130 135 140 Lys Lys Oly Lys Leu His Wing Being Wing Lys Phe Thr Asp Asp Cys Lys 145 150 155 160 Phe Arg Glu Arg Phe Gln G1U Asn Ser Tyr Asn Thr Tyr Wing Ser Wing 165 170 175 He His Arg Thr Glu Lys Thr Gly Arg Glu Trp Tyr Val Ala Leu Asn 180 185 190 Lys Arg Gly Lys Wing Lys Arg Gly Cys Ser Pro Arg Val Lys Pro Gln 195 200 205 His He Ser Thr His Phe Leu Pro Arg Phe Lys Gln Ser Glu Gln Pro 210 215 220 Glu Leu Ser Phe Thr Val Thr Val Pro Glu Lys Lys Asn Pro Pro Ser 225 230 235 240 Pro He Lys Ser Lys He Pro Leu Ser Wing Pro Arg Lys Asn Thr Asn 245 250 255 Ser Val Lys Tyr Arg Leu Lys Phe Arg Phe Gly 260 265 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 14: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 208 Amino Acids (B) TYPE: Amino Acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO .: 1 Met Ala Leu Gly Gln Lys Leu Phe He Thr Met Ser Arg Gly Ala Gly 1 5 10 15 Arg Leu Gln Gly Thr Leu Trp Wing Leu Val Phe Leu Gly He Leu Val 20 25 30 Gly Met Val Val Pro Pro Pro Wing Gly Thr Arg Wing Asn Asn Thr Leu 35 40 45 Leu Asp Ser Arg Gly Trp Gly Thr Leu Leu Ser Arg Ser Arg Ala Gly 50 55 60 Leu Ala Gly Glu He Wing Gly Val Asn Trp Glu Ser Gly Tyr Leu Val 65 70 75 80 Gly He Lys Arg Gln Arg Arg Leu Tyr Cys Asn Val Gly He Gly Phe 85 90 95 His Leu Gln Val Leu Pro Asp Gly Arg He Ser Gly Thr His Glu Glu 100 105 110 Asn Pro Tyr Be Leu Leu Glu Be Ser Thr Val Glu Arg Gly Val Val 115 120 125 Ser Leu Phe Gly Val Arg Ser Ala Leu Phe Val Ala Met Asn Ser Lys 130 135 140 Gly Arg Leu Tyr Ala Thr Pro Ser Phe Gln Glu Glu Cys Lys Phe Arg 145 150 155 160 Glu Thr Leu Leu Pro Asn Asn Tyr Asn Wing Tyr Glu Ser Asp Leu Tyr 165 170 175 Gln Gly Thr Tyr He Wing Leu Being Lys Tyr Gly Arg Val Lys Arg Gly 180 185 190 Ser Lys Val Ser Pro He Met Thr Val Thr His Phe Leu Pro Arg He 195 200 205 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 15: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 194 Amino Acids (B) TYPE: Amino Acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: S? C. FROM IDENT. NO .: 1 Met His Lys Trp He Leu Thr Trp He Leu Pro Thr Leu Leu Tyr Arg 1 5 10 15 Ser Cys Phe His He He Cys Leu Val Gly Thr He Ser Leu Cys Wing 20 25 30 Asn Asp Met Thr Pro Glu Gln Met Ala Thr Asn Val Asn Cys Ser Ser 35 40 45 Pro Glu Arg His Thr Arg Ser Tyr Asp Tyr Met Glu Gly Gly Asp He 50 55 60 Arg Val Arg Arg Leu Phe Cys Arg Thr Gln Trp Tyr Leu Arg He Asp 65 70 75 80 Lys Arg Gly Lys Val Lys Gly Thr Gln Glu Met Lys Asn Asn Tyr Asn 85 90 95 He Met Glu He Arg Thr Val Wing Val Gly He Val Wing He Lys Gly 100 105 110 Val Glu Ser Glu Phe Tyr Leu Wing Met Asn Lys Glu Gly Lys Leu Tyr 115 120 125 Wing Lys Lys Glu Cys Asn Glu Asp Cys Asn Phe Lys Glu Leu He Leu 130 135 140 Glu Asn His Tyr Asn Thr Tyr Wing Ser Wing Lys Trp Thr His Asn Gly 145 150 155 160 Gly Glu Met Phe Val Ala Leu Asn Gln Lys Gly He Pro Val Arg Gly 165 170 175 Lys Lys Thr Lys Lys Glu Gln Lys Thr Wing His Phe Leu Pro Met Wing 180 185 190 He Thr (2) INFORMATION FOR SEC. FROM IDENT. NO .: 16: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 215 Amino acids (B) TYPE: Amino acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO .: 1 Met Gly Ser Pro Arg Ser Ala Leu Ser Cys Leu Leu Leu His Leu Leu 1 S 10 15 V to Leu Cys Leu Gln Wing Gln Val Thr Val Gln Ser Ser Pro Asn Phe 20 25 30 Thr Gln His Val Arg Glu Gln Ser Leu Val Thr Asp Gln Leu Ser Arg 35 40 45 Arg Leu He Arg Thr Tyr Gln Leu Tyr Ser Arg Thr Ser Gly Lys His 50 55 60 Val Gln Val Leu Wing Asn Lys Arg He Asn Wing Met Wing Glu Asp Gly 65 70 75 80 Asp Pro Phe Wing Lys Leu He Val Glu Thr Asp Thr Phe Gly Ser Arg 85 90 95 Val Arg Val Arg Gly Wing Glu Thr Gly Leu Tyr He Cys Met Asn Lys 100 105 110 Lys Gly Lys Leu He Wing Lys Ser Asn Gly Lys Gly Lys Asp Cys Val 115 120 125 Phe Thr Glu He Val Leu Glu Asn Asn Tyr Thr Ala Leu Gln Asn Ala 130 135 140 Lys Tyr Glu Gly Trp Tyr Met Wing Phe Thr Arg Lys Gly Arg Pro Arg 145 150 155 160 Lys Gly Ser Lys Thr Arg Gln His Gln Arg Glu Val His Phe Met Lys 165 170 175 Arg Leu Pro Arg Gly His His Thr Thr Glu Gln Ser Leu Arg Phe Glu 180 185 190 Phe Leu Asn Tyr Pro Pro Phe Thr Arg Ser Leu Arg Gly Ser Gln Arg 195 200 205 Thr Trp Wing Pro Glu Pro Arg 210 215 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 17: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 208 Amino Acids (B) TYPE: Amino Acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO .: 1 Met Ala Pro Leu Gly GlU Val Gly Asn Tyr Phe Gly Val Gln Asp Ala 1 5 10 15 Val Pro Phe Gly Asn Val Pro Val Leu Pro Val Asp Ser Pro Val Leu 20 25 30 Leu Ser Asp His Leu Gly Gln Ser Glu Wing Gly Gly Leu Pro Arg Gly 35 40 45 Pro Ala Val Thr Asp Leu Asp His Leu Lys Gly He Leu Arg Arg Arg 50 55 60 Gln Leu Tyr Cys Arg Thr Gly Phe His Leu Glu He Phe Pro Asn Gly 65 70 75 80 Thr He Gln Gly Thr Arg Lys Asp His Ser Arg Phe Gly He Leu Glu 85 90 95 Phe He Ser He Wing Val Gly Leu Val Ser He Arg Gly Val Asp Ser 100 105 110 Gly Leu Tyr Leu Gly Met Asn Olu Lys Gly Glu Leu Tyr Gly Ser Glu 115 120 125 Lys Leu Thr Gln GlU Cys Val Phe Arg Glu Gln Phe Glu Glu Asn Trp 130 135 140 Tyr Asn Thr Tyr Being Ser Asn Leu Tyr Lys His Val Asp Thr Gly Arg 145 150 155 160 Arg Tyr Tyr Val Ala Leu Asn Lys Asp Gly Thr Pro Arg Glu Gly Thr 165 170 175 Arg Thr Lys Arg His Gln Lys Phe Thr His Phe Leu Pro Arg Pro Val 180 185 190 Asp Pro Asp Lys Val Pro Glu Leu Tyr Lys Asp He Leu Ser Gln Ser 195 200 205 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 18: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 181 Amino Acids (B) TYPE: Amino Acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO .: 1 Met Glu Ser Lys Glu Pro Gln Leu Lys Gly He Val Thr Arg Leu Phe 1 5 10 15 Be Gln Gln Gly Tyr Phe Leu Gln Met His Pro Asp Gly Thr He Asp 20 25 30 Gly Thr Lys Asp Glu Asn Ser Asp Tyr Thr Leu Phe Asn Leu He Pro 35 40 45 Val Gly Leu Arg Val Val Ala He Gln Gly Val Lys Ala Ser Leu Tyr 50 55 60 Val Ala Met Asn Gly Glu Gly Tyr Leu Tyr Ser Ser Asp Val Phe Thr 65 70 75 80 Pro Glu Cys Lys Phe Lys Glu Ser Val Phe Glu Asn Tyr Tyr Val He 85 90 95 Tyr Ser Ser Thr Leu Tyr Arg Gln Gln Glu Ser Gly Arg Wing Trp Phe 100 105 110 Leu Gly Leu Asn Lys Glu Gly Gln He Met Lys Gly Asn Arg Val Lys 115 120 125 Lys Thr Lys Pro Ser Ser His Phe Val Pro Lys Pro He Glu Val Cys 130 135 140 Met Tyr Arg Glu Pro Ser Leu His Glu He Gly Glu Lys Gln Gly Arg 145 150 155 160 Be Arg Lys Be Ser Gly Thr Pro Thr Met Asn Gly Gly Lys Val Val 165 170 175 Asn Gln Asp Ser Thr 180 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 19: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 255 Amino acids (B) TYPE: Amino acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (Xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT. : Met Ser Gly Lys Val Thr Lys Pro Lys Glu Glu Lys Asp Wing Ser Lys 1 5 10 15 Val Leu Asp Asp Wing Pro Pro Gly Thr Gln Glu Tyr He Met Leu Arg 20 25 30 Gln Asp Ser He Gln Ser Wing Glu Leu Lys Lys Lys Glu Ser Pro Phe 35 40 45 Arg Ala Lys Cys His Glu He Phe Cys Cys Pro Leu Lys Gln Val His 50 55 60 His Lys Glu Asn Thr Glu Pro Glu Glu Pro Gln Leu Lys Gly He Val 65 70 75 80 Thr Lys Leu Tyr Ser Arg Gln Gly Tyr His Leu Gln Leu Gln Wing Asp 85 90 95 Gly Thr He Asp Gly Thr Lys Asp Glu Asp Ser Thr Tyr Thr Leu Phe 100 105 110 Asn Leu He Pro Val Gly Leu Arg Val Val Ala He Gln Gly Val Gln 115 120 125 Thr Lys Leu Tyr Leu Wing Met Asn Ser Glu Gly Tyr Leu Tyr Thr Ser 130 135 140 Glu Leu Phe Thr Pro Glu Cys Lys Phe Lys Glu Ser Val Phe Glu Asn 145 150 155 160 Tyr Tyr Val Thr Tyr Ser Ser Met He Tyr Arg Gln Gln Gln Ser Gly 165 170 175 Arg Gly Trp Tyr Leu Gly Leu Asn Lys Glu Gly Glu He Met Lys Gly 180 185 190 Asn His Val Lys Lys Asn Lys Pro Wing Ala His Phe Leu Pro Lys Pro 195 200 205 Leu Lys Val Wing Met Tyr Lys Glu Pro Ser Leu His Asp Leu Thr Glu 210 215 220 Phe Ser Arg Ser Gly Ser Gly Thr Pro Thr Lys Ser Arg Ser Val Ser 225 230 235 240 Gly Val Leu Asn Gly Gly Lys Ser Met Ser His Asn Glu Ser Thr 245 250 255 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 20 (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 208 Amino Acids (B) TYPE: Amino Acids (OR TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO .: 2 Met Trp Lys Trp He Leu Thr His Cys Wing Ser Wing Phe Pro His Leu 1 5 10 15 Pro Gly Cys Cys Cys Cy5 Cys Phe Leu Leu Leu Phe Leu Val Ser Ser 20 25 30 Val Pro Val Thr Cys Gln Ala Leu Gly Gln Asp Met Val Ser Pro Glu 35 40 45 Wing Thr Asn Being Being Ser Being Being Phe Being Pro Pro Being Wing Gly 50 55 60 Arg His Val Arg Ser Tyr Asn His Leu Gln Gly Asp Val Arg Trp Arg 65 70 75 80 Lys Leu Phe Ser Phe Thr Lys Tyr Phe Leu Lys He Glu Lys Asn Gly 85 90 95 Lys Val Ser Gly Thr Lys Lys Glu Asn Cys Pro Tyr Ser He Leu Glu 100 105 110 He Thr Ser Val Glu He Gly Val Val Ala Val Lys Ala He Asn Ser 115 120 125 Asn Tyr Tyr Leu Wing Met Asn Lys Lys Gly Lys Leu Tyr Gly Ser Lys 130 135 140 Glu Phe Asn Asn Asp Cys Lys Leu Lys Glu Arg He Glu Glu Asn Gly 145 150 155 160 Tyr Asn Thr Tyr Wing Ser Phe Asn Trp Gln His Asn Gly Arg Gln Met 165 170 175 Tyr Val Ala Leu Asn Gly Lys Gly Ala Pro Arg Arg Gly Gln Lys Thr 180 185 190 Arg Arg Lys Asn Thr Ser Wing His Phe Leu Pro Met Val Val His Ser 195 200 205 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 21: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 212 Amino acids (B) TYPE: Amino acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO .: 2 Arg Leu Leu Pro Asn Leu Thr Leu Cys Leu Gln Leu Leu He Leu Cys 1 5 10 15 CYR Gln Thr Gln Gly Glu Asn His Pro Ser Pro Asn Phe Asn Gln Tyr 20 25 30 Val Arg Asp Gln Gly Wing Met Thr Asp Gln Leu Ser Arg Arg Gln He 35 40 45 Arg Glu Tyr Gln Leu Tyr Ser Arg Thr Ser Gly Lys His Val Gln Val 50 55 60 Pro Gly Arg Arg Be Ser Wing Thr Wing Glu Asp Gly Asn Lys Phe Wing 65 70 75 80 Lys Leu He Val Glu Thr Asp Thr Phe Gly Ser Arg Val Arg He Lys 85 90 g5 Gly Ala Glu Ser Glu Lys Tyr He Cys Met Asn Lys Arg Gly Lys Leu 100 105 110 He Gly Lys Pro Ser Gly Lys Ser Lys Asp Cys Val Phe Thr Glu He 115 120 125 Val Leu Glu Asn Asn Tyr Thr Wing Phe Gln Asn Wing Arg His Glu Gly 130 135 140 Trp Phe Met Val Phe Thr Arg Gln Gly Arg Pro Arg Gln Wing Ser Arg 145 150 155 160 Being Arg Gln Asn Gln Arg Glu Wing His Phe He Lys Arg Leu Tyr Gln 165 170 175 Gly Gln Leu Pro Phe Pro Asn His Wing Glu Lys Gln Lys Gln Phe Glu 180 185 190 Phe Val Gly Be Wing Pro Thr Arg Arg Thr Lys Arg Thr Arg Arg Pro 195 200 205 Gln Pro Leu Thr 210 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 22: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 225 Amino Acids (B) TYPE: Amino Acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear . { ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT. : Met Ala Ala Ala Ala Be Ser Leu He Arg Gln Lys Arg Glu Val Arg 1 5 10 15 Glu Pro Gly Gly Ser Arg Pro Val Ser Wing Gln Arg Arg Val Cys Pro 20 25 30 Arg Gly Thr Lys Ser Leu Cys Gln Lys Gln Leu Leu He Leu Leu Ser 35 40 45 Lys Val Arg Leu Cys Gly Gly Arg Pro Wing Arg Pro Asp Arg Gly Pro 50 55 60 Glu Pro Gln Leu Lys Gly He Val Thr Lys Leu Phe Cys Arg Gln Gly 65 70 75 80 Phe Tyr Leu Gln Wing Asn Pro Asp Gly Be He Gln Gly Thr Pro Glu 85 90 95 Asp Thr Ser Being Phe Thr His Phe Asn Leu He Pro. Val Gly Leu Arg 100 105 110 Val Val Thr He Gln Ser Wing Lys Leu Gly His Tyr Met Wing Met Asn 115 120 125 Wing Glu Gly Leu Leu Tyr Ser Ser Pro His Phe Thr Wing Glu Cys Arg 130 135 140 Phe Lys Glu Cys Val Phe Glu Asn Tyr Tyr Val Leu Tyr Ala Ser Wing 145 150 155 160 Leu Tyr Arg Gln Arg Arg Ser Gly Arg Wing Trp Tyr Leu Gly Leu Asp 165 170 171 Lys Glu Gly Gln Val Met Lys Gly Asn Arg Val Lys Lys Thr Lys Wing 180 185 190 Ala Ala His Phe Leu Pro Lys Leu Leu GlU Val Ala Met Tyr Gln Glu 195 200 205 Pro Ser Leu His Ser Val Pro Glu Wing Ser Pro Pro Ser Pro Pro Wing 210 215 220 Pro 225 (2) INFORMATION FOR SEC. FROM IDENT. NO .: 23 (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 252 Amino Acids (B) TYPE: Amino Acids (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: Protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. DO NOT.: Met Val Lys Pro Val Leu Phe Arg Arg Thr Asp Phe Lys Leu Leu 1 5 10 15 Leu Cys Asn His Lys Asp Leu Phe Phe Leu Arg Val Ser Lys Leu Leu 20 25 30 Asp Cys Phe Ser Pro Lys Ser Met Trp Phe Leu Trp Asn He Phe Ser 35 40 45 Lys Gly Thr His Met Leu Gln Cys Leu Cys Gly Lys Ser Leu Lys Lys 50 55 60 Asn Lys Asn Pro Thr Asp Pro Gln Leu Lys Gly He Val Thr Arg Leu 65 70 75 80 Tyr Cys Arg Gln Gly Tyr Tyr Leu Gln Met His Pro Asp Gly Ala Leu 85 90 95 Asp Gly Thr Lys Gly Asp Ser Thr Asn Ser Thr Leu Phe Asn Leu He 100 105 110 Pro Val Gly Leu Arg Val Val Ala He Gln Gly Val Lys Thr Gly Leu 115 120 125 Tyr He Thr Met Asn Gly Glu Gly Tyr Leu Tyr Pro Ser Glu Leu Phe 130 135 140 Thr Pro Glu Cys Lys Phe Lys GlU Ser Val Phe Glu Asn Tyr Tyr Val 145 150 155 160 He Tyr Ser Ser Met Leu Tyr Arg Gln Gln Glu Ser Gly Arg Wing Trp 165 170 175 Phe Leu Gly Leu Asn Lys Glu Gly Gln Wing Met Lys Gly Asn Arg Val 180 185 190 Lys Lys Thr Lys Pro Wing Ala His Phe Leu Pro Lys Pro Leu Glu Val 195 200 205 Wing Met Tyr Arg Glu Pro Ser Leu His Asp Val Gly Glu Thr Val Pro 210 215 220 Lys Pro Gly Val Thr Pro Ser Lys Ser Thr Ser Ala Ser Ala He Met 225 230 235 240 Asn Gly Gly Lys Pro Val Asn Lys Ser Lys Thr Thr 245 250 It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention. Having described the invention as above, property is claimed as contained in the following:

Claims

1. A polynucleotide characterized in that it comprises a member selected from the group consisting of: (a) a polynucleotide encoding the polypeptide as set f in Figure 1; (b) a polynucleotide capable of hybridizing and which is at least 70% identical to the polynucleotide of (a); and (c) a fragment of the polynucleotide of the polynucleotide of (a) or (b).

2. The polynucleotide according to claim 1, characterized in that it encodes for the polypeptide comprising from amino acid 1 to amino acid 252, as set f in SEQ. FROM IDENT. NO .: 23. The polynucleotide according to claim 1, characterized in that the polynucleotide is DNA. 4. The polynucleotide according to claim 1, characterized in that the polynucleotide is RNA. 5. The polynucleotide according to claim 1, characterized in that the polynucleotide is genomic DNA. 6. The polynucleotide according to claim 1, characterized in that it comprises from nucleotide 1 to nucleotide 759, as set f in SEQ. FROM IDENT. NO .: 1. 7. An isolated polynucleotide, characterized in that it comprises a member that is selected from the group consisting of: (a) a polynucleotide that encodes a mature polypeptide encoded by the DNA contained in ATCC, Deposit No. 97146; (b) a polynucleotide encoding the polypeptide expressed by the DNA contained in ATCC, Deposit No. 97146; (c) a polynucleotide capable of hybridizing with and which is at least 70% identical with the polynucleotide of (a) or (b); and (d) a polynucleotide fragment of the polynucleotide of (a), (b) or (c). 8. The polynucleotide according to claim 7, characterized in that the polynucleotide encodes a polypeptide expressed by DNA contained in ATCC, Deposit No. 97146. 9. The polynucleotide according to claim 7, characterized in that the polynucleotide encodes a polypeptide expressed by DNA contained in ATCC, Deposit No. 97146. 10. The polynucleotide according to claim 7, characterized in that the polynucleotide encodes a polypeptide expressed by DNA contained in ATCC, Deposit No. 97146. 11. A vector, characterized in that it contains the DNA according to claim 2. 12. A host cell characterized in that it has been subjected to genetic engineering with the vector according to claim 11. 13. A process for producing a polypeptide, characterized in that it comprises: expressing from the host cell according to claim 12 of the polypeptide encoded by the DNA. 14. A process for producing cells capable of expressing a polypeptide, characterized in that it comprises engineering cells with the vector according to claim 11. 15. A polypeptide, characterized in that it is selected from the group consisting of: (i) a polypeptide having the deduced amino acid sequence of Figure 1 and fragments, analogs and derivatives thereof; and (ii) a polypeptide encoded by the ATCC cDNA, Deposit No. 97146 and fragments, analogs and derivatives of such a polypeptide. 16. The polypeptide according to claim 15, characterized in that the polypeptide has the deduced amino acid sequence of Figure 1. 17. An antibody characterized in that it is produced with the polypeptide according to claim 15. 18. A compound characterized in that it inhibits the polypeptide according to claim 15. 19. A compound characterized in that it activates a receptor for the polypeptide according to claim 15. 20. A process for identifying active compounds as agonists for the polypeptide according to claim 15, the process is characterized in that it comprises: (a) combining a compound to be examined and a reaction mixture containing cells under conditions in which the cells are normally stimulated by the polypeptide, the reaction mixture contains a label incorporated into the cells as they proliferate; and (b) determining the amount of proliferation of the cells to identify whether the compound is an effective agonist. 2i. A process for identifying an active compound as antagonists for the polypeptide according to claim 15, the process is characterized in that it comprises: (a) combining a compound to be examined, the polypeptide and a reaction mixture containing cells under conditions wherein the cells are normally stimulated by the polypeptide, the reaction mixture contains a tag incorporated into the cells as they proliferate; and (b) determining the amount of proliferation of the cells to identify whether the compound is an effective antagonist.